sort by

20 publications mentioning ssc-mir-15a

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-15a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 166
Although there is not an direct evidence that CCND1 (cyclin D1) might be also a target of miR-15a in PK15 cells due to the absence of the complete 3′ UTR of Sus scrofa cyclin D1 available, we found that limitation of miR-15a expression by treatment with miR-15a inhibitor promoted cyclins D1 and E protein expression in synchronized PCV2-infected PK15 cells, in which miR-15a -induced cell cycle arrest can be restored after inhibition of miR-15a expression. [score:14]
This might implicate that miR-15a also regulates expression of cyclin D1 protein via direct interaction with target sequence located at the 3′ UTR of Sus scrofa cyclin D1, as observed for cyclin E. In addition, we found that miR-15a promoted more efficient PCV2 replication as confirmed by decreased viral protein expression and virus production in the PCV2-infected cells after inhibition of miR-15a expression. [score:13]
The above data demonstrated that expression of miR-15a is upregulated in the PCV2-infected PK15 cells and that miR-15a regulated expression of cyclins D1 and E, which are required for promoting cells from G1 to S phase. [score:9]
We further used to determine the expression of cyclins D1 and E in the PCV2-infected miR-15a inhibitor -treated cells and found that decrease of cyclins D1 and E as well as reduction in the level of Rb phosphorylation were also recovered in the PCV2-infected cells after miR-15a inhibitor treatment (Fig. 5D). [score:7]
Given that CCND1/CCNE and miR-15a are inversely regulated during PCV2 infection, we suggested that involvement of miR-15a in augmenting PCV2 replication is mainly modulated by its ability to downregulate expression of CCND1 and CCNE. [score:7]
PK15 cells were transfected with a specific miR-15a inhibitor or control miR-NC followed by infection with PCV2 (MOI = 1) for 24 h. Western blot analysis showed that the expression levels of viral ORF2 protein were significantly decreased after treatment with miR-15a inhibitor (Fig. 6A). [score:7]
miR-15a downregulated cell cycle regulators CCND1 and CCNE expression and promoted G0/G1 cycle arrest in PCV2-infected cells. [score:7]
As shown in Fig. 5C, inhibition of miR-15a expression can rescue PCV2 -induced G [0]/G [1] phase cell cycle block, at which time about 56% and 43% G0/G1-phase populations for PCV2-infected and PCV2-infected miR-15a inhibitor -treated cells, respectively, as compared to that in the mock-infected cells. [score:6]
These results demonstrated that PCV2 infection mediated upregulation of only miR-15a expression, which prompted us to speculate that miR-15a may involve in PCV2 -induced G0/G1 cell cycle arrest. [score:6]
Upregulation of miR-15a expression in PCV2-infected PK15 cells. [score:6]
These results further demonstrated that overexpression of miR-15a induced by PCV2 decreased cyclins D1 and E expression followed by reduction of Rb phosphorylation, thus leading to the blockage of cell cycle in G0/G1 phase in PK15 cells. [score:5]
After predicating the putative targets of miR-15a, we further found CCNE (cyclin E) as a direct target of miR-15a in PK15 cells through luciferase assay. [score:5]
To access the role of miR-15a expression in PCV2 -induced blockage of G0/G1 cycle progression, the cells were transfected with miR-15a inhibitor before PCV2 infection for 24 h and the cell cycle was analyzed by flow cytometry. [score:5]
To validate the possibility that miR-15a may target key molecules related to PCV2 -induced G0/G1 cell cycle arrest, we used RNA hybrid 2.2 to analyse and found that miR-15a seed sequence possesses the highest score of probability for targeting cyclin E (CCNE) 3′ UTR (Fig. 5A). [score:5]
These results, together with the data shown in Fig. 5C,D, indicated that upregulation of miR-15a is beneficial for PCV2 growth and that contribution of miR-15a to PCV2 -induced G0/G1 phase in PK15 cells. [score:4]
Upregulation of miR-15a is beneficial for PCV2 growth. [score:4]
In the present study, we found that only miR-15a but not other miRNAs including miR-16, miR-21, and miR-34a, exhibited significant upregulation in the synchronized PCV2-infected PK15 cells. [score:4]
Overall, these results showed that PCV2 upregulates miR-15a as a means to decrease CCND1 and CCNE levels, which may benefit viral replication by blocking G0/G1 cell cycle progression. [score:4]
miR-15a was upregulated in PCV2-infected cells. [score:4]
The above results indicated that the G0/G1 cell cycle arrest in PCV2-infected cells was mediated by decrease of cyclins D1 and E. Research data has shown that miR-15a/16 family share many common targets including cyclins D1 and E, regulating the G0/G1 cell cycle progression 36 37. [score:4]
However, treatment of miR-15a mimics obviously reduced the expressions of cyclins D1 and E as well as p-Rb in the PCV2-infected cells (Fig. 5D). [score:3]
The relative luciferase activity in the PCV2-infected miR-15a inhibitor -treated cells was higher than that in the PCV2 alone-infected cells. [score:3]
As shown in Fig. 4, significant upregulation of miRNA-15a (3.7 folds) was observed in the synchronized cells at 24 h postinfection as compared to that in mock-infected cells. [score:3]
The synchronized PK15 cells were transfected with miRNA-15a mimics/inhibitor or negative control (miRNA-NC) (GenePharma, sequence: CAGUACUUUUGUGUAGUACAA) at a final concentration of 30–40 nmol/l using Lipofectamine 2000 (Invitrogen) following the manufacturer’s procedure. [score:3]
The supernatants from PCV2-infected miR-15a inhibitor -treated cells were further collected for determination of virus production. [score:3]
Collectively, these results suggested that miR-15a targets cyclin E mRNA at 3′ UTR. [score:3]
The public miRNA database (RNAhybrid 2.2) predicted that cyclin E might be a target for miR-15a, with a highly conserved binding site occurring at the 3′ UTR of Sus scrofa cyclin E (position 1786 to 1794) (Sus scrofa cyclin E, XM_003127005) mRNA for miR-15a (NR_035364). [score:3]
Knowledge of the role of miRNA-15a in regulating cell cycle control will provide important information for understanding the molecular mechanism of PCV2 infection. [score:2]
miR-15a regulates PCV2 -induced G0/G1 phase cell cycle arrest. [score:2]
In addition, we used pGL3-control-CCNE (mutant) plasmid (Fig. 5A) to transfect PCV2-infected cells and found that the relative luciferase activity of the PCV2-infected cells was not obviously changed, regardless of co-transfection with miR-NC, miR-15a inhibitor, or miR-15a mimics, as compared to that in mock-infected miR-NC -treated cells (Fig. 5B). [score:2]
For miR-15a mimics treatment, expression of ORF2 protein was slightly increased when compared to that in the PCV2 alone-infected cells (Fig. 6A). [score:2]
PCV2 -induced G0/G1 cell cycle arrest may be regulated by host miRNA-15a via mediating cyclins D1 and E degradation, in which enhances PCV2 growth. [score:2]
Synchronized PK15 cells were mock infected or infected with PCV2 at an MOI of 1. At 24 h postinfection, expression levels of miR-15a and miR-16 as well as miR-21 and miR-34a were assayed by qRT-PCR. [score:2]
To investigate miR-15a function in PCV2-infected PK15 cells, we purchase miRNA-15a mimics and inhibitor from GenePharma Co. [score:1]
How to cite this article: Quan, R. et al. Involvement of miR-15a in G0/G1 Phase Cell Cycle Arrest Induced by Porcine Circovirus Type 2 Replication. [score:1]
We have not found the complete 3′ UTR of Sus scrofa cyclin D1 (CCND1) and cannot predict whether Sus scrofa CCND1 possesses a highly conserved binding site, but the binding site to miR-15a was found to occur at other species such as the 3′ UTR of Gallus gallus cyclin D1 (position 1816–1823), and this binding site is highly homology to that in the 3′ UTR of sus scrofa cyclin E (position 1786 to 1794). [score:1]
G0/G1-phase populations were slightly increased in the PCV2-infected cells after treatment with miR-15a mimics (Fig. 5C). [score:1]
miR-15a promotes PCV2 growth. [score:1]
Thus, we wanted further to assess the effects of miR-15a on PCV2 replication. [score:1]
Therefore, dual luciferase reporter assay was performed to only investigate whether miR-15a directly target the 3′ UTR of cyclin E mRNAs. [score:1]
[1 to 20 of 40 sentences]
2
[+] score: 28
miR-15a and miR-195 are members of miR-15/16/195 family with up-regulated expression response to GnRH. [score:6]
Let-7, miR-15 and miR-133 families possessed at least two members, more interestingly, these miRNAs shared similar expression profile (up-regulated). [score:6]
Bottoni reported that miR-15a and miR-16-1 were down-regulated in pituitary adenomas [44]. [score:4]
Further studies demonstrated that miR-15a, miR-16-1, as well as miR-195 were important regulators of the cell cycle by targeting BCL2, DLEU2 [45], [46]. [score:4]
Microarray revealed a total of 31 differentially expressed miRNAs, most of which had been detected in pig pituitary anterior lobe with high abundance in our previous study [20], such as let-7a, let-7c, miR-361-5p, miR-320, miR-21, miR-22, miR-152 and miR-15a. [score:3]
Among all differentially expressed miRNAs, miR-133, miR-15/195 and let-7 families had two members. [score:3]
h CAAAUGC ssc-miR-19b 1.50 miR-19 GUGCAAA ssc-miR-183 1.47 miR-183 AUGGCAC ssc-miR-423-3p 1.46 miR-423/423-3p GCUCGGU ssc-miR-206 1.46 miR-1/206 GGAAUGU ssc-miR-15a 1.42 miR-15/16/195/424/497 AGCAGCA ssc-miR-22-5p 1.39 miR-22-5p/3568 GUUCUUC ssc-miR-133a-3p 1.39 miR-133 UUGGUCC ssc-miR-340 1.37 miR-340/340-5p UAUAAAG ssc-let-7a 1.37 let-7/98 GAGGUAG ssc-miR-338 1.36 miR-338/338-3p CCAGCAU ssc-miR-361-5p 1.35 miR-361/361-5p UAUCAGA 10.1371/journal. [score:1]
h CAAAUGC ssc-miR-19b 1.50 miR-19 GUGCAAA ssc-miR-183 1.47 miR-183 AUGGCAC ssc-miR-423-3p 1.46 miR-423/423-3p GCUCGGU ssc-miR-206 1.46 miR-1/206 GGAAUGU ssc-miR-15a 1.42 miR-15/16/195/424/497 AGCAGCA ssc-miR-22-5p 1.39 miR-22-5p/3568 GUUCUUC ssc-miR-133a-3p 1.39 miR-133 UUGGUCC ssc-miR-340 1.37 miR-340/340-5p UAUAAAG ssc-let-7a 1.37 let-7/98 GAGGUAG ssc-miR-338 1.36 miR-338/338-3p CCAGCAU ssc-miR-361-5p 1.35 miR-361/361-5p UAUCAGA 10.1371/journal. [score:1]
[1 to 20 of 8 sentences]
3
[+] score: 20
Among all unique qPCR candidates, miR-15a represents an exclusive profile of very low expression in the control sample, followed by remarkable up-regulation (p-value =1 E-08) in all 3 samples originating from the infection study. [score:6]
The miRNA candidates assayed by RT-qPCR are found to target multiple mRNAs as shown in Table  6. Two out of 13 microRNAs (miR-15a, miR-155) included in Table  6 are predicted to target more than 20 different mRNAs. [score:4]
No significant difference of the miR-15a expression has been detected between the infected samples (visually unaffected, demarcation zone, necrotic), which is also reflected in the RNAseq results. [score:3]
Most of the miRNA candidates are falling into highly abundant or up/down regulated microRNAs in the necrotic sample, however the two miRNAs: miR-15a and miR-155 were chosen due to their biological relevance as reported in the literature disregarding their rather low read count (). [score:2]
Of the miRNAs investigated in the present study, miR15a, miR21, miR126, miR142-5p, miR144-5p, miR146a-5p, miR148a, miR152, miR155, miR192, miR-223, miR-45 and miR-d5 are 5'-miRNAs hence only the mature miRNAs of these targets were detected. [score:1]
The remaining microRNA candidates namely: miR-15a, -142-5p, -144, -451 and −664 were not previously described as important in response to infectious pathogen lung infection. [score:1]
The ncRNAs chosen for RT-qPCR validation were: miR-15a, miR-21, miR-126, miR-142-5p, miR-143-3p, miR-144*, miR-146a-5p, miR-148a, miR-155, miR-223, miR-451, miR-664-5p, miR-d5 and SNORD15. [score:1]
Moreover, miR-664-5p, miR-451 and miR-15a appear as very promising candidates for microRNAs involved in response to pathogen infection. [score:1]
control, showing no differences between the different sampled areas from infected lung (miR-15a). [score:1]
[1 to 20 of 9 sentences]
4
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, hsa-mir-215, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-mir-15b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-143, hsa-mir-152, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-184, hsa-mir-200c, hsa-mir-155, hsa-mir-29c, hsa-mir-200a, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-451a, ssc-mir-125b-2, ssc-mir-148a, ssc-mir-15b, ssc-mir-184, ssc-mir-224, ssc-mir-23a, ssc-mir-24-1, ssc-mir-26a, ssc-mir-29b-1, ssc-let-7f-1, ssc-mir-103-1, ssc-mir-21, ssc-mir-29c, hsa-mir-486-1, hsa-mir-499a, hsa-mir-671, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-29a, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-499, bta-mir-99a, bta-mir-125b-1, bta-mir-126, bta-mir-181a-2, bta-mir-27b, bta-mir-31, bta-mir-15b, bta-mir-215, bta-mir-30e, bta-mir-148b, bta-mir-192, bta-mir-200a, bta-mir-200c, bta-mir-23a, bta-mir-29b-2, bta-mir-29c, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-mir-200b, bta-let-7a-1, bta-mir-342, bta-let-7f-1, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-15a, bta-mir-99b, hsa-mir-664a, ssc-mir-99b, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-16-2, ssc-mir-16-1, bta-mir-141, bta-mir-143, bta-mir-146a, bta-mir-152, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-223, bta-mir-224, bta-mir-26a-1, bta-mir-296, bta-mir-29d, bta-mir-378-1, bta-mir-451, bta-mir-486, bta-mir-671, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, ssc-mir-181a-1, ssc-mir-215, ssc-mir-30a, bta-mir-2318, bta-mir-2339, bta-mir-2430, bta-mir-664a, bta-mir-378-2, ssc-let-7a-1, ssc-mir-378-1, ssc-mir-29a, ssc-mir-30e, ssc-mir-499, ssc-mir-143, ssc-mir-10b, ssc-mir-486-1, ssc-mir-152, ssc-mir-103-2, ssc-mir-181a-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-99a, ssc-mir-148b, ssc-mir-664, ssc-mir-192, ssc-mir-342, ssc-mir-125b-1, oar-mir-21, oar-mir-29a, oar-mir-125b, oar-mir-181a-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-296, ssc-mir-155, ssc-mir-146a, bta-mir-148c, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-486-2, hsa-mir-664b, hsa-mir-378j, ssc-let-7f-2, ssc-mir-29b-2, ssc-mir-31, ssc-mir-671, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, oar-let-7a, oar-let-7f, oar-mir-103, oar-mir-10b, oar-mir-143, oar-mir-148a, oar-mir-152, oar-mir-16b, oar-mir-181a-2, oar-mir-200a, oar-mir-200b, oar-mir-200c, oar-mir-23a, oar-mir-26a, oar-mir-29b-1, oar-mir-30a, oar-mir-99a, bta-mir-664b, chi-let-7a, chi-let-7f, chi-mir-103, chi-mir-10b, chi-mir-125b, chi-mir-126, chi-mir-141, chi-mir-143, chi-mir-146a, chi-mir-148a, chi-mir-148b, chi-mir-155, chi-mir-15a, chi-mir-15b, chi-mir-16a, chi-mir-16b, chi-mir-184, chi-mir-192, chi-mir-200a, chi-mir-200b, chi-mir-200c, chi-mir-215, chi-mir-21, chi-mir-223, chi-mir-224, chi-mir-2318, chi-mir-23a, chi-mir-24, chi-mir-26a, chi-mir-27b, chi-mir-296, chi-mir-29a, chi-mir-29b, chi-mir-29c, chi-mir-30a, chi-mir-30e, chi-mir-342, chi-mir-378, chi-mir-451, chi-mir-499, chi-mir-671, chi-mir-99a, chi-mir-99b, bta-mir-378d, ssc-mir-378b, oar-mir-29b-2, ssc-mir-141, ssc-mir-200b, ssc-mir-223, bta-mir-148d
Through target prediction analysis, growth hormone receptor (GHR) was determined to be targeted by miR-15a and functional analyses with a mammary epithelial cell line confirmed that miR-15a inhibited the expression of caseins, epithelial cell number as well as the expression of GHR mRNA and protein (Li et al., 2012e). [score:11]
MiR-15a decreases bovine mammary epithelial cell viability and lactation and regulates growth hormone receptor expression. [score:3]
From lung tissue of pigs infected with Actinobacillus pleuropneumoniae, Podolska et al. (2012) identified miR-664-5p, miR-451, and miR-15a as promising miRNA candidates involved in response to bacterial infection. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 13
Common to all five miRNAs found to correlate negatively with apoptosis-related gene expression (ssc-miR-15a, ssc-miR-18a, ssc-miR-21, ssc-miR-29b, and hsa-miR-590-3p) is that they were significantly up-regulated on day 3 after challenge, and not regulated at other time points. [score:7]
This negative correlation between miRNA expression and their target transcripts thus suggest the specific involvement of ssc-miR-15a, ssc-miR-18a, ssc-miR-21, ssc-miR-29b, and hsa-miR-590-3p in the modulation of important signaling cascades of apoptosis and viral recognition. [score:5]
These include ssc-miR-7 [56], ssc-miR-15a [26], ssc-miR-18a [26, 56], ssc-miR-21 [55, 56], mmu-miR-34b-3p [26], ssc-miR-34c [26], ssc-miR-92b-3p [26], ssc-miR-193a-3p [55], hsa-miR-449a [26], and ssc-miR-671-3p [26]. [score:1]
[1 to 20 of 3 sentences]
6
[+] score: 10
Maudet et al. demonstrated that several members of the miR-15 miRNA family were down-regulated during Salmonella infection due to the inhibition of the transcription factor E2F1 [16]. [score:6]
Analysis of the miR-15 family targets revealed that de-repression of CCND1 and the consequent promotion of G1/S transition are crucial for Salmonella intracellular proliferation. [score:3]
In addition to miR-146 and miR-155, the let-7, miR-15, miR-128 and miR-29a also have roles in Salmonella infection. [score:1]
[1 to 20 of 3 sentences]
7
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-150, mmu-mir-24-1, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-204, hsa-mir-210, hsa-mir-221, hsa-mir-222, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-150, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-326, mmu-mir-107, mmu-mir-17, mmu-mir-210, mmu-mir-221, mmu-mir-222, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-30e, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, ssc-mir-125b-2, ssc-mir-24-1, ssc-mir-326, ssc-mir-27a, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-204, ssc-mir-21, ssc-mir-30c-2, ssc-mir-9-1, ssc-mir-9-2, hsa-mir-378d-2, hsa-mir-103b-1, hsa-mir-103b-2, ssc-mir-17, ssc-mir-30b, ssc-mir-210, ssc-mir-221, ssc-mir-30a, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-30d, ssc-mir-30e, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-222, ssc-mir-125b-1, hsa-mir-378b, hsa-mir-378c, ssc-mir-30c-1, ssc-mir-378-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, ssc-let-7a-2, hsa-mir-378j, mmu-mir-21b, mmu-let-7j, mmu-mir-378c, mmu-mir-21c, mmu-mir-378d, mmu-mir-30f, ssc-let-7d, ssc-let-7f-2, ssc-mir-9-3, ssc-mir-150-1, ssc-mir-150-2, mmu-let-7k, ssc-mir-378b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Cai et al. (2014) found that 18 miRNAs were differentially expressed between intact and castrated male pigs, including miR-15a, miR-21, miR-27, miR-30, and so on [23]; Bai et al. (2014) reported that 177 miRNAs had more than 2-fold differential expression between castrated and intact male pigs, including miR-21, miR-30, miR-27, miR-103, and so on [22]. [score:5]
We found 13 adipogenesis-promoting miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) target 860 lncRNA loci. [score:3]
We analyzed the relationship between the 343 identified lncRNAs with the 13 promoting adipogenesis miRNAs (let-7、miR-9、miR-15a、miR-17、miR-21、miR-24、miR-30、miR-103、miR-107、miR-125b、miR-204、miR-210、and miR-378) and five depressing adipogenesis miRNAs (miR-27, miR-150, miR-221, miR-222, and miR-326). [score:1]
[1 to 20 of 3 sentences]
8
[+] score: 9
Using target site prediction, AQP11 was identified as a target of miR-15a/16 in many species including human, rat and mouse. [score:5]
We found that SNPs located on SSC9 associated with Aquaporins (AQP11) and miR-15a/16a. [score:1]
For example, miR-34a correlated with IP, and TCHO or miR-204, miR-15a, miR-16b correlated with TG. [score:1]
miR-15a, however, has not been located in the pig genome. [score:1]
In the present study, miR-15a was also found to be negatively correlated with TG and TCHO. [score:1]
[1 to 20 of 5 sentences]
9
[+] score: 8
Secondly, targets for a sub-set of down-regulated miR (miR-15, miR-16, miR-27, miR-29, miR-34 and miR-106), of which 44 targets were identified based on our previous criteria were predicted (see Additional file 4). [score:8]
[1 to 20 of 1 sentences]
10
[+] score: 6
In our study, prv-miR-6, prv-miR-15, prv-miR-16, prv-miR-LLT-1, prv-miR-LLT-7, prv-miR-LLT-9 and prv-miR-LLT-11 are predicted to target the 3’ UTR of the PRV trans-activator IE180. [score:3]
prv-miR-5, prv-miR-15, prv-miR-16, prv-miR-17, prv-miR-22, prv-miR-23, prv-miR-25, prv-miR-LLT-1, prv-miR-LLT-3, prv-miR-LLT-7, prv-miR-LLT-8 and prv-miR-LLT-11 were predicted to target the LLT region that serves as the large latency transcript of the PRV. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 5
Likewise, miR-448 and miR-15a were reported as potential inhibitors of adipogenesis, by suppressing Kruppel-like factor 5 (KLF5) [27] and promoting proliferation [28], respectively, while other miRNAs can accelerate adipocyte differentiate, such as miR-103 and miR-143 [29]. [score:5]
[1 to 20 of 1 sentences]
12
[+] score: 5
Many studies have demonstrated that miRNA expression profiles are subject to change in different cells when stimulated by LPS via TLR-signaling pathways, including miR-146a, miR-155, miR-132, miR-15a/16, miR-27a and miR-532-5p [19, 20, 21, 22, 23]. [score:3]
Moon H. G. Yang J. Zheng Y. Jin Y. miR-15a/16 regulates macrophage phagocytosis after bacterial infection J. Immunol. [score:2]
[1 to 20 of 2 sentences]
13
[+] score: 4
For example, miR-15 and miR-16 were found to be down-regulated in pituitary adenomas and correlated with the secretion of P43, a precursor of the inflammatory cytokine endothelial monocyte-activating polypeptide II [29]. [score:4]
[1 to 20 of 1 sentences]
14
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Similarly, we found all members of the miR-15, miR-16, miR-18 and miR-133 families in our sequences, suggesting that all members belonging to these miRNA families are expressed in these three (heart, liver and thymus) tissues. [score:3]
[1 to 20 of 1 sentences]
15
[+] score: 3
CCR7, for example, is involved in cytokine-cytokine receptor interaction and was identified as a potential target of let-7g, miR-15a, miR-98 and miR-331. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
MiR-15a and miR-15b modulate the cellular ATP levels [15, 16]. [score:1]
MiR-210, miR-15 and miR-338 were highly correlated to the concentration of ADP and ATP in muscle cells. [score:1]
569 AMP miR-10, miR-126, let-7, miR-27, miR-450 9.860E-05–5.804E-04 0.789–0.730 ADP miR-15, miR-885, miR-322, miR-450, miR-338 1.316E-04–4.540E-03 0.781–0.636 ATP miR-15, miR-450, miR-210, miR-885, miR-451 4.811E-04–9.562E-03 0.737–0.593 Correlations between gene expression derived from post quality-filtered 17,820 mRNA probes and each phenotypic- trait were calculated for both Duroc and PiNN pigs. [score:1]
[1 to 20 of 3 sentences]
17
[+] score: 3
We found that miRNAs with higher expression in WBCs includes different miRNA families: mir-15, mir-17, mir-181, mir-23, mir-27 and mir-29 families. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 2
Other miRNAs from this paper: ssc-mir-122, ssc-mir-135-1, ssc-mir-135-2, ssc-mir-148a, ssc-mir-19a, ssc-mir-20a, ssc-mir-224, ssc-mir-24-1, ssc-mir-323, ssc-mir-140, ssc-mir-183, ssc-mir-214, ssc-mir-27a, ssc-mir-325, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-103-1, ssc-mir-107, ssc-mir-136, ssc-mir-153, ssc-mir-18a, ssc-mir-186, ssc-mir-196a-2, ssc-mir-204, ssc-mir-21, bta-mir-18b, bta-let-7f-2, bta-mir-101-2, bta-mir-103-1, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-21, bta-mir-221, bta-mir-27a, bta-mir-27b, bta-mir-107, bta-mir-140, bta-mir-20b, bta-mir-215, bta-let-7d, bta-mir-17, bta-mir-186, bta-mir-199b, bta-mir-210, bta-mir-214, bta-mir-450a-2, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-15a, bta-mir-19a, bta-mir-204, ssc-mir-17, ssc-mir-199b, ssc-mir-210, ssc-mir-221, bta-mir-101-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-135a-2, bta-mir-135a-1, bta-mir-135b, bta-mir-136, bta-mir-146b, bta-mir-153-1, bta-mir-153-2, bta-mir-183, bta-mir-24-1, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-224, bta-mir-323, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-450a, ssc-mir-146b, ssc-mir-215, bta-mir-1343, bta-mir-2320, bta-mir-2326, bta-mir-2366, bta-mir-2411, bta-mir-2483, bta-mir-450a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-103-2, ssc-mir-27b, ssc-mir-24-2, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-450c, ssc-mir-133a-2, ssc-let-7a-2, ssc-mir-18b, ssc-mir-1343, ssc-mir-2320, bta-mir-450b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-196a-1, ssc-mir-196b-2, ssc-mir-2366-1, ssc-mir-2366-2, ssc-mir-2411, ssc-mir-2483
For example, ssc-miR-153, miR-325, miR-135-1*, miR-135-2*, miR-146b*, miR-15a*, miR-215* and miR-323* were only identified in Large White, contrary to the patterns displayed by ssc-miR-101a-1*, miR-103*, miR-183*, miR-1a* and miR-210*, indicating that these miRNAs may function in the physiology or development of the backfat tissue. [score:2]
[1 to 20 of 1 sentences]
19
[+] score: 1
In addition, we identified 199, 127, 140, and 37 DE miRNAs in the 60/120, 120/150, 150/180, and 180/210 dpn comparisons, respectively, in M pig, among which nine miRNAs (ssc-miR-23a, ssc-miR-new-276, ssc-miR-142-3p, ssc-miR-142-5p, ssc-miR-499-5p, ssc-miR-15a, ssc-miR-new-386, ssc-miR-new-421, and ssc-miR-144) were common (S4 Fig and S7 Table). [score:1]
[1 to 20 of 1 sentences]
20
[+] score: 1
However, the highest number of significantly regulated miRNAs compared to before challenge was found at 14d pi, at which time point the infection had completely cleared (ssc-miR-15a, ssc-miR-29b, ssc-miR-29a, hsa-miR-449a, ssc-miR-186, ssc-miR-22-5p, ssc-miR-28-5p, hsa-miR-203a-3p, ssc-miR-146a-5p, hsa-miR-150-5p, ssc-miR-23b, hsa-miR-223-3p, hsa-miR-23a-3p, hsa-miR-16-5p). [score:1]
[1 to 20 of 1 sentences]