sort by

6 publications mentioning bta-mir-2478

Open access articles that are associated with the species Bos taurus and mention the gene name mir-2478. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 94
The higher muscle DNAJB2 expression in the grain-fed JB cattle than in the grazing cattle might indicate that DNAJB2 was upregulated via downregulation of miR-2478 by some cellular stress due to difference between the feeding conditions. [score:9]
The mRNA expression of actin -binding protein PFN2, the potential target of miR-17-5p, miR-19a, miR-30b-5p, miR-142-5p, miR-301a, and miR-2478, also tended to be downregulated in the grazing cattle compared to the grain-fed cattle (P = 0.064), as did the potential miR-29b targets DNAJB2 (P = 0.021) and COL3A1 (P = 0.100). [score:9]
The downregulated ELOVL6 and SCD1 expression in our study was associated with the increased miR-10b and miR-2478 expression in the LL muscle of grazing JB cattle. [score:8]
Association of miR-10b with the target PTEN in JB cattle muscleTargetScan analysis predicted that miR-10b and miR-2478 targeted PTEN. [score:7]
The altered expression of miR-10b and miR-2478 in the LL muscle was further associated with the expression of the target lipogenic genes, ELOVL6 and SCD1, respectively. [score:7]
TargetScan analysis predicted that miR-10b and miR-2478 targeted PTEN. [score:5]
The expression of PTEN, the potential target of miR-10b, miR-17-5p, miR-19a, miR-29b, miR-30b-5p, miR-142-5p, miR-301a, miR-652, and miR-2478, was lower in the grazing cattle than in the grain-fed cattle (P = 0.011). [score:5]
One of the lipogenic genes, SCD1, which is predicted as a target of miR-98, miR-142-5p, and miR-2478, showed higher expression in the grain-fed than in the grazing cattle (P = 0.038, Fig 4). [score:5]
miR-2478 was also predicted to target PFN2 and DNAJB2, whose expression tended to be reduced in the LL muscle of the grazing cattle in the present study. [score:5]
The other adipogenic or lipogenic genes, miR-301a target PPARG2 and a target of miR-10b and miR-2478, ELOVL6, also tended to differ between the groups (P = 0.058 and = 0.051, respectively). [score:5]
The expression levels of muscle miR-374b, miR-652, and miR-2478 also tended to be higher in the LL muscle of the grazing cattle. [score:3]
Thus, the reduced PTEN expression in the grazing cattle suggests alterations in both muscle cell growth and glucose homeostasis in the LL muscle, which might be modulated by miR-10b and possibly miR-2478, and might further affect final beef production. [score:3]
Potential impact of miR-2478 and its targets on JB cattle muscle. [score:3]
All other miRNAs tested (miR-15a, miR-23b-3p, miR-27b, miR-30d-5p, miR-92a, miR-140, miR-197, miR-345-5p, miR-451, miR-885, miR-2284x, miR-2295, miR-2412, and miR-2478) were not differently expressed between the groups (P > 0.10), except that miR-103 content tended to be higher in the grain-fed cattle than in the grazing cattle (P = 0.057). [score:3]
Therefore, it is likely that the expression of those lipogenic genes induced by grain-rich feeding was also modulated by miR-10b and/or miR-2478 in the IMF of the LL muscle, and might affect beef quality. [score:3]
miR-2478 potentially targets mRNAs of lipogenic genes ELOVL6 and SCD1. [score:3]
The potential targets of the most plasma-enriched miR-2478 were associated with protein localization and transport. [score:3]
[1]log2(G/H): the value of log2(grazing/grain-fed) We then conducted qPCR for the contents of c-miRNAs of interest, not only to validate the results of microarray analysis for those 13 miRNAs and the miRNAs below the top 20 in SAM analysis (miR-29b, miR-197), but also to further explore potential feeding -induced miRNAs among adipose-enriched (miR-15a, miR-19a, miR-27b, miR-92a, miR-103, miR-142-5p), plasma-enriched (miR-2412, miR-2478), and bovine-specific (miR-2284x and miR-2295) miRNAs [31]. [score:1]
We also conducted qPCR of miRNAs that are enriched in muscle or plasma (miR-21-5p, miR-30d-5p, miR-103, miR-206, miR-208b, miR-451, miR-486, miR-499, miR-2412, and miR-2478), some of which are abundant in bovine skeletal muscles [4]. [score:1]
It is especially notable that the bovine-specific miR-1584-5p, miR-2305, miR-2412, and miR-2478, most of which are associated with energy metabolism [32], were highly enriched in the plasma samples of both groups in the present study. [score:1]
Of those miRNAs, only miR-2478 in LL muscle tended to differ between the feeding conditions (P = 0.053). [score:1]
[1]log2(G/H): the value of log2(grazing/grain-fed)We then conducted qPCR for the contents of c-miRNAs of interest, not only to validate the results of microarray analysis for those 13 miRNAs and the miRNAs below the top 20 in SAM analysis (miR-29b, miR-197), but also to further explore potential feeding -induced miRNAs among adipose-enriched (miR-15a, miR-19a, miR-27b, miR-92a, miR-103, miR-142-5p), plasma-enriched (miR-2412, miR-2478), and bovine-specific (miR-2284x and miR-2295) miRNAs [31]. [score:1]
miR-10b and miR-2478 in circulation and skeletal muscle of JB cattle. [score:1]
Those profiles were enriched with bovine-specific miR-1584-5p, miR-2305, miR-2412, and miR-2478, which are associated with energy metabolism [32]. [score:1]
In the plasma samples of both groups, miR-2478 and miR-1260b were approximately 46 and 17% of the total miRNAs, respectively (Fig 1). [score:1]
[1 to 20 of 25 sentences]
2
[+] score: 16
Other miRNAs from this paper: bta-let-7f-2, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-26b, bta-mir-125a, bta-mir-125b-1, bta-mir-128-1, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-140, bta-mir-15b, bta-mir-92a-2, bta-let-7d, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-125b-2, bta-mir-374a, bta-mir-128-2, bta-mir-146b, bta-mir-152, bta-mir-155, bta-mir-181d, bta-mir-24-1, bta-mir-223, bta-mir-374b, bta-mir-500, bta-mir-708, bta-mir-92a-1, bta-mir-9-1, bta-mir-9-2, bta-mir-1249, bta-mir-181a-1, bta-mir-2285a, bta-mir-2285d, bta-mir-2285b-1, bta-mir-2285c, bta-mir-2898, bta-mir-2285e-1, bta-mir-2285e-2, bta-mir-2285f-1, bta-mir-2285f-2, bta-mir-2285g-1, bta-mir-2285h, bta-mir-2285i, bta-mir-2285j-1, bta-mir-2285j-2, bta-mir-2285k-1, bta-mir-2285l, bta-mir-2285o-1, bta-mir-2285o-2, bta-mir-2285n-1, bta-mir-2285n-2, bta-mir-2285p, bta-mir-2285m-1, bta-mir-2285m-2, bta-mir-2285n-3, bta-mir-2285n-4, bta-mir-2285o-3, bta-mir-2285o-4, bta-mir-2285m-3, bta-mir-2285m-4, bta-mir-2285o-5, bta-mir-2285m-5, bta-mir-2285n-5, bta-mir-2285n-6, bta-mir-2285n-7, bta-mir-2285k-2, bta-mir-2285k-3, bta-mir-2285k-4, bta-mir-2285k-5, bta-mir-2285q, bta-mir-2285r, bta-mir-2285s, bta-mir-2285t, bta-mir-2285b-2, bta-mir-2285v, bta-mir-2285g-2, bta-mir-2285g-3, bta-mir-2285af-1, bta-mir-2285af-2, bta-mir-2285y, bta-mir-2285w, bta-mir-2285x, bta-mir-2285z, bta-mir-2285u, bta-mir-2285aa, bta-mir-2285ab, bta-mir-2285ac, bta-mir-2285ad, bta-mir-2285ae, bta-mir-2285ag, bta-mir-2285ah, bta-mir-2285ai, bta-mir-2285aj, bta-mir-2285ak, bta-mir-2285al, bta-mir-2285am, bta-mir-2285ar, bta-mir-2285as-1, bta-mir-2285as-2, bta-mir-2285as-3, bta-mir-2285at-1, bta-mir-2285at-2, bta-mir-2285at-3, bta-mir-2285at-4, bta-mir-2285au, bta-mir-2285av, bta-mir-2285aw, bta-mir-2285ax-1, bta-mir-2285ax-2, bta-mir-2285ax-3, bta-mir-2285ay, bta-mir-2285az, bta-mir-2285an, bta-mir-2285ao-1, bta-mir-2285ao-2, bta-mir-2285ap, bta-mir-2285ao-3, bta-mir-2285aq-1, bta-mir-2285aq-2, bta-mir-2285ba-1, bta-mir-2285ba-2, bta-mir-2285bb, bta-mir-2285bc, bta-mir-2285bd, bta-mir-2285be, bta-mir-2285bf-1, bta-mir-2285bf-2, bta-mir-2285bf-3, bta-mir-2285bg, bta-mir-2285bh, bta-mir-2285bi-1, bta-mir-2285bi-2, bta-mir-2285bj-1, bta-mir-2285bj-2, bta-mir-2285bk, bta-mir-2285bl, bta-mir-2285bm, bta-mir-2285bn, bta-mir-2285bo, bta-mir-2285bp, bta-mir-2285bq, bta-mir-2285br, bta-mir-2285bs, bta-mir-2285bt, bta-mir-2285bu-1, bta-mir-2285bu-2, bta-mir-2285bv, bta-mir-2285bw, bta-mir-2285bx, bta-mir-2285by, bta-mir-2285bz, bta-mir-2285ca, bta-mir-2285cb, bta-mir-2285cc, bta-mir-2285cd, bta-mir-2285ce, bta-mir-2285cf, bta-mir-2285cg, bta-mir-2285ch, bta-mir-2285ci, bta-mir-2285cj, bta-mir-2285ck, bta-mir-2285cl, bta-mir-2285cm, bta-mir-2285cn, bta-mir-2285co, bta-mir-2285cp, bta-mir-2285cq, bta-mir-2285cr-1, bta-mir-2285cr-2, bta-mir-2285cs, bta-mir-2285ct, bta-mir-2285cu, bta-mir-2285cv-1, bta-mir-2285cv-2, bta-mir-2285cw-1, bta-mir-2285cw-2, bta-mir-2285cx, bta-mir-2285cy, bta-mir-2285cz, bta-mir-2285da, bta-mir-2285db, bta-mir-2285dc, bta-mir-2285dd, bta-mir-2285de, bta-mir-2285df, bta-mir-2285dg, bta-mir-2285dh, bta-mir-2285di, bta-mir-2285dj, bta-mir-2285dk, bta-mir-2285dl-1, bta-mir-2285dl-2, bta-mir-2285dm
It was reported recently that bta-miR-2478 inhibits TGFβ1 expression during mammary gland development in goats and a strong negative correlation between miR-2478 and TGFβ1 expression was demonstrated [66]. [score:8]
This suggests that bta-miR-2478 may target other gene(s) than TGFβ1 in infected macrophages. [score:3]
We could not observe this negative correlation in our study, as the lowest transcript level of TGFβ1 (Fig. 1) was associated with the lowest expression of bta-miR-2478 (Additional file 5: Table S4) in macrophages challenged with ST12, compared to the other groups. [score:2]
Moreover, three out of these (i. e. bta-miR-2478, bta-miR-1249 and bta-miR-2898; Additional file 7: Table S5) were found among DE miRNAs commonly regulated by both S. agalactiae strains. [score:2]
Three out of thirteen DE miRNAs (i. e. bta-miR-2478, bta-miR-2898 and bta-miR-1249) detected among macrophages challenged with ST12 compared to macrophages challenged with ST103 were also found among DE miRNAs commonly regulated by both S. agalactiae strains (Fig. 4 and Additional file 7: Table S5). [score:1]
[1 to 20 of 5 sentences]
3
[+] score: 16
For instance, miRNAs that were poorly conserved could still be highly expressed, as was observed with miR-2478 (a bovine specific miRNA) which was non-clustered and poorly conserved, but the most highly expressed miRNA in bovine adipose tissue (Additional file 1). [score:5]
In general, species specific miRNAs tend to be less expressed than highly conserved miRNAs, but bovine specific miR-2478 was the most highly expressed miRNA in all animals from our study suggesting it has an established role in bovine adipose tissue. [score:5]
Expression of bovine specific miRNAs varied considerably and was as much as 70 fold higher for miR-2478 than that of miR-2882. [score:3]
Expression of AT core miRNAs (n = 155) varied wi dely, as microarray intensity values (normalized) ranged from close to zero (miR-2425-3p) to up to 10.9 (miR-2478). [score:3]
[1 to 20 of 4 sentences]
4
[+] score: 12
confirmed the down-regulation of 8 miRNAs (novel-miR-51, novel-miR-99, miR-30d, miR-574, miR-222, miR-196a, miR-3613a, and miR-27a-5p) and the up-regulation of 4 miRNAs (novel-miR-75, miR-1246, miR-2478, and miR-2904) in infected MDBK cells compared with the uninfected (Figure 4A). [score:6]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
Primer Sequence (5′-3′) bta-miR-30d TGTAAACATCCCCGACTGGAAGCT bta-miR-574 TGAGTGTGTGTGTGTGAGTGTGTG bta-miR-222 GAGCTACATCTGGCTACTGGGT bta-miR-196a GGCTAGGTAGTTTCATGTTGTTGGG bta-miR-3613a GCGGCTGTTGTACTTTTTTTTTTGTTC bta-miR-1246 GGCAATGGATTTTTGGAGCAGG bta-miR-2478 GCCGTATCCCACTTCTGACACCA bta-miR-2904 GGGAGCCTCGGTTGGCCT bta-miR-27a-5p GGCTTCACAGTGGCTAAGTTCCG novel-miR-51 TAATACTGCCTGGTAATGATGAC novel-miR-99 TTGGGAAGCACAGACACTAGGACT novel-miR-75 TCAAAGACTCGGACGTGACTGA 5S rRNA-F GTCTACGGCCATACCACCCT Table 2 Primers used to detect target genes expression with RT-qPCR. [score:3]
[1 to 20 of 3 sentences]
5
[+] score: 3
For miR-342, miR-2478 and miR424-3p, expression levels (Table 3) were similar in the cumulus cells surrounding an oocyte that gave rise to a blastocyst to those in cumulus cells around oocytes that did not cleave (Figure 5). [score:3]
[1 to 20 of 1 sentences]
6
[+] score: 1
The c-miRNA profile of the housed cattle at time 0 showed that the top 20 miRNAs comprised 84.38% of the total miRNAs, of which the most and second-most abundant were miR-2478 (33.68%) and miR-1260b (9.49%), respectively (Fig 4). [score:1]
[1 to 20 of 1 sentences]