sort by

22 publications mentioning mmu-mir-190b

Open access articles that are associated with the species Mus musculus and mention the gene name mir-190b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 83
To ensure high probability of interactions between miR-190b-5p and its targets and avoid false -positives we applied stringent criteria using simultaneously both scores (aPCT > 0.2; CT < -0.07) thereby selecting the top ~33% of targets (34 out of 103 total targets) with the highest aPCT score and the lowest TC score. [score:7]
We showed here that expression of miR-190b-5p, but not other miRNAs targeting Nrg3 mRNAs, is highly correlated with impulsivity. [score:5]
We used TargetScanMouse (Release 6.2) to predict mouse miR-190b-5p targets. [score:5]
Subsequently, to determine the Nrg3-related network of miR-190b-5p targets, we predicted biological interactions of these gene products with Nrg3, as well as their functional importance using TargetScanMouse, and DAVID (Huang et al., 2007; Friedman et al., 2009; Warde-Farley et al., 2010), respectively. [score:5]
This correlation is negative, which supports a suppressive role of miR-190b-5p on Nrg3 gene expression. [score:5]
One of the direct targets of the miR-190b-5p network is neuroligin (Nlgn1), which is a key synaptic factor that mediates the formation and maintenance of synapses. [score:4]
Besides three miR-190b-5p targets (Myo5a, Celf6, and Nlgn1) interacting directly with Nrg3, we also discovered additional gene products as members of the Nrg3 network, which were ErbB4, the receptor of Nrg3, and Grlb, the b-subunit of the glycine receptor (Figure 4A). [score:4]
Because a single miRNA typically regulates several protein-coding mRNAs we first established which gene products are, in addition to Nrg3, miR-190b-5p targets. [score:4]
We established that only miR-190b-5p is significantly correlated with impulsive action and that this correlation is negative, meaning that with increased impulsivity of BXD mice the expression of miR-190b-5p in the amygdala is lowered. [score:3]
Yin Yang 1 phosphorylation contributes to the differential effects of mu-opioid receptor agonists on microRNA-190 expression. [score:3]
Based on this, we could hypothesize that the shared mechanism between impulsivity and compulsivity could lie in regulation of a miR-190b-5p-directed network. [score:3]
Besides miR-190b-5p, the expression of miR-340-5p, miR-28a and miR-491 in the amygdala was negatively correlated with impulsivity. [score:3]
Thus, miR-190b-5p, via its targets and genes within the Nrg3-network, seems to control synaptic activity. [score:3]
Moreover, expression of miR-190b-5p is negatively correlated with two body mass traits and food intake that significantly correlate with impulsivity (Figure 3). [score:3]
We originally input all 34 targets of miR-190b-5p using network weighting as “equal as determined by the network” (see Figures 4A,C), or using Gene Ontology (GO) -based weighting for “biological terms” (see Figures 4B,D) to maximize prediction of connectivity between all input genes. [score:3]
Figure 4 Impulsivity-related miR-190b and Nrg3 expression network in amygdala. [score:3]
Here, we focused on a selection of the network that is targeted by miR-190b-5p, and that is related to biological relevance of Nrg3. [score:3]
In this respect, the role of miRNAs is important, because the network found for miR-190b-5p targets and associated genes includes those that have a function in synapse formation and stabilization. [score:3]
This approach, ensuring selection of high probability interactions between miR-190b-5p and its targets, yielded 34 genes (Table 5). [score:3]
Recently, miR-190 has been shown to be involved in regulation of synapses by drugs of abuse. [score:2]
Fentanyl (but not morphine) decreases miR-190 levels and thereby regulates NeuroD by binding to its 3′-UTR (Ambros and Lee, 2004; Landgraf et al., 2007; Friedman et al., 2009; Zheng et al., 2010). [score:2]
Our data suggest that miR-190b-5p is a strong candidate of a biological network regulation centered around Nrg3 in relation to impulsive and compulsive traits. [score:2]
Together, we observed that miRNAs miR-190b, miR-28a, -219a, -340, and -491-5p may contribute to synaptic rearrangements and plasticity in the “impulsive” amygdala. [score:1]
We further determined correlation of miR-190b-5p with the overrepresented compound traits and only observed significant correlations with two metabolic traits (Table 4, Figure 3). [score:1]
The miRNAs binding to these sites, i. e., miR-137-3p, miR-155a-5p, miR-190b-5p, miR-204-5p, miR-30b-5p, miR-30c-5p, miR-30d-5p, miR-30e-5p, miR-384-3p, were selected for the correlation analysis with impulsivity. [score:1]
On one hand, miR-190b-5p seems to control synaptic activity, whereas other miRNAs (primarily miR-340-5p) may control axonal guidance. [score:1]
We used to predict the miR-190b/Nrg3 interactive network. [score:1]
[1 to 20 of 27 sentences]
2
[+] score: 69
In this study, the target genes of modulated miRNAs were found to be involved in Jak-STAT signaling, including JAK2 SOCS4, which are targets of miR-377; TYK2 and IL12A, targets of miR-691; IL6, a target of miR-190; IFNAR2, a target of miR-135a*; IFNGR2 and AKT1, targets of miR-290-5p; and SOCS3 and AKT2, targets of miR-203. [score:15]
These included FASL IL18RAP, and KITL, which are targets of miR-377; IL25 IL12A TNFSF14, and CLCF1, which are targets of miR-691; CCR10, a target of miR-1935; CXCL16, a target of miR-190; IL24 IFNG CXCL16, and CD40LG, targets of miR-135a*; IL18R1 CD40 CXCL12, and CSF, targets of miR-290-5p; and IL24 XCL1, and IL12B, targets of miR-203 (Table 1). [score:15]
cDNA samples were diluted 1:80 in nuclease-free water and then PCR was amplified using SYBR Green Master Mix and specific LNA [TM] miRNA primers (Exiqon, Denmark) for mmu-miR-691 (target sequence AUUCCUGAAGAGAGGCAGAAAA), mmu-miR-377 (target sequence AUCACACAAAGGCAACUUUUGU), mmu-miR-1935 (target sequence AGGCAGAGGCUGGCGGAUCUCU), mmu-miR-190 (target sequence UGAUAUGUUUGAUAUAUUAGGU), mmu-miR-203 (target sequence GUGAAAUGUUUAGGACCACUAG), and mmu-miR-145 (target sequence GUCCAGUUUUCCCAGGAAUCCCU). [score:12]
The predicted target genes of five up-regulated miRNAs, miR-691, miR-377, miR-190, miR-203, and miR-1290-5p, and one down-regulated miRNA, miR-145, were found to be involved in other pathways, such as the Adherens junction, Wnt signaling pathway, Axon guidance, cell cycle, TGF-beta signaling pathway, and Focal adhesion. [score:9]
As shown in Table 1, the predicted target genes of six up-regulated miRNAs, miR-691, miR-377, miR-1935, miR-190, miR-203, and miR-135a*, and one down-regulated miRNA, miR-145, were found to be involved in immune-related pathways, such as the Jak-STAT signaling pathway, MAPK signaling pathway, Fc gamma R -mediated phagocytosis and cytokine-cytokine receptor interactions. [score:9]
To validate the differential expression profiles of miRNAs obtained by microarray analysis, quantitative RT-PCR was performed on six selected differentially expressed miRNAs including miR-691, miR-377, miR-1935, miR-190, miR-203, and miR-145. [score:5]
As shown in Figure 2B, nine miRNAs, miR-691, miR-377, miR-1935, miR-190, miR-1902, miR-135a*, miR-203, miR-2138, and miR-290-5p, were found to be significantly up-regulated. [score:4]
[1 to 20 of 7 sentences]
3
[+] score: 40
Other miRNAs from this paper: mmu-mir-132, mmu-mir-190a
Overall, it is clear from these studies that neither talin2 nor miR-190 are essential for normal mouse development or the viability and fertility of adult mice, despite the fact that talin2 expression is tightly regulated at both transcriptional and translational levels. [score:7]
miR-190 down-regulates expression of the PH domain-containing leucine-rich repeat protein phosphatase PHLPP, which in turn negatively regulates the activity of Akt (Fig. S4). [score:7]
miR190 has recently been shown to suppress expression of Leucine Rich Repeat Protein Phosphatase PHLPP [15] which in turn negatively regulates AKT signaling. [score:6]
Loss of miR190 would therefore be predicted to result in upregulation of PHLPP and suppression of AKT signaling. [score:6]
As a result, increased miR-190 expression enhances Akt signaling, and miR-190 over -expression stimulates cell proliferation and can lead to malignant transformation. [score:5]
Recent studies show that expression of both Tln2 and miR-190 are markedly increased by trivalent arsenic As [3+] [15]. [score:3]
miR-190 has also been implicated in the negative regulation of TGF-β signaling [23]. [score:2]
Subsequent to generating the Tln2 [cd/cd] allele, it became apparent that we had also deleted the miR190 gene which is contained within the Tln2 gene. [score:1]
A recently noted feature of the Tln2 gene is that it encodes the micro -RNA miR-190 which is contained within intron 51 towards the 3′-end of the gene [2]. [score:1]
Complete loss of talin2, miR-190 or both may contribute to this phenotype. [score:1]
Ablation of the miR-190 gene in the Tln2 [cd/cd] mice would be predicted to increase PHLPP phosphatase activity and thereby decrease Akt signaling. [score:1]
[1 to 20 of 11 sentences]
4
[+] score: 33
The most significantly downregulated (mmu-miR-31, mmu-miR-455, mmu-miR-744, mmu-miR-695, mmu-miR-181a, mmu-miR-181d, mmu-miR-182, mmu-miR-190, mmu-miR-194) and upregulated miRNAs (mmu-miR-34c, mmu-miR-124, mmu-miR-142–3p, mmu-miR-706, mmu-miR-29c) were analyzed. [score:7]
Mmu-miR-695, mmu-miR-31, mmu-miR-190, mmu-miR-183, mmu-miR-182, and mmu-miR-194 were the most significantly downregulated miRNAs, whereas mmu-miR-34c and mmu-miR-124 were the most significantly upregulated miRNAs. [score:7]
The results showed that the expression of mmu-miR-31, mmu-miR-695, mmu-miR-183, mmu-miR-182, mmu-miR-194, and mmu-miR-190 markedly downregulated in the corneal endothelium of old mice compared to young mice. [score:5]
The results of the miRNA– messenger RNA regulatory networks indicated that the common target gene between mmu-miR-181d and mmu-miR-455 was motile sperm domain containing 1 (MOSPD1); that between mmu-miR-31 and mmu-miR-182 was RNA polymerase II, TATA box -binding protein–associated factor (TAF4A); that between mmu-miR-455 and mmu-miR-182 was reticulon 4 (RTN4); that between mmu-miR-182 and mmu-miR-190 was brain-derived neurotrophic factor (BDNF); that between mmu-miR-142–3p and mmu-miR-34c was protein phosphatase 1, regulatory subunit 10 (PPP1R10); and that between mmu-miR-142–3p and mmu-miR-124 was leucine rich repeat containing 1 (LRRC1). [score:5]
The qRT-PCR results demonstrated a decrease in the expression of mmu-miR-31(34.2±13.4-fold), mmu-miR-695 (19.8±4.79-fold), mmu-miR-183 (26.6±2.53-fold), mmu-miR-182 (55.2±15.3-fold), mmu-miR-194 (42.6±10.2-fold) and mmu-miR-190 (37.1±2.78-fold) in the corneal endothelium of old mice compared to young mice, whereas the expression of mmu-miR-34c and mmu-miR-124 increased 26.4±5.28-fold and 62.7±2.54-fold, respectively (Figure 2). [score:4]
The common target gene between mmu-miR-181d and mmu-miR-455 was motile sperm domain containing 1 (MOSPD1), that between mmu-miR-31 and mmu-miR-182 was RNA polymerase II, TATA box binding protein (TBP) -associated factor (TAF4A), that between mmu-miR-455 and mmu-miR-182 was reticulon 4 (RTN4), that between mmu-miR-182 and mmu-miR-190 was brain-derived neurotrophic factor (BDNF), that between mmu-miR-142–3p and mmu-miR-34c was protein phosphatase 1, regulatory subunit 10 (PPP1R10), and that between mmu-miR-142–3p and mmu-miR-124 was leucine rich repeat containing 1 (LRRC1). [score:4]
To validate the reproducibility of the results from the miRNA microarray, qRT-PCR analysis of (microRNAs come from mice) mmu-miR-695, mmu-miR-183, mmu-miR-182, mmu-miR-194, mmu-miR-34c, mmu-miR-31, mmu-miR-190, and mmu-miR-124 was performed using the same extracted total RNA as the microarray analysis. [score:1]
[1 to 20 of 7 sentences]
5
[+] score: 20
Other miRNAs from this paper: mmu-mir-190a
Interestingly, miR-190 is expressed in mouse testis and kidney [49, 50], where the two Tln2 short transcripts are highly expressed, as well as in various human cell lines [50], and is upregulated in primary myelofibrosis patients [51]. [score:8]
Clearly, it will be important to establish the origin of miR-190 transcripts, and their expression profile, targets, and function. [score:5]
Intriguingly, out of the 36 miR-190 target genes common to at least two different prediction algorithms and conserved in mammals [51], 12 are genes involved in cell adhesion or related processes, e. g. members of the ARP 2/3 complex (ACTR3 and ARPC5), cadherins (CDH2, PCDH9), myosin VA (MYO5A), dystroglycan and attractin precursors (DAG1 and ATRN), neurofascin (NFASC), hyalouronan synthase (HAS2), and KRAS2. [score:3]
Fourth, the presence of microRNA miR-190 within the 3′-region of the Tln2/ TLN2 gene raises questions about its function, the role of the short Tln2 transcripts, and the protein isoforms that they encode, and should also be taken into consideration in the design of knockout strategies. [score:2]
However, miR-190 is absent in the Caenorhabditis elegans genome, indicating that miR-190 first appeared in the Arthropod lineage and was maintained throughout the chordates. [score:1]
As miR-190, like many intronic microRNAs [52], is transcribed as part of larger primary transcripts, it is possible that one of the functions of the short Tln2 transcripts is to produce miR-190. [score:1]
[1 to 20 of 6 sentences]
6
[+] score: 12
mu-Opioid receptor agonists differentially regulate the expression of miR-190 and NeuroD. [score:4]
Additional studies demonstrate altered miRNA expression in CNS tissue following opioid administration; miR-190 (Zheng et al., 2010a), miR-133b (Sanchez-Simon et al., 2010), miR-28, -125b, -150 and -382 (Wang et al., 2011), miR-23b and -339 (Wu et al., 2008, 2009, 2013), miR-339 (Zheng et al., 2012), miR-103 and -107 (Lu et al., 2014), miR-21 and -146a (Strickland et al., 2014), and miR-124 (Qiu et al., 2015). [score:3]
Yin Yang 1 phosphorylation contributes to the differential effects of mu-opioid receptor agonists on microRNA-190 expression. [score:3]
Non-Coding RNAs regulating morphine function: with emphasis on the in vivo and in vitro functions of miR-190. [score:2]
[1 to 20 of 4 sentences]
7
[+] score: 9
miR222 targets the PPP2R2Asubunit of PP2A in HCC to disrupt cell motility and miR-190 inhibits PHLPP expression and promotes carcinogenic transformation of bronchial cells suggesting that the AKT pathway is a prominent target of miRNA activity [148, 149]. [score:9]
[1 to 20 of 1 sentences]
8
[+] score: 8
miR-148b −2.6183 decrease apoptosis miR-152 −2.3341 Increase cell growth miR-17 −6.2545 Bcl2, N-myc miR-181c −3.5756 proliferation and remo deling of muscles miR-190b −2.2 Binds to Ubiquitin-specific protease 46, increase cell growth miR-192 −2.4871 Increase cell growth miR-199a-3p −1.9 Activin receptor IIA, Map3k4 miR-218-1 −2.2887 Increase cell growth miR-23b −2.1623 Increase Cell growth, proliferation miR-26a −2.4565 decrease proapoptotic signaling miR-27a −2.7 Ubiquitin-conjugating enzyme E2N miR-27b −3 Ubiquitin-conjugating enzyme E2N miR-296-3p −7.3378 Increase cell growth, decrease apoptosis miR-322 8.7 Hydroxysteroid (17-beta) dehydrogenase 7 miR-455 129.249 Up-regulated brown adipocyte differentiation miR-470 3.2 TGFB -induced factor homeobox 1 miR-715 18.25 Fucosyltransferase 1 miR-7a −6.2174 Increase cell growth, decrease apoptosis miR-93 −48.423 Map3k14 (NIK) miR-98 1.8 Tripartite motif-containing 6, insulin-like growth factor 2 mRNA binding protein 1 In order to understand the interaction between different genes, we generated common networks using Ingenuity Pathway Analysis (IPA) software. [score:4]
miR-148b −2.6183 decrease apoptosis miR-152 −2.3341 Increase cell growth miR-17 −6.2545 Bcl2, N-myc miR-181c −3.5756 proliferation and remo deling of muscles miR-190b −2.2 Binds to Ubiquitin-specific protease 46, increase cell growth miR-192 −2.4871 Increase cell growth miR-199a-3p −1.9 Activin receptor IIA, Map3k4 miR-218-1 −2.2887 Increase cell growth miR-23b −2.1623 Increase Cell growth, proliferation miR-26a −2.4565 decrease proapoptotic signaling miR-27a −2.7 Ubiquitin-conjugating enzyme E2N miR-27b −3 Ubiquitin-conjugating enzyme E2N miR-296-3p −7.3378 Increase cell growth, decrease apoptosis miR-322 8.7 Hydroxysteroid (17-beta) dehydrogenase 7 miR-455 129.249 Up-regulated brown adipocyte differentiation miR-470 3.2 TGFB -induced factor homeobox 1 miR-715 18.25 Fucosyltransferase 1 miR-7a −6.2174 Increase cell growth, decrease apoptosis miR-93 −48.423 Map3k14 (NIK) miR-98 1.8 Tripartite motif-containing 6, insulin-like growth factor 2 mRNA binding protein 1 A) C2C12 myotubes were treated with 10ng/ml of TWEAK for 18h following isolation of total RNA enriched with small RNAs. [score:4]
[1 to 20 of 2 sentences]
9
[+] score: 8
Through sequencing miRNAs for their quantifications, we show that some known miRNAs (miR-148b-5p, miR-879-5p, miR-144-3p, miR-540-5p, miR-582-5p, miR-15b-5p, miR-210-5p, miR-871-3p, miR-3103-5p, miR-16-1-3p, miR-470-5p, miR-190b-5p, miR-384-5p and miR-490-5p) are upregulated in CUMS -induced depression mice (Table 3), which degrade mRNAs listed in Table 1. In other words, the analysis from miRNA sequencing is consistent to the analysis from mRNA sequencing. [score:4]
These upregulated miRNAs include certain known miRNAs (mmu-miR-148b-5p, mmu-miR-879-5p, mmu-miR-144-3p, mmu-miR-540-5p, mmu-miR-582-5p, mmu-miR-15b-5p, mmu-miR-210-5p, mmu-miR-871-3p, mmu-miR-3103-5p, mmu-miR-16-1-3p, mmu-miR-470-5p, mmu-miR-190b-5p, mmu-miR-384-5p and mmu-miR-490-5p), as well as some novel miRNAs (novel_mir_46, novel_mir_214 and novel_mir_213) with their stem loop structures by Miredp (S3 Fig). [score:4]
[1 to 20 of 2 sentences]
10
[+] score: 7
Other miRNAs from this paper: mmu-mir-181a-2, mmu-mir-190a, mmu-mir-181a-1
However, miR-190 has multiple targets, one of which is Pax6 that is associated primarily with the Type 1 progenitors and directly activates the Neurogenin2 (Ngn2) gene [44]. [score:4]
We surmised that such a miR-190 effect was due to its decrease in the NeuroD1 level. [score:1]
Activation of MOR by morphine resulted in an elevation of the miR-181a level [24], while the miR-190 level was not altered (Zheng, 2010; Zheng, 2013). [score:1]
In our previous study, we reported that the extinction of the fentanyl-trained CPP response could be shortened by the injection of the miR-190 lentivirus within the DG [19]. [score:1]
[1 to 20 of 4 sentences]
11
[+] score: 7
Of these, 12 (mir-9, mir-200c, mir-708, mir-377, mir-26b, mir-296, mir-369, mir-32, mir-1965, mir-1190, mir-135b and mir-201) were differentially up-regulated and five (mir-291a, mir-190b, mir-297c, mir-713 and mir-470) were differentially down-regulated. [score:7]
[1 to 20 of 1 sentences]
12
[+] score: 7
The comparison between control- and MPA -treated cells revealed that 16 miRNAs were significantly modulated by more than two-fold (P < 0.05, Figure 1A), nine miRNAs were upregulated (miR-191*, miR-17*, miR- 470*, miR-451, miR-702, miR-434-3p, miR-493, miR-23a* and miR-485*) and seven were downregulated (miR-378*, miR-376a, miR-224, miR-190b, miR-16, miR-410 and miR-197) (Figure 1B). [score:7]
[1 to 20 of 1 sentences]
13
[+] score: 6
Other miRNAs from this paper: mmu-mir-190a, hsa-mir-190a, hsa-mir-190b
Yu Y Zhang D Huang H Li J Zhang M Wan Y Gao J Huang C NF-kappaB1 p50 promotes p53 protein translation through miR-190 downregulation of PHLPP1Oncogene 2013 37. [score:6]
[1 to 20 of 1 sentences]
14
[+] score: 5
Three of these candidate miRNAs were validated as being more highly expressed in the sperm from CORT -treated mice, namely miR-98 (t [(6.4)=]5.26, P=0.002), miR-144 (t [(3.9)]=5.93, P=0.008) and miR-190b (t [(7.4)]=2.73, P=0.028). [score:3]
An independent cohort of CORT -treated animals was generated to validate the five top miRNA candidates, miR-190b, miR-192, miR-449a, miR-98 and miR-144, using SNORD95 as a reference gene (Figure 5d). [score:1]
miR-190b, miR-26b, miR350 and miR-449a have predicted binding sites for Bdnf. [score:1]
[1 to 20 of 3 sentences]
15
[+] score: 4
mu-Opioid receptor agonists differentially regulate the expression of miR-190 and NeuroD. [score:4]
[1 to 20 of 1 sentences]
16
[+] score: 4
miR-145, miR-148a, miR-190 and miR-335 however showed different expression pattern in and HD cell mo del [33]. [score:3]
, miR-145, miR-190 and miR-335) remained unchanged in. [score:1]
[1 to 20 of 2 sentences]
17
[+] score: 4
Other miRNAs from this paper: mmu-mir-190a, hsa-mir-190a, hsa-mir-190b
In addition, As [3+] is able to induce the biogenesis of microRNA-190 (miR-190) that is responsible for the down-regulation of PHLPP. [score:4]
[1 to 20 of 1 sentences]
18
[+] score: 3
miR-431, miR-714, miR-744, miR-877, miR-130b, miR-21, miR-323-3p, miR-325, miR-409-3p, miR-154*, and miR-681 were significantly increased 4 days post-sciatic nerve crush in pre-conditioned DRGs, while miR-190, miR-1, miR-33, miR-32, miR-153, miR-335-5p, miR-193, and miR-488 showed significantly decreased expression. [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 3
Both the 3p and 5p miRNAs for miR-190 and miR-340 were affected by the deletion of EBER1, indicating that the promoters driving expression of the primary miRNA transcripts were affected (Fig. 2B), consistent with a recent report on miR-190 (9). [score:3]
[1 to 20 of 1 sentences]
20
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, hsa-mir-503, mmu-mir-503, hsa-mir-642a, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The luminal subtypes of breast cancer appear to have elevated expression of miR-190b, while basal-like tumors have higher levels of miR-18a/b, miR-9 and the miR-17-92 family and lower levels of miR-29 and miR-190b [55]. [score:3]
[1 to 20 of 1 sentences]
21
[+] score: 2
miR-190b and miR-19b-2 were increased and miR-133a-1, miR-133a-2 (same gene sequences mapped to different chromosomes) and miR-455 were decreased. [score:1]
There was a 40% decrease in miR-190b, but this was not significant (t [(8)]=1.59, P=0.151). [score:1]
[1 to 20 of 2 sentences]
22
[+] score: 1
Most candidates had 5′seed sequences distinct from known miRNAs; however the following candidates, conserved with humans, were similar to those in parentheses: 5 (miR-190/190b), 19 (miR-29b-2), 92 (miR-1195), 93 (miR-134), 132 (miR-486), and 183 (miR-345-3p). [score:1]
[1 to 20 of 1 sentences]