sort by

60 publications mentioning hsa-mir-374b

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-374b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 159
Other miRNAs from this paper: hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-145, hsa-mir-410
Binding of CCL3 to CCR5 receptor inhibits miR-374b expression by activating JNK, ERK, and p38 signaling pathways, which subsequently promotes VEGF-A expression and angiogenesis. [score:7]
In the present study we found that JNK, ERK, and p38 inhibitor or siRNA reversed CCL3 -inhibited miR-374b expression, suggesting that CCL3 reduced miR-374b via JNK, ERK, and p38 pathways. [score:7]
CCL3 increases angiogenesis and up-regulation of VEGF-A expression by down -regulating miR-374b through JNK, p38, and ERK pathways in human osteosarcoma cells (Fig. 7). [score:7]
We found that the mRNA expression of CCL3 has positive correlation with VEGF-A (Fig. 6F), and the miR-374b expression has negative correlation with CCL3 and VEGF-A expression (Fig. 6G and 6H). [score:7]
These results demonstrated that CCL3 promotes angiogenesis through down-regulation of miR-374b expression. [score:6]
Figure 7 CCL3 activates CCR5 receptor and JNK, ERK, or p38 pathway, then down -regulating miR-374b expression, which leads to VEGF-A expression and increases the angiogenesis of human osteosarcoma cells. [score:6]
In addition, the expression of miR-374b has negative correlation with CCL3 and VEGF-A in osteosarcoma patients, suggesting miR-374b plays a negative regulator in CCL3 -induced VEGF-A expression and angiogenesis. [score:6]
CCL3 promotes VEGF-A expression and angiogenesis by downregulating miR-374b. [score:6]
CCL3 promotes VEGF-A expression and angiogenesis by down -regulating miR-374b expression. [score:6]
CCL3 activates CCR5 receptor and JNK, ERK, or p38 pathway, then down -regulating miR-374b expression, which leads to VEGF-A expression and increases the angiogenesis of human osteosarcoma cells. [score:6]
However, we found that miR-145, miR-29b and miR-410 only have less regulated by CCL3, and we revealed another miRNA (miR-374b) that could target VEGF-A, and inhibit angiogenesis in human osteosarcoma cells. [score:6]
MicroRNA-374b (miR-374b) promotes gastric cancer cell invasion and metastasis by suppressing RECK expression [23]. [score:5]
Matrigel plugs assay was performed to confirm CCL3 -mediated angiogenesis by down-regulation of miR-374b expression in vivo. [score:5]
Data show that CCL3 inhibits miR-374b expression dose -dependently. [score:5]
Here we show that CCL3 enhances tumor angiogenesis and VEGF-A expression by dysregulation of miR-374b via the JNK, ERK, and p38 pathways in human osteosarcoma. [score:4]
To determine whether CCL3-reduced miR-374b regulates VEGF-A expression by binding to VEGF-A 3′ UTR, we constructed luciferase reporter vectors harboring the wild-type (pmirGLO-VEGF-A-WT; WT) or mutant (pmirGLO-VEGF-A-MUT; MUT) 3′ UTR of the VEGF-A, which has miR-374b binding site (Supplementary Fig. S5), and transfected into MG-63 and U-2 OS cells. [score:4]
Direct application of CCL3 in MG-63 and U-2 OS cells for 24 h reduced miR-374b expression dose -dependently (Fig. 5A). [score:4]
We ranked the top 24 miRNAs that harboring the binding sites of VEGF-A. After stimulation with CCL3, we found miR-374b was the most down-regulated in response to CCL3 (Supplementary Table S1), which is also conserved across species (Supplementary Fig. S3). [score:4]
These data suggests that CCL3 induces VEGF-A expression and angiogenesis by down -regulating miR-374b through JNK, p38, and ERK pathways. [score:4]
Besides, we also detected the expression of miR-374b in Control- and CCL3-shRNA stabled cells. [score:3]
Transfection with miR-374b mimic halted CCL3 -mediated VEGF-A expression. [score:3]
E. Cells were pre -treated with SP600125, U0126, SB203580 for 30 min or pre-transferated with JNK-, ERK-, p38-, or multiple (combining JNK-, ERK-, and p38-) siRNA for 24 h, then treated cells with CCL3 (10 ng/mL) for 24 h. The miR-374b expression was detected by RT-qPCR. [score:3]
Besides, cells pre -treated with SP600125, U0126, and SB203580 or pre -transfected with JNK-, ERK-, and p38-siRNA reversed CCL3-reduced miR-374b expression (Fig. 5E and Supplementary Fig. S6). [score:3]
Overexpression of miR-374b mimic attenuates the mRNA level of VEGF-A in PC-3 prostate cancer cells [24]. [score:3]
In the provided concentration, these inhibitors, siRNA, or miR-374b mimic did not significantly affect cell viability. [score:3]
Particularly, combining multiple (JNK-, ERK-, and p38-) siRNAs returned miR-374b expression in osteosarcoma cells (Fig. 5E). [score:3]
We found that transfection with miR-374b mimic abolished CCL3 -induced VEGF-A expression and tube formation in EPCs (Fig. 5C and 5D). [score:3]
A. Cells were treated with CCL3 (1-10 ng/mL) for 24 h, and miR-374b expression was detected by RT-qPCR. [score:3]
Figure 5 A. Cells were treated with CCL3 (1-10 ng/mL) for 24 h, and miR-374b expression was detected by RT-qPCR. [score:3]
Cells were then treated with CCL3 alone for 24 h, or pretreated with pharmacological inhibitors, or transfected with specific siRNA, or miR-374b mimic followed by stimulation with CCL3 for 24 h. After treatment, the medium was removed and stored at −80°C. [score:3]
We found that the expression of miR-374b was elevated >3-folds in CCL3-shRNA than Control-shRNA cells (Supplementary Fig. S4). [score:3]
Osteosarcoma cells were either treated with CCL3 alone for 24 h or were pretreated with pharmacological inhibitors, siRNA, or miR-374b mimic followed by stimulation with CCL3 for 24 h. The cells were washed and transferred to serum-free medium after treatment. [score:3]
C. Cells were transfected with miR-374b mimic for 24 h, and then incubated with CCL3 (10 ng/mL), and the VEGF-A expression was detected by ELISA kit. [score:3]
MiR-374b mimic was used to determine the effect of CCL3-reduced miR-374b in VEGF-A expression and angiogenesis (the transfection efficiency was shown in Supplement Fig. S7). [score:3]
Thirty male BALB/c nude mice (4 weeks of age; purchased from National Laboratory Animal Center, Taipei, Taiwan) were used and randomized into three groups: PBS (control), control -mimic, and miR-374b -mimic. [score:1]
The correlation between CCL3/VEGF-A F. CCL3/miR-374b G. and VEGF-A/miR-374b H. Each experiment was done in triplicate. [score:1]
The tumors were photographed with a microscope B. measured weight C. and volume D. and quantified the hemoglobin levels E. The mRNA expression of CCL3, VEGF-A and miR-374b in osteosarcoma patients was examined by RT-qPCR. [score:1]
Osteosarcoma cells were transfected with miRNA control or miR-374b mimic for 24 h and then treated with CCL3 for 24 h. CM was then collected. [score:1]
The 3′ UTR regions of human VEGF-A gene including miR-374b binding site was amplified by PCR. [score:1]
Clinical importance of CCL3, VEGF-A, and miR-374b in osteosarcoma patients. [score:1]
Moreover, transfection of cells with miR-374b mimic abolished CCL3 -mediated angiogenesis in the CAM (VEGF-A was used as positive control). [score:1]
In contrast, the CM from miR-374b mimic treated cells abolished CCL3 -mediated angiogenesis (Fig. 5F- 5G). [score:1]
However, the role of miR-374b in human osteosarcoma is largely unknown. [score:1]
[1 to 20 of 43 sentences]
2
[+] score: 31
Regarding these observations, we performed qRT-PCR for 8 target genes of commonly regulated miRNA; 4 target genes (ATG5, ITGA6, NCKAP1, SARBS1) of the 2 up-regulated miRNA (mmu-miR-291b-5p, mmu-miR-296-5p) and 4 target genes (AKT1, APC, LMO7, MSN) of the 3 down-regulated miRNA (mmu-miR-30c-1*, mmu-miR-467b* and mmu-miR-374*). [score:14]
For example, mmu-miR-374* is up-regulated after mutagenesis in apoE mice by a factor of 2.96 comparing to the wild-type mice, however when supplemented by polyphenols, this miRNA is down-regulated in apoE by an average factor of −2.44. [score:7]
Interestingly, in cluster A, 3 miRNAs (mmu-miR-30c-1*, mmu-miR-374* and mmu-miR-497b*) were identified as being down-regulated by all nine polyphenols tested, while in cluster 2, 2 miRNAs (mmu-miR-291b-5p and mmu-miR-296-5p) were observed as up-regulated by all nine polyphenols (Table 2). [score:7]
Moreover, changes in miRNA expression were observed after polyphenol supplementation, and five miRNAs (mmu-miR-291b-5p, mmu-miR-296-5p, mmu-miR-30c-1*, mmu-miR-467b* and mmu-miR-374*) were identified as being commonly modulated by these polyphenols. [score:3]
[1 to 20 of 4 sentences]
3
[+] score: 30
This study describes how p19 affects the RNA world and shows that: i) miR-342, miR-206, miR-330, miR-138 and miR-99b are upregulated by p19 but not by p19W164A mutant; ii) anti-miR-206 can restore the G2 phase in the presence of p19; iii) p19 and p21Q61L regulate their own alternative splicing; iv) miR-206 and miR-138 are differentially regulated by p19 and p21 H-Ras and v) P19G12S Costello mutants show a clear upregulation of miR-374, miR-126, miR-342, miR-330, miR-335 and let-7. These results allow us to conclude that the H-Ras G12S mutation plays an important role in miRNA expression and open up a new line of study to understand the consequences of this mutation on Costello syndrome. [score:13]
These miRNAs included miR-342 and miR-330, which are already known to be upregulated by p19 overexpression (Fig.   1), miR-126 and miR-335, which significantly reduce the ability of CN34-LM1 and CN34-BoM1 cells to metastasize to the lung [23], miR-374, which is known to be associated with aggressive small cell lung cancer [26], and let-7, which targets Ras genes [27]. [score:8]
Those results showed that miR-330, miR-335 and miR-374 are statiscaly and significally overexpressed in those CS patients cells, and thus they are putative cadidates to be miRNAs overexpressed in CS patients (R. García-Cruz and K. Sol-Church, personnel communication). [score:5]
Thus, p21 was found to upregulate miR-374, miR-126, miR-342, miR-335 and let-7 but not miR-330, and p21G12S was found to have the same effect as p21 on miR-374, miR-342 and miR-126. [score:4]
[1 to 20 of 4 sentences]
4
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
The relative expression intensities of miR-374 were 8.9 ± 2.4 in adenoma-free mice and 21.1 ± 6.9 in adenoma-bearing mice, thus accounting for a 2.4-fold upregulation, which is in line with the 3.0-fold upregulation detected in adenoma bearing mice by microarray (see Table 2). [score:9]
Such a situation occurred for miR-26b, miR-30, and miR-374 downregulation, and for miR-34, miR-301, and miR-352 upregulation [121]. [score:7]
1Proliferation, Invasion, Tumor suppression [63– 66] miR-344 ↓2.0 ↓3.2 NA miR-346 ↓2.4Proliferation [67, 68] miR-362 ↓2.3Proliferation, Invasion, Apoptosis [69– 76] miR-369 ↓2.8 ↓2.6 ↓2.1Aerobic glycolysis [77] miR-374 ↑3.0 ↓2.2 NA miR-449 ↑2.7 ↑2.4Proliferation [78– 81] miR-463 ↓2.7 NAmiR-466 [°] ↑2.4 ↑2.1 ↓3.5 NA miR-483 ↓3.2Apoptosis [82] miR-493 ↑2.1 ↓2.2Proliferation [83– 85] miR-499a ↓5.0 ↑2.3Proliferation [86] miR-504 ↓2.6 ↑2.0Proliferation, Apoptosis [87, 88] miR-579 ↑2.8 NAmiR-582 [^] ↑2.4Proliferation [89] miR-615 ↓2.1Proliferation, Invasion [90, 91] miR-652 ↑2.4Proliferation, EMT [92, 93] miR-669b ↓2.1 NA miR-669h ↓3.6 ↑2.3 NA miR-669i ↓2.3 NA miR-669k ↓7.2 ↓5. [score:3]
The panels report the amplification curves for each one of the 20 mouse lung fragments tested, either adenoma-free (green) or adenoma-bearing (purple), relatively to miRNAs miR-125, miR-374, and miR-669k. [score:1]
Figure 4 The panels report the amplification curves for each one of the 20 mouse lung fragments tested, either adenoma-free (green) or adenoma-bearing (purple), relatively to miRNAs miR-125, miR-374, and miR-669k. [score:1]
Validation of microarray data was performed by real time-qPCR for miR-125, miR-374, and miR-669k. [score:1]
[1 to 20 of 6 sentences]
5
[+] score: 17
TRAF6 and TAOK3 are inhibited by mir-373, GYK and APPBP2 are inhibited by mir-200a, TRAF6, TAOK3 and ZNF302 are inhibited by mir-141, CBX2 is inhibited by mir-1, APBB1 is inhibited by mir-148b, POLR3D is inhibited by mir-374b, NAE1 is inhibited by mir-503, and GTF2I is inhibited by mir-98. [score:17]
[1 to 20 of 1 sentences]
6
[+] score: 16
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, hsa-mir-3195
In vitro studiesMelatonin significantly suppressed the expression of angiogenesis-related proteins HIF-1α, HIF-2α and VEGF at mRNA level of PC-3 cells under hypoxia, and upregulation of miRNA3195 and miRNA374b could mediate this anti-angiogenic property of melatonin [93]. [score:8]
Melatonin significantly suppressed the expression of angiogenesis-related proteins HIF-1α, HIF-2α and VEGF at mRNA level of PC-3 cells under hypoxia, and upregulation of miRNA3195 and miRNA374b could mediate this anti-angiogenic property of melatonin [93]. [score:8]
[1 to 20 of 2 sentences]
7
[+] score: 15
High Ca [++] intake significantly downregulated the expression levels of miR-9 and miR-374 in TALH cells, which in turn causes a reciprocal increase in claudin-14 expression level. [score:8]
Treatments with antisense oligonucleotide against miR-9 or miR-374 revealed that both microRNAs suppressed claudin-14 translation and induced its mRNA decay in a synergistic manner [36]. [score:5]
The promoters of both miR-9 (miR-9-3 locus) and miR-374 genes contain a canonical myc -binding site (E-box: CACGTG). [score:1]
Gong et al. have identified two microRNA molecules, miR-9 and miR-374 from TALH cells, both of which recognize partially complementary binding sites located in 3′-UTRs of claudin-14 mRNA (Figure 3) [36]. [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 13
Another miRNA upregulated in DSA+ was miR-374b-3p; its target NMMLCK contributes to endothelial barrier dysfunction in inflammation [43]. [score:6]
miR-374b-3p also targets RECK [44], which is important in angiogenesis. [score:3]
Based on inspection of the volcano plots and an in silico analysis of regulated pathways with DIANA miRPath v. 2.0 [10] we chose a set of 16 miRNAs for confirmation in microdissected glomeruli from patients with only HLA-class I DSAs: miR-let-7c, miR-28-3p, miR-29b, miR-30d, miR-99b, miR-125a-5p, miR-133a, miR-138, miR-146b, miR-195, miR-374b-3p, miR-484, miR-501-3p, miR-520e, miR-625-3p, miR-885-5p (Table  1). [score:2]
Glomerular miR-let-7c-5p (a), miR-28-3p (b), miR-30d-5p (d), miR-99b-5p (e), miR-125a-5p (f) and miR-195-5p (j), miR-374b-3p (k), miR-484 (l), miR-501-3p (m), miR-520e (n) and miR-885-5p (p) were higher in DSA+ than to controls. [score:1]
0.27; 0.16; 0.43; p < 0.001), miR-374b-3p (3.04e-5; 3.04e-5; 6.12e-4 vs. [score:1]
[1 to 20 of 5 sentences]
9
[+] score: 13
miR-374 was also downregulated in older participants in an earlier study [18], but in contrast with our study, miR-376 was upregulated in older participants in another report [20]. [score:7]
Interestingly, none of the six miRNAs has previously been shown to play a mechanistic role in aging, and none has been implicated in heart disease, but many have been shown to function and/or act as biomarkers in different cancers (miR-211: melanoma cell invasive-ness; head, neck, renal cell carcinomas; pancreatic cancer; miR-374: small cell lung cancer; miR-340: osteosarcoma, colorectal cancer, breast cancer, gastric cancer; miR-376: glioblastoma, hepato-cellular carcino-ma) [24]. [score:3]
Four of these miRNAs (miR-374, 376, 29, 378) have been shown in prior studies to be differentially expressed between older and younger persons in separate profiling experiments [18, 20, 21]. [score:3]
[1 to 20 of 3 sentences]
10
[+] score: 11
Concordantly, miR-148a, together with miR-374b, are the miRNAs with more miRComb predicted targets (363 and 381, respectively) as shown in Table 2. MiRNAs appearing in that table probably are those playing more central roles in PDAC because they are the ones with more targets and they would regulate a huge number of mRNAs simultaneously. [score:6]
Interestingly, most of these miRNAs are coincident with those appearing in Table 1 (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-93, miR-106b, miR-497, miR-23a, miR-19b, miR-107, miR-15a, miR-330-5p, miR-144), indicating that, apart from being targeting many mRNAs, these miRNAs are participating in the most reliable interactions. [score:3]
It is worth noting that these 10 miRNAs together (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-448, miR-93, miR-106b, miR-217, miR-539) could potentially be regulating 41% of the mRNAs significantly altered in PDAC. [score:2]
[1 to 20 of 3 sentences]
11
[+] score: 11
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Comparison of miRNA expression of microdissected HRS cells from cHL patients to CD77+ GC B cells showed three downregulated miRNAs, namely, miR-520a, miR- 200a, and miR-614 and twelve upregulated miRNAs, namely, miR-20a, miR-21, miR-9, miR-155, miR-16, miR-140, miR-18a, miR-30b, miR-30a- 5p, miR-196a, miR-374, and miR-186 [36]. [score:9]
This study also uncovered a novel set of miRNAs like miR-222 and let-7f (associated with other malignancies), miR-513 and miR-223 (linked to immune regulation and related B-cell tumors), miR-424 (hematopoiesis), and miR-188 and miR-374 (no known physiological or pathological functions) [49]. [score:2]
[1 to 20 of 2 sentences]
12
[+] score: 10
Evidence of the concerted interplay of miRNAs regulated by CpG-ODN and their potential target mRNAs was observed (Fig. 4) for 2 miRNAs upregulated (hsa-miR-302b and hsa-miR-374b) and for 13 miRNAs downregulated in CpG-ODN -treated mice (hsa-miR-135a, hsa-miR-136, hsa-miR-340, hsa-miR-445-5p, hsa-miR-424, hsa-miR-96, hsa-miR-142-3p, hsa-miR-140-5p, hsa-miR-542-3p, hsa-miR-18a, hsa-miR-18b, hsa-miR-101, and hsa-miR-99a). [score:10]
[1 to 20 of 1 sentences]
13
[+] score: 10
Other miRNAs from this paper: hsa-mir-3195
Additionally, Sohn et al. (2015) have recently demonstrated that melatonin (1 mM) upregulates miRNA3195 and miRNA374b, whose overexpression synergistically reduced VEGF production in hypoxic PC-3 prostate cancer cells, indicating the important role of miRNA3195 and miRNA374b in melatonin induced antiangiogenic activity. [score:6]
Upregulation of miRNA3195 and miRNA374b mediates the anti-angiogenic properties of melatonin in hypoxic PC-3 prostate cancer cells. [score:4]
[1 to 20 of 2 sentences]
14
[+] score: 9
Of these, 14 (miR-23b, miR-28, miR-98, miR-103, miR-107, miR-193a,0, miR-324-5p, miR-324-3p, miR-331, miR-374, miR-432, miR-502, and miR-660) were upregulated and 6 (miR-31, miR-451, miR-452, miR-565, miR-594 and miR-659) were downregulated. [score:7]
[27]↓quail myoblasts diff, ↓ C2C12 diff [29] ↓ C2C12 diff [28] ↓ muscle development [32]40miR-320↓(this study)↑ pMyo diff [33]  41 miR-324-3p (n)↑↑(this study)   42 miR-324-5p (n)↑(this study)   43 miR-331 (n)↑(this study)-  44miR-339↓(this study)↑ C2C12 diff [33] ↑ pMyo diff [33]  45miR-361↑(this study)↑ pMyo diff [33]  46 miR-362↑↑(this study)↑ C2C12 diff [28]  47 miR-374 (n)↑(this study)   48 miR-432 (n)↑(this study)   49 miR-451 (n)↓↓↓(this study)   50 miR-452 (n)↓↓(this study)   51 miR-500↑↑(this study)↑ C2C12 diff [28, 33] ↑ pMyo diff [33]  52 miR-501↑↑↑(this study)↑ C2C12 diff [28, 33]  53 miR-502 (n)↑↑(this study)-  54 miR-503↑(this study)↑ C2C12 diff [19, 28, 33] ↑ pMyo diff [33]  55 miR-532↑↑(this study)↑ C2C12 diff [28, 33] ↑ pMyo diff [33]  56↓↓ pMyo diff. [score:2]
[1 to 20 of 2 sentences]
15
[+] score: 8
Other miRNAs from this paper: hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-374a, hsa-mir-374c
Clues in this direction come from an elegant recent work by Gong and coworkers, demonstrating that activation of the CaSR regulates the expression levels of two microRNAs: miR-9 and miR-374, which in turn transduce the extracellular signal to CLDN14 through microRNA mediated gene silencing [41]. [score:5]
Although, this study reported miR-9 and miR-374 convergence onto CLDN14, regulation of microRNA by CaSR signaling may occur on several layers including key regulatory proteins involved in CaSR receptor activated calcium signaling. [score:3]
[1 to 20 of 2 sentences]
16
[+] score: 8
Predicted to target IL-10 mRNA, it was suggested that decreased levels of miR-125a and miR-374b could increase patient susceptibility to infection by creating an immune suppressive environment [38]. [score:5]
For instance, when compared to healthy controls, the levels of circulating miRNAs predicted to regulate the expression of pro- and anti-inflammatory cytokine genes (e. g., miR-125a, miR-181, miR-202, miR-374b and miR454) as well as genes involved in neuronal survival and central nervous system signalling have been shown to be increased or decreased in samples obtained post-polytrauma or TBI [36, 38]. [score:3]
[1 to 20 of 2 sentences]
17
[+] score: 7
At that time, 2 miRNA were upregulated (hsa-miR-668 and hsa-miR-374b-3p), and one downregulated (hsa-miR-370). [score:7]
[1 to 20 of 1 sentences]
18
[+] score: 7
The fixed-effects mo del revealed that downregulation of miR-374 was associated with shorter DFS (combined adjusted HR: 0.77; 95% CI: 0.65–0.90) (Fig. 5). [score:4]
[41] The results of a pathway analysis showed that miR-374b may regulate critical pathways involved in TNBC tumor development and progression, including the fibroblast growth factor and transforming growth factor pathways. [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 7
Other miRNAs from this paper: mmu-mir-374b
As reported before, MIP-1α activates chemokine receptor type 5 (CCR5) and c-Jun N-terminal kinase (JNK), extracellular-signal regulated kinase (ERK), or p38 pathway and consecutive leads to down -regulating of miR-374b expression, which promotes VEGF-A expression and subsequently induces human endothelial progenitor cells (EPCs) migration and tube formation [37]. [score:7]
[1 to 20 of 1 sentences]
20
[+] score: 7
Microarray data revealed that after TSA treatment, 19 miRNAs, including miR-4323 and miR-135a-3p, were upregulated 2-fold relative to the control group; 30 miRNAs, including miR-4261, miR374b-5p and miR-4306, were downregulated 2-fold (Figure 1B). [score:7]
[1 to 20 of 1 sentences]
21
[+] score: 7
Moreover, the upregulation of miR-142-5p, miR-221, miR-30, miR-32, miR-374, miR-99a, miR-122 and miR-101 and the downregulation of miR-145, miR-195 and miR-98 observed in JEV-infected PK-15 cells in our study have been reported in the brains of mice infected with West Nile virus (WNV), another mosquito-borne flavivirus [34]. [score:7]
[1 to 20 of 1 sentences]
22
[+] score: 7
Other miRNAs from this paper: hsa-mir-3195
Sohn E. J. Won G. Lee J. Lee S. Kim S. H. Upregulation of miRNA3195 and miRNA374b Mediates the anti-angiogenic properties of melatonin in Hypoxic PC-3 prostate cancer cellsJ. [score:4]
Moreover, Sohn et al. reported that the antiangiogenic properties of melatonin (1 mM) in hypoxic PC3 prostate cancer cells were mediated by enhancing the expression of miRNA3195 and miRNA374b [239]. [score:3]
[1 to 20 of 2 sentences]
23
[+] score: 6
Expression of all miRNAs (miR-145-5p, miR-26b-5p, miR-34c-5p, and miR-374b-5p) was suppressed in varying degree with JEV infection (Fig. 3F–I). [score:5]
The results of qPCR analysis of (A) miR-3648, (B) miR-3687 (C) miR-572, (D) miR-129-5p, (E) miR-197-3p, (F) miR-145-5p, (G) miR-374b-5p, (H) miR-26b-5p, (I) miR-149-5p, at three different time points are presented. [score:1]
[1 to 20 of 2 sentences]
24
[+] score: 6
In contrast, 11 miRNAs (hsa-miR-206, hsa-miR-34a, hsa-miR-374, hsa-miR-424, hsa-miR-100, hsa-miR-101, hsa-miR-323, hsa-miR-368, hsa-miR-137, hsa-miR-138 and hsa-miR-377) were abundantly expressed in day 9 neuronal progenitors (Figures 1B and 2A). [score:3]
Another 11 miRNAs (miR-206, miR-34a, miR-374, miR-424, miR-100, miR-101, miR-323, miR-368, miR-137, miR-138 and miR-377) were abundantly expressed in transdifferentiated neuronal progenitors. [score:3]
[1 to 20 of 2 sentences]
25
[+] score: 6
Increasing evidence suggests that several miRNAs can reduce tumor progression via direct repression of VEGF-A. miR-199a, miR-200b, miR-206, miR-210, and miR-374b have been shown to inhibit metastasis and angiogenesis in several human cancer cells by targeting VEGF-A [18, 25, 38, 39]. [score:6]
[1 to 20 of 1 sentences]
26
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
In a rat mo del of selenium deficiency, five miRNAs extracted from harvested heart (miR-374, miR-16, miR-199a-5p, miR-195 and miR-30e*) were identified as upregulated >5-fold in the deficiency group, compared to the selenium-supplemented group, and three were downregulated (miR-3571, miR-675 and miR-450a*). [score:6]
[1 to 20 of 1 sentences]
27
[+] score: 5
E3 ligases and deubiquitinases such as MDM2, SMUR1, NEDD4L, NEDD4, RNF41, ITCH, CBL, UBPY, and AMSH were targeted by 9 (hsa-miR-545, hsa-miR-541, hsa-miR-511, hsa-miR-888, hsa-miR-146-5p, hsamiR- 429, hsa-miR-374b, hsa-miR-500, and hsa-miR-656) of the predicted poor prognosis miRs. [score:3]
Eleven of the miRs (hsa-miR-876-5p, hsa-miR-1255b, hsa-miR573, hsa-miR-29a, hsa-miR-455-3p, hsa-miR374b, hsamiR- 545, hsa-miR-486-3p, hsa-miR-541, hsa-miR-656, and hsa-miR-let-7c) were of poor prognosis. [score:1]
Strikingly, 9 of the poor prognosis associated miRs: hsa-miR-545, hsa-miR-541, hsa-miR-511, hsa-miR-888, hsa-miR-146- 5p, hsa-miR-429, hsa-miR-374b, hsa-miR-500, and hsamiR- 656 have functions in E3 ligases and deubiquitinases (Figure 4B). [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 5
Our bioinformatical analysis identified eight potential microRNAs that might be regulated by PTIP, including miR-548k, miR-374b, miR-374a, miR-369-3p, miR-374c, miR-655, miR-4307, miR-570. [score:2]
We selected 8 potential microRNAs including miR-548k, miR-374b, miR-374a, miR-369-3p, miR-374c, miR-655, miR-4307, miR-570. [score:1]
miR-374b has been reported to promote progression in gastric cancer [26]. [score:1]
miR-374a, miR-374b, miR-374c and miR-570 decreased in HCCLM3shPTIP cells. [score:1]
[1 to 20 of 4 sentences]
29
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
In addition, many miRNA families showed low expression (count number <100) in milk exosomes, such as the miR-1, miR-130, miR-17, miR-10, miR-29, miR-374, mir-9, miR-15 and miR-491 families (Figure 12F), which are routinely expressed in specific tissues [53– 56]. [score:5]
[1 to 20 of 1 sentences]
30
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Stimulation of HCC proliferationBudhu et al., 2008; Gramantieri et al., 2008; Huang et al., 2009, 2011 miR-373 Invasion and metastasisMeng et al., 2007; Bartels and Tsongalis, 2009; Wu et al., 2011 miR-374 DevelopmentWang et al., 2008; Wong et al., 2008, 2010; Koh et al., 2013 miR-375 Stimulation of HCC proliferationLiu et al., 2010; He et al., 2012 miR-376a Proliferation and apoptosisMeng et al., 2007; Zheng et al., 2012b miR-423 Enhanced CDK2 activityLin et al., 2011 miR-491-5p Inhibition of TNF-α-related apoptosisYoon et al., 2010 miR-500 Elevated in HCC, returned to physiologic level after surgical interventionYamamoto et al., 2009 miR-637 Active STAT3Zhang et al., 2011 let-7a/a-1/a-2/b/c/d/e/f/f-2/g Development. [score:5]
[1 to 20 of 1 sentences]
31
[+] score: 5
On the other hand, these 19 miRNAs (hsa-miR106a, hsa-miR-125a, hsa-miR-140, hsa-miR-146a, hsa-miR-146b, hsa-miR-155, hsa-miR-16, hsa-miR-17, hsa-miR186, hsa-miR-191, hsa-miR-197, hsa-miR-200b, hsa-miR-200c, hsa-miR-339, hsa-miR-374, hsa-miR-422, hsa-miR-422, hsa-miR-454, hsa-miR-484 and hsa-miR-590) were up-expressed in VP and ART (block1-group2) and down-expressed in EC and HIV- (block2-group2). [score:5]
[1 to 20 of 1 sentences]
32
[+] score: 4
miR-142-3p, miR-374b-5p while one showed up-regulation: miR-320a) [23]. [score:4]
[1 to 20 of 1 sentences]
33
[+] score: 4
In hyperdiploid patients a significant down-regulation of miR-21, miR-22, miR-93, miR-125b, and miR-374b with a maximal FC of 2.1 is present (Supplementary Table S6B). [score:4]
[1 to 20 of 1 sentences]
34
[+] score: 4
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Finally, miR-30c-2-3p, miR-101b-3p, miR-142-3p, miR-142-5p, miR-181a-1-3p, miR-374-5p, miR-466c-3p, miR-1188-3p, miR-3065-3p and miR-3582 were significantly down-regulated in the chronic stage (Supplementary Fig. S7D). [score:4]
[1 to 20 of 1 sentences]
35
[+] score: 3
MiRNA expression was normalized to that of hsa-RNU48 (1006), miR-16 (000391), miR-26b (000407) and miR-92 (000430) (solid tissues), or hsa-miR-16 and hsa-miR-374 (000563) (cultured cells), or hsa-miR-425-5p (001516), hsa-RNU-48 and hsa-miR-16 (serum samples). [score:3]
[1 to 20 of 1 sentences]
36
[+] score: 3
Oncogenic miRNAs [37], [38], including let-7 family, miR-374 family, miR-138, miR-195, miR-19a and miR-200a, had more than twice expression level in rpESCs comparing with their IVF counterparts. [score:3]
[1 to 20 of 1 sentences]
37
[+] score: 3
Therefore, we selected both miR-1246 and miR-374b-5p as the best pair of reference genes. [score:1]
miR-1246 and miR-374b-5p were identified as the two miRNAs with the lowest variability across all samples without considering the designated groups (Fig.   2B). [score:1]
The two endogenous references, miR-1246 and miR-374b-5p, were empirically selected based on the NormFinder algorithm (Fig.   2). [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 3
Of the nine miRNAs were specifically expressed in cashmere goat dorsal skin [18], only four of them were examined in the present study: miR-1, miR-374, miR-455-3p and miR-92b. [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 3
Recently, we identified 6 potential biomarkers (mmu-miR140-5p, hsa-let-7g, hsa-miR-15b, hsa-miR-132, hsa-miR-222, and hsa-miR-374) that were differently expressed in whole saliva from patients with benign parotid neoplasms and malignant parotid neoplasms [16]. [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 3
Although other miRNAs including miR-196a, miR-374b, miR-124, and miR-98 have not been reported for associations with ovarian cancer, they are related with the oncogenic phenotype or their expression of other cancers [24- 27]. [score:3]
[1 to 20 of 1 sentences]
41
[+] score: 3
Data are presented as fold change (FC) in miR expression after normalization to the endogenous control, miR-374. [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 3
Transfections were performed using the following miRNA specific mimics at a final concentration of 50nM: miR-141, miR-147b, miR-190b, miR-199a-5p, miR-374b, miR-449b, miR-512-5p, miR-518b, miR-874, and miR-1263 (Thermo Scientific/Dharmacon). [score:1]
0076560.g003 Figure 3 (A) A549 cells were mock infected, infected with A/WSN/33 (5 pfu/cell), or infected after transfection with an equimolar mixture of miRNAs (50nM final concentration) that included either hsa-miR-141, hsa-miR-374b, hsa-miR-449b, hsa-miR-518b, and hsa-miR-1263 (G1), or hsa-miR-147b, hsa-miR-190b, hsa-miR-199a-5p, hsa-miR-512-5p, and hsa-miR-874 (G2). [score:1]
Ten highly inducible miRNAs (miR-141, miR-147b, miR-190b, miR-199a-5p, miR-374b, miR-449b, miR-512-5p, miR-518b, miR-874, and miR-1263) were used in this experiment and divided randomly into two groups of 5 for analysis: one group (G1) consisted of miR-141, miR-374b, miR-449b, miR-518b, and miR-1263, and the other group (G2) consisted of miR-147b, miR-190b, miR-199a-5p, miR-512-5p, and miR-874 (Figure 3A). [score:1]
[1 to 20 of 3 sentences]
43
[+] score: 2
0074916hsa-miR-16-5p0.0890.0071513hsa-miR-44540.3420.001154hsa-miR-181a-5p0.1060.041029hsa-miR-46440.3580.004136hsa-miR-25-3p0.1290.000127hsa-miR-197-3p0.3590.005471hsa-miR-4653-3p0.1290.000547hsa-miR-15a-5p0.3620.0302713hsa-miR-146a-5p0.1400.002395hsa-miR-2115-3p0.3640.000163hsa-miR-339-5p0.1460.002487hsa-miR-9370.3650.008018hsa-miR-50890.1560.0017917hsa-miR-331-3p0.3740.0010912hsa-miR-493-5p0.1630.0061914hsa-miR-374b-5p0.3800. [score:1]
000631hsa-miR-296-5p2.710.0495120hsa-miR-4685-3p5.040.0009010hsa-miR-150-5p2.850.0092719hsa-miR-23c5.110.00081Xhsa-miR-45402.860.012809hsa-miR-5002-3p5.140.000353hsa-miR-42682.970.009692hsa-miR-56895.330.000546hsa-miR-12363.080.048776hsa-miR-9355.430.0018719hsa-miR-221-5p3.160.03132Xhsa-miR-374b-3p5.795.4E-05Xhsa-miR-36853.260.0035612hsa-miR-1255b-2-3p5.830.008231hsa-let-7d-3p3.350.021539hsa-miR-485-3p6.000. [score:1]
[1 to 20 of 2 sentences]
44
[+] score: 2
Although the roles of miR-320a and miR-374–5p have been reported in many different types of cancer, there are no direct reports of these miRNAs in osteosarcoma to date. [score:2]
[1 to 20 of 1 sentences]
45
[+] score: 2
Preliminary results showed that the level of miR874-3p, miR-422a, miR-490-3p, miR-374b, miR-133a, let-7 g, miR-378, miR-9*, and miR-378i were all deregulated in the CRC tissues compared with the neighboring noncancerous colorectal tissues (all P < 0.05) (Figure  2). [score:1]
After a series of selection processes independently with enter method and conditional forward method in conditional logistic regression, we found nine statistically significant miRNAs in enter method, namely, miR574-3p, miR422a, miR490-3p, miR-374b, miR-133a, let7g, miR-378*, miR-9* and miR-378i. [score:1]
[1 to 20 of 2 sentences]
46
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-497, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
[1 to 20 of 2 sentences]
47
[+] score: 2
miRNA ΔΔCT(mean) p-value miR-374 -0.4458 0.454 miR-142-3p -0.4136 0.4322 miR-523 -0.5518 0.3424 miR-374-5p -0.2611 0.6425 miR-376c -0.4312 0.5867 miR-27a -0.3863 0.4776 miR-520d-5p -0.3081 0.7506 miR-122 -0.0856 0.9251 miR-485-3p -0.2611 0.6392 miR-21 -0.3976 0.5261 miR-218 -1.332 0.1659 miR-374 -0.4458 0.454 Comparison of mean ΔΔCT’s for various plasma miRNA from plasma samples drawn from the same 7 individuals on the same day 12 hours apart. [score:1]
B) ROC Curve for miR-523, miR-218, miR-142-3p,miR-27a,miR-376c,miR-374. [score:1]
[1 to 20 of 2 sentences]
48
[+] score: 2
The importance of miRNAs can be told from the co-regulation motifs, such as 'STAT2’-'hsa-miR-583’-'IRF9’, 'ATF2’-'hsa-miR-374b’-'JAK1’, 'IKBKB’-'hsa-miR-218’-'AKT1’, and 'MAPK1’-'hsa-miR-543’-'IL8’. [score:2]
[1 to 20 of 1 sentences]
49
[+] score: 2
More than 10-fold increase in miR-374 expression was observed in miR-374a lentivirus or mimics -treated NSCLC cells compared with the control group by quantitative real-time reverse transcription-PCR (qRT-PCR) (with P < 0.01; P < 0.001) (Supplementary Figure  1B). [score:2]
[1 to 20 of 1 sentences]
50
[+] score: 1
Other housekeeping genes frequently used are the miRNAs: let-7, miR-16, miR-423 and miR-374, among others, but the use of a single miRNA to normalize data may induce a systematic error [78]. [score:1]
[1 to 20 of 1 sentences]
51
[+] score: 1
0094839.g005 Figure 5(A) We plotted two miRNAs (miR-34a-5p and miR-374-5p) detected in CSF from Table? [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
An independent study by Jeffries and co-workers confirmed the presence of these motifs in seven other nuclear-localized miRNAs: miR-30b, miR-30c, miR-19a, miR-374a, miR-374b, miR-590-5p and miR-193b [36]. [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
Prognostic plot created using PROGmiR for miRNA hsa-miR-374 identified as prognostically important biomarker in Lung Squamous cell carcinoma (LUSC) by Annilo et al, using TCGA data. [score:1]
[1 to 20 of 1 sentences]
54
[+] score: 1
A serious miRNA, such as miR-374 [20], miR-203 [21], miR-21 [22], miR-7 [23, 24], play a role in cell proliferation, cancer metastasis, epithelial-mesenchymal transition et al through AKT/β-catenin signaling pathway. [score:1]
[1 to 20 of 1 sentences]
55
[+] score: 1
The following are the 10 miRNA precursors with previously unreported antisense transcripts: hsa-miR-33b, hsa-miR-101, hsa-miR-191, hsa-miR-219-2, hsa-miR-374b, hsa-miR-486, hsa-miR-625, hsa-miR-766, hsa-miR-3135b, and hsa-miR-4433. [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
In an additional case, A-to-I editing was observed in a novel stem-loop structure in sequence adjacent to the unedited miRNA miR-374. [score:1]
[1 to 20 of 1 sentences]
57
[+] score: 1
The most recent study of prognostic miRNAs by Liu et al. (2015) identified a signature of four miRNAs that appeared to be associated with a good prognosis in TNBC (miR-374b-5p ↑, miR-218-5p ↑, miR-126-3p ↑, miR-27b-3p ↓). [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
These include miR-145-5p [20, 21], miR-141-3p [21, 22], miR-27b-3p [21, 81], miR-106b-5p, miR-93-5p [21] miR-148a-3p, miR-193a-3p [22, 81], miR-135a-5p, miR-374b-5p, miR-29c-3p, miR-365a-3p [22], let-7a-5p, miR-515-3p [24], and miR-34c-3p [81]. [score:1]
[1 to 20 of 1 sentences]
59
[+] score: 1
A) ssc-miR-215, B) MDM238, C) MDM392, D) ssc-miR-30a, E) ssc-miR-194, F) ssc-miR-374b, G) ssc-miR-155, H) ssc-miR-4331. [score:1]
[1 to 20 of 1 sentences]
60
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-186, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
54376002:- bta-miR-374b′-5pbta-mir-374b′bta-miR-374-3p1.460ugauaauacaaccugauaagug220cuuagcagguuguauuauaucc22X:82023929.. [score:1]
[1 to 20 of 1 sentences]