sort by

4 publications mentioning eca-mir-146b

Open access articles that are associated with the species Equus caballus and mention the gene name mir-146b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 42
This, in turn, suggests that HMB may play an important role in the inflammation processes as an anti-inflammatory factor which could be related to the inhibition of pro-inflammatory cytokine secretion by HMB -induced miR-146 over -expression and activate innate immunity response by miR-155 over -expression. [score:7]
Curtale et al. [39] showed that miR-146b may mediate anti-inflammatory activities and modulates the TLR4 signaling pathway by direct targeting several genes which are most likely targets for our identified miRNAs (cxcl10, tlr4). [score:6]
Similar to the aforementioned authors who demonstrated that miR-146b may inhibit pro-inflammatory cytokine secretion, we observed over -expression of both miR-146a and miR-146b. [score:5]
The following cell proliferation-related genes were identified: jak2 (target of identified miR-101, miR-155), rarg (miR-142-3p, miR-30c), pten (miR-146a, miR-374b, miR-193a), ets1 (miR-221/222), and rarb (miR-146a, miR-146b); cell differentiation-related target genes: jak2 (miR-155), pten (miR-1), klf4 (miR-1, miR-146a, miR-206) and ets1 (miR-221/222). [score:5]
One of the most interesting miRNAs involved in oxidative stress and inflammation appears to be miR-146 family which members are known as negative regulators of inflammatory cytokine expression during immune response [37, 38]. [score:4]
Among them, family of miR-146a/b able to balance the induction of muscle proliferation or differentiation with miR-146 up- and downregulation, respectively [25]. [score:4]
The analysis confirmed statistically significant differences in the expression of six miRNAs (miR-204, miR-208b, miR-222, miR-675, miR-146a, and miR-146b) and six genes (sod1, sod2, tgfb2, myf5, bdnf, otud4) in HMB -treated ESC when compared to control condition (CTRL) (Fig.   5). [score:2]
Primer’s name Target sequence Amplification time and temperature 1 miR-146a-5p UGAGAACUGAAUUCCAUGGGUU 10 s/95 °C and 60 s/60 °C 2 miR-146b-5p UGAGAACUGAAUUCCAUAGGCU 10 s/95 °C and 60 s/60 °C 3 miR-204b UUCCCUUUGUCAUCCUAUGCCU 10 s/95 °C and 60 s/60 °C 4 miR-208b AUAAGACGAACAAAAGGUUUGU 10 s/95 °C and 60 s/60 °C 5 miR-222 AGCUACAUCUGGCUACUGGGU 10 s/95 °C and 60 s/60 °C 6 miR-675 UGGUGCGGAGAGGGCCCACAGUG 10 s/95 °C and 60 s/60 °CBased on previous studies in different species and the manufacturer recommendation (Exiqon, Denmark), a U6 snRNA reference was used. [score:2]
Primer’s name Target sequence Amplification time and temperature 1 miR-146a-5p UGAGAACUGAAUUCCAUGGGUU 10 s/95 °C and 60 s/60 °C 2 miR-146b-5p UGAGAACUGAAUUCCAUAGGCU 10 s/95 °C and 60 s/60 °C 3 miR-204b UUCCCUUUGUCAUCCUAUGCCU 10 s/95 °C and 60 s/60 °C 4 miR-208b AUAAGACGAACAAAAGGUUUGU 10 s/95 °C and 60 s/60 °C 5 miR-222 AGCUACAUCUGGCUACUGGGU 10 s/95 °C and 60 s/60 °C 6 miR-675 UGGUGCGGAGAGGGCCCACAGUG 10 s/95 °C and 60 s/60 °C Based on previous studies in different species and the manufacturer recommendation (Exiqon, Denmark), a U6 snRNA reference was used. [score:2]
Their study also provides evidence for a link between miR-146b and IL-10, indicating that miR-146b induction depends on the activity of IL-10, which is suspected to be realized by muscle cells, both in vivo and in vitro [40]. [score:1]
Selected miRNAs (miR-204 (↑), miR-208b (↓), miR-222 (↑), miR-675 (↓), miR-146a (↑), miR-146b (↑)) and genes (bdnf (↓), sod1 (↓), sod2 (↑), tgfb2 (↓), myf5 (↓), otud4 (↑)) were validated by RT-qPCR showing the same trend as in microarray analysis. [score:1]
Another miRNA, miR-146, is related to satellite cell activation [49], myoblast differentiation, and muscle regeneration in vivo [50]. [score:1]
RIG-I-like receptor pathway is known to play a crucial role in innate response [63] which is necessary to activate early muscle regeneration and may be modulated by three identified miRNAs: miR-146a, miR-146b, and miR-155. [score:1]
Ras and MAPK pathways promote protein degradation in muscle cells [64] and oxidative stress (closely related to miR-146 activity) [61]. [score:1]
[1 to 20 of 14 sentences]
2
[+] score: 35
Other common, but not universal, expression changes have included upregulation of miR-146a and/or miR-146b in most mo dels (but not in B-cells or PBMCs), upregulation of miR-9, miR-18a and miR-132, and downregulation of miR-125b [4, 7, 44– 46, 63]. [score:12]
MicroRNA-155 was selected due to its significant LPS -induced expression change, whereas miR-146a and miR-146b were selected due to strong time effects, trends towards an LPS effect, high expression and known roles in TLR regulation in other species. [score:6]
Lack of upregulation of miR-146a and miR-146b could represent a weakness of an equine mo del such as this, although this is potentially consistent with some human mo dels using patient-sourced cells [46] as opposed to cell lines. [score:4]
A number of miRNAs clustered together with miR-155 on the hierarchical clustering analysis (Fig 2), including miRNAs such as miR-146a, miR-146b and miR-132 that had significant increases in expression with time. [score:3]
Expression changes with time in miR-146a, miR-146b and miR-155. [score:3]
Contrary to predictions, no effect of LPS on expression of miR-146a or miR-146b in equine PBMCs could be demonstrated in the current mo del, although the trends observed with time suggest that these could warrant further investigation. [score:1]
Statistically significant but weaker correlations (r = 0.50–0.63) were present between miR-146a and these cytokines, while miR-146b was correlated with TNFα (r = 0.57, p = 0.005) and the other miRNAs only. [score:1]
Pairwise correlations between the cytokines TNFα, IL-10, IFNγ, IL-4 and IL-17, and the -ΔΔCT values for the miRNAs miR-155, miR-146 and miR-146b, are shown in Fig 5. MicroRNA-155 correlated strongly with miR-146a (r = 0.87, p < 0.001) and miR-146b (r = 0.79, p < 0.001), and showed moderate to strong correlations with the cytokines TNFα, IL-10, IFNγ and IL-17 (r = 0.61–0.80). [score:1]
Delayed miRNA responses to LPS, such as the IL-10 -mediated induction of miR-146b described after eight hours in human monocytes [45], may not have been detected in the present mo del, but changes in many LPS-responsive miRNAs can be observed within two hours [7, 45, 50]. [score:1]
No effect of LPS was evident for miR-146a (p = 0.57) or miR-146b (p = 0.97). [score:1]
For example, the increase in IFNγ in LPS-stimulated cells in this mo del, probably in part from T-lymphocytes [55], could have blunted the effects of LPS on miR-146a, miR-146b and miR-132, as observed in human cord blood CD14+ cells [46]. [score:1]
Furthermore, miRNAs of likely functional significance in PBMCs, including miR-146a, miR-146b and miR-155 were previously designated as colon-specific. [score:1]
[1 to 20 of 12 sentences]
3
[+] score: 12
Other miRNAs from this paper: eca-mir-140, eca-mir-489, eca-mir-146a, eca-mir-223
Interestingly, mir-489 was upregulated (p < 0.01, Figure 2(b)) while mir-146 was downregulated in MVs [EMS] (p < 0.05, Figure 2(c)). [score:7]
Only mir-146 expression showed statistical significance as it was decreased in ASC [EMS] (Figure 8(b), p < 0.05). [score:3]
Moreover, the MVs derived from ASC [EMS] were characterized by the decreased amount of transferred mir-223 and mir-146 with simultaneous upregulation of mir-456 mRNA level. [score:2]
[1 to 20 of 3 sentences]
4
[+] score: 2
Other miRNAs from this paper: eca-mir-26a, eca-mir-763, eca-mir-1289
Four miRNA sequences (eca-miR-146b, 763, 7, and 1,289) were found in proximity to the QTL #6, 1, 7, and 16 (Table S6). [score:1]
QTL# [a] SNP identification Gene loci identified by the SNP Transcription factor (TF) binding sites (BS) within 1 Mbp Number of within 0.5 Mbp 6 BIEC2_1022884candidate lncRNA [b] KCNQ1OT1, miRNA eca-miR-763 5 BSs, 20 TFs (NFκb) 6 within 20–34 kb 1 BIEC2_11782 SORCS3 intron#16 [c] miRNA eca-miR-146b 1 BS, 23 TFs 5 within 50 kb 7 BIEC2_977605 1 BS, 20 TFs 2 within 11 kb 16 BIEC2_363958CNV [d]miRNA eca-miR-1289 11 BSs, 34 TFs (PPPARγ, c-Myc, NF1) 29 BIEC2_755603 SLC39A12 intron#51 [e] 17 BSs, 134 TFs (PPARγ, NF1, MyoD) BIEC2_755604 a Quantitative trait loci (QTL) number: this number was used to identified the QTL in the manuscript and tables. [score:1]
[1 to 20 of 2 sentences]