sort by

2 publications mentioning mtr-MIR159a

Open access articles that are associated with the species Medicago truncatula and mention the gene name MIR159a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 36
Other miRNAs from this paper: dme-mir-7, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-124-1, hsa-mir-124-2, mmu-mir-34a, osa-MIR169a, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, cel-mir-354, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, mtr-MIR169a, mtr-MIR319a, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR168a, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, hsa-mir-519b, ppt-MIR319a, ppt-MIR319b, ppt-MIR319c, ppt-MIR319d, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR169f, mtr-MIR319b, mtr-MIR168a, mtr-MIR169g, mtr-MIR169h, mtr-MIR169b, ppt-MIR319e, osa-MIR169r, mtr-MIR169k, mtr-MIR169j, mtr-MIR159b, ptc-MIR169ag, mtr-MIR169i, mtr-MIR319c, mtr-MIR319d, mtr-MIR169l
With an alignment-score cutoff of 4.5 and a P-value threshold of 0.2, we found small RNA cleavage products of seven mRNA genes targeted by six miRNA-like RNAs that we identified (miR159a. [score:3]
We also examined the target conservation of the miRNA-like RNAs on miR159a and miR319b precursors across Arabidopsis, a dicotyledonous plant, and rice, a monocotyledonous plant. [score:3]
miR159 and miR319 belong to the same MIR family based on their evolutionary origin [30, 44], playing important roles in plant development [47]. [score:2]
3 and miR159a. [score:1]
Importantly, a close inspection showed that many individual miRNA-like RNAs on the miR159 and miR319 precursors are also highly conserved at the sequence level. [score:1]
miRNA-like RNAs appeared in miR319 precursors in all of these five plants, and miRNA-like RNAs occurred in miR159 precursors in all of five bar moss. [score:1]
3 TAAAAAAGGATTTGGTTATA 6 miR159a. [score:1]
For example, the three miRNA-like RNAs on the miR159a precursor that passed our selection criteria are labeled as miR159a. [score:1]
This is consistent with the recent discovery that the DCL cleavage that produces mature miR159 and miR319 starts from the loop ends of their fold-back structures [45, 46]. [score:1]
2-5p is paired with miR159a. [score:1]
2, miR159a. [score:1]
Furthermore, four of these six miRNA-like RNAs (miR159a. [score:1]
Some of these miRNA-like RNAs from conserved miRNA families, that is, miR159 and miR319 in plants, are conserved at the sequence level (Figure 7), which adds another layer of evidence that these miRNA-like RNAs are potentially functionally important in plants. [score:1]
Examples include MIR159a, MIR319a and MIR319b in Figures 1a,c,d, respectively. [score:1]
Figures 1, 2, 3, and 4 show this type of phasing pattern on the precursors of miR159a, miR169 m, miR319a/b, miR447, miR822 and miR839. [score:1]
1/miR159a. [score:1]
1* GAGCTCCTTAAAGTTCAAACA 9 miR159a. [score:1]
2-5p AGCTGCTAAGCTATGGATCCC 36 2,7 miR159a. [score:1]
Following miRNA nomenclature [17, 18], we name these miRNA-like RNAs miR n. k, where integer n specifies a particular miRNA family and precursor (for example, 159a for miR159a) and integer k denotes a specific miRNA or miRNA-like RNA. [score:1]
Note that miRNA-miRNA* duplexes for miRNA-like RNAs, with approximately two-nucleotide 3'-end overhangs, appear on the miR159, miR169m and miR319b precursors. [score:1]
Both ath-miR159a. [score:1]
In the five plant species we studied, miRNA-like RNAs appeared in two well-conserved miRNA families, that is, miR159 and miR319 (Table 2). [score:1]
1* (that is, miR159a/miR159a*) in four plants, A. thaliana (ath), O. sativa (osa), P. patens (ppt) and M. truncatula (mtr). [score:1]
2-3p and miR159a. [score:1]
2-5p/miR159a. [score:1]
2-3p and osa-miR159a. [score:1]
2-3p ATTGCATATCTCAGGAGCTTT 9 1,2,7 At5g24620 miR159a. [score:1]
Figure 6a displays the miR159a precursors in Arabidopsis, rice, Medicago and Populus and Figure 6b shows the miR319b precursors in Arabidopsis, rice, moss and Medicago. [score:1]
2-5p, miR159a. [score:1]
2-5p, and miR159a. [score:1]
For example, miR159a. [score:1]
[1 to 20 of 31 sentences]
2
[+] score: 3
Other miRNAs from this paper: mtr-MIR319a, mtr-MIR319b, mtr-MIR159b, mtr-MIR319c, mtr-MIR319d
The distribution of degradome tags across the miR159b precursor sequence confirmed the loop to base processing for this miR159 family member in M. truncatula. [score:1]
All M. truncatula precursor sequences belonging to the families of miR159 and miR319, were gathered and analyzed for small RNA and degradome read location as well as abundance. [score:1]
The read numbers of miR159 and miR159* from the small RNA libraries [23] are given. [score:1]
[1 to 20 of 3 sentences]