sort by

83 publications mentioning hsa-mir-1246

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-1246. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 317
The following criteria were used to identify the possible miR-1246 or miR-1290 target genes: (1) genes downregulated >1.5-fold on miR-1246 or miR-1290 overexpression in NuLi-1 cells, and (2) genes upregulated >1.5-fold on miR-1246 or miR-1290 downregulation in A549 cells. [score:14]
HumanHT-12 v4 Expression BeadChip (Illumina) was used to identify the genes upregulated in A549 knocking down miR-1246 or miR-1290, and genes downregulated in NuLi-1 overexpressing miR-1246 or miR-1290. [score:12]
MT1G is a target of miR-1246 and miR-1290 that inhibit TICsBecause miRNAs are well-known to regulate the activities of downstream targets, which in turn, control the behaviour of a cell, we sought to identify genes that might be directly targeted by miR-1246 or miR-1290. [score:11]
metallothioneins expression was inversely correlated with both miR-1246 (Fig. 6g) and CD166 expression (Fig. 6h), providing an indication that metallothionein expression was repressed in lung TICs which tend to express the miR-1246 and CD166. [score:9]
While we identified the putative tumour suppressor, MT1G, as a common target for miR-1246 and miR-1290, one could not exclude the possibility that other miRNA target genes could also contribute towards the inhibition of tumorigenicity. [score:9]
To do so, we performed whole-transcriptome analyses after knocking down miR-1246 or miR-1290 in A549, a metastatic lung cancer cell line, which expressed high levels of the miRNAs, as well as after overexpressing miR-1246 or miR-1290 in NHBE, a normal lung epithelial cell line not expressing the miRNAs. [score:8]
Because miRNAs are well-known to regulate the activities of downstream targets, which in turn, control the behaviour of a cell, we sought to identify genes that might be directly targeted by miR-1246 or miR-1290. [score:7]
The top downregulated lung TIC -associated miRNAs include miR-23a, miR-130a, let-7 family, miR-513a-5p, miR-125b and miR-29a, whereas the top upregulated miRNAs include miR-1290, miR-130b, miR-1246, miR-630, miR-196a/b, miR-9/9* and miR-17∼92 cluster and its miR-106b∼25 analogues. [score:7]
If MT1G was a major target of both miRNAs, we tested whether MT1G overexpression could counter the effect of miR-1246 or miR-1290 expression. [score:7]
Since miRNAs are well-known to exert pleiotropic effects on a variety of gene targets, it is arguably more effective to inhibit miRNAs, owing to their potential for silencing other additional endogenous target mRNAs, as in the case of miR-1246 and miR-1290. [score:7]
Potential miR-1246 and miR-1290 targets were identified by using two sets of wide-transcriptome microarray profiles: NuLi-1 relative to NuLi-1 cells overexpressing miR-1246 or miR-1290 (Illumina humanHT12_V4), and A549 relative to A549 cells knocking down miR-1246 or miR-1290 (Illumina humanHT12_V4). [score:6]
Indeed, the concomitant administration of LNAs against miR-1246 and miR-1290 in mice bearing the pre-established tumours could result in a greater inhibition of tumour growth, and suggested the utility of targeting both miRNAs together (Fig. 5f). [score:5]
A few of the top target genes, such as MT1G and GLIPR1 were, in fact, common targets of both miR-1246 and miR-1290, thus suggesting that they may play an important role in mediating the function of lung cancer cells. [score:5]
Similar to the expression patterns of miR-1246, miR-1290 and CD166, we also observed heterogeneous expression of metallothioneins within human lung tumour sections. [score:5]
Inhibition of either miR-1246 or miR-1290 significantly reduced their respective expression (Fig. 5a). [score:5]
Using seed sequence base-pairing analyses, we detected the duplex formations between human miR-1246 and miR-1290 with the 3′-untranslated region (UTR) of mRNAs that include MT1G (Fig. 6c), thereby highlighting the propensity of both miRNAs to target a common gene. [score:5]
MT1G, a common target of miR-1246 and miR-1290, inhibits tumour growth and metastasis. [score:5]
We next assessed whether the expression of miR-1246 and miR-1290 might be heterogeneous among the tumours of different NSCLC patients, and the implications for disease outcome. [score:5]
To confirm MT1G as a direct target of miR-1246 and miR-1290, we cloned its wild-type 3′-UTR, as well as made point mutations, and tagged them to a luciferase reporter vector. [score:5]
χ [2]-Analysis in NSCLC tissues showed a strong correlation between the intensity of miR-1246 expression and miR-1290 expression by ISH (P<0.001 by Student's t-test; Supplementary Fig. 2b). [score:5]
Primary tumours that contain high miR-1246 or miR-1290 expression tended to correlate with the detection of metastatic tumour cells within lymph nodes, whereas those expressing low levels of the miRNAs did not (Fig. 3a,b). [score:5]
MT1G is a target of miR-1246 and miR-1290 that inhibit TICs. [score:5]
LNA inhibitors against miR-1246 or miR-1290 (Exiqon) contained the following sequence: 5′- TGCTCCAAAAATCCAT -3′ or 5′- CCTGATCCAAAAATCC -3′, respectively, and the scramble LNA inhibitor control's sequence was: 5′- ACGTCTATACGCCCA -3′. [score:5]
When tumourspheres were transplanted into immune-compromised mice, those bearing knockdown of either miR-1246 or miR-1290 alone markedly inhibited tumour growth (Fig. 2c,d). [score:4]
Finally, the transplantation of these treated cells in limiting cell numbers into NSG mice clearly showed that the TS cells containing MT1G knock down remain tumorigenic even in the presence of miR-1246 or miR-1290 loss, thus confirming MT1G to be their major target (Fig. 6o). [score:4]
The pmiRZip-1246 and pmiRZip-1290 in miRZip-copGFP lentiviral vector (System Biosciences) to stably knockdown miR-1246 or miR-1290 expression was used following the manufacturer's instructions and contained the following shRNA sequence: 5′- AAUGGAUUUUUGGAGCAGG -3′ or 5′- UGGAUUUUUGGAUCAGGGA -3′, respectively. [score:4]
We chose to focus on miR-1246 and miR-1290 because they represent the topmost upregulated miRNAs among our TIC miRNA signature, and could be important drivers for cancer progression. [score:4]
Patients bearing tumours with higher miR-1246 expression, as assessed by staining intensity, showed elevated subdistribution hazard ratio compared with those harbouring tumours with lower miR-1246 expression (2.85, 95% confidence interval 1.22–6.66) (Fig. 1h). [score:4]
For lentiviral overexpression or knockdown of miR-1246 or miR-1290, cells (tumoursphere, A549, NuLi-1 and HEK293) were infected with the lentiviral supernatant for 48 h in the presence of 8 μg ml [−1] polybrene (Sigma). [score:4]
To directly correlate the expression pattern of miR-1246 with CD166, we combined ISH and immunohistochemistry on the same tissue or tumour section. [score:4]
The outgrowth of tumours in the LNA -treated mice was largely inhibited, whereas control -treated mice continued to form large tumours, thereby indicating the therapeutic utility of silencing miR-1246 and miR-1290 in established tumours (Fig. 5e,f). [score:3]
How to cite this article: Zhang, W. C. et al. Tumour-initiating cell-specific miR-1246 and miR-1290 expression converge to promote non-small cell lung cancer progression. [score:3]
Heterogeneous expression of miR-1246 and miR-1290 in human NSCLC. [score:3]
Group 3 consisted of a single individual (Patient 220), who had stable disease, and no change in the serum levels of miR-1246 or miR-1290 was detected (Fig. 4d). [score:3]
In all, 66.7% (4/6) and 88.3% (5/6) of mice bearing miR-1246- and miR-1290 -overexpressing HEK293 cells, respectively, grew tumours, whereas none of the mice transplanted with control -treated cells formed tumours. [score:3]
To understand whether LNA targeting miR-1246 or miR-1290 would produce adverse side-effects in mice, we profiled the dynamic changes in albumin levels, as well as alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities, in mouse serum at different time points following LNA therapy at 8 mg kg [−1]. [score:3]
In human lung cancer patient cohorts, gene set enrichment analysis (GSEA) demonstrated a positive correlation between metastasis incidence and miR-1246 or miR-1290 expression in a variety of patient solid tumours that included lung adenocarcinoma (Supplementary Fig. 5). [score:3]
Although miR-1246 and miR-1290 expression are restricted to TICs, it remains unclear whether they are also associated with tumour grades. [score:3]
Here, we performed a longitudinal survey of circulating miR-1246 and miR-1290 in the same individuals to assess variation in their levels in response to ongoing EGFR tyrosine kinase inhibitor (TKI) treatment, which is a standard of care for NSCLC patients with tumours harbouring mutant EGFR. [score:3]
We then sought to correlate the expression of metallothioneins, which was classified as low or high based on immunohistochemistry, with either miR-1246 or CD166 protein level in a cohort of patient tumours. [score:3]
The highly enriched expression of miR-1246 and miR-1290 in lung CD166 [+] TICs, but not in CD166 [−] cells and normal lung epithelial cells, strongly suggests these two miRNAs to be crucial for tumour initiation and establishment. [score:3]
The pmiR-1246 and pmiR-1290 in pCDH-CMV-MCS-EF1-copGFP (CD511B-1) lentiviral vector (System Biosciences) to stably overexpress miR-1246 or miR-1290 was used following the manufacturer's instructions and contained the following sequence: 5′- AAUGGAUUUUUGGAGCAGG -3′ or 5′- UGGAUUUUUGGAUCAGGGA -3′, respectively. [score:3]
The sequences of the LNA targeting miR-1246 or miR-1290 were fully complementary to the mature miRNA sequence: 5′- TGCTCCAAAAATCCAT -3′ (LNA antimiR-1246) and 5′- CCTGATCCAAAAATCC -3′ (LNA antimiR-1290); the scrambled LNA control was 5′- ACGTCTATACGCCCA -3′ (LNA antimiR-ctrl). [score:3]
Because our initial evidence suggested that miR-1246 and miR-1290 could be restricted to lung TICs, we first sought to examine their expression patterns within human lung tumours as this serves to provide a clinically relevant context for studying their function. [score:3]
To compare the cellular expression of miR-1246 and CD166 protein, ISH and immunohistochemistry were first performed separately on serial sections of both malignant and normal lung tissues. [score:3]
MiR-1246 and miR-1290 targets prediction. [score:3]
Consistently, higher miR-1246 or miR-1290 expression in tumours was associated with shorter patient survival periods (P=0.007 and P=0.024 by log-rank test, respectively; Supplementary Fig. 1f,g). [score:3]
More importantly, the comparative expression of other miRNA candidates such as miR-130b, miR-23a and miR-125b, which were initially found to be also enriched in TICs, did not provide strong evidence that they were restricted to tumours, whereas miR-1246 and miR-1290 did (Supplementary Fig. 1e). [score:3]
Because tumours appear to depend on miR-1246 and miR-1290 to progress, we reasoned that the inhibition of these miRNAs might impact their growth. [score:3]
Taken altogether, our results demonstrated that miR-1246 and miR-1290 contribute towards lung cancer progression through acting on TIC populations, and more importantly, we provided a proof-of-concept principle that LNA approaches can be used to impact the behaviour of TICs by targeting miRNAs crucial for their function. [score:3]
Similarly, by analysing the miRNA sequencing -based expression of a far larger cohort of paired tumour and adjacent tissues deposited in The Cancer Genome Atlas (TCGA), we observed a highly significant elevation of miR-1246 in tumour samples, relative to adjacent tissues (Fig. 1f and Supplementary Table 2). [score:3]
Both miR-1246 and miR-1290 showed consistent upregulation in tumours compared with their adjacent non-neoplastic tissues (P<0.01 for miR-1246, P<0.01 for miR-1290 by unpaired t-test; Fig. 1e). [score:3]
More strikingly, overexpression of either miR-1246 or miR-1290 in non-tumorigenic CD166 [−] cancer cells was able to confer tumorigenic ability, as demonstrated by the formation of tumours when 100,000 cells were transplanted (Fig. 2m). [score:3]
Knocking down either miR-1246 or miR-1290 markedly reduced the tumoursphere-forming ability of TS cells as anticipated (Fig. 6n). [score:2]
Taken altogether, our results indicate that miR-1246 and miR-1290, which are enriched in TICs, have critical roles in regulating tumour growth and metastasis, in part, through the repression of metallothioneins, especially MT1G. [score:2]
After 5 weeks, metastatic nodules in the lungs and liver were markedly reduced on knockdown of either miR-1246 or miR-1290 in tumoursphere cells before tail-vein injection (Fig. 3e–j and Supplementary Fig. 4c). [score:2]
Both the migration (Fig. 3c,d) and invasion capabilities (Supplementary Fig. 4a,b) were markedly impaired on knockdown of either miR-1246 (zip1246) or miR-1290 (zip1290), thus suggesting that the miRNAs were necessary for the invasion, at least in vitro. [score:2]
To test this, we utilized highly specific miRZip lentiviral anti-miR-1246 and anti-miR-1290 to knockdown miR-1246 and miR-1290 in lung tumourspheres and assessed their tumorigenic potential in cell cultures and in mice. [score:2]
To confirm that the loss of miR-1246 or miR-1290 impacted tumour initiation, we transplanted TS cells that were knocked down for either miRNA in limiting dilution cell numbers. [score:2]
Conversely, knockdown of miR-1246 or miR-1290 in tumourspheres increased luciferase activity of wild-type MT1G 3′-UTR but not the mutant (Supplementary Fig. 6d). [score:2]
Using another independent lung cancer patient cohort for which we generated tumourspheres, and also purified for CD166 [+] cells, we indeed confirmed miR-1246 and miR-1290 expression to be elevated more than fivefold in CD166 [+] TICs, and increased 6 and 30 times, respectively, in the corresponding patient-derived tumourspheres when compared with either normal lung epithelial cells or CD166 [−] non-TICs (Fig. 1d). [score:2]
By in situ-hybridization (ISH) assay on tissue microarrays from a cohort of 143 patients (n=197 tumour cores; Fig. 1g), miR-1246 expression negatively correlated with patient survival (P=0.016 by log-rank test), while miR-1290 had a weaker correlation (P=0.082 by log-rank test; Fig. 1h and Supplementary Tables 3 and 4). [score:2]
MiR-1246 expression was predominantly restricted to CD166 [+] cells in primary NSCLC tumours, and largely absent in CD166 [−] tumour cells and normal lung epithelial cells (Supplementary Fig. 2a). [score:2]
However, when tumourspheres bearing either miR-1246 or miR-1290 knockdown were subjected to extended periods of culture in serum-free sphere-forming condition that selects for TICs and stem cells, their numbers were markedly reduced by at least 5.4-fold (Fig. 2a). [score:2]
We further sought to examine whether miR-1246 and miR-1290 were indeed directly mediating the metastasis of lung TICs in animal mo dels. [score:2]
Since we initially found miR-1246 to be enriched in flow cytometry purified CD166 [+] cells, we proceeded to verify whether the miRNA was also found within TICs present in patient tumour sections. [score:1]
On co-transfection of either miR-1246 or miR-1290 together with wild-type MT1G 3′-UTR reporters into HEK293 cells, the luciferase activities were reduced significantly (Fig. 6e). [score:1]
Overall, the results suggest that miR-1246 and miR-1290 could contribute towards the metastatic abilities of lung tumour cells. [score:1]
Using an unbiased approach to uncover TIC-specific miRNAs from patient-derived tumour cells and tumourspheres, we identified a miRNA signature containing two miRNAs, miR-1246 and miR-1290, both of which contribute towards tumour initiation and metastasis. [score:1]
Because lung TICs and cancer progression were dependent on miR-1246 or miR-1290, we assessed whether these miRNAs could confer tumorigenic potential to otherwise normal-like or non-tumorigenic cells. [score:1]
Concomitant increases in the serum miR-1246 and miR-1290 could be detected, thus suggesting their levels to be indicative of the patients' response to therapy. [score:1]
Taqman miRNA probes were as follow: hsa-miR-1246 (462575_mat), hsa-miR-1290 (002863), hsa-miR-130a (000454), hsa-miR-130b (000456), hsa-miR-196a (241070_mat), hsa-miR-196b (002215), hsa-miR-630 (001563), hsa-let-7b-5p (002619), hsa-let-7c (000379), hsa-let-7d-5p (002283), hsa-let-7i (002221), hsa-miR-106b (000442), hsa-miR-125b (000449), hsa-miR-23a (000399), hsa-miR-25 (000403), hsa-miR-320c (241053_mat), hsa-miR-3667-5p (462350_mat), hsa-513-5p (002090), hsa-miR-9* (002231). [score:1]
To test the oncogenic potential of miRNAs in more physiologically relevant cell systems, we introduced either miR-1246 or miR-1290 into immortalized human lung epithelial cells (NuLi-1). [score:1]
In all, 50 n M of LNA anti-miR-1246, anti-miR-1290 or negative control (Exiqon) with fluorescine and PureFection (System Biosciences) were applied for transfection. [score:1]
Interestingly, in mice bearing xenografted tumours that were treated with anti-miR-1246 or anti-miR-1290 LNAs (Fig. 5e), these small residual tumours had increased metallothionein protein level (Supplementary Fig. 7e). [score:1]
We first evaluated the utility of LNA against miR-1246 or miR-1290 in cell cultures by transfecting them into lung TICs expressing high levels of both miRNAs. [score:1]
Collectively, our data indicated that miR-1246 and miR-1290 play pivotal roles in mediating the spontaneous metastasis of primary tumour cells. [score:1]
To ascertain the impact of anti-miR-1246 and anti-miR-1290 LNA on pre-existing tumours, we first allowed tumours to form (5 mm in length) before treating mice with 8 mg kg [−1] LNA at 3–4-day intervals. [score:1]
In all, 100 ng of wild-type or mutant 3′-UTR reporter constructs of MT1G constructs (GeneCopoeia) were cotransfected with 100 ng of pCDH-miR-1246, pCDH-miR-1290, pmiRZip-1246, pmiRZip-1290 or scrambled control vectors into HEK293 or tumoursphere cells. [score:1]
This led us to wonder whether miR-1246 and miR-1290 could confer metastatic traits to lung tumour cells. [score:1]
Fold change of miR-1246 and miR-1290 levels is presented as box plot. [score:1]
MiR-1246, miR-1290 or metallothionein staining was independently scored by two anatomical pathologists (M. E. N and Y. H. P). [score:1]
Exogenous introduction of either miR-1246 or miR-1290 into immortalized human embryonic kidney cells (HEK293) modestly increased proliferation and colony formation in vitro (Fig. 2f–h and Supplementary Fig. 3e), but surprisingly, was able to confer on these otherwise non-tumorigenic cells and their tumorigenic potential, as gauged by the ability of the miRNA-bearing cells to form tumours efficiently (Fig. 2i). [score:1]
We first examined the serum levels of miR-1246 and miR-1290 from NSCLC patients and healthy individuals (n=124) by qRT–PCR. [score:1]
The concomitant depletion of MT1G in miR-1246- or miR-1290 -depleted cells could, at least in part, rescue the effect of miRNA loss. [score:1]
During this response period, serum levels of miR-1246 and miR-1290 reduced by 69–87% and 63–90%, respectively. [score:1]
MiR-1246- or miR-1290 -binding site 5′- AAATC -3′ was substituted with 5′- TTTAG -3′ in mutated MT1G. [score:1]
The median value of serum miR-1246 or miR-1290 levels in healthy individuals was normalized to 1. Data are represented as mean±s. [score:1]
MiR-1246 and miR-1290 are required for lung cancer metastasis. [score:1]
To assess their therapeutic utility in a physiologically relevant manner, LNAs against either miR-1246 or miR-1290 were introduced intraperitoneally into NSG mice bearing patient-derived lung tumour xenografts. [score:1]
The metastatic ability of lung TICs is dependent on miR-1246 and miR-1290. [score:1]
Nonetheless, our observations indicate miR-1246 and miR-1290 can behave as non-invasive biomarkers that may be exploited for the early detection of a broad spectrum of cancers (Supplementary Fig. 10). [score:1]
After washing, the sections were incubated with 20 n M LNA probes (5′-double-digoxigenin -labelled LNA probes specific for human miR-1246 (5′- cctgctccaaaaatccatt -3′), miR-1290 (5′- tccctgatccaaaaatcca -3′) or scrambled probe (5′- gtgtaacacgtctatacgccca -3′) (Exiqon)) in hybridization buffer (Roche) overnight at 55 °C. [score:1]
Genes repressed by miR-1246 include PRL36A, GLIPR1, HAS2, NCKAP5, MT1G and CYP4F11, whereas miR-1290 represses MT1G, MT1H, GLIPR1, CYP4F11 and NCKAP5, among others. [score:1]
Interestingly, this resulted only in a small decrease in colony numbers, indicating that the loss of miR-1246 and miR-1290 did not impact cell growth and proliferation under these cell culture conditions (Supplementary Fig. 3a–d). [score:1]
The LNA, however, completely abrogated tumour-initiation when 100 cells were transplanted, thereby demonstrating the in vivo impact of blocking miR-1246 and miR-1290 on tumour initiation (Fig. 5d). [score:1]
As an example, Patient 218 progressed on EGFR TKI as tumour grew by 41% on day 86; this was mirrored by increases in miR-1246 and miR-1290 levels. [score:1]
LNA (8 mg kg [−1]) against either miR-1246 or miR-1290 was administered at the same time as lung TIC implantation (1 × 10 [5] cells). [score:1]
MiR-1246 and miR-1290 confer tumorigenicity. [score:1]
For co-localization of miRNA-1246/miR-1290 and CD166 protein in FFPE tissues, the sections were stained with LNA probe by ISH followed by immunohistochemistry with anti-CD166 (Novaocastra). [score:1]
miR-1246 and miR-1290 contribute towards transformation and lung tumorigenesis. [score:1]
Of note, for the vast majority of patients in all four groups, serum levels of miR-1246 and miR-1290 showed a positive correlation with tumour size as well (Fig. 4b,c,e). [score:1]
In this example, the levels of miR-1246 appeared to better mirror the response of patient to therapy than that of miR-1290. [score:1]
The median values for miR-1246 and miR-1290 levels in normal tissues were normalized as 1; n=11. [score:1]
[1 to 20 of 104 sentences]
2
[+] score: 222
To assess whether a direct correlation exists between the expression patterns of mRNA and the target genes of miR-1246, we assessed the expression profile of the mRNA transcripts present in HEV71-infected SH-SY5Y cells, following transfection with the miR-1246 inhibitor, and control cells using a microarray assay based on the 35 K Human Genome Array. [score:9]
Together, all these results clearly demonstrated that the up-regulation of miR-1246 in response to HEV71 infection inhibited the expression of DLG3. [score:8]
miR-1246 Target the 3′-UTR of DLG3 To clarify the roles of host miR-1246 in HEV71 infection, miRanda and TargetScan databases were initially used to screen for potential targets of miR-1246 within HEV71 genome. [score:7]
Compared with the classical transcription factors, miR-1246 directly targeted the 3′-UTR of DLG3 mRNA (Fig. 7 ), and its expression was inversely correlated with DLG3 expression in HEV71-infected SH-SY5Y cells (Fig. 6 ). [score:7]
The potential target genes of miR-1246 were predicted using TargetScan6.0 online, and a total of 178 conserved target genes were shown in Table S4. [score:7]
Finally, to clarify the relationship between miR-1246 and DLG3 regulation in response to HEV71 infection, varying doses of miR-1246 inhibitor were transfected to inhibit the induction of miR-1246. [score:6]
These results ruled out the possibility that up-regulation of miR-1246 may facilitate or suppress viral replication. [score:6]
To clarify the roles of host miR-1246 in HEV71 infection, miRanda and TargetScan databases were initially used to screen for potential targets of miR-1246 within HEV71 genome. [score:5]
Among the 69 differentially expressed miRNAs, miR-1246 was expressed at significantly higher levels. [score:5]
Table S4 The predicted miRNA targets of miR-1246 by Targetscan Human 6.0. [score:5]
As shown in Fig. 7, the expression of DLG3 was significantly inhibited by miR-1246, while pGL3-DLG3-mut that destroyed the binding sites and vector control were not affected by miR1246 (p<0.001). [score:5]
Table S2 Up-regulated genes in SH-SY5Y cells infected with HEV71 after transfection miR-1246 inhibitor by mRNA microarray assay. [score:5]
Table S3 Down-regulated genes in SH-SY5Y cells infected with HEV71 after transfection miR-1246 inhibitor by mRNA microarray assay. [score:5]
b. DLG3 gene expression in HEV71-infected SH-SY5Y cells was analyzed by qRT-PCR following transfection with varying doses of miR-1246 inhibitor. [score:5]
The results showed that the suppression of DLG3 caused by HEV71 infection was significantly eliminated by the transfection of miR-1246 inhibitor in dose -dependent manner (Fig. 6B). [score:5]
As shown in Fig. S1, no significant difference was observed at 6 and 12 hpi with or without the miR-1246 inhibitor, indicating the inhibition of miR-1246 did not significantly affect HEV71 replication. [score:5]
miR-1246 has been shown to target the 3′-UTR sequence of the DYRK1A mRNA, resulting in a reduction in DYRK1A levels [59]; however, in our study, sequence analysis showed that this miRNA does not target the 3′-UTR or 5′-UTR of HEV71, which is in agreement with virus growth experiments (Fig. S1). [score:5]
Potential targets of miR-1246 were predicted using miRanda and TargetScan6.0. [score:5]
These results strongly indicated that miR-1246 was significantly up-regulated in HEV71-infected SH-SY5Y cells. [score:4]
As shown in Fig. 3A, PV-3 and CV-B5 significantly induced the up-regulation of miR-1246 in SH-SY5Y cells, as did HEV71. [score:4]
Together, these results indicated that the up-regulation of miR-1246 is a specific response to HEV71 infection in human neuroblastoma cells. [score:4]
Additionally, up-regulation of miR-1246 reduced the levels of disc-large homolog 3 (DLG3), which was associated with neurological disorders, particularly X-linked mental retardation (XLMR). [score:4]
The HEV71 -mediated up-regulation of miR-1246 reduced the levels of DLG3 protein in SH-SY5Y cells. [score:4]
The results showed that up-regulation of miR-1246 was only observed in HEV71-infected SH-SY5Y cells; no significant change was observed in RD cells, and only a slight change was observed in Vero cells at 12 hpi (Fig. 3B ). [score:4]
SH-SY5Y cells were infected with HEV71 followed by transfection with varying doses of miR-1246 inhibitor. [score:3]
As shown in Fig. 2, the expression levels of miR-125a significantly decreased, while miR-320b and miR-1246 significantly increased at 6 and 12 hpi; No significant change was observed for miR-1268 at either time points. [score:3]
SH-SY5Y Cells Infected with HEV71 after Transfection with miR-1246 Inhibitor. [score:3]
a. SH-SY5Y cells were infected with HEV71, PV-3, CV-B5, and JEV, respectively, and the expression of miR-1246 was detected by qRT-PCR. [score:3]
The expression of pLG3-DLG3 was significantly decreased by miR-1246 in comparison with vector control and pLG3-DLG3-mut (***p<0.001). [score:3]
The 3′-UTR of DLG3 was the target of miR-1246. [score:3]
Our results demonstrated that the 3′-UTR of DLG3 gene were a potential target of miR-1246. [score:3]
Inhibition of miR-1246 in HEV71-infected Cells. [score:3]
The inhibitorof miR-1246 (MIN0005898) and its negative control oligonucleotides (1027271) were purchased from QIAGEN. [score:3]
Computational Analysis Validating the miR-1246 Targets and mRNAs. [score:3]
The miR-1246 inhibitor is a chemically synthetic oligonucleotide with a complete complementary sequence to endogenous miR-1246. [score:3]
Construction of miR-1246 Expression Plasmid. [score:3]
The potential miR-1246 -binding sites within the 3′-UTR of DLG3 were further predicted using TargetScan 6.0, and one specific miR-1246 binding site was accessed (Fig. 6A ). [score:3]
To confirm the specific expression of miR-1246 in HEV71-infected cells, the infected RD, Vero, and SH-SY5Y cells, along with the control cells, were collected. [score:3]
miR-1246 Target the 3′-UTR of DLG3. [score:3]
Interestingly, one of the 69 miRNAs, miR-1246, was expressed at significantly higher levels in SH-SY5Y cells than in RD or Vero cells. [score:3]
Previously, the expression of miR-1246 was identified in human embryonic stem cells [37]. [score:3]
Firstly, SH-SY5Y cells were transiently transfected with the miR-1246 inhibitor or the negative control using the HiPerFect Transfection Reagent (QIAGEN) according to the manufacturer’s instructions. [score:3]
Each well contained the miR-1246 negative control (50 nM, final concentration) or the miR-1246 inhibitor (100 nM, final concentration). [score:3]
Further, to test whether miR-1246 directly target the 3′-UTR of DLG3, dual luciferase reporter assay was performed in pS-miR-1246 -transfected cells. [score:3]
Site-directed mutagenesis of the predicted miR-1246 target sites in the 3′-UTR of DLG3 was generated with the following primers: 5′-ctctgtacctaattgcacctgtgctagcgcttgggaaa-3′ and 5′-aggtgcaattaggtacagagccattgtttt-3′. [score:3]
However, our results showed that inhibition of miR-1246 did not affect HEV71 production at 6 and 12 hpi (Fig. S1). [score:3]
0095272.g003 Figure 3 a. SH-SY5Y cells were infected with HEV71, PV-3, CV-B5, and JEV, respectively, and the expression of miR-1246 was detected by qRT-PCR. [score:3]
Our results set up connection between the neurologic sequelae caused by HEV71 infection and host miR-1246 regulation in association with DLG3 gene. [score:2]
In this study, we combined results from gene chips, mRNA assay, computational predictions, and dual luciferase assay to confirm miR-1246 directly targets DLG3 in HEV71-infected neuroblastoma cells. [score:2]
Together, these results indicate that miR-1246 play a potential role in the neurological process and cell death pathways by regulating DLG3 upon HEV71 infection in human neuroblastoma cells. [score:2]
b. SH-SY5Y cells, RD cells, and Vero cells were infected with HEV71 and subjected to qRT-PCR analysis for miR-1246. [score:1]
Two complementary oligonucleotides were designed and synthesized based on the cDNA sequence of the Homo sapiens miR-1246 precursor including restriction enzyme sites as well as protecting bases. [score:1]
In addition, SH-SY5Y cells infected with HEV71, PV-3, CV-B5, and JEV, along with the control cells, were collected to evaluate the miR-1246 expression in response to other enterovirus infections. [score:1]
Thus, how miR-1246 interacts with HEV71 is of highly interests. [score:1]
miR-1246 is Specifically Induced by Enterovirus Infection in SH-SY5Y Cells. [score:1]
However, no significant difference in miR-1246 levels was observed in the JEV-infected cells (Fig. 3A ). [score:1]
miR-1246 is specially induced in enterovirus-infected SH-SY5Y cells. [score:1]
The results demonstrated that miR-1246 specifically responds to HEV71 and other enterovirus infections in SH-SY5Y cells. [score:1]
0095272.g006 Figure 6 A. Predicted sequence of the miR-1246 binding sites within the DLG3 3′-UTR are indicated with vertical lines. [score:1]
The results showed that no miR-1246 complementary sequences were found in the HEV71 genome RNA transcripts. [score:1]
The recombinant plasmid, pS-miR-1246, was confirmed by restriction enzyme digestion and DNA sequencing. [score:1]
A. Predicted sequence of the miR-1246 binding sites within the DLG3 3′-UTR are indicated with vertical lines. [score:1]
DLG3 is repressed by miR1246 in HEV71-infected SH-SY5Y cells. [score:1]
Figure S1 HEV71 virus replication was uncorrelated to miR-1246 in SH-SY5Y cells. [score:1]
To further investigate the potential effects of miR-1246 on viral RNA replication, SH-SY5Y cells were infected with HEV71 at an MOI of 1, following transfection with the miR-1246 inhibitor or the negative control. [score:1]
To further characterize the expression pattern of miR-1246 in response to virus infection, SH-SY5Y cells were infected with various viruses, and the levels of miR-1246 were analyzed at 6 and 12 hpi. [score:1]
The miRNAs were isolated from the samples using a miRNA isolation kit (QIAGEN), and the miR-1246 level was quantified using qRT-PCR according to the QuantiTec SYBR Green PCR Kit (QIAGEN). [score:1]
miR-1246 does not Affect HEV71 Replication. [score:1]
[1 to 20 of 68 sentences]
3
[+] score: 130
Overexpression of miR-1246 induces a highly metastatic phenotype based on gene expression pattern and regulates cell motility by directly targeting DENND2D. [score:9]
Our results show for the first time that DENND2D is also regulated by miRNAs and can be directly targeted and downregulated by miR-1246. [score:8]
These results suggest that miR-1246 can downregulate the expression of DENND2D by direct binding to the 3′UTR. [score:7]
Exosomal miR-1246 directly and functionally targets the DENND2D geneTo gain insight into the mechanism through which exosomal miRNAs promote the migration and invasion of HOC313-P cells, we analyzed the genes that are downregulated by these miRNAs. [score:7]
To identify target genes of miR-1246, we focused on 13 genes that were downregulated upon miR-1246 transfection according to the array data (Table 2). [score:6]
Importantly, in our study, we found that DENND2D is a direct target of miR-1246 and demonstrated a gene expression pattern that resembled that of HOC313-LM cells (Fig. 4a). [score:6]
Notably, exosomal miR-342–3p and miR-1246 induced a pro-metastatic phenotype, including increased cell motility and invasion, and miR-1246 directly targets DENND2D expression by binding to its 3′UTR. [score:6]
A heatmap of the gene expression profiles of miR-342–3p-, miR-1246-, and miR-NC -transfected HOC313-P cells and the highly metastatic HOC313-LM cell line revealed that transfection with miR-342–3p is insufficient to induce a HOC313-LM-like gene expression profile, in contrast to that of miR-1246 (Fig. 4a). [score:5]
The array data showed that the gene expression pattern upon miR-1246 transfection was similar to the HOC313-LM cell gene expression pattern (Fig. 4a). [score:5]
Hence, downregulation of DENND2D by miR-1246 results in the acquisition of migratory and invasive abilities of poorly metastatic cancer cells in various types of cancer. [score:4]
Collectively, these results suggest that DENND2D is regulated by miR-1246, and upon suppression, DENND2D promotes the migration and invasion of HOC313-P, TSU as well as HeLa cells. [score:4]
Genes downregulated by miR-1246 transfection in HOC313-P cells. [score:4]
Exosomal miR-1246 directly and functionally targets the DENND2D gene. [score:4]
In addition, we performed a cell growth assay in miR-1246 -overexpressing cells and observed that cell growth was not affected by miR-1246 expression (Fig. 3e, 4b, Supplementary Fig. S4, S5). [score:4]
One of the molecular mechanisms resulting in cancer progression involves the direct targeting of DENND2D by miR-1246. [score:4]
Two miRNAs, miR-342-3p and miR-1246, were upregulated in both whole cells and exosomes. [score:4]
To determine whether DENND2D is a direct target of miR-1246 binding to the miR-1246 seed sequence in the 3′UTR, we performed a luciferase assay in HOC313-P cells using a reporter plasmid vector containing either a wild-type (WT) or mutant (Mut) seed sequence within the 3′UTR (Fig. 4d). [score:3]
Among the candidate genes, we found that DENN/MADD Domain Containing 2D (DENND2D) was downregulated 6.2-fold in miR-1246 -transfected cells compared with control -transfected cells. [score:3]
Although migration and invasion abilities of HOC313-P, TSU and HeLa cells were increased upon overexpression of miR-342–3p and/or miR-1246, we did not observe any significant effect on cell growth rates. [score:3]
Cell growth was not affected by the suppression of DENND2D, which is consistent with our results analyzing cell growth upon miR-1246 or DENND2D-specific siRNA transfection (Fig. 4b,4c). [score:3]
To this end, we performed gene expression array analysis on HOC313-LM cells and on miR-NC-, miR-342–3p- or miR-1246 -transfected HOC313-P cells. [score:3]
Overexpression of miR-342–3p and miR-1246 enhanced the migration and invasion ability in HOC313-P, TSU and HeLa cells (Fig. 3f, g, Supplementary Fig. S4, S5). [score:3]
MicroRNA expression levels of miR-342-3p (left) and miR-1246 (right) relative to the negative controls are shown. [score:3]
We also examined the migration and invasion ability of HOC313-P, TSU and HeLa cells by overexpressing miR-342–3p and/or miR-1246. [score:3]
Protein expression of DENND2D was reduced upon treatment with LM-exosomes and/or transfection of miR-1246 in HOC313-P, TSU and HeLa cells (Fig. 4b, Supplementary Fig. S4, S5). [score:3]
How to cite this article: Sakha, S. et al. Exosomal microRNA miR-1246 induces cell motility and invasion through the regulation of DENND2D in oral squamous cell carcinoma. [score:2]
LM-exosomes contain oncomiRs miR-342–3p and miR-1246 that are transferred to HOC313-P cells for intercellular communicationRNA and proteins contained in exosomes contribute to exosome function 21. [score:1]
To test the functions of miR-342-3p and miR-1246, we transiently transfected miR-342–3p and/or miR-1246 into HOC313-P, TSU and HeLa cells. [score:1]
Luciferase reporter plasmids were transfected into HOC313-P cells, and miR-1246 or miR-NC was transfected five hours later. [score:1]
Seed sequences of miR-1246 within the DENND2D 3′UTR and mutant sequences are indicated (left). [score:1]
Interestingly, we show evidence that the abundance of oncogenic miR-342–3p and miR-1246 in cancer exosomes is significantly associated with malignancy. [score:1]
Recently, extracellular miR-1246 has been reported to promote lung cancer proliferation and enhance radioresistance 27 28. [score:1]
In addition, to examine whether miR-342–3p and miR-1246 transfer requires direct cell contact, we set up a Transwell assay in which HOC313-P cells or HOC313-LM cells were separated from HOC313-P cells by a porous 1-μm upper membrane in a ratio of 4:1. Under this condition, only acellular material, such as exosomes or other soluble factors, can migrate across these membranes 13. [score:1]
These data suggest that a specific miRNA population could be selectively sorted into the exosomes, of which miR-342–3p and miR-1246 could act as oncomiRs in oral squamous cell carcinoma. [score:1]
Exosomal miRNAs miR-342-3p and miR-1246 increase cell motility but not cell growth in HOC313-P, TSU and HeLa cells. [score:1]
Therefore, we focused on the functions of miR-342–3p and miR-1246. [score:1]
Taken together, these data suggest that miR-342–3p and miR-1246 delivered via LM-exosomes act as oncomiRs by affecting the cell motility of the recipient cells. [score:1]
Gain-of-function was simulated by using miRNA mimics (miR-342- 3p [MC12328], miR-1246 [MC13182] and negative control [4464058]) purchased from Thermo Fisher Scientific. [score:1]
LM-exosomes contain oncomiRs miR-342–3p and miR-1246 that are transferred to HOC313-P cells for intercellular communication. [score:1]
Exosomal miRNAs miR-342-3p and miR-1246 increase cell motility but not cell growth in HOC313-P, TSU and HeLa cellsFollowing the observation that LM-exosomes function in an oncogenic manner in HOC313-P cells, we hypothesized that the miRNA cargo of LM-exosomes was responsible for such biological functions. [score:1]
[1 to 20 of 40 sentences]
4
[+] score: 124
The heatmap (Supplementary Fig.   7e) depicts the expression patterns of the genes whose abundance was significantly upregulated or downregulated following miR-1246 treatment compared with a control scrambled mimic. [score:8]
In addition, miR-1246 may target WT p53 in hepatocellular carcinoma where it inhibits cell growth and even reported to be targeted by p53 itself in Down syndrome 54, 55. [score:7]
Finally, to identify potential miR-1246 target genes in macrophages, we transfected M2 macrophages with either miR-1246 mimic, a miR-1246 inhibitor or a mimic control. [score:5]
Zhang Q p53 -induced microRNA-1246 inhibits the cell growth of human hepatocellular carcinoma cells by targeting NFIBOncol. [score:5]
We validated these results by overexpressing miR-1246 in M2 macrophages using a locked-nucleic–acid (LNA) -based miR-1246 mimetic (miR-1246 mimic) that yielded macrophage reprogramming consistent with our co-culture results, including increased levels of IL-10 expression while TNF-α levels decreased (Fig.   3c, Supplementary Fig.   3a). [score:5]
d HCT116 mutp53 (R248W) cells were transfected with LNA-miR-1246 mimic (mim) or miR-1246 inhibitor (inhib. ) [score:5]
Then, we performed a gene expression array to explore the potential miR-1246 targets. [score:5]
miR-1246 was found to be upregulated in M2 macrophages when treated with the exosomes fraction but not the proteins fraction (Supplementary Fig.   3c). [score:4]
Three days later, the transfected macrophages were mixed with luciferase expressing HCT116 cells and co -injected subcutaneously to the back of NOD-SCID mice (HCT116 + M2 with control mimic, n = 5, HCT116 + M2 with miR1246 mimic, n = 5). [score:3]
g Changes in expression for four prominent miRs that were found to be significantly more abundant in mutp53 HCT116 and HT29 cells Next, we determined whether miR-1246 containing exosomes are transferred from tumor cells to neighboring macrophages. [score:3]
Zhang WC Tumour-initiating cell-specific miR-1246 and miR-1290 expression converge to promote non-small cell lung cancer progressionNat. [score:3]
Both miR-21 and miR-1246 were observed to be expressed primarily in the Alix- and CD9 -positive fractions, indicating a close association with exosomes for these miRs (Supplementary Fig.   2f, g). [score:3]
In line with our in vitro findings, when M2 macrophages were transfected with miR-1246 inhibitor, no significant difference was observed in tumor growth (Supplementary Fig.   4e). [score:3]
As an additional control, this list of genes was also validated in the miR-1246 inhibitor treatment group to be unchanged. [score:3]
Following miR-1246 treatment, RNA was extracted and subjected to expression microarray analysis. [score:3]
Many reports are showing tight association with several types of cancer, including non-small cell lung, colon, breast, cervical and oral squamous cell carcinomas 16, 51– 53. miR-1246 was found to promote invasiveness and stemness, to be highly expressed in metastases and proposed to serve as a bio-marker for early detection of certain malignancies. [score:3]
When comparing the expression levels between WT and mutp53 tumors, miR-1246 was found to be the top miR associated with mutp53 tumors with a logarithmic fold change of 2.29 and pvalue of 0.045. [score:3]
For miR-1246 mimic/inhibitor array: Total RNA was isolated with miRNAeasy micro kit from Qiagen. [score:3]
s of HCT116 cells together with miR-1246 -transfected M2 macrophages were used to directly assimilate metastatic foci in mice livers through the splenic vein. [score:2]
Therefore, the indirect manipulation of exosomal miR-1246 sources had a paracrine effect over the macrophage polarization patterns consistent with the co-culture results. [score:2]
Furthermore, inhibition of miR-1246 in co-cultured mutp53 tumor cells significantly decreased miR-1246 levels in derived exosomes (Supplementary Fig.   3b, p < 0.01 Student’s t-test) and attenuated the increase in IL-10 and CCL2 compared with HCT116 cells and HT29 treated with miR-1246 mimic (Fig.   3d, Supplementary Fig.   3d). [score:2]
Colon tumor cell acquires a mutation in TP53 yielding an increased release of exosomes containing miR-1246. [score:2]
Fig. 6Mutp53 correlates with miR-1246 in CRC patients. [score:1]
While the general levels of hnRNPa2b1 were higher in the WT p53 cells (IP: hnRNPa2b1), the SUMOylated hnRNPa2b1 was increased by threefold in the mutp53 cells (IP:SUMO1) suggesting a role for this RNA -binding protein in sorting miR-1246 into exosomes (Supplementary Fig.   7d). [score:1]
Because miR-1246 was able to induce increased secretion of TGF-β from M2 macrophages (Supplementary Fig.   7a), we propose a molecular mo del (Fig.   7e), where exosomes carrying miR-1246 are being released from mutp53 colon tumor cells. [score:1]
Mutp53 positively correlates with miR-1246 in CRC patients. [score:1]
On the other hand, as presented both in Fig.   3b and in Supplementary Fig. 3e, the mature miR-1246 was significantly increased 48 and 96 h post exosomes addition (p < 0.01, Student’s t test). [score:1]
Importantly, miR-1246 was found both in the cancer cells compartment of the mutp53 tumors and in the stromal compartments including immune cells of monocytic appearance (Fig.   6b, Supplementary Fig.   6b: Arrows—cancer cells, arrowheads—non-epithelial cells). [score:1]
The functional link between miR-1246 and cancer is also becoming more evident. [score:1]
In addition, we examined the possibility that endogenous miR-1246 levels are elevated in mutp53-reprogrammed macrophages, driving their phenotypic shift. [score:1]
Next, we validated the association of miR-1246 with mutp53 in cancer patients. [score:1]
While these accumulated findings might indicate that miR-1246 is part of a complicated and context -dependent network, the fact that others have found it in cancer-derived exosomes reinforces the argument that miR-1246 is involved in tumor progression and metastasis 29, 52. [score:1]
In addition, intracellular miR-1246 levels were increased only in the macrophages that were cultured with purified exosomes collected from mutp53 cells and not when cultured with exosomes from either WT p53 cells or p53 null cells (Fig.   3b). [score:1]
SUMOylated hnRNPa2b1 sorts exosomal miR-1246 in mutp53 tumors. [score:1]
These findings are consistent with an exogenous miR-1246 increase that drives macrophage reprogramming. [score:1]
Figure  6c shows a clear association between miR-1246 and CD206 macrophages specifically in tumors harboring mutp53 and not WT p53. [score:1]
Exosomal miR-1246 is associated with mutp53 in tumor cells and TAMs. [score:1]
Taken together, these results suggested that miR-1246 is transferred from mutp53 tumor cells to the microenvironment including macrophages. [score:1]
To quantitate the degradation activity, images were taken in a Zeiss LSM 710 confocal microscope (Carl Zeiss) and the Zen light software was used to profile signal ratio between FITC and the Cy-3. The LNA [TM] microRNA probe double-DIG labeled (hsa-miR-1246, 610948-360, Exiqon) was employed for visualization of the miR-1246. [score:1]
For in situ co-detection we employed sequentially a two-step immune-fluorescence process: (1) FISH utilizing the Locked Nucleic Acid (LNA) technology developed from Exiqon allowing superior hybridization properties for the detection of miR-1246. [score:1]
These results are consistent with several recent publications suggesting that exosomes enriched with miRs and most specifically miR-1246 will carry a number varying from several to a few dozens of copies per vesicle 30, 31. [score:1]
In addition, we tested the possible role of exosomes as vehicles for miR-1246 in mutp53 tumors. [score:1]
Known quantities of the miR-1246 mimic were used to create a standard curve. [score:1]
Still, even though miR-1246 is significantly expressed in mutp53 tumor-derived exosomes, the manner through which miR-1246 is being sorted into the exosomes and how mutp53 is involved in the exosome machinery needs to be further investigated. [score:1]
c Co-detection of miR-1246 and CD206 in the stroma of sporadic colorectal carcinomas harboring mutp53 and WT p53. [score:1]
Lysates from WT p53 and mutp53 cells pulled down with biotinylated miR-1246 were analyzed by mass-spectrometry to identify protein associates to miR-1246. [score:1]
Several prominent miRs annotated as mutp53 -associated-miRs, such as miR-1246, miR-21, and miR-29b, were previously reported to be packaged into exosomes and transported between tumor cells and other cell types 2, 21, 29. [score:1]
Mutp53 triggers miR-1246 -dependent reprogramming of macrophages. [score:1]
M2 macrophages were transfected with miR-1246 mimic and co -injected with HCT116 cells or HT29 cells to form xenograft tumors in NOD-SCID mice. [score:1]
Next, we aimed to determine the number of miR-1246 molecules transferred between tumor cells and macrophages via exosomes. [score:1]
miR-1246 was found to be increased in the co-cultured M0 and M2 macrophages specifically after they had been exposed to tumor cells harboring mutp53 whereas tumor cells not carrying mutp53 did not exert such an effect (Fig.   3a). [score:1]
To validate that miR-1246 is transferred to macrophages in mutp53 colon cancers, we conducted a two-step immune-fluorescence process: (i) FISH employing double-DIG-labeled LNATM miR-1246 probe, followed by (ii) CD206 immunostaining. [score:1]
Notably, miR-1246 bears such a recognition Exo-motif (Supplementary Fig.   7c). [score:1]
To exclude false -positive staining, we performed a parallel experiment omitting each time one of the following primary reagents: miR-1246 or anti-CD206 or anti-CD163. [score:1]
The SUMOylated protein is associated with mutp53, leading the way for miR-1246 enrichment in exosomes. [score:1]
To further increase detection sensitivity, we used double-DIG-labeled probe (hsa-miR-1246, 610948-360, Exiqon) visualized with Tyramide Signal Amplification (TSA) Plus Fluorescein System (an upgraded version of standard tyramide systems, TSA [TM] Plus Fluorescein System, NEL741B001KT, Perkin Elmer), (2) IF detecting employing anti-CD206 (ab64693, Abcam) or anti-CD163 (NCL-CD163, Novocastra-Leica). [score:1]
In summary, colon cancer cells with GOF mutp53 promote the formation of a distinctive population of reprogrammed macrophages by releasing exosomes containing miR-1246. [score:1]
Our findings identify miR-1246 as a unique cargo of mutp53-derived exosomes potentially amenable for therapeutic and diagnostic applications in colon cancer. [score:1]
The ISH of miR-1246 was validated with scrambled negative control as well as with U6 snRNA serving as positive control (Supplementary Fig.   6b, lower panel). [score:1]
White arrowheads demonstrate miR-1246+/CD206+ cells. [score:1]
To exclude false -positive staining from the secondary antibodies, we performed a parallel experiment omitting each time one of the following primary reagents (miR1246 or anti-CD206) (Supplementary Fig.   6c). [score:1]
We found hnRNPa2b1 to be pulled down with miR-1246 that contains the specific exo-motif recognized by the protein. [score:1]
Levels of miR-1246 were abolished completely in fraction 8, which was not associated with exosomal markers; however, in fractions 5–7, considerable levels of miR-1246 were detected even after exosomes were treated with RNAse indicating its presence inside the vesicles (Supplementary Fig.   2h). [score:1]
Although these miRs were enriched in mutp53-cell-derived exosomes, the levels of miR-1246 and miR-21 were independent of the p53 status of the tumor cells as their levels were similar in cells harboring mutp53 and cells harboring WT p53 (Supplementary Fig.   2e). [score:1]
[1 to 20 of 64 sentences]
5
[+] score: 109
Tumor-suppressor miRNAs such as miR-1246, miR-302a and miR-4448 are activated and suppress their cancer-related target genes, thus inducing apoptosis and G1/S arrest of cancer cells and inhibiting their migration. [score:9]
miR-1246, miR-302a and miR-4448 suppress their target genes upon treatment with SAHA and DZNep in cancer cellsA recent study has shown that dual-specificity tyrosine phosphorylation-regulated kinase 1A (DYRK1A), a Down syndrome -associated protein kinase, is a target of miR-1246. [score:8]
DYRK1A, which was recently identified as one of the targets of miR-1246, was significantly suppressed by treatment with EZH2 inhibitors, resulting in apoptosis of AGS and HepG2 cells. [score:7]
miRNAs that were significantly upregulated after treatment of AGS and HepG2 cells with SAHA and DZNep are summarized in Table 1. Interestingly, miR-1246 was upregulated in both cell lines after SAHA and DZNep treatment (Table 1). [score:7]
As shown in Figure 3a, the expression level of miR-1246 was increased, and accompanied by downregulation of DYRK1A, after treatment of AGS and HepG2 cells with SAHA and DZNep. [score:6]
[18] We examined the levels of expression of miR-1246 and its target DYRK1A by quantitative RT–PCR and western blotting, respectively. [score:5]
Treatment with SAHA and/or DZNep suppresses EZH2 expression and reduces the level of H3K27 methylation, creating a more active chromatin structure, and thus allowing p53 to bind to the promoter region of miR-1246. [score:5]
miR-1246 is a common target of EZH2 inhibitors in cancer cells. [score:5]
miR-1246, miR-302a and miR-4448 suppress their target genes upon treatment with SAHA and DZNep in cancer cells. [score:5]
[21] Here we have shown for the first time that, in cancer cells, miR-1246 is a common target of EZH2 inhibitors and that miR-302a and miR-4448 are activated by SAHA and DZNep. [score:5]
miR-1246 is a common target of EZH2 inhibitors in cancer cellsTo investigate the miRNA expression profiles altered by the treatment of AGS and HepG2 cells with SAHA and DZNep, we conducted microarray analyses. [score:5]
A recent study has shown that dual-specificity tyrosine phosphorylation-regulated kinase 1A (DYRK1A), a Down syndrome -associated protein kinase, is a target of miR-1246. [score:4]
In the present study, we focused on three miRNAs— miR-1246, miR-302a and miR-4448—which were robustly upregulated by SAHA and DZNep treatment in AGS and HepG2 cells. [score:4]
A recent study has shown that miR-1246 has a p53-responsive element in its promoter region, and that p53 induces miR-1246 expression in response to DNA damage. [score:3]
Binding of EZH2 to the promoter regions of miR-1246, miR-302a and miR-4448 is inhibited by SAHA and DZNep. [score:3]
In addition, miR-1246 has a p53-responsive element in its promoter region, and p53 induces miR-1246 expression. [score:3]
[18] Treatment with SAHA and DZNep increased p53 binding to the miR-1246 promoter region, thus further increasing miR-1246 expression. [score:3]
These findings indicate that binding of EZH2 to the promoter regions of miR-1246, miR-302a and miR-4448 was inhibited in cancer cells by treatment with SAHA and DZNep. [score:3]
Binding of EZH2 to the promoter regions of miR-1246, miR-302a and miR-4448 is inhibited by SAHA and DZNepFinally, we performed the ChIP assay with antibodies against EZH2 and p53 to clarify the mechanism responsible for regulation of these miRNAs by histone-modifying drugs. [score:3]
As EZH2 is the catalytic subunit of polycomb repressive complex 2, which mediates epigenetic gene silencing by trimethylating histone H3 lysine 27, suppression of EZH2 by SAHA and DZNep may induce transcriptional activation of miR-1246, miR-302a and miR-4448 in cancer cells. [score:3]
This suggests that miR-1246 is a common target of SAHA and DZNep in cancer cells and can be activated by these histone-modifying drugs. [score:3]
Increased expression of miR-1246 by treatment with SAHA and DZNep was confirmed by quantitative RT–PCR (Figure 3a). [score:3]
Expression levels of genes were analyzed by TaqMan quantitative RT–PCR assay for miR-1246, miR-302a, Oct3/4 and Sox2 (Applied Biosystems) in accordance with the manufacturer's instructions. [score:2]
ChIP assay revealed that binding of EZH2 to the promoter regions of miR-1246, miR-302a and miR-4448 was inhibited by SAHA and DZNep. [score:2]
22, 23 These findings suggest that SAHA and DZNep induce DYRK1A -mediated apoptosis in cancer cells through activation of miR-1246. [score:1]
Chromatin around the miR-1246 promoter region that was immunoprecipitated with EZH2 antibody was significantly reduced by treatment with SAHA and DZNep in both AGS and HepG2 cells (Figure 6a). [score:1]
U6 was used as an internal control for miR-1246 and miR-302a. [score:1]
[1 to 20 of 27 sentences]
6
[+] score: 37
For the validation of a miR-1246 putative target, FAM53C 3’UTR, HeLa cells were plated at a density of 10 [4] cells/well in 96-well plates and co -transfected with 100 ng of MiTarget [™] MicroRNA 3'UTR Target Clone HmiT059263-MT01 plasmid (GeneCopoeia, FAM53C/ NM_001135647.1 3’UTR) and a range of dilution of miR-1246 mimic. [score:7]
A single miRNA can recognize hundreds of targets; FAM53C was identified as the top ranking target mRNA of hsa-miR-1246 by a number of prediction algorithms. [score:5]
In recent years hsa-miR-1246 has been described as a novel p53 target miRNA [33]. [score:3]
Relative reduction in luciferase activity in hsa-miR-1246 mimic and exosome treated samples was expressed as percent of control (scrambled miRNA) transfections, n = 6. The error bars represent ± SEM; *** p<0.001. [score:3]
As part of our assay development we assessed hsa-miR-1246/ FAM53C target validation by co-transfecting HeLa cells with a range of dilution of hsa-miR-1246 mimic and FAM53C 3’UTR dual luciferase plasmid. [score:3]
Data were expressed as percent of control (scrambled miRNA) transfections, n = 6. (B) Biological functional transfer assessment of exosomal hsa-miR-1246 cargo. [score:3]
Overall miR-1246 has been demonstrated to play an essential role in regulating cell growth and apoptosis [37, 38]. [score:2]
The differential expression of this protein was verified in hsa-miR-1246 mimic and exosome treated HeLa cells compared with untreated and scrambled miRNA treated HeLa cells (Fig 4C). [score:2]
Hsa-miR-1246, hsa-miR-4488, hsa-miR-4508, hsa-miR-4492 and hsa-miR-4516 were identified as the 5 most abundant miRNA types in exosomes derived from hNSC producers and had the highest ratio of exosomal to cellular miRNA abundance. [score:1]
Hsa-miR-1246, one of the most abundant exosomal miRNAs in our hNSC, was originally identified following miRNA sequencing in embryonic stem cells [32]. [score:1]
Control wells were transfected with the FAM53C 3’UTR dual luciferase plasmid and either positive (miR-1246 mimic, 120nM) or negative (AllStars negative control siRNA AF 488, scrambled miRNA, 120nM) miRNAs. [score:1]
For the evaluation of FAM53C protein expression by Western blotting, HeLa cells were transiently transfected with hsa-miR-1246 mimic and AllStars negative control siRNA AF 488 as described above or treated with hNSC exosomal preparation; untreated HeLa cells were use as control. [score:1]
QRT-PCR absolute quantification of cel-miR-39 copy numbers were quantified to assess that the efficiency of cel-miR-39 recovery was similar among tested samples and consequentially the quantification of hsa-miR-1246 was not biased during the experimental procedures. [score:1]
Hsa-miR-1246, hsa-miR-4488, hsa-miR-4508, hsa-miR-4492 and hsa-miR-4516 were identified as the 5 most exosomal enriched miRNAs (Fig 2C). [score:1]
One of the most enriched miRNA, hsa-miR-1246, was selected and its copy number per exosome was quantified by qRT-PCR absolute quantification (Fig 3A). [score:1]
Interestingly, based on the qRT-PCR absolute quantification of hsa-miR-1246 copy number per cell (4.75×10 [5]) and the ratio of the exosome and cell volumes (2.33x10 [-04] μm [3]/380 μm [3]), we would have expected approximately 0.5 copies per exosome. [score:1]
Proteins from untreated and scrambled miRNA (AllStars negative control siRNA AF 488, Qiagen), hsa-miR-1246 mimic (Qiagen), and exosome treated HeLa were separated and blotted as described above, and probed with primary rabbit polyclonal anti-FAM53C (1:100, Sigma) and primary mouse monoclonal α-tubulin (1:1000, Sigma). [score:1]
[1 to 20 of 17 sentences]
7
[+] score: 35
To find out whether radiation could regulate the expression of this specific miRNA signature, we first analyzed the expression of miR-630, miR-1246, miR-1290 and miR-3138 by qRT-PCR in human cervical cancer Hela cells after radiation at a dose of 6 Gy. [score:6]
Of note, qRT-PCR illustrated that the expression of 4 miRNAs were up-regulated over 5 folds, including miR-630, miR-1246, miR-1290 and miR-3138. [score:6]
The present study also demonstrated that overexpression of the specific miRNA signature (miR-630, miR-1246, miR-1290 and miR-3138) by transfection with its mimics respectively could enhance the radioresistance in cervical cancer cells, and that suppression of miR-630, delegate of the specific miRNA signature, attenuates the radioresistance in cervical cancer cells. [score:5]
miR-1246 can be up-regulated in human epidermoid carcinoma cells A431 in response to photodynamic therapy [34], serve as a novel diagnostic and prognostic biomarker for oesophageal squamous cell carcinoma [35] and multiple myeloma [36]. [score:4]
In the present study, 4 miRNAs (miR-630, miR-1246, miR-1290 and miR-3138) showing more than 5 folds of expression changes were selected for further analysis. [score:3]
The mimics and inhibitors specific for miR-630, miR-1246, miR-1290 and miR-3138 were obtained from Ambion (Grand Island, NY). [score:3]
The present study reveals positive roles of miR-630, miR-1246, miR-1290 and miR-3138 in radioresistance of cervical cancer cells, supporting regulatory roles of miRNAs in radioresistance. [score:2]
To investigate whether the specific miRNA signature is involved in the development of radioresistance of cervical cancer cells, we used Hela cells transfected with the mimics specific for the 4 miRNAs, which respectively express relatively higher miR-630, miR-1246, miR-1290 and miR-3138 than negative control cells (data not shown). [score:2]
A miRNA signature consisting of 4 miRNAs (miR-630, miR-1246, miR-1290 and miR-3138) exhibited more than 5 folds of increase in radioresistant cells. [score:1]
Our present data indicated that a specific miRNA signature including miR-630, miR-1246, miR-1290 and miR-3138 could promote radioresistance of human cervical cancer cells. [score:1]
The radiation -induced miRNAs (miR-630, miR-1246, miR-1290 and miR-3138) in cervical cancer cells are not included in the miRNA profiles of M059 and TK6, supporting the speculation that the modulation of miRNA is dependent on cell type, radiation dose and dose rate [30]. [score:1]
The present study indicated that miRNA is involved in radioresistance of human cervical cancer cells and that a specific miRNA signature consisting of miR-630, miR-1246, miR-1290 and miR-3138 could promote radioresistance of cervical cancer cells. [score:1]
[1 to 20 of 12 sentences]
8
[+] score: 34
Total RNA was isolated from the whole exosome population and the expression of several selectively secreted microRNAs (cell to the exosome) and/or abundantly expressed (cancer exosomes versus the MCF10A exosomes) (miR-1246, miR-21, miR-122, and let-7a) was analyzed by real-time PCR. [score:5]
miR-1246 and miR-21 are highly expressed in plasma exosomes from patients with breast cancer. [score:3]
normal) were produced using each microRNA expression value for miR-21 (a) and miR-1246 (b) separately, and for miR-21 and miR-1246 combined (c). [score:3]
While the expression of plasma exosome miR-1246 was higher in mice with any subtypes of breast cancer, those mice with ER- and PR- tumors had the highest levels (Fig.   4c). [score:3]
As shown in Fig.   5, the expression of plasma exosome miR-1246 (p = 0.03) and miR-21 (p = 0.04) was significantly higher in the group of patients with breast cancer as compared to the normal population (Fig.   5b). [score:2]
Total RNA was extracted from the bead-bound exosomes and the expression of miR-1246, miR-451 and miR-122 were measured by qRT-PCR. [score:1]
Our results demonstrate that certain microRNA species, such as miR-21 and miR-1246, are selectively enriched in human breast cancer exosomes and significantly elevated in the plasma of patients with breast cancer. [score:1]
Student’s t test, * p < 0.05 ROC curves were constructed separately for miR-21 (Fig.   6a) and miR-1246 (Fig.   6b), and combined (Fig.   6c) to compare the diagnostic value of miR-1246 and miR-21 to predict breast cancer. [score:1]
Furthermore, a most recent study indicated that serum miR-1246 is elevated among patients with invasive breast cancer [35]; these observations are consistent with our current findings. [score:1]
Importantly, the selectively enriched exosome microRNA, human miR-1246, was detected at significantly higher levels in exosomes isolated from PDX mouse plasma, indicating that tumor exosome microRNAs are released into the circulation and can serve as plasma biomarkers for breast cancer. [score:1]
Based on previous reports, both miR-21 and miR-1246 are cancer -associated microRNA species. [score:1]
We have detected plasma exosome miR-21 and miR-1246 at significantly higher levels in patients with breast cancer vs. [score:1]
The confirmation that miR-1246 and miR-21 levels are significantly higher in plasma exosomes from patients with breast cancer vs. [score:1]
As shown in Table  2, miR-1246 was most enriched, followed by miR-122 in MCF7 exosomes, and miR-21 was most enriched in MDA-MB-231 cells, followed by let-7a. [score:1]
Thus, our observation that the levels of plasma exosome miR-21 and miR-1246 are significantly higher in patients with breast cancer is in line with previous reports and suggests that these two exosome microRNA species are selectively enriched and significantly elevated in plasma exosomes potentially among a spectrum of different types of human cancer. [score:1]
Student’s t test, * p < 0.05ROC curves were constructed separately for miR-21 (Fig.   6a) and miR-1246 (Fig.   6b), and combined (Fig.   6c) to compare the diagnostic value of miR-1246 and miR-21 to predict breast cancer. [score:1]
Based on the selective enrichment and absolute abundance, we identified miR-1246, miR-122, miR-21, and let-7a as candidate exosome microRNAs that may serve as biomarkers indicative of breast cancer. [score:1]
b- c Exosomes were isolated from the mouse plasma exosome sample by magnetic-bead based immunoaffinity isolation using an antibody against human CD63, the total RNA was extracted and the expression of miR-1246 and miR-122 were evaluated by qRT-PCR analysis (absolute quantitation) in the immunoaffinity isolated human CD63 -positive exosomes from the plasma of three NSG (n = 3, in triplicate) and nine HCI-PDX mo dels (with available biological replicates as indicated in c, in triplicate); Student’s t test; *** p < 0.001. [score:1]
When miR-1246 and miR-21 were combined, the AUC increased to 0.73 (95 % CI 0.53, 0.92; p = 0.022). [score:1]
The AUC for miR-21 was 0.69 (95 % CI 0.50, 0.88; p = 0.048) and for miR-1246 was 0.69 (95 % CI 0.49, 0.89; p = 0.068), indicating fair predictive power. [score:1]
Our finding that the levels of the selectively secreted and highly enriched exosome miR-1246 were significantly higher in the plasma of PDX mice vs. [score:1]
In conclusion, we have demonstrated that certain microRNA species, such as miR-21 and miR-1246, are selectively enriched in human breast cancer exosomes, detectable in plasma from breast cancer PDX mice, and significantly elevated in plasma from patients with breast cancer. [score:1]
In addition, miR-1246 has also been found to be elevated in serum from patients with esophageal cancer [36], colon cancer [37], and pancreatic cancer [38]. [score:1]
[1 to 20 of 23 sentences]
9
[+] score: 28
Other miRNAs from this paper: hsa-mir-494, hsa-mir-4488, hsa-mir-4516
MicroRNA inhibitors were purchased from Exiqon (Woburn, MA, USA) including miRCURY LNA Power Inhibitor Control (199020-04), miRCURY LNA Power Inhibitor hsa-miR-494 (427173-04), miRCURY LNA Power Inhibitor has-miR-1246 (426697-04) and a custom miRCURY LNA Power Inhibitor hsa-miR-4516. [score:11]
Elevated expression of miR-1246 and -4516 had no effect on apoptosis; however, overexpression of only miR-494 conferred a significant increase in sensitivity to TRAIL (Figure 4, lower panel). [score:5]
miR-4488 levels were very low and not detected by qRT-PCR and miR-494, miR-1246 and miR-4516 were significantly upregulated in cells treated with 2DG+TRAIL relative to controls treated with TRAIL or 2DG alone, validating the array data. [score:4]
MiR-1246 was also included in the analysis given that it was the most highly expressed miRNA with the combination treatment at 2313-fold over control (2DG+TRAIL:TRAIL ratio +1.8, 2DG+TRAIL:2DG ratio +2891) (Figure 4). [score:3]
HT-29 cells were electroporated with individual microRNA inhibitors and mimics for miR-494, miR-1246 or miR-4561. [score:3]
MicroRNA mimics were purchased from Qiagen, including Syn-hsa-miR-494 (MSY0002816), Syn-hsa-miR-1246 (MSY0005898) and Syn-hsa-miR-4516 (MSY0019053). [score:1]
This sensitivity was not enhanced further when combining the miR-494 mimic with those of miR-1246 and miR-4516. [score:1]
[1 to 20 of 7 sentences]
10
[+] score: 28
miRNAExpression change [a] miRbase accession numberExpression change [b] miR-132-5p Down MIMAT0004594 DownLi et al., 2013 miR-125b-1-3p Down MIMAT0004592 DownLi et al., 2013; Mar-Aguilar et al., 2013a miR-34c-5p Down MIMAT0000686 DownYang et al., 2013 miR-382-3p Down MIMAT0022697 DownLi et al., 2013; Mar-Aguilar et al., 2013b miR-485-5p Down MIMAT0002175 DownAnaya-Ruiz et al., 2013 miR-323b-3p Down MIMAT0015050 NA NA miR-598-3p Down MIMAT0003266 NA NA miR-224-5p Up MIMAT0000281 UpHuang et al., 2012 miR-1246 Up MIMAT0005898 UpPigati et al., 2010 miR-184 Up MIMAT0000454 NA NA a Expression change in this study. [score:7]
Perhaps the overexpression of miR-1246 alters the CD59 expression profiles in breast cancer, resulting in cell apoptosis. [score:5]
In this study, we found that CD59, the cluster of differentiation 59, was a common target of miR-1246 and miR-485-5p belonging to the 10 differentially expressed miRNAs (Figure 5). [score:5]
Figure 5 miR-1246 and miR-485 molecules bind to the target gene. [score:3]
Because miRNAs can regulate cell-fate decisions, we concluded that miR-1246 and miR-485 may regulate the apoptotic vs. [score:3]
Notably, miR-382 (Mar-Aguilar et al., 2013b), miR-224 (Huang et al., 2012), and miR-1246 (Pigati et al., 2010) were also reported as valuable potential biomarkers of breast cancer and diseases. [score:3]
In addition to this, a previous study showed that miR-1246 induced p53 -dependent apoptosis triggered by DNA damage (Palma et al., 2012). [score:1]
Unfortunately, the interaction between CD59 and miR-1246 has not been verified. [score:1]
[1 to 20 of 8 sentences]
11
[+] score: 27
0064396.g003 Figure 3 A. Expression of miR-1, miR-26a and miR-29c B. Expression of miR-34b, miR-451 and miR-1246. [score:5]
A. Expression of miR-1, miR-26a and miR-29c B. Expression of miR-34b, miR-451 and miR-1246. [score:5]
MiR-1, miR-26a, miR-29c, miR-34b, miR-451 and miR-1246 are downregulated in PH subjects. [score:4]
The miR-1246 showed target for caveolin1, GSK3ß and cadherin 2 genes. [score:3]
During moderate PH, miR-21, miR-23b, miR-130a, miR-491 and miR-1246 are moderately upregulated but, are more pronounced in severe PH, compared to the controls. [score:3]
In contrast miR-451 and miR-1246 showed sharp declined expression in the male subjects (Fig. 5). [score:3]
The expressions of miR-26a, miR-29c, miR-451 and miR-1246 were declined to 0.66±0.12, 0.52±0.14, 0.49±0.16 (p<0.05) and 0.67±0.21-folds (p = ns) respectively, in moderate PH subjects, compared to the control subjects. [score:2]
We choose the following miRNAs for validation:MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
We choose the following miRNAs for validation: MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
[1 to 20 of 9 sentences]
12
[+] score: 26
Recently, expression profiling of human miRNAs in colorectal tumors combined with miRNA-network analysis, identified an association between miR-1246 over -expression and the development of colorectal cancer [60]. [score:6]
Probes-1246 and -1290 correspond to miR-1246 and miR-1290 sequences respectively, while CPHD-6235 is longer covering 10 nt upstream of miR-U2-1. Because miR-1246 and miR-1290 cross-map to miR-U2-1, the signal detected by their respective probes corresponds exclusively to hybridization with miR-U2-1. The probe CPHD-6235 also hybridizes exclusively to miR-U2-1. The analysis of the 8 matched samples reveals a very similar expression profile for the three probes, and a significant over -expression (>3 fold) of miR-U2 is observed in the primary tumors relative to the adjacent normal tissue for seven of eight patients (Fig. 4b). [score:5]
Independent work revealed that miR-1246 is a target of p53 family members. [score:3]
Using this method, the fold changes for the 11 primary tumors for which matched adjacent normal tissue was not available showed an over -expression (>x2) in 12 individuals out of 19 (i. e. 63%) with probes corresponding to miR-1290 and miR-1246 sequences, and 14 individuals (i. e. 74%) with the probe CPHD-6235. [score:3]
TP53 induces the expression of miR-1246 which, in turn, reduces the level of DYRK1A resulting in a decrease in the induction of apoptosis [61]. [score:3]
The two proposed mature microRNAs are actually truncated versions of miR-U2-1. This was indirectly confirmed for miR-1246, when attempts to sequence its precursor in the same tissue where miR-1246 was detected failed, suggesting that the supposed precursor does not exist [46]. [score:2]
Similarly, two short microRNAs (19 nt), miR-1246 and miR-1290, match miR-U2-1 with 100% identity and one mismatch respectively [44]. [score:1]
Mapping reads from our five short libraries to the respective precursors of these two microRNAs [45] revealed unambiguously that the two putative precursors of miR-1246 and miR-1290 are the result of false-mapping. [score:1]
As previously discussed, miR-1246 is very likely a false mapping of miR-U2, thus these results more probably concern miR-U2. [score:1]
We conclude from these data that all results related to miR-1246 and miR-1290 can be assigned to miR-U2. [score:1]
[1 to 20 of 10 sentences]
13
[+] score: 20
TP53 induces the expression of miR-1246 which, in turn, reduces the level of DYRK1A, a Down syndrome -associated protein kinase. [score:3]
Overexpression of miR-1246 reduces DYRK1A levels and decreases the induction of apoptosis [25]. [score:3]
Twenty-five of them were overexpressed, with hsa-miR1246 showing the highest fold-change value (12.0-fold). [score:3]
Recently, Zhang et al. [25] have shown that miR-1246 is a new target of p53 family members. [score:3]
For CRC, different degrees of correlation were found for the 24 miRNAs exhibiting altered expression: miR-106a was not correlated at all, while miR-195 exhibited the largest number of ties and was taken as a root node with 9 edges (degree 15.86); 8 links were detected for miR-28-3p (degree 15.66), and 7 links for miR-1280 (degree 13.79), miR-1246 (degree 13.05), and miR-140-3p (degree 12.12) (Figure 5, panel A). [score:3]
By miRNA-network analysis, tissue-specific patterns of miRNA deregulation were traced: the driving miRNAs were miR-195, miR-1280, miR-140-3p and miR-1246 in colorectal tumors, and miR-103, miR-23a and miR-15b in pancreatic cancers. [score:2]
In CRC network, as shown in panel A, m iR-195, miR-28-3p, miR-1280, miR-18a and miR-1246 exhibit the highest weighted degree rank. [score:1]
In particular, in CRC three principal nodes were found: miR-195, miR-18a, and miR-1246. [score:1]
The last relationship has miR-1246 as principal node. [score:1]
[1 to 20 of 9 sentences]
14
[+] score: 19
A total of 10 and 14 miRNAs were upregulated (e. g. miR-1246 and miR-148-a) and down-regulated (e. g. miR- 551b and miR-10a) respectively during megakaryocyte differentiation, all of which were confirmed by qPCR. [score:7]
The highest expression change was observed for miR-1246 which targets the transcripts of mitogen-activated protein kinases (MAPK) and dual- specificity tyrosine phosphorylation-regulated kinase 1 (DYRK-1A) and cell adhesion molecule 1 (CADM1). [score:6]
Study of the miR-1246 function showed many zinc finger protein targets for this molecule. [score:3]
Among these, ten were significantly up- regulated in megakaryocytes with the top four being miR1246, miR-148a, miR-22 and miR-188 from 18 to 5 fold increase. [score:2]
There are some other targets that showed no obvious correlation with this lineage, however, miR-1246 has recently been used as a diagnostic and prognostic biomarker in a number of cancers such as oesophagous squamous cell carcinoma and hepatocellular carcinoma (35, 36), thus requiring further investigation. [score:1]
[1 to 20 of 5 sentences]
15
[+] score: 18
Downregulated HRMs were striking in that for the most part they displayed an associated lack of known targets in hMSC biology but miRs- miR-1246, -4484, -1909-3p, -3135b and miR-940 are known to target Nuclear factor 1 B-type or NFIB which plays a role in the promotion of cortical development and neuronal differentiation [55]. [score:9]
Up-regulated (miR-138-5p, -195-5p, -379-5p, -181a-2-3p, and miR-629-5p) and down-regulated (miR-1246, -4485, -3175, and miR-663a) miRNA expression was confirmed with quantitative stem loop RT-PCR in hMSC derived RNA from two independent donor bone marrow samples (Fig 2c and 2d, S2a and S2b Fig). [score:9]
[1 to 20 of 2 sentences]
16
[+] score: 18
Seven over-expressed microRNAs that were altered at least four fold, including hsa-miR-671-5p, hsa-miR-542-5p, hsa-miR-542-3p, hsa-miR-1185, hsa-miR-539, hsa-miR-148a and hsa-miR-301a, (Figure 4A) and six over-expressed microRNAs that were highly expressed (normalized data ≥6), including hsa-miR-1290, hsa-miR-136, hsa-miR-424, hsa-miR-30a, hsa-miR-148a and hsa-miR-1246 (Figure 4B), were selected for further qRT-PCR analyses. [score:7]
However, miR-1246 which was overexpressed in hepatic differentiation was underexpressed in osteogenic differentiation. [score:5]
The qRT-PCR results demonstrated that the expression patterns of hsa-miR-542-5p, hsa-miR-542-3p, hsa-miR-148a, hsa-miR-1290, hsa-miR-424, hsa-miR-30a and hsa-miR-1246 were consistent with the microarray results (Figure 4C). [score:3]
miR-1290 and miR-1246 were enriched in L02 and HepG2 cells, and their expression in hUC-MSC was gradually increased after induction to a level that was similar to that observed in L02 cells. [score:3]
[1 to 20 of 4 sentences]
17
[+] score: 16
For example, miR-21-5p was found to be significantly deregulated in colorectal cancer [25]; overexpression of miR-21-5p as a predictive marker for complete tumor regression to neoadjuvant chemo radiotherapy in rectal cancer patients [26]; overexpression of miR-638 inhibited the processes of tumor angiogenesis in vitro and in vivo [27]; miR-1246 was commonly upregulated in cancer cells by treatment with SAHA and DZNep and leading to apoptosis, cell cycle arrest and reduced migration of AGS and HepG2 cells [28]; miR-663a is upregulated by administration of the human cathelicidin AMP in the colon cancer cell line HCT-116, over -expression of miR-663a caused anti-proliferative effects both in vitro and in vivo [29]. [score:16]
[1 to 20 of 1 sentences]
18
[+] score: 13
Another study on the serum microRNA expression profile of esophageal cancer showed that the expression level of miR-1246 is higher in ESCC patients than in controls and that this expression level decreases after surgical resection. [score:7]
Takeshita N. Hoshino I. Mori M. Akutsu Y. Hanari N. Yoneyama Y. Ikeda N. Isozaki Y. Maruyama T. Akanuma N. Serum microRNA expression profile: miR-1246 as a novel diagnostic and prognostic biomarker for oesophageal squamous cell carcinoma Br. [score:3]
This finding supports the promising application of miR-23a and miR-1246 as diagnostic biomarkers [32]. [score:1]
Results showed that the sensitivity and specificity of miR-1246 were 71.3% and 73.9%, respectively, in distinguishing ESCC patients from healthy controls. [score:1]
The abundant exosomal circulating miR-1246 in serum significantly correlates with the ESCC tumor-node-metastasis stage, and it is the most potent independent risk factor for poor survival [33]. [score:1]
[1 to 20 of 5 sentences]
19
[+] score: 12
Different colors represent different experimental groups as indicated and the numbers 1, 2, 4, 5, 7 and 26 show the differentially expressed miRNAs that were significantly changed during infection with DENV-3 and ADE To further confirm our sequencing data, six significantly differentially expressed miRNAs, including hsa-miR-184, hsa-let-7e-5p, hsa-miR-132-3p, hsa-miR-155-5p, and hsa-miR-1246, were chosen for RT-qPCR analysis. [score:5]
Different colors represent different experimental groups as indicated and the numbers 1, 2, 4, 5, 7 and 26 show the differentially expressed miRNAs that were significantly changed during infection with DENV-3 and ADETo further confirm our sequencing data, six significantly differentially expressed miRNAs, including hsa-miR-184, hsa-let-7e-5p, hsa-miR-132-3p, hsa-miR-155-5p, and hsa-miR-1246, were chosen for RT-qPCR analysis. [score:5]
a. Quantitative real-time PCR verify of hsa-miR-1246 among III-8, III-24 and ADE-24. [score:1]
The levels of hsa-miR-1246 is the comparison of PBMC infected with DENV to PBMC infected with DENV-ADE. [score:1]
[1 to 20 of 4 sentences]
20
[+] score: 11
The authors also indicate that miR-1246 was not upregulated in ESCC tissue samples; however, this observation is consistent with the previously mentioned report of preferential exosome secretion of miR-1246 from breast cancer cells [49]. [score:4]
In serum obtained from esophageal squamous cell carcinoma (ESCC) patients, microRNA expression profiling showed that miR-1246 was consistently elevated in patients versus controls and was an independent risk factor for poor survival [111]. [score:3]
Overall, these exosomal microRNA profiling studies, summarized in Table 1, have found that microRNA expression signatures are not significantly different between TD-exosomes and tumor cells, with the exception of miR-1246, suggesting that these circulating TD-exosome microRNAs could be utilized as a surrogate for biopsy microRNA profiling. [score:3]
Specifically, the microRNAs, miR-451 and miR-1246, produced by malignant breast epithelial cells are released, whereas the majority of these microRNAs are retained in non-malignant mammary epithelial cells [49]. [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 11
Although scarce details are available on the role of miR-143 and 1246 in islet function, miR-143 was shown to be among the ten most abundant miRNAs expressed in human islets beta cells whereas miR-1246 was predominantly expressed in other islet cell types [35]. [score:5]
Notwithstanding, the “mut” allele generates binding sites for six alternative miRNAs (Table  1) of which four, miR-143 (3p and 5p), miR-490-3p, miR-1246, and miR-1261, were expressed in the human 1.1E7 pancreatic cell line (Fig.   5a). [score:3]
In contrast mouse islets only expressed miR-143 and very low levels of miR-1246 (Fig.   5b). [score:3]
[1 to 20 of 3 sentences]
22
[+] score: 10
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
[1 to 20 of 2 sentences]
23
[+] score: 9
p53 downregulates Down syndrome -associated DYRK1A through miR-1246. [score:4]
Serum microRNA expression profile: miR-1246 as a novel diagnostic and prognostic biomarker for oesophageal squamous cell carcinoma. [score:3]
Breast and ovarian tumor cells have been demonstrated to release >99% of miR451 and miR1246 produced by the cells (Pigati et al., 2010; Gercel-Taylor et al., 2013). [score:1]
miR1246 induces p53 -dependent apoptosis triggered by DNA damage (Zhang et al., 2011). [score:1]
[1 to 20 of 4 sentences]
24
[+] score: 8
MiR-1246 gene that encodes one of the most abundantly expressed miRNAs in FBS, is present in only 4 out of 223 species, including bovine, human, orangutan and chimpanzee, but not in mouse or rat 17. [score:3]
FBS-derived miR-1246 is detected in cultured mouse cells. [score:1]
MiR-122 was the most abundant miRNA in the FBS, followed by miR-1246, miR-423-5p, miR-148a-3p, and let-7 family (Fig. 1f). [score:1]
There are no sequences homologous to hsa-miR-1246 identified in the mouse genome. [score:1]
miR-1246 signal varied between the recipient cells lines, suggesting different levels of uptake and/or processing in the different cells. [score:1]
The miR-1246 signal was significantly reduced in cells that were switched to 10% vdFBS culture medium seven days prior to and undetectable in mouse tissues (Fig. 1h). [score:1]
[1 to 20 of 6 sentences]
25
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-100, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-10a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-215, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-194-1, hsa-mir-195, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-130b, hsa-mir-302c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-324, hsa-mir-451a, hsa-mir-483, hsa-mir-484, hsa-mir-486-1, hsa-mir-500a, hsa-mir-92b, hsa-mir-595, hsa-mir-596, hsa-mir-421, hsa-mir-378d-2, hsa-mir-744, hsa-mir-885, hsa-mir-939, hsa-mir-940, hsa-mir-1229, hsa-mir-1233-1, hsa-mir-1290, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-4286, hsa-mir-500b, hsa-mir-1233-2, hsa-mir-3935, hsa-mir-642b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j, hsa-mir-486-2
Takeshita N. Hoshino I. Mori M. Akutsu Y. Hanari N. Yoneyama Y. Ikeda N. Isozaki Y. Maruyama T. Akanuma N. Serum microRNA expression profile: miR-1246 as a novel diagnostic and prognostic biomarker for oesophageal squamous cell carcinoma Br. [score:3]
Takeshita et al. identified serum miR-1246 as a novel diagnostic and prognostic marker in ESCC patients using microRNA arrays [18]. [score:1]
Several circulating miRNAs, such as miR-27a, miR-642b, miR-885-5p, miR-22, miR-21, miR-483, miR-1246, miR-4644, miR-3976, and miR-4306, have been identified as novel diagnostic markers with acceptable availability in PCa patients [70, 71, 72, 73]. [score:1]
As described above, Takeshita et al. reported that serum miR-1246 is also a novel prognostic marker in ESCC patients [18]. [score:1]
They showed that serum miR-1246 correlated with the tumor depth, nodal metastasis, and distant metastasis (TNM stage) and identified it as an independent risk factor for poor survival [18]. [score:1]
Ogata-Kawata reported that the serum exosomal levels of seven miRNAs (let-7a, miR-1229, miR-1246, miR-150, miR-21, miR-223, and miR-23a) were significantly higher in primary CRC patients, even those with early stage, than in healthy controls. [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 8
The relationship between spontaneous apoptosis and baseline miRNA expression was examined by Pearson correlation analysis, resulting in significant negative correlations for 29 miRNAs, most of them expressed at high levels, including miR-29a-3p, let-7g-5p, miR-29b-3p, let-7f-5p, let-7a-5p, miR-26b-5p, miR-19b-3p, or miR-155-5p, and positive correlations for 9 miRNAs, all of them expressed at low levels, including miR-1246, or miR-638 (S4 Table). [score:7]
From this list, miR-1246 and miR-1290 were positively correlated with spontaneous apoptosis, further suggesting that they are candidates to play pro-apoptotic roles in CLL. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 8
Lu X et al. [67]confirmed that Bafilomycin A1 inhibits the growth and metastatic potential of the BEL-7402 liver cancer cells and induces miR-923, miR-1246, miR-149, miR-638 and miR-210 upregulation, which may represent promising targets for anti-cancer therapies. [score:8]
[1 to 20 of 1 sentences]
28
[+] score: 8
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-214, hsa-mir-126, hsa-mir-1228
Yamada N. Tsujimura N. Kumazaki M. Shinohara H. Taniguchi K. Nakagawa Y. Naoe T. Akao Y. Colorectal cancer cell-derived microvesicles containing microRNA-1246 promote angiogenesis by activating Smad 1/5/8 signaling elicited by PML down-regulation in endothelial cells Biochim. [score:4]
Similar discrepancy was also observed in human cancers; for example, Yamada et al. reported that miR-1246 was down-regulated in human colorectal cancer tissues and cell lines; however, the level of miR-1246 in the plasma from colorectal cancer patients was conversely elevated [18]. [score:4]
[1 to 20 of 2 sentences]
29
[+] score: 7
The expression profile of infected and uninfected cells was evaluated using a miRNA microarray, and 16 miRNAs were reported to be up-regulated (miR-4290, miR-4279, miR-625*, miR-let-7e, miR-1290, miR-33a, miR-3686, miR-378, miR-1246, miR-767-5p, miR-320c, miR-720, miR-491-3p, miR-3647, miR-451 and miR-4286) and 4 down-regulated (miR-106b, miR-20a, miR-30b and miR-3653) during dengue infection. [score:7]
[1 to 20 of 1 sentences]
30
[+] score: 7
Statistical analysis was made on Ct values normalized with a housekeeping gene; one-way ANOVA followed by Tukey’s HSD post hoc tests Three of the most down-regulated miRNAs in the metastatic group, revealed in tumour samples in our microarray analysis (cfa-miR-144, cfa-miR-32 and cfa-miR-374a), and hsa-miR-1246, known for its deregulation in plasma from human breast cancer patients [28], were chosen for the evaluation in plasma samples. [score:3]
Relative expression of cfa-miR-144, cfa-miR-32 cfa-miR-374a and hsa-miR-1246 in plasma samples from dogs with non-metastatic and metastatic tumours. [score:3]
P-value for hsa-miR-1246 amounts to 0.67. [score:1]
[1 to 20 of 3 sentences]
31
[+] score: 7
At 18 and 24-hour post-infection, miR-923, miR-1246, miR-574-3p, and miR-663 were up-regulated (>3-fold, p<0.05) in H5N1 infected cells. [score:4]
As a summary, miR-1246, miR-663 and miR-574-3p were up-regulated (>3-fold, p<0.05) at 24-hour post-infection with subtype H5 as compared with non-infected control cells. [score:3]
[1 to 20 of 2 sentences]
32
[+] score: 7
The production of autoantibodies by uncontrolled hyperactivated B cells is a hallmark of SLE, and the early B cell factor 1 (EBF1) has been shown to play a key role in the development, activation, and proliferation of B cells through the AKT signaling pathway [149], which has recently been identified as a target of miR-1246 [150]. [score:4]
The miR-1246 thus may be a novel biological target in SLE treatment [150]. [score:3]
[1 to 20 of 2 sentences]
33
[+] score: 6
From these, they discovered that inhibition of miR-1246, miR-196b-5p, and miR-320a, which were upregulated in infected cells, could prevent cell death. [score:6]
[1 to 20 of 1 sentences]
34
[+] score: 6
Other miRNAs from this paper: hsa-let-7b, hsa-mir-21, hsa-mir-27a, hsa-mir-148a, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-141, hsa-mir-126, hsa-mir-146a, hsa-mir-1-1, hsa-mir-155, hsa-mir-34b, hsa-mir-34c, hsa-mir-296, hsa-mir-370, hsa-mir-373, hsa-mir-342, hsa-mir-526a-1, hsa-mir-526a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-542, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-548q, hsa-mir-548s, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
The EV71 -induced miR-1246 directly repressed the expression of disc-large homolog 3 (DLG3), which is a member of the membrane -associated guanylate kinase protein family and is associated with mental disorders [95]. [score:4]
MiR-1246 might contribute to EV71 -associated neurological pathogenesis by targeting DLG3. [score:2]
[1 to 20 of 2 sentences]
35
[+] score: 6
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-574, hsa-mir-3646, hsa-mir-3658, hsa-mir-4438
From several differentially expressed miRNAs obtained from the microarray, we selected 5 upregulated miRNAs (has-miR-3646, has-miR-3658, has-miR-4438, miR-1246, and has-miR-574-3p) for RT-qPCR validation. [score:6]
[1 to 20 of 1 sentences]
36
[+] score: 6
Yuan D Xu J Wang J Extracellular miR-1246 promotes lung cancer cell proliferation and enhances radioresistance by directly targeting DR5Oncotarget. [score:6]
[1 to 20 of 1 sentences]
37
[+] score: 6
In our study, using microarray analyses in two different cell lines, we identified and confirmed two differentially expressed human miRNAs (hsa-miR-597 and hsa-miR-720) in HRT-18 and identified nine differentially expressed human miRNAs (hsa-miR-3142, hsa-miR-20a, hsa-miR-4301, hsa-miR-1290, hsa-miR-4286, hsa-miR-3182, hsa-miR-3142, hsa-miR-1246 and hsa-miR-720) in Caco-2 cells. [score:5]
In the Caco-2 cell line, we identified two human miRNAs (hsa-miR-3142 and hsa-miR-20a) and eight human miRNAs (hsa-miR-4301, hsa-miR-1290, hsa-miR-4286, hsa-miR-3182, hsa-miR-3142, hsa-miR-1246 and hsa-miR-720) after 12 and 24 h, respectively (p < 0.05, Figure 4C,D). [score:1]
[1 to 20 of 2 sentences]
38
[+] score: 5
Exosomal miR-1229, miR-1246, miR-150, miR-21, miR-223, and miR-2a are reported to be significantly up-regulated in CRC patients [13]. [score:4]
Another study demonstrated that the serum exosomal levels of seven miRNAs (let-7a, miR-1229, miR-1246, miR-150, miR-21, miR-223, and miR-23a) were significantly higher in CRC patients [13]. [score:1]
[1 to 20 of 2 sentences]
39
[+] score: 5
Of these, the top 20 expressed miRNA and their read counts in the duplicated samples are shown in Table 2. These include known disease associated miRNA species such as miR-451a [20, 21], miR-1246 [22], miR-423 [23], and miR-148a [24, 25] (Table 3). [score:5]
[1 to 20 of 1 sentences]
40
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Several analyses provided evidence that miRNA genes (miR-101, miR-145, miR-223, miR-384, miR-494, miR-509-3p, and miR-1246) regulate CFTR expression, as well as anion transport, particularly in patients with F508 del mutation [58, 59, 60, 61, 62]. [score:5]
[1 to 20 of 1 sentences]
41
[+] score: 5
While miR-1246 and miR-155 individually correlated well with AML in our mo del (Fig. 4), the analysis of multiple miRNA in combinations allowed us to arrive at the subset most representative of AML disease status. [score:3]
To identify linear combinations of serum miRNA markers that could distinguish engrafted from non-engrafted mice, we carried out a logistic regression mo del of engraftment status at day 14 and day 21 on every possible combination of the markers miR-150, miR-155, and miR-1246. [score:1]
In spite of the anticipated substantial inter-animal variability, this panel of miRNA reproducibly distinguished between cohorts (Fig. 4a): miR-155 was elevated in Molm-14- and CD34+-engrafted animals but not NSG controls, miR-150 separated Molm-14 from CD34+ engraftment, miR-221 was altered at late but not early leukemia time points, and miR-1246 increased over time in leukemia-, but not nonmalignant CD34+ cell-engrafted mice. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 5
In addition, a study on the interaction of miR-1246 with CCNG2 in pancreatic cancer found that a high expression of miR-1246 was correlated with a worse prognosis and that CCNG2 expression was significantly lower in those patients (34). [score:5]
[1 to 20 of 1 sentences]
43
[+] score: 5
The c-FLIP expression was also inhibited by mi -RNAs hsa-miR-1246, hsa-miR-320a and hsa-miR-196b-5p were induced in human umbilical vein endothelial cells [20]. [score:5]
[1 to 20 of 1 sentences]
44
[+] score: 5
An NNC mo del was built to generate a miRNA biomarker panel for BC diagnosis using the eight miRNAs listed in Table 1. Finally, three miRNAs, namely, miR-1246, mi R-6756-5 p, and miR-8073, were used to effectively extend the cascade (Fig. 2A). [score:1]
In conclusion, we constructed and validated an NNC -based biomarker panel comprising three miRNAs (miR-1246, miR-6756-5p, and miR-8073) for early detection of BC. [score:1]
The currently developed NNC mo del showed significantly higher accuracy ranging from 95.8% to 97.1% after integration of single miRNA, miR-8073, with the two miRNAs miR-6756-5p and miR-1246 that was validated as biomarkers for several cancers (Hannafon et al., 2016; Machida et al., 2016; Todeschini et al., 2017). [score:1]
L1–L3: Layers 1–3 of the NNC mo del; R1246: miR-1246; R6756-5p: miR-6756-5p; R8073: miR-8073; AUC values are shown above the layers. [score:1]
The authors validated the effectiveness of a biomarker panel comprising five miRNAs (miR-1246, miR-1307-3p, miR-4634, miR-6861-5p, and miR-6875-5p) for BC diagnosis with 89.7% accuracy. [score:1]
[1 to 20 of 5 sentences]
45
[+] score: 5
Subsets of mRNAs (SLC1A3, PRKAR2B, HYDIN, WDR65, PRDX1, and ADAMTS5) and miRNAs (miR-1246, miR-375, miR-410, and miR-758) that were identified as differentially expressed by the microarray analysis were selected for further validation (Figure 4). [score:3]
Four miRNAs (miR-1246, miR-375, miR-410, and miR-758) and six mRNAs (SLC1A3, PRKAR2B, HYDIN, WDR65, PRDX1, and ADATMS5) were selected to validate our miRNA and mRNA microarray data by qPCR. [score:1]
Several of the miRNAs (miR-1246 and miR-630) and genes (SLC1A3, PRKAR2B, and PRDX1) identified in our analysis have also been addressed in previous studies. [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 5
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-361, hsa-mir-384
For example, miR-1246 promotes cancer stemness including self-renewal, drug resistance, tumorigencity and metastasis by activation of Wnt/β-catenin pathway via suppressing the expression of AXIN2 and GSK3β [18]. [score:5]
[1 to 20 of 1 sentences]
47
[+] score: 5
Exosomal let-7a, miR-1229, miR-1246, miR-150, miR-21, miR-223 and miR-23a from colorectal tumor samples and cancer cell lines are more highly expressed than those from healthy controls samples and normal colon cell lines, and the expression levels of these miRNAs are significantly decreased in exosomes samples collected after tumor resection, indicating the cancer status (121). [score:5]
[1 to 20 of 1 sentences]
48
[+] score: 5
For example, hsa-miR-1246 and 513a-5p that are usually found up-regulated in all stroke subtypes with pre-existing risk factors [15] were found to be down regulated in cardioemblic stroke sample from a patient who had no apparent pre-existing risk factors (BE; Table 2). [score:5]
[1 to 20 of 1 sentences]
49
[+] score: 4
miR-1246 and six others were upregulated by more than 1.5-fold at any time point (Supplementary Fig.   5b). [score:4]
[1 to 20 of 1 sentences]
50
[+] score: 4
By performing microarray screening on exosomes, we found nine inflammatory miRNAs which were deregulated in sera of chronic alcohol-fed mice compared to controls including upregulated miRNAs: miRNA-192, miRNA-122, miRNA-30a, miRNA-744, miRNA-1246, miRNA 30b and miRNA-130a. [score:4]
[1 to 20 of 1 sentences]
51
[+] score: 4
For instance, focusing on T vs N up-regulated DEMs, miR-182 is involved together with miR-21, miR-18a, miR-1246 and miR-183 in the modulation of cancer-related pathways, and with miR-150 and miR-183 in the reprogramming of energy metabolism (purine and selenoaminoacid metabolism), in which various down-modulated DEGs were found, including ENTPD5 (Figure  2 and Additional file 1: Table S4). [score:4]
[1 to 20 of 1 sentences]
52
[+] score: 4
MiR-503 and five other miRNAs (miR-4417, miR-18a, miR-431, miR-1246, and miR-18b) were the only short RNAs, which showed significant upregulation through the normal to  adenoma (dysplasia) transition in our analysis. [score:4]
[1 to 20 of 1 sentences]
53
[+] score: 4
Seven human miRNAs (hsa-miR-1291, hsa-miR-1246, hsa-miR-1248, hsa-miR-1274b, hsa-miR-1973, hsa-miR-4284 and hsa-miR-3656) could be accurately mapped to other ncRNAs, which included snoRNAs, snRNAs, tRNAs and rRNAs (Table 1). [score:1]
They may have consensus sequences (hsa-mir-1291 and snoRNA_AJ609443) or show large divergences (hsa-mir-1246 and snRNA_X59360). [score:1]
But, the similarity between hsa-mir-1246 and snRNA_X59360 was fairly low (Figure 3B). [score:1]
Similarly, those miRNAs involved in cross-mapping events, such as hsa-miR-1246 and hsa-miR-4284 in Table 1 (their pre-miRNAs were classified as pseudo miRNA precursors according to the miPred web server), could also be miRNA -mimics that may be by-products of other ncRNAs. [score:1]
[1 to 20 of 4 sentences]
54
[+] score: 4
p53 downregulates Down syndrome -associated DYRK1A through miR-1246. [score:4]
[1 to 20 of 1 sentences]
55
[+] score: 4
[36] Further studies indicated that p53 performs its function through regulating the expression of a range of miRNAs, such as miR-605, [37] miR-1246, [38] and miR-107. [score:4]
[1 to 20 of 1 sentences]
56
[+] score: 3
Yamada N. Tsujimura N. Kumazaki M. Shinohara H. Taniguchi K. Nakagawa Y. Naoe T. Akao Y. Colorectal cancer cell-derived microvesicles containing microrna-1246 promote angiogenesis by activating smad 1/5/8 signaling elicited by pml down-regulation in endothelial cells Biochim. [score:3]
[1 to 20 of 1 sentences]
57
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-100, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-139, hsa-mir-10b, hsa-mir-34a, hsa-mir-182, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-221, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-134, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-154, hsa-mir-320a, hsa-mir-155, hsa-mir-128-2, hsa-mir-200a, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-302c, hsa-mir-367, hsa-mir-370, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-379, hsa-mir-328, hsa-mir-151a, hsa-mir-135b, hsa-mir-335, hsa-mir-133b, hsa-mir-449a, hsa-mir-451a, hsa-mir-410, hsa-mir-486-1, hsa-mir-146b, hsa-mir-520f, hsa-mir-518d, hsa-mir-517c, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-584, hsa-mir-602, hsa-mir-629, hsa-mir-638, hsa-mir-449b, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-298, hsa-mir-1908, hsa-mir-718, hsa-mir-2861, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-4728, hsa-mir-4734, hsa-mir-378j, hsa-mir-6165, hsa-mir-486-2
Allenson et al. (2017) CD44v6, Tspan8, EpCAM, MET, CD104, CD184, Tspan8, CD24, CD133, CD9, CD63, CD151, MiR-1246, MiR-4644, MiR-3976, and MiR-4306Blood collection samples from 131 PaCa, 25 chronic pancreatitis (CP), 22 benign pancreatic tumor and 12 patients with non-PaCa, and 30 volunteers The human PaCa tumor cell lines AsPC1, Capan1, Panc1, ExPC3, A818 cells qRT-PCR analysis, Flow cytometry assay, and Microarray miRNA analysis MiR-1246, miR-4644, miR-3976, and miR-4306 were significantly upregulated in 83% of PaCa serum-exosomes, but rarely in control groups. [score:3]
[1 to 20 of 1 sentences]
58
[+] score: 3
Zhang WC Tumour-initiating cell-specific miR-1246 and miR-1290 expression converge to promote non-small cell lung cancer progressionNat. [score:3]
[1 to 20 of 1 sentences]
59
[+] score: 3
Therefore, we selected both miR-1246 and miR-374b-5p as the best pair of reference genes. [score:1]
miR-1246 and miR-374b-5p were identified as the two miRNAs with the lowest variability across all samples without considering the designated groups (Fig.   2B). [score:1]
The two endogenous references, miR-1246 and miR-374b-5p, were empirically selected based on the NormFinder algorithm (Fig.   2). [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 3
Other miRNAs from this paper: hsa-mir-30b, hsa-mir-320a, hsa-mir-155, hsa-mir-196b
Hsa-miR-1246, hsa-miR-320a and hsa-miR-196b-5p inhibitors can reduce the cytotoxicity of Ebola virus glycoprotein in vitro. [score:3]
[1 to 20 of 1 sentences]
61
[+] score: 3
Zhang W. C. Chin T. M. Yang H. Nga M. E. Lunny D. P. Lim E. K. Sun L. L. Pang Y. H. Leow Y. N. Malusay S. R. Tumour-initiating cell-specific mir-1246 and mir-1290 expression converge to promote non-small cell lung cancer progressionNat. [score:3]
[1 to 20 of 1 sentences]
62
[+] score: 3
The and mRNA associations are further summarised in Table  4. Table 4 Summary of NF-κB signalling pathway gene expression and associations Genes with seed-region match Genes without seed-region match miR-1246 PLCG1 miR-1271-5p TRAF5 miR-130b-3p PLCG1 miR-133b CXCL12 miR-145-5p CXCL12 miR-146a-5p TRAF5 miR-150-5p BTK, CXCL2, PRKCB, BCL2, PLCG2, CD40, ZAP70, CCL21 miR-17-5p PLCG1, TNFRSF11A miR-193b-3p CXCL12, TNFRSF11A, IL1R1 miR-195-5p BCL2. [score:3]
[1 to 20 of 1 sentences]
63
[+] score: 3
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
One-base-shift forms of miR-9*, miR-148b* and miR-1246 showed higher expression than the reference forms in both metastatic and non-metastatic lines. [score:3]
[1 to 20 of 1 sentences]
64
[+] score: 3
MiR-1246 modulated pulmonary endothelial cell apoptosis through targeted regulating angiotensin-converting enzyme 2 (ACE2) in LPS -induced ALI [24]. [score:3]
[1 to 20 of 1 sentences]
65
[+] score: 2
For example, miR-1246 was found to have one of the highest CVs in each biofluid. [score:1]
miR-1246 had a high CV in all biofluids. [score:1]
[1 to 20 of 2 sentences]
66
[+] score: 2
Other miRNAs from this paper: hsa-mir-181c, hsa-mir-132, rno-mir-132, rno-mir-181c
NSC-derived EVs might be involved in the maintenance of self-renewal of NSCs because their regeneration ability by the transfer of stem cell-derived mRNA was reported in a study of other stem cell-derived EVs (Katsman et al., 2012); EVs from a human NSC line shuttled miRNA-1246, which is known to play a role in regulating cell growth (Stevanato et al., 2016). [score:2]
[1 to 20 of 1 sentences]
67
[+] score: 1
For exosomes, the sequences that stand out include hsa-mir-1246, hsa-mir-451, chr6. [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
We note that miRDeep2 erroneously missed counting of bta-mir-1246 in the known list and assigned this as a novel miRNA; the reason for this is unclear. [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-99a, mmu-mir-140, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-192, hsa-mir-148a, hsa-mir-30d, mmu-mir-122, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-122, hsa-mir-140, hsa-mir-191, hsa-mir-320a, mmu-mir-30d, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-22, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-92a-2, mmu-mir-25, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-92a-1, hsa-mir-26a-2, hsa-mir-423, hsa-mir-451a, mmu-mir-451a, hsa-mir-486-1, mmu-mir-486a, mmu-mir-423, bta-mir-26a-2, bta-let-7f-2, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-140, bta-mir-92a-2, bta-let-7d, bta-mir-191, bta-mir-192, bta-mir-22, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-mir-122, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-24-1, bta-mir-26a-1, bta-mir-451, bta-mir-486, bta-mir-92a-1, bta-mir-181a-1, bta-mir-320a-1, mmu-mir-486b, hsa-mir-451b, bta-mir-1246, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2
There were three microRNAs (bta-miR-1246, bta-miR-21-5p, and bta-miR-320a) that were identified in the present study, but unreported by. [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
While 44 miRNAs showed a greater enrichment in the cytosolic Hy3-labeled RNA fraction, 13 miRNAs were significantly and reproducibly enriched in the mitochondrial Hy5-labeled RNA sample (ranging from 1.5- to 56-fold), namely hsa-miR-1973, hsa-miR-1275, hsa-miR-494, hsa-miR-513a-5p, hsa-miR-1246, hsa-miR-328, hsa-miR-1908, hsa-miR-1972, hsa-miR-1974, hsa-miR-1977, hsa-miR-638, hsa-miR-1978 and hsa-miR-1201 (Figure 5A). [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
In another study, three miRNAs (miR-720, miR-1308 and miR-1246) showed a good specificity in distinguishing MM or MGUS from healthy individuals and also in differentiating MM from MGUS [21]. [score:1]
[1 to 20 of 1 sentences]
72
[+] score: 1
Among these, miR-1246 was the most abundant with >13,000 sequencing reads detected. [score:1]
[1 to 20 of 1 sentences]
73
[+] score: 1
They identified 6 serum miRNAs that can predict LNM in cervical SCC patients: miR-1246, miR-20a, miR-2392, miR-3147, miR-3162-5p and miR-4484. [score:1]
[1 to 20 of 1 sentences]
74
[+] score: 1
Also present were miR-1777b (6.71%), miR-1777a (4.88%), miR-1246 (4.42%), miR-126-3p (2.44%), miR-2305 (2.07%), miR-1584-5p (1.90%), miR-2413 (1.74%), miR-4286 (1.58%), miR-1224 (1.56%), and miR-451 (1.41%). [score:1]
[1 to 20 of 1 sentences]
75
[+] score: 1
The comprehensive set of serum miRNAs (miR-1246, miR-20a, miR-2392, miR-3147, miR-3162-5p and miR-4484) have great potential to serve as potential biomarkers for LNM in early-stage squamous cell carcinoma, with an AUC of 0.992, a sensitivity of 0.967 and a specificity of 0.950 [22]. [score:1]
[1 to 20 of 1 sentences]
76
[+] score: 1
For example, 72.60% of hsa-mir-1246 with its downstream sequence was derived from 147 bp to 208 bp of MLT1M. [score:1]
[1 to 20 of 1 sentences]
77
[+] score: 1
Among these miRNAs, miR-146a-5p and miR-29a-3p are the most abundant, while miR-1246 and miR-1290 are most enriched (>10-fold) in EVs. [score:1]
[1 to 20 of 1 sentences]
78
[+] score: 1
Other miRNAs found in our study to be affected during senescence (Fig. 3), but not reported in previous senescence studies, include miR-1246, miR-584 and miR-323, which are implicated in certain cancers [55]– [57]. [score:1]
[1 to 20 of 1 sentences]
79
[+] score: 1
Recently, several studies have indicated that some miRNAs [34], such as miR-21 [35], miR-155 [36], miR-320c [18] and miR-1246 [37], have been involved in the induction of chemoresistance in PDAC. [score:1]
[1 to 20 of 1 sentences]
80
[+] score: 1
Other miRNAs from this paper: hsa-let-7b, hsa-mir-21, hsa-mir-10b, hsa-mir-122, hsa-mir-132
For example, full-length U2 snRNA (RNU2-1), which also serves as a precursor for miR-1246 [31], and specific tRNAs are also released to a lesser extent in extracellular fractions than their corresponding processed products (Fig.   6f). [score:1]
[1 to 20 of 1 sentences]
81
[+] score: 1
They found that the bulk of miR-451 and miR-1246 produced by malignant cells was selectively released into blood particularly, but the majority of these miRNAs produced by normal cells were retained intracellularly [71]. [score:1]
[1 to 20 of 1 sentences]
82
[+] score: 1
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3
Among them, the increase of miR-7-5p and miR-1246 is sustained from 4 hr to 8 hr after irradiation. [score:1]
[1 to 20 of 1 sentences]
83
[+] score: 1
Moreover, the histone demethylase Jarid1b could also repress let-7e as well as miR-1246, miR-1826, and miR-361-5p by removing the active mark H3K4me3 in breast cancer [34]. [score:1]
[1 to 20 of 1 sentences]