sort by

23 publications mentioning zma-MIR396d

Open access articles that are associated with the species Zea mays and mention the gene name MIR396d. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 70
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR529, zma-MIR390b
The up-regulation of miR396 in HKI-1532 suppressed the expression of its target, GRF1, whereas the up-regulation of miR396 in V-372 led to neutral expression of its target. [score:17]
The target distributions of miRNA families themselves were investigated, which showed that zma-miR166, zma-miR396, zma-miR529, zma-miR164, and zma-miR169 had the most targets, with 6, 6, 5, and 5 target mRNAs, respectively, while zma-miR160, zma-miR390, zma-miR393, and zma-miR2275 had the fewest target mRNAs, with a single target each (Figure 3). [score:9]
Ectopic expression of miR396 suppresses GRF target gene expression and alters leaf growth in Arabidopsis. [score:9]
Conversely, in V-372, members of 7 families—zma-miR164, zma-miR169, zma-miR393, zma-miR396, zma-miR399, zma-miR529, and zma-miR2275—were significantly up-regulated; and zma-miR156, zma-miR159, zma-miR166 and zma-miR395 families were significantly down-regulated. [score:7]
However, expression of miR396c and miR396d, targeting GRFs, was the same in both genotypes. [score:5]
In tolerant genotype HKI-1532, 16 miRNAs belonging to the zma-miR159, zma-miR160, zma-miR164, zma-miR166, zma-miR169, zma-miR390, zma-miR395, zma-miR396, and zma-miR399 families were significantly up-regulated. [score:4]
The significantly up-regulated miRNAs common to both genotypes (HKI-1532 and V-372) included zma-miR164h, zma-miR169l, zma-miR396c, zma-miR396d, and zma-miR399e. [score:4]
Overexpression of miR168, miR171 and miR396 under hypersalinity, mannitol, and cold stress was reported in Arabidopsis (Liu et al., 2008). [score:3]
m Growth -regulating factor 9 zma-miR396-c,d gnl|GNOMON|8836063. [score:2]
m Growth -regulating factor 1 zma-miR396-c,d gnl|GNOMON|54764053. [score:2]
m Growth -regulating factor 8 zma-miR396-c,d gnl|GNOMON|9726103. [score:2]
m Growth -regulating factor 1 zma-miR396-c,d gnl|GNOMON|41140073. [score:2]
m Growth -regulating factor 1-like zma-miR396-c,d gnl|GNOMON|74420063. [score:2]
Similar results were obtained for miR396 in Arabidopsis (Liu et al., 2008) and tobacco (Frazier et al., 2011). [score:1]
m Atpsulfurylase miR396 zma-miR396-c,d gnl|GNOMON|3258103. [score:1]
[1 to 20 of 15 sentences]
2
[+] score: 31
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, zma-MIR444a, zma-MIR444b
For example, the miR396 family is overall highly expressed in the juvenile root and seedling samples but only certain individual family members (miR396a, miR396b, and miR396g) are highly expressed in pollen (Figure 4). [score:5]
The latter are also the only members of the miR396 family that target QLQ (glutamine-leucine-glutamine) and WRC (tryptophan-arginine-cysteine) domains that define the Growth-Regulating Factor (GRF) family of transcription factors [64]. [score:4]
1000716.g004 Figure 4 Solexa reads mapping to the miR396 family were counted and summed for each family member, showing tissue specificity of expression amongst members of the same family. [score:3]
The same trend is observed in many other miRNA families including miR164, miR166, miR169, miR171, miR172, miR319 and miR396 as they target various families of transcription factors such as NAM (No Apical Meristem) proteins, bZIP (basic-leucine Zipper) genes, CBF (CCAAT binding factor), GRAS transcription factor, AP2 (APETALA2)-EREBP (Ethylene-Responsive Element Binding Proteins), CCCH type zinc finger protein and TCP (Teosinite branched, Cycloidea, and PCF), GRF transcription factor families respectively [12], [71], [85]– [87]. [score:3]
Solexa reads mapping to the miR396 family were counted and summed for each family member, showing tissue specificity of expression amongst members of the same family. [score:3]
As seen in the miR396 gene family, tissue expression profiles are not necessarily conserved amongst miRNA genes of the same family. [score:3]
The miR156, miR164, miR168, miR393, miR395, miR396, miR398, and miR399 families had higher signatures in juvenile root and seedling tissues while miR172 demonstrated a higher expression level in reproductive tissues (tassel and ear). [score:3]
Expression levels of miRNA genes from miR396 family across tissue types. [score:3]
Therefore, miR396c/d could be acting as regulatorsr of GRF genes in juvenile tissues independently from the rest of the miR396 family. [score:2]
Other members of the miR396 family are conserved in both monocots and dicots, but miR396c/d appear to be monocot specific (equivalent to osa-miR396d/e found in rice) [63]. [score:1]
These families are: miR156, miR160, miR164, miR166, miR167, miR172, miR396, and miR528. [score:1]
[1 to 20 of 11 sentences]
3
[+] score: 30
In the leaf primordia, miR396 expresses at low levels throughout the meristem, overlapping with the expression of its target, GRF2 [36]. [score:7]
The repression of zma-miR396 maybe leads to the steady expression amount of GRFs, and enhances the development of the corn kernel. [score:4]
During the seed development process of wheat and rice, the expression amount of miR396 was weak too, some of them even less than 1 RPM [33, 34]. [score:4]
MicroRNA miR396 and RDR6 synergistically regulate leaf development. [score:3]
Over -expression of miR396 was found to decrease the GRFs that has been shown to influence cell proliferation in the meristem and developing leaves [37]. [score:3]
In this study, the results showed that zma-miR396 increased in the endosperm at the four sampling times, but the expression level was weak, with values less than 30 RPM. [score:3]
miR396 regulates growth -regulating factors (GRFs), which are transcription factors of the plant-specific family. [score:3]
The qRT-PCR results revealed that GRF decreased a little with a slight increase of zma-miR396 (Fig 4). [score:1]
Control of cell proliferation in Arabidopsis thaliana by microRNA miR396. [score:1]
0125800.g002 Fig 2 Six novel maize miRNAs (miRt4, miRt13, miRt15, miRt17 and miRt21, miRt28) and six conserved miRNAs (miR156, miR162, miR172, miR393, miR396 and miR408) were chosen to verify the sequencing results via the qRT-PCR analysis. [score:1]
[1 to 20 of 10 sentences]
4
[+] score: 30
That is, they all (miR159 and its target with IAA; miR166, miR169, miR393, miR396, and their targets with ZR + iPA; miR159, miR396 and their targets with GA; miR396 and their targets with BR; miR159, miR396 and their targets with JA; miR160, miR164, miR166, miR169, miR172, and miR396 and their targets with ABA) showed a significant positive and/or negative correlation with the phytohormone levels. [score:13]
For example, OsGRF4, a target of miR396, was found to positively regulate BR content through direct interaction with GSK2, the central negative regulator of brassinosteroid signaling in rice (Che et al., 2015). [score:6]
OsGRF4, a target of miR396, reportedly regulates a CK dehydrogenase precursor gene and controls rice grain shape (Sun et al., 2016), while TCP14 and TCP15 TFs, which mediate CK responses, were found to cause excessive proliferation of the boundaries of the Arabidopsis gynoecium replum (Takei et al., 2001). [score:4]
Eight known miRNAs (miR159, miR160, miR164, miR166, miR169, miR172, miR393, and miR396), four newly identified miRNAs, and 12 target genes were selected for qRT-PCR validation. [score:3]
It should be noted that miR396 expression increased on the day of silking and thereafter decreased (Figure 3A). [score:3]
Blocking miR396 increases rice yield by shaping inflorescence architecture. [score:1]
[1 to 20 of 6 sentences]
5
[+] score: 26
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR529
Among the target genes profiled in the ear leaves of the inbred line ELS-1, the gene expression trends were opposite those of miR171, miR172, miR159, and miR396, suggesting that these miRNA target genes were subjected to a negative regulation by the miRNAs, most likely through a target cleavage pathway. [score:10]
n ≥ 3. [*], p < 0.1; [**], p < 0.01; [***], p < 0.001 Based on the profiles, almost all of the miRNAs were down-regulated in the ear leaves of the inbred line ELS-1, except miR396 and miR529, which had high expression levels on 30DAP and miR394, which had a low expression level on 10DAP. [score:8]
n ≥ 3. [*], p < 0.1; [**], p < 0.01; [***], p < 0.001 Based on the profiles, almost all of the miRNAs were down-regulated in the ear leaves of the inbred line ELS-1, except miR396 and miR529, which had high expression levels on 30DAP and miR394, which had a low expression level on 10DAP. [score:8]
[1 to 20 of 3 sentences]
6
[+] score: 22
Expression profiles were established based on stem-loop real-time RT-PCR analysis of six selected miRNAs, comprising miR156, miR164, miR167, miR168, miR169 and miR396, as well as real-time RT-PCR analysis of their target mRNAs. [score:5]
Ectopic over -expression of miR396 represses expression of not only six GRF genes but also GIF1, which encodes a GRF-interacting transcription co-activator with a role in cell proliferation in the leaf [49]. [score:5]
Studies on the mo del plants rice and Arabidopsis indicate that growth regulating factors (GRFs) were the conserved target genes of miR396 in dicotyledon and monocotyledon plants [49]– [50]. [score:4]
It is clear that miR396 plays an important role in plant leaf growth and development, most likely by repression of GRF gene expression. [score:4]
In maize, the targets of miR396 were also GRF genes, and our study showed that miR396 was over dominantly repressed. [score:3]
Since GRFs might regulate cell division, it is possible that repression of miR396, which leads to inducement of GRFs, enhances cell division in Yuyu22 compared to that in the parental inbred lines. [score:1]
[1 to 20 of 6 sentences]
7
[+] score: 15
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR1432
Analyses of target genes indicated that the expression of four miRNA families (miR164, miR396, miR530, and miR1846) was positively or negatively correlated with that of their respective targets, genes that were associated with symptom development. [score:8]
miR396 is related to the regulation of stress responses (Liu et al., 2008) and pistil development in Arabidopsis (Liang et al., 2014), and to arsenate and arsenite stress responses in wild accessions of rice (Sharma et al., 2015). [score:3]
Combined analyses indicated that the regulation of the miRNA families miR166, miR167, miR169, miR396, and miR399 might be involved in maize tissues and stress responses. [score:2]
In the third group of miRNAs, members within five known miRNA families (miR166, miR167, miR169, miR396, and miR399) increased or decreased at the same time. [score:1]
miR166, miR167, miR169, and miR396 also responded to RBSDV in rice leaves and roots (Sun et al., 2014). [score:1]
[1 to 20 of 5 sentences]
8
[+] score: 12
The results indicated that miR156, miR171, miR396 and miR444, which respectively targeted to SPL, SCL, QQT and EDA genes, might differentially expressed in the seed development in two maize inbred lines, especially involved in flowering regulation and embryo development. [score:8]
The results indicated that some miRNAs (e. g. miR156, miR171, miR396 and miR444) differentially expressed in the seed development between PH6WC and PH4CV maize inbred lines under different genetic backgrounds. [score:4]
[1 to 20 of 2 sentences]
9
[+] score: 11
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR528a, zma-MIR528b, zma-MIR827, zma-MIR390b, zma-MIR444a, zma-MIR444b
MiR168, miR393, miR396 and miR398 were highly expressed in the endosperm at 15 DAP and 20 DAP, indicating their regulation function during middle and late development of the endosperm (Figure 3e). [score:5]
miR396 can target growth -regulating factors (GRFs), which are involved in the control of grain size and yield in rice [15, 16, 17, 18]. [score:4]
Among them, miR166 was the most abundant family (17,602) followed by miR171 (11,988), miR827 (7686), miR167, miR396, miR528, miR156, miR408, miR160, miR390, miR159, miR444, miR319, miR398, miR168, miR394, miR164, miR393 and miR169 (Figure 3a). [score:1]
Gao F. Wang K. Liu Y. Chen Y. Chen P. Shi Z. Luo J. Jiang D. Fan F. Zhu Y. Blocking miR396 increases rice yield by shaping inflorescence architectureNat. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 8
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR156k, zma-MIR160f, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR1127a, osa-MIR169r, osa-MIR396f, zma-MIR396c, osa-MIR2275a, osa-MIR2275b, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, tae-MIR167b, hvu-MIR168, hvu-MIR169, tae-MIR169, hvu-MIR397a, tae-MIR398, tae-MIR171b, hvu-MIR166b, hvu-MIR166c, osa-MIR2275c, osa-MIR2275d, tae-MIR1122b, tae-MIR9653a, tae-MIR9654a, tae-MIR9656, tae-MIR9657a, tae-MIR9659, tae-MIR9660, tae-MIR1127b, tae-MIR9661, tae-MIR396, tae-MIR9665, tae-MIR2275, tae-MIR9667, tae-MIR167c, tae-MIR1120b, tae-MIR397, tae-MIR1130b, tae-MIR5384, tae-MIR9675, tae-MIR1120c, tae-MIR9679, tae-MIR9657b, hvu-MIR397b, hvu-MIR156b, tae-MIR9653b
Although low expression (976 RPM and 921 RPM, respectively) was observed for both miR164 and miR396 families, their expression level was still about 4 to 200 times greater than any of the 6 remaining highly conserved miRNA families (Table  2 and Additional file 2). [score:5]
Of the 15 known miRNA families, 8 (miR396, miR168, miR156, miR172, miR159, miR398, miR1318 and miR167) showed different levels of preferential expression in wheat flag leaves, with the logarithm of the fold changes ranged from 0.5 to 5.2 as well as more than those in the developing seeds (Figure  3a, Table  2). [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 8
Bioinformatic analyses reveal that grf1 homologs in Arabidopsis and rice have complementary target sites for miR396, a relatively rare small RNA that is either expressed at very low levels or in a limited number of cells/tissues [83]. [score:5]
Zm-grf1 also harbors the conserved miR396 recognition motif, and thus represents an intriguing candidate gene for reverse genetic analyses of microRNA-regulated leaf development. [score:3]
[1 to 20 of 2 sentences]
12
[+] score: 7
In previous studies, the over -expression of GRF genes in Arabidopsis was found to result in bigger organ size than the vector control [3, 7], while reduction of AtGRF gene expression by the overexpression of the microRNA miR396 in transgenic Arabidopsis caused narrow-leaf phenotypes due to a reduction in cell number [24– 26]. [score:7]
[1 to 20 of 1 sentences]
13
[+] score: 7
For example, miR162 was not found in our research; miR156, miR164, miR167, and miR396 were not down-regulated in the roots, but in the leaves, miR164 showed a down-regulation. [score:7]
[1 to 20 of 1 sentences]
14
[+] score: 6
The effects on both cell proliferation and cell expansion were shown to be regulated by the overexpression of miR396 and may result in the repression of multiple GRF genes in these transgenic plants overexpressing miR396 [35]. [score:6]
[1 to 20 of 1 sentences]
15
[+] score: 4
Most of the targets were found to be transcription factors (TFs), such as auxin response factors (miR160 and miR167), growth -regulating factor (miR396), N-acetylcysteine domain containing protein (miR164), SQUAMOSA promoter -binding protein-like (miR156) and nuclear TF Y (miR169). [score:4]
[1 to 20 of 1 sentences]
16
[+] score: 4
The endogenous miR396 h targeting sequence was replaced with TCTTATTCCTCTCCCCTCCTG and the endogenous star sequence replaced with CAGGAGGGCAGAGGAATAAGA. [score:3]
An artificial microRNA was designed to silence specifically the Ms44 allele, using the scaffolding of the maize miR396 h pri‐miRNA as template. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 3
In Arabidopsis, the expression of miR156, miR167, miR168, and miR396 increased 2 h to 24 h after exposure to high-salinity treatment. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR528a, zma-MIR528b, zma-MIR827
Finally, miR396 mediates leaf development in Arabidopsis by controlling GROWTH-REGULATING FACTOR [46]. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
004G317000’s network, the pink line represented the gene targeted by the sbi-miR396 family. [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, osa-MIR444a, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR156k, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR1425, osa-MIR1428a, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1874, osa-MIR2055, osa-MIR827, osa-MIR1428f, osa-MIR1428g, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR827, osa-MIR395x, osa-MIR395y, zma-MIR444a, zma-MIR444b
The first category corresponds to osa-miR156h*, osa-miR393b* and osa-miR396d*. [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
The nine families comprised miR156, miR166, miR167, miR171, miR396, miR398, miR408, miR444, and miR827. [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
Control of cell proliferation in Arabidopsis thaliana by microRNA miR396. [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR396f, zma-MIR396c, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR529, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
Of these, 45 miRNAs aligned with 59 members of 21 maize miRNA families, while the others corresponded to members of miRNA families from three other plant species, including rice (osa-miR156/162/164/168/396/529) Arabidopsis (ath-miR156/164/167) and sorghum (sbi-miR396). [score:1]
[1 to 20 of 1 sentences]