sort by

2 publications mentioning aga-mir-1000

Open access articles that are associated with the species Anopheles gambiae and mention the gene name mir-1000. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 17
In order to confirm the small RNA sequencing results, and to determine the expression patterns of these miRNAs in different developmental stages, we chose three conserved miRNAs: miR-184, −989 and miR-1000 represented in our sequencing data for further northern blot analysis. [score:4]
The expression patterns of four conserved miRNAs are shown in Figure  3. The patterns of miR-184, −2943 and miR-1000 are similar to the patterns found in Ae. [score:3]
miR-1000 is present in embryonic, larval, pupal, and adult stages, and the expression level in male adults is higher than those in female adults by comparing with the blot signal. [score:3]
The results of miR-1000, −184, −2943 and miR-989 with mirVana miRNA isolation kit are similar to the patterns with trizol isolation (Additional file 4: Figure S2). [score:1]
As shown in Additional file 3: Table S2, the GC contents of aan-miR-1000 and miR-2943 are very contiguous to miR-141 and miR-200c, which is about 43.5%. [score:1]
miR-184 and miR-1000 are present in An. [score:1]
The aan-miR-1000 isolated by trizol can be found in both male and female adults in the sequencing experiments, which further demonstrated that the trizol-related impact on low GC miRNA isolation in our study has been limited in sequencing experiments. [score:1]
As described before, miR-1000 and miR-2943 belong to the low GC miRNAs family. [score:1]
So, aan-miR-1000 and miR-2943 also belong to low GC miRNAs. [score:1]
Probe sequences were as follow, aan-miR-184: CCCTTATCAGTTCTCCGTCCA; aan-miR-989: GTACCACTACGTCACATCACA; aan-miR-998: GAGCTGAATCTCATG GTGCTA; aan-miR-2943: TTTGCCTGCAAGTGCCTACTTAA; aan-miR-1000: ACTG CTGTGTCAGGCAATAT. [score:1]
[1 to 20 of 10 sentences]
2
[+] score: 1
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, dme-mir-1, dme-mir-8, dme-mir-11, hsa-mir-34a, hsa-mir-210, dme-mir-184, dme-mir-275, dme-mir-92a, dme-mir-276a, dme-mir-277, dme-mir-33, dme-mir-281-1, dme-mir-281-2, dme-mir-34, dme-mir-276b, dme-mir-210, dme-mir-92b, dme-bantam, dme-mir-309, dme-mir-317, hsa-mir-1-2, hsa-mir-184, hsa-mir-190a, hsa-mir-1-1, hsa-mir-34b, hsa-mir-34c, aga-bantam, aga-mir-1, aga-mir-184, aga-mir-210, aga-mir-275, aga-mir-276, aga-mir-277, aga-mir-281, aga-mir-317, aga-mir-8, aga-mir-92a, aga-mir-92b, hsa-mir-92b, hsa-mir-33b, hsa-mir-190b, dme-mir-190, dme-mir-957, dme-mir-970, dme-mir-980, dme-mir-981, dme-mir-927, dme-mir-989, dme-mir-252, dme-mir-1000, aga-mir-1174, aga-mir-1175, aga-mir-34, aga-mir-989, aga-mir-11, aga-mir-981, aga-mir-1889, aga-mir-1890, aga-mir-1891, aga-mir-190, aga-mir-927, aga-mir-970, aga-mir-957, aga-mir-309, cqu-mir-1174, cqu-mir-281-1, cqu-mir-1, cqu-mir-275, cqu-mir-957, cqu-mir-277, cqu-mir-252-1, cqu-mir-970, cqu-mir-317-1, cqu-mir-981, cqu-mir-989, cqu-mir-1175, cqu-mir-276-1, cqu-mir-276-2, cqu-mir-276-3, cqu-mir-210, cqu-mir-92, cqu-mir-190-2, cqu-mir-190-1, cqu-mir-1000, cqu-mir-11, cqu-mir-8, cqu-bantam, cqu-mir-1891, cqu-mir-184, cqu-mir-1890, cqu-mir-980, cqu-mir-33, cqu-mir-2951, cqu-mir-2941-1, cqu-mir-2941-2, cqu-mir-2952, cqu-mir-1889, cqu-mir-309, cqu-mir-252-2, cqu-mir-281-2, cqu-mir-317-2, aga-mir-2944a-1, aga-mir-2944a-2, aga-mir-2944b, aga-mir-2945, aga-mir-33, aga-mir-980
In Aedes, four miRNAs, miR-276, miR-317, miR-1000, and miR-309 arise from two potential hairpin precursors (Table 1). [score:1]
[1 to 20 of 1 sentences]