sort by

1 publications mentioning mml-mir-654

Open access articles that are associated with the species Macaca mulatta and mention the gene name mir-654. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 13
TableĀ 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCCmiRNAs regulate gene expression at the post-transcriptional level. [score:6]
TableĀ 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCC miRNAs regulate gene expression at the post-transcriptional level. [score:6]
In the Hh signalling pathway, we detected mir-495 and mir-383 for Gas1 and mir-654-5P for Gli3. [score:1]
[1 to 20 of 3 sentences]