sort by

7 publications mentioning bra-MIR171e

Open access articles that are associated with the species Brassica rapa and mention the gene name MIR171e. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 8
The numbers of reads of the 24 known miRNAs in the two small RNA libraries from flower buds of A line and B line are listed in Additional file 1: Table S2 Among the 24 known miRNAs, bra-miR159a, bra-miR160a-5p, bra-miR171e, bra-miR1885b, and bra-miR5724 showed very high expression levels. [score:3]
In plants, many miRNAs seems to be universally expressed among diverse angiosperms, such as miR156, miR159, miR160, miR162, miR171, miR172 and so on. [score:3]
miRNA sequences and the corresponding number of reads in flower buds of the A line and B line are listed in Table  2. Table 2 on the other arm of known pre-miRNAs miR_name miR_seq Len Flower buds of A line Flower buds of B linebra-miR164a-p3CACGTGCTCCACTCCTCCAAC2110844bra-miR167b-p3GATCATGTTCGCAGTTTCACC216,0613,762bra-miR171b-p5AGATATTAGTGCGGTTCAATC215317bra-miR171e-p5TATTGGCCTGGTTCACTCAGA212001,049bra-miR172a-p5GCAGCACCATCAAGATTCACA2188bra-miR824-p3CCTTCTCATCGATGGTCTAGA215203,882bra-miR1140-p5TCCGATTGGCTTTAGGCTGTTG227091,068 bra-miR5718-p5 TGTTCTGGTTTGATTTTGAAC 21 1,686 1,258 To identify conserved miRNAs in Brassica campestris, all mappable small RNAs were mapped to the Brassica campestris genome sequences and known plant miRNAs in miRBase. [score:1]
miRNA sequences and the corresponding number of reads in flower buds of the A line and B line are listed in Table  2. Table 2 on the other arm of known pre-miRNAs miR_name miR_seq Len Flower buds of A line Flower buds of B linebra-miR164a-p3CACGTGCTCCACTCCTCCAAC2110844bra-miR167b-p3GATCATGTTCGCAGTTTCACC216,0613,762bra-miR171b-p5AGATATTAGTGCGGTTCAATC215317bra-miR171e-p5TATTGGCCTGGTTCACTCAGA212001,049bra-miR172a-p5GCAGCACCATCAAGATTCACA2188bra-miR824-p3CCTTCTCATCGATGGTCTAGA215203,882bra-miR1140-p5TCCGATTGGCTTTAGGCTGTTG227091,068 bra-miR5718-p5 TGTTCTGGTTTGATTTTGAAC 21 1,686 1,258 To identify conserved miRNAs in Brassica campestris, all mappable small RNAs were mapped to the Brassica campestris genome sequences and known plant miRNAs in miRBase. [score:1]
[1 to 20 of 4 sentences]
2
[+] score: 7
Most of the known miRNAs targeted transcription factor-encoding genes, such as the targeting of SPL, MYB, auxin response factor (ARF), NAC, scarecrow, APETALA 2 (AP2), GROWTH-REGULATING FACTOR (GR), and C3HC4-type RING finger family transcription factors by miR156/157, miR159, miR160, miR164, miR171, miR172, miR396, and miR5716, respectively. [score:6]
By expending the members to the existing B. rapa miRNA families, bra-miR156 was now the largest family (harboring 21 members), followed by bra-miR171 (11 members), bra-miR167 (8 members), bra-miR172 (8 members), bra-miR164 (7 members), bra-miR168 (7 members), bra-miR2111 (7 members), bra-miR157 (6 members), bra-miR160 (6 members), bra-miR390 (6 members), and bra-miR395 (6 members). [score:1]
[1 to 20 of 2 sentences]
3
[+] score: 7
In maize, miR164, miR165, miR166, and miR398 are up-regulated, while miR156, miR171, miR172, miR396, and miR529 are down-regulated under UV-B radiation treatment. [score:7]
[1 to 20 of 1 sentences]
4
[+] score: 4
Other miRNAs from this paper: bna-MIR156a, bna-MIR171g, bna-MIR396a, bra-MIR824, bna-MIR824, bna-MIR397a, bna-MIR397b, bna-MIR390a, bna-MIR390b, bna-MIR390c, bna-MIR171a, bna-MIR171b, bna-MIR171c, bna-MIR171d, bna-MIR171e, bna-MIR171f, bna-MIR169a, bna-MIR169b, bna-MIR169c, bna-MIR169d, bna-MIR169e, bna-MIR169f, bna-MIR169g, bna-MIR169h, bna-MIR169i, bna-MIR169j, bna-MIR169k, bna-MIR169l, bna-MIR169m, bna-MIR168a, bna-MIR167a, bna-MIR167b, bna-MIR167c, bna-MIR166a, bna-MIR166b, bna-MIR166c, bna-MIR166d, bna-MIR164a, bna-MIR159, bna-MIR156b, bna-MIR156c, bra-MIR1885a, bra-MIR157a, bra-MIR159a, bra-MIR160a, bra-MIR164a, bra-MIR167a, bra-MIR167b, bra-MIR167c, bra-MIR167d, bra-MIR171a, bra-MIR171b, bra-MIR171c, bra-MIR171d, bra-MIR172a, bra-MIR172b, bna-MIR2111b, bna-MIR2111a, bra-MIR2111a, bra-MIR1885b, bna-MIR156d, bna-MIR156e, bna-MIR156f, bna-MIR156g, bna-MIR160a, bna-MIR160b, bna-MIR160c, bna-MIR160d, bna-MIR164b, bna-MIR164c, bna-MIR164d, bna-MIR166f, bna-MIR166e, bna-MIR167d, bna-MIR168b, bna-MIR169n, bna-MIR172d, bna-MIR172b, bna-MIR172c, bna-MIR172a, bna-MIR394a, bna-MIR394b, bna-MIR395a, bna-MIR395b, bna-MIR395c, bna-MIR395d, bna-MIR395e, bna-MIR395f, bna-MIR403, bna-MIR860, bna-MIR2111d, bna-MIR2111c, bra-MIR408, bra-MIR158, bra-MIR156a, bra-MIR156b, bra-MIR156c, bra-MIR156d, bra-MIR156e, bra-MIR156f, bra-MIR156g, bra-MIR168b, bra-MIR168c, bra-MIR168a, bra-MIR319, bra-MIR390, bra-MIR391, bra-MIR395d, bra-MIR395b, bra-MIR395c, bra-MIR395a, bra-MIR396, bra-MIR400, bra-MIR403, bra-MIR860, bra-MIR164b, bra-MIR164d, bra-MIR164c, bra-MIR164e, bra-MIR172c, bra-MIR2111, bra-MIR172d
Group A3, including miR171, miR160 and miR394, were expressed in both flower buds and during seed development. [score:4]
[1 to 20 of 1 sentences]
5
[+] score: 4
Similarly, miR171 also participates in the biotic and abiotic stress responses (Zhou et al., 2007; Liu et al., 2008), while miR166 can alter the development and polarity of the leaf via an interaction with HD-ZIP genes (Emery et al., 2003; Williams et al., 2005). [score:2]
The 12 newly generated conserved MIRNAs, including six, two, and three from the miR156, miR171, and miR166 families, respectively (Table 2 and Supplementary Table S11), obviously originated from the existing MIRNAs via the gene or genomic segmental duplication events. [score:1]
As revealed by the genomic microsynteny analysis, at least 12 of the 18 newly generated MIRNAs in B. napus obviously originated from the existing conserved MIRNAs (miR156, miR171, and miR166 families) in the two progenitors via such genomic reorganization. [score:1]
[1 to 20 of 3 sentences]
6
[+] score: 1
A list of the identified miRNA families and the number of members for each family that were identified in this study are presented in Table 2. The sequence of the most abundant member (based on read counts of control sample) is also presented in Table 2. The highest number of miRNA members belong to miR169 family (5 members) followed by 4 members each in miR156 and miR171 families. [score:1]
[1 to 20 of 1 sentences]
7
[+] score: 1
Eight cis-NATs were coincidently the precursors of miR162, miR167, miR171, miR172, miR398 and miR408 (Table  3). [score:1]
[1 to 20 of 1 sentences]