sort by

6 publications mentioning hsa-mir-1302-6

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-1302-6. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 121
Because the functions of miR-1302 have been predicted and predictions notoriously produce a large number of false -positives, a better method to assign a function to miR-1302 would be to combine the expression profiles of the miRNAs and the target genes. [score:5]
Click here for file Targets, conserved sites and poorly conserved sites of miR-1302 predicted by TargetScan. [score:5]
Furthermore, we have found that the predicted target genes of miR-1302 are over-represented in transportation, localization, and in system development processes as well as in the positive regulation of cellular processes. [score:5]
Finally, we have found that the target genes of miR-1302 are over-represented in transportation, localization, and system development processes and in the positive regulation of cellular processes. [score:5]
Click here for file Targets and target sites of miR-1302 predicted by PITA in the human genome. [score:5]
Two programs, PITA [41] and TargetScan [42, 43], were used to identify potential target sites of hsa-miR-1302. [score:5]
Targets and target sites of miR-1302 predicted by PITA in the human genome. [score:5]
Targets, conserved sites and poorly conserved sites of miR-1302 predicted by TargetScan. [score:5]
The target genes of miR-1302 are over-represented in functions that require the binding of metal ions and binding to DNA. [score:3]
To determine the functions and pathways that may involve hsa-miR-1302, all the valid targets of hsa-mir-1302 were annotated using WebGestalt [44] and KEGG [45]. [score:3]
We have analyzed the targets of the mature human miR-1302 in an attempt to explore its potential function. [score:3]
The miR-1302 gene and the neighboring genes in each duplication region are shown in Additional file 5. In each of the segmental duplication pairs, the gene members are similar and the gene order is either identical or in the opposite direction (see Additional file 5 and Figure S4 in Additional File 1). [score:2]
When the hsa-mir-1302-2 gene underwent duplication, as part of the evolution process, it is possible that mutations occurred resulting in a new gene, hsa-mir-1302-3. Because they have not been found in regions of segmental duplication, the other hsa-mir-1302 genes may be products of MER53 transposition events alone. [score:2]
When the hsa-mir-1302-2 gene underwent duplication, as part of the evolution process, it is possible that mutations occurred resulting in a new gene, hsa-mir-1302-3. Because they have not been found in regions of segmental duplication, the other hsa-mir-1302 genes may be products of MER53 transposition events alone. [score:2]
Because, in placental species many miR-1302 genes have been gained and lost, we have proposed that their development proceeded according to the birth-and-death mo del of evolution. [score:2]
In placental species, many miR-1302 genes have been gained and lost, indicating that they may have evolved following the birth-and-death mo del of evolution. [score:1]
In addition, in the tarsier genome the orthologs of miR-1302-1 and miR-1302-6 are further diverged than other miRNA genes (Figure 2). [score:1]
Under the birth-and-death mo del, the miR-1302 genes have experienced a complex expansion with some members evolving by segmental duplications and some by Alu -mediated recombination events. [score:1]
Here we report a microRNA family, the miR-1302 family, which originates from the DNA transposable element, MER53. [score:1]
The nomenclature for some members of the hsa-mir-1302 family differs between miRBase v13.0 and that in later releases. [score:1]
The members of miR-1302 family that are derived from MER53 elements are placental-specific miRNAs. [score:1]
It is interesting that all 11 of the MER53-derived miRNA genes that we identified, developed into one mature miRNA, hsa-miR-1302 (5'UUGGGACAUACUUAUGCUAAA3'). [score:1]
Here we report our study of the miR-1302 gene family that has been experimentally verified in the human genome [23]. [score:1]
In miRBase v13.0, there were eight members of the hsa-mir-1302 family. [score:1]
To identify potential paralogs of MER53-derived miR-1302 genes, we developed a three-step operational scheme. [score:1]
Click here for file The sequences of orthologs of the human miR-1302 family in 21 placental mammals. [score:1]
By comparing the genomic coordinates of human miRNAs from miRBase v13.0 [27] with the locations of repeats annotated by RepeatMasker [28] in the human genome, we found 11 MER53-derived miRNA genes that can encode hsa-mir-1302-1, hsa-mir-1302-2 (four copies on different chromosomes), hsa-mir-1302-3, hsa-mir-1302-4, hsa-mir-1302-5, hsa-mir-1302-6, hsa-mir-1302-7 and hsa-mir-1302-8 (Figure 1, Table 1 and Figure S1 in Additional File 1). [score:1]
By comparing the coordinates, we determined whether human miR-1302 genes were located in regions of segmental duplications. [score:1]
Figures of the distribution of members of hsa-mir-1302 family on the human chromosomes; Alignments of two MER53 elements and corresponding derived miRNA genes; Distribution relationship between segmental duplications (SD) and Alus and miR-1302 genes in the human genome. [score:1]
Click here for file Genome-wide Identification by MiPred of Potential Paralogs of MER53-derived miR-1302 Genes. [score:1]
Because eutherian mammals diverged from marsupials and monotremes 180 and 210 million years ago, respectively [31], the homologs of the hsa-mir-1302 family in placental mammals may all be derived from MER53 elements, explaining why homologs of the mir-1302 family are not found in opossum and platypus (Figure 2). [score:1]
We used Circos v0.52 [68] to show the relationships between segmental duplications harboring miR-1302 genes. [score:1]
The IDs of the other members of the miR-1302 family are unchanged. [score:1]
We therefore hypothesize that, in addition to the MER53 transposition effect, segmental duplication events may have contributed to the expansion of the hsa-mir-1302 family. [score:1]
Phylogenetic Distribution of Orthologs of the Human miR-1302 Family. [score:1]
Segmental duplication events have facilitated the expansion of the miR-1302 family while the expansion of these segmental duplications may also have been facilitated by Alu-Alu -mediated recombination events. [score:1]
However, this mechanism apparently does not apply to other members of the human miR-1302 family or to potential paralogs in the human genome. [score:1]
The sequences of orthologs of the human miR-1302 family in 21 placental mammals. [score:1]
Although the conservation scores of the MER53-derived pre-miRNA sequences are low, we have identified 36 potential paralogs of MER53-derived miR-1302 genes in the human genome and 58 potential orthologs of the human miR-1302 family in placental mammals. [score:1]
It should be noted that the parsimony reconstruction of gain and loss of the miR-1302 genes is influenced by the fact that the miR-1302 genes were first identified in the human genome and the orthologs in other species were identified using computational approaches. [score:1]
To test our hypothesis that, in addition to the effect of MER53 transposition, SD events may contribute to the expansion of the hsa-mir-1302 family, we analyzed the segmental duplication data that were pre-computed by Bailey and his colleagues [66] and that we downloaded from the UCSC Genome Browser [52]. [score:1]
Genome-wide Identification of Potential Paralogs of MER53-derived miR-1302 Genes. [score:1]
Figure 2 Phylogenetic distribution of orthologs of the hsa-mir-1302 family. [score:1]
To determine if they were also formed by segmental duplication events, we analyzed the 36 paralogs of the hsa-mir-1302 family that we identified in the human genome (Additional File 2). [score:1]
During evolution, many miR-1302 genes have been gained and lost (Figure 2). [score:1]
Some of the eleven members of the hsa-mir-1302 family are remarkably similar. [score:1]
The function of hsa-miR-1302 is still unknown. [score:1]
: miR, miRNA; Gap, a gap in the genome; Large insertion, an insertion of more than 100 bp, except for a 17 bp insertion in the ortholog of hsa-mir-1302-4 in Pika; Ortholog not miR, the ortholog is not a miRNA; Ortholog and miR, the ortholog has been validated as a miRNA; MIR1-MIR8, the orthologs of hsa-mir-1302-1, hsa-mir-1302-2, hsa-mir-1302-3, hsa-mir-1302-4, hsa-mir-1302-5, hsa-mir-1302-6, hsa-mir-1302-7, and hsa-mir-1302-8 respectively. [score:1]
To estimate the gain and loss of miR-1302 genes during evolution, we have used the previously reported parsimony method [32] to infer that miR-1302-1, miR-1302-2, miR-1302-4, miR-1302-5, miR-1302-6, miR-1302-7, and miR-1302-8 evolved after the MER53 elements had been inserted and fixed. [score:1]
Potential Paralogs of the miR-1302 Family in the Human Genome. [score:1]
The orthologs of the eight members of the hsa-mir-1302 family in different organism were retrieved from the Multiz alignments of 44 vertebrate species [56]. [score:1]
As miR-1302 was first identified in pluripotent human embryonic stem cells and embryoid bodies [23] and is enriched in pathways to cancer, it may influence the biological processes taking place in stem cells, in tumor cells and in the early embryo. [score:1]
We have shown that all members of the miR-1302 family are derived from MER53 elements. [score:1]
Thus, we have identified 36 MER53 elements that may encode miRNAs belonging to the miR-1302 family and that have not yet been reported in the human genome. [score:1]
In the present study, we have focused on the precursors of human miR-1302. [score:1]
Eight of the 44 potential sequences overlap with experimentally verified miR-1302 precursor sequences [23] that are distributed on different chromosomes (Additional File 2). [score:1]
The 103 orthologs (Figure 2) of the hsa-mir-1302 family, identified as described in Materials and, were only found in placental mammals, suggesting that the miR-1302 family is a placental-specific gene family. [score:1]
The list includes 58 orthologs of the human miR-1302 family in 21 placental species predicted as pre-miRNAs by computational method. [score:1]
Genome-wide Identification by MiPred of Potential Paralogs of MER53-derived miR-1302 Genes. [score:1]
Overall, we have identified 36 novel potential paralogs of miR-1302 genes in the human genome and 58 orthologs of the human miR-1302 genes in 21 placental species. [score:1]
Except for hsa-1302-2 and hsa-1302-3 that are produced from recent segmental duplication events and cluster together, the miR-1302 genes do not show a within-species clustering pattern (Figure S2 in Additional File 1). [score:1]
Phylogenetic Distribution of the Orthologs of MER53-derived miR-1302 Genes. [score:1]
Pairwise p- distances for the 58 orthologs of the human miR-1302 family in 21 placental species. [score:1]
The rows with grey backgrounds are already known precursors of hsa-miR-1302 that were found to be derived from MER53 elements. [score:1]
Segmental Duplication and Alu Repeats Mediate the Expansion of the miR-1302 Gene in the Human Genome. [score:1]
To find out if the segmental duplications that harbor miR-1302 genes are produced by Alu -mediated recombination events, we examined sequence features at the junctions of duplications. [score:1]
The relationships are shown between the 10 duplication pairs where the miR-1302 genes located on chromosomes 1, 9, 15 and 19 are linked by green lines. [score:1]
In our study, the average phastCons conservation scores of hsa-mir-1302 members are much lower than the thresholds used in previous studies (Table 1) [21, 29]. [score:1]
Because quite a few orthologs of the precursors of human miR-1302 are found (See Additional File 3) in eutherian mammals, we suggest that the MER53 elements and MER53-derived miRNA genes may have evolved after eutherian mammals diverged from marsupials and monotremes as recently as 180 million years ago. [score:1]
The number of possible target sites for human miR-1302 in all human coding genes was calculated after removing the coordinates of overlapping genes. [score:1]
Next, the phylogenetic distribution and evolution dynamics of the miR-1302 family were analyzed. [score:1]
We found that, like most of the members of the hsa-mir-1302 family, none of them were located in regions of segmental duplications. [score:1]
This is powerful evidence supporting our thesis that the miR-1302 gene and its neighbors evolved by segmental duplication events. [score:1]
In this study, we report the origin and evolution of the miR-1302 family in the human genome. [score:1]
However, we find that the average conservation scores for the miR-1302 genes are very low (Table 1). [score:1]
cja-mir-1302-5, ggo-mir-1302-6 and ggo-mir-1302-7 were detected by the BLAT program with best reciprocal hits. [score:1]
Our data show that all members of miR-1302 family are derived from MER53 elements and we have proposed that they emerged at the early stage of the recent 180 million years since eutherian mammals diverged from marsupials. [score:1]
Only hits with exact matches in the "seed region" (nucleotides 2-8) of miR-1302 were selected and two potential miR-1302 precursor sequences of length 110 nt harboring the "seed region" were excised from the hit sequences using a method similar to that described earlier [55]. [score:1]
Combining the evolutionary divergence between sequences information (Additional file 4) and the results of previous analysis, we can infer that the miR-1302 genes evolved in a birth-and-death manner. [score:1]
[1 to 20 of 79 sentences]
2
[+] score: 7
Lastly, the authors also explored the targets of the mature human miR-1302 and found 1835 genes with predicted function in transportation, localization, system development processes and their regulation, as well as in binding and in transcription regulation [23]. [score:6]
Further analysis of the phylogenetic distribution and evolution dynamics of the miR-1302 family identified 36 potential paralogs of MER53-derived miR-1302 genes in the human genome and another 58 potential orthologs in placental mammals and showed that these members of the hsa-mir-1302 family emerged within the last 180 million years since placental mammals diverged from marsupials. [score:1]
[1 to 20 of 2 sentences]
3
[+] score: 6
The instances of MER53 that are highly expressed and conserved among primates do not overlap with annotated miR-1302 transcripts, however the annotated transcripts are only ones that have been experimentally validated. [score:3]
Notably, this TE family has previously been shown to be the source of a placental-specific family of miRNAs [34], the miR-1302 family, and to be expressed in human embryonic stem cells [35]. [score:3]
[1 to 20 of 2 sentences]
4
[+] score: 5
Yuan et al. reported that the highest expression level of miR-1302 target genes was in the nervous system and the genes were enriched in both synapses and intracellular membrane-bounded organelles [26]. [score:5]
[1 to 20 of 1 sentences]
5
[+] score: 2
Other miRNAs from this paper: hsa-mir-25, hsa-mir-28, hsa-mir-95, mmu-mir-151, mmu-mir-290a, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-130b, mmu-mir-340, mmu-mir-25, mmu-mir-28a, hsa-mir-130b, hsa-mir-367, hsa-mir-372, hsa-mir-378a, mmu-mir-378a, hsa-mir-340, hsa-mir-151a, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-505, hsa-mir-506, mmu-mir-367, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-648, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-659, hsa-mir-421, hsa-mir-151b, hsa-mir-1271, hsa-mir-378d-2, mmu-mir-467b, mmu-mir-297b, mmu-mir-505, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-421, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-92b, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-669g, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, mmu-mir-1195, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1289-1, hsa-mir-1289-2, hsa-mir-548k, hsa-mir-1299, hsa-mir-548l, hsa-mir-1302-1, hsa-mir-1302-2, hsa-mir-1302-3, hsa-mir-1302-4, hsa-mir-1302-5, hsa-mir-1302-7, hsa-mir-1302-8, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1255a, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-1268a, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1255b-1, hsa-mir-1255b-2, mmu-mir-1906-1, hsa-mir-1972-1, hsa-mir-548q, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-3116-1, hsa-mir-3116-2, hsa-mir-3118-1, hsa-mir-3118-2, hsa-mir-3118-3, hsa-mir-548s, hsa-mir-378b, hsa-mir-466, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-3156-1, hsa-mir-3118-4, hsa-mir-3174, hsa-mir-3179-1, hsa-mir-3179-2, hsa-mir-3179-3, hsa-mir-548w, hsa-mir-3156-2, hsa-mir-3156-3, hsa-mir-548x, mmu-mir-3470a, mmu-mir-3470b, mmu-mir-3471-1, mmu-mir-3471-2, hsa-mir-378c, hsa-mir-1972-2, hsa-mir-1302-9, hsa-mir-1302-10, hsa-mir-1302-11, mmu-mir-1906-2, hsa-mir-3683, hsa-mir-3690-1, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-1268b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, mmu-mir-28c, mmu-mir-378b, mmu-mir-28b, hsa-mir-548ao, hsa-mir-548ap, mmu-mir-466q, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, mmu-mir-378c, mmu-mir-378d, hsa-mir-548ay, hsa-mir-548az, hsa-mir-3690-2, mmu-mir-290b, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-3179-4, mmu-mir-466c-3, hsa-mir-548bc, mmu-mir-1271
Examples of this are the mir-297, mir-466, mir-467, mir-548 [16], mir-1302 [20], mir-1972, mir-3118 and mir-3179 families (which are all RrmiR families listed here) (Table S5). [score:1]
For example, the mir-548 family (derived from MADE1 element) is primate-specific [16] and the mir-1302 family (derived from MER53 element) is a placental-specific miRNA family [20]. [score:1]
[1 to 20 of 2 sentences]
6
[+] score: 1
Zhang et al. reported that SNPs in miR-1302 -binding site of CGA increased the risk of idiopathic male infertility [13]. [score:1]
[1 to 20 of 1 sentences]