sort by

11 publications mentioning bna-MIR169h

Open access articles that are associated with the species Brassica napus and mention the gene name MIR169h. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 30
The three nuclear factor Y subunit genes (SlNF-YA1/2/3) targeted by miR169 were also down-regulated. [score:6]
Similarly, the expression of miR169a and miR169c in Arabidopsis decreased under drought stress, and the miR169-target gene NFYA5, a member of the Arabidopsis family of CCAAT-box nuclear transcription factors functioning in drought resistance, was strongly induced (Li et al., 2008). [score:5]
However, miR169 was found to be up-regulated in rice and tomato under drought conditions (Zhao et al., 2007; Zhang et al., 2011). [score:4]
miR169, one of the most important miRNAs involved in drought stress, was down-regulated in our study. [score:4]
Indeed, only six miRNAs (miR156, miR169, miR171, miR395, miR399, and miR860), which were sequenced <50 times, were significantly differentially expressed between the drought stress and control treatments. [score:3]
Members of miR-169 family are induced by high salinity and transiently inhibit the NF-YA transcription factor. [score:3]
Over -expression of microRNA169 confers enhanced drought tolerance to tomato. [score:2]
Similar instances were found in other miRNA families, such as the miR156 (62,938–1,698,631 reads), miR167 (2785–240,853 reads), miR169 (8–2565 reads), and miR171 (6–592 reads) families. [score:1]
Briefly, the miR169 family was the most abundant, with 14 members distinguished by internal nucleotide differences in the CK, S, and D small -RNA libraries, and 6–7 members of the miR156, miR166, miR171, and miR395 families were also found. [score:1]
Many other miRNAs have also been shown to act under conditions of environmental stress, such as miR169 with high salt (Zhao et al., 2009), miR395 with sulfate starvation (Jones-Rhoades and Bartel, 2004), and miR398 with heavy metal toxicity (Sunkar et al., 2006). [score:1]
[1 to 20 of 10 sentences]
2
[+] score: 22
Other miRNAs from this paper: bna-MIR156a, bna-MIR171g, bna-MIR396a, bra-MIR824, bna-MIR824, bna-MIR397a, bna-MIR397b, bna-MIR390a, bna-MIR390b, bna-MIR390c, bna-MIR171a, bna-MIR171b, bna-MIR171c, bna-MIR171d, bna-MIR171e, bna-MIR171f, bna-MIR169a, bna-MIR169b, bna-MIR169c, bna-MIR169d, bna-MIR169e, bna-MIR169f, bna-MIR169g, bna-MIR169i, bna-MIR169j, bna-MIR169k, bna-MIR169l, bna-MIR169m, bna-MIR168a, bna-MIR167a, bna-MIR167b, bna-MIR167c, bna-MIR166a, bna-MIR166b, bna-MIR166c, bna-MIR166d, bna-MIR164a, bna-MIR159, bna-MIR156b, bna-MIR156c, bra-MIR1885a, bra-MIR157a, bra-MIR159a, bra-MIR160a, bra-MIR164a, bra-MIR167a, bra-MIR167b, bra-MIR167c, bra-MIR167d, bra-MIR171a, bra-MIR171b, bra-MIR171c, bra-MIR171d, bra-MIR171e, bra-MIR172a, bra-MIR172b, bna-MIR2111b, bna-MIR2111a, bra-MIR2111a, bra-MIR1885b, bna-MIR156d, bna-MIR156e, bna-MIR156f, bna-MIR156g, bna-MIR160a, bna-MIR160b, bna-MIR160c, bna-MIR160d, bna-MIR164b, bna-MIR164c, bna-MIR164d, bna-MIR166f, bna-MIR166e, bna-MIR167d, bna-MIR168b, bna-MIR169n, bna-MIR172d, bna-MIR172b, bna-MIR172c, bna-MIR172a, bna-MIR394a, bna-MIR394b, bna-MIR395a, bna-MIR395b, bna-MIR395c, bna-MIR395d, bna-MIR395e, bna-MIR395f, bna-MIR403, bna-MIR860, bna-MIR2111d, bna-MIR2111c, bra-MIR408, bra-MIR158, bra-MIR156a, bra-MIR156b, bra-MIR156c, bra-MIR156d, bra-MIR156e, bra-MIR156f, bra-MIR156g, bra-MIR168b, bra-MIR168c, bra-MIR168a, bra-MIR319, bra-MIR390, bra-MIR391, bra-MIR395d, bra-MIR395b, bra-MIR395c, bra-MIR395a, bra-MIR396, bra-MIR400, bra-MIR403, bra-MIR860, bra-MIR164b, bra-MIR164d, bra-MIR164c, bra-MIR164e, bra-MIR172c, bra-MIR2111, bra-MIR172d
Comparing our putative targets to Xu et al. [16] and Zhou et al. [15], we found significant overlap among them based on the annotations of target genes, including miR156 targets (SPLs), miR167 targets (ARFs), miR159 targets (MYBs), miR169 targets (NF-Y subunits), miR164 targets (NAC-domain proteins) and miR172 targets (AP2-like transcription factors). [score:17]
Previous reports suggested the potential involvement of miR156, miR160, miR169, and miR396 in seed development, dormancy, and germination [53]. [score:2]
As shown in Additional file 5: Figure S1, the MIR159, MIR319 and MIR169 precursor loci as well as newly identified putative novel MIRNA loci MIR5801 and MIR5810 (Additional file 6: Figure S2) can be folded into a long stem-loop structure and generated multiple distinct sRNAs. [score:1]
Following the above filtering, we identified 10 putative novel MIRNA loci for 13 out of the 78 presumed miRNA sequences and several conserved miRNA variants including miR400, miR169 and miR395. [score:1]
These included a cluster containing three MIR156 genes (bra-MIR156f, k, r) on chromosome A06 within a 1000 bp region; a MIR169 cluster as well as a MIR395 cluster, also on chromosome A06. [score:1]
[1 to 20 of 5 sentences]
3
[+] score: 21
Furthermore, the downregulation of ath-miR169 a/b/c was reported [55] in wild-type Arabidopsis due to drought stress, while transgenic Arabidopsis plants overexpressing ath-miR169a showed enhanced leaf water loss and susceptibility to drought. [score:6]
ath-miR169 is known to target mRNAs of genes that encode members of CCAAT binding TF, as well as allowing the expression of Nuclear Factor Y (NFY) [58], which has important implications in stress responses [55]. [score:5]
The expression of ath-miR169 was found to be increase at 20 dpi. [score:3]
In contrast, the miR169 family was increased in rice (Oryza sativa) during drought stress [56], and the overexpression of miR169 (sly-miR169c) in transgenic tomato led to decreased transpiration rate and enhanced drought tolerance [57]. [score:3]
| target_5′ UGGGAAGUCAUCCUUGGCUCA miRNA_3′ UCCGUUCAGUAGGAACCGAU ath-miR169h |||. [score:3]
A similar increase in abundance of the ath-miR169 has been reported following pathogen attack in the Arabidopsis [24] as well as in response to osmotic stress in rice [31], [41]. [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 17
Among them, Bna-miR159, Bna-miR166a, Bna-miR164, Bna-miR171f and Bna-miR168 had relatively high number of reads, indicating that these miRNAs are likely to be expressed at a higher level, whereas Bna-miR169 family members had a low number of reads, and are, therefore, likely to be expressed at a lower level (Additional file 4: Table S1). [score:5]
NF-YA transcription factor genes were validated as targets of for miR169 family numbers. [score:3]
The AtNF-YA5 transcription factor, whose transcript is a target of miR169, has been implicated in drought stress responses in Arabidopsis[64]. [score:3]
Over -expression of a miR169-resistant AtNF-YA5 transgene significantly improves drought resistance by promoting stomatal closure under drought stress [64]. [score:3]
NF- YA mRNAs were identified as targets of miR169 in B. napus (Table  4). [score:3]
[1 to 20 of 5 sentences]
5
[+] score: 9
At least six other miR169 targets were predicted to exist in the AtNF-YA family [24]. [score:3]
In rice, an NF-YA gene (Os03g29760) known to be a target of the miR169 family was found to be induced by high salinity [14]. [score:3]
In addition, several members of the NF-Y family were shown to be regulated by the microRNA169 (miR169) family, suggesting that a complex regulatory cascade is activated under stress conditions [13], [14], [23]. [score:3]
[1 to 20 of 3 sentences]
6
[+] score: 7
Ten members of the miRNA169 family and four members of the miRNA172 family target BnPYR1-2, and 10 members of the miRNA169 family target BnPYR1-4. Notably, miR169 plays important roles in A. thaliana by targeting genes related to drought stress [42]. [score:7]
[1 to 20 of 1 sentences]
7
[+] score: 6
Both miR156 and miR169 have been earlier reported to be significantly up-regulated post infection with fungal phytopathogens such as Dothiorella gregaria and Botrytis cinerea [65– 66]. [score:4]
Among the conserved lncRNA families, four families (tRNA, snoR71, mir156 and mir169) accounted for more than 10 members. [score:1]
Five lncRNAs (TCONS_00012499; TCONS_00004577; TCONS_00015411; TCONS_00004034 and TCONS_00009614) served as precursor for miR156, while another five lncRNAs (TCONS_00006568; TCONS_00018692; TCONS_000017152; TCONS_00008591; TCONS_000010926) were precursors for miR169 (Fig 4). [score:1]
[1 to 20 of 3 sentences]
8
[+] score: 6
Interestingly, some of the targets from the differentially abundant MIR156, MIR167, MIR169, MIR171, MIR319 and MIR396 were related to lipid metabolism (Table S6). [score:3]
MIR165/166 (21 members), MIR169 (15 members) and MIR319 (14 members) were the second, third and fourth largest miRNA families, respectively. [score:1]
On the contrary, some members of MIR156/157, MIR169, MIR319, MIR390, MIR391, MIR403, MIR824 and MIR1885 were more represented in mature seeds than in developing seeds (Figure 3b). [score:1]
Some members of MIR156/157, MIR162, MIR164, MIR168, MIR169, MIR172, MIR393, MIR395, MIR396, MIR398, MIR399, MIR828 and MIR1140 were more represented in developing seeds than in mature seeds (Figure 3b). [score:1]
[1 to 20 of 4 sentences]
9
[+] score: 5
Of these, five conserved MIRNAs (e. g. members of the miR169 and miR172 families) were obviously lost due to sequence deletions or mutations as revealed by comparative genome analysis between B. napus and it two progenitors (Table 2; an example of miR169 member is shown in Fig. 4a). [score:2]
The deletion of seveval bases on chromosome A08 of B. napus, which caused the loss of one member of miR169 family in B. napus. [score:1]
In addition, a significant expansion of a few conserved miRNA families, such as miR156, miR160, and miR169, have obviously enlarged the number of miRNAs in B. napus (Supplementary Table S10), but these expansions have mostly occurred before the AA-CC hybridization, as such expansion events could also be observed in the two progenitor genomes (Supplementary Table S10). [score:1]
A significant expansion of several miRNA families, including miR156, miR160, and miR169 in B. napus, was observed (Supplementary Table S10). [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 4
The miR169 family was highly expressed in young leaves and stems but not in roots and mature leaves, supporting the hypothesis that miR169 plays an important role in development [12]. [score:4]
[1 to 20 of 1 sentences]
11
[+] score: 1
Although the same applies to ml-siRNAs of the miR169 and miR822 precursors according to our data, Zhang et al. (2010) found ml-siRNAs located on either side of miR822. [score:1]
[1 to 20 of 1 sentences]