sort by

38 publications mentioning mmu-mir-675

Open access articles that are associated with the species Mus musculus and mention the gene name mir-675. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 516
Other miRNAs from this paper: hsa-mir-31, mmu-mir-31, hsa-mir-675, hsa-mir-3187
Overexpression of miR-675-5p can lead to the down-regulation of GPR55 and its signaling pathway, whereas the effect can be reversed by down-regulation of miR-675-5p expression. [score:11]
The target prediction of miR-675-5p from websites DIANA TOOL Targetscan and miRanda,the GRP55 score is 0.916(from DIANA TOOL, miTG score), -0.64(from Targetscan),-0.4313 and -0.1271(from miRanda, mirSVR score )and other target genes prediction of miR-675-5p score has been included in Additional file 1: Table S2 or refer to DIANA TOOL, Targetscan and miRanda websites. [score:11]
Down-regulation of the expression of GPR55 influences the effects of miR-675 on NSCLC cells To further ascertain whether GPR55 is a functional target of miR-675-5p, we transfected with LV-miR-675-5p inhibitor into Ltep-a-2 NSCLC cells, which have high endogenous miR-675-5p levels (Figure  1D). [score:10]
In contrast, expression of these genes was significantly up-regulated in NSCLC cells that stably expressed miR-675-5p inhibitor. [score:10]
As a low level of miR-675-5p expression in NSCLC is a common molecular incident and is correlated with progression of the disease, we hypothesize that overexpression of miR-675-5p in NSCLC can exert inhibitory effects on cell growth and proliferation. [score:9]
In the present study, we examined the expression of GPR55 signaling downstream target genes and found that expression of p-ERK, cyclin D1, MMP2 and MMP9 were decreased in NSCLC cells that stably overexpressed miR-675-5p. [score:9]
Therefore, down-regulation of the RhoA-MMP2/9 axis through inhibition of GPR55 is one of the important mechanisms underlying miR-675-5p -mediated inhibition of NSCLC invasion and metastasis. [score:8]
In contrast, expression of these genes was significantly up-regulated in Ltep-a-2 cells with stable down-regulation of miR-675-5p (Figure  7, right, lane 2) compared with negative control cell group (Negative control) (Figure  7, right, lane 1). [score:8]
Compared with control cell group (scrambled sequence), the cells transfected with miR-675-5p inhibitor displayed higher expression of GPR55, whereas the cells with the co-transfection of both LV-miR-675-5p inhibitor and si-GPR55 exhibited lower GPR55 expression (Figure  6A). [score:8]
Thus, down-regulation of cyclin D1 through inhibition of GPR55 could be a mechanism by which miR-675-5p suppresses cell proliferation and promotes cell cycle arrest at the G1 phase. [score:8]
Knockdown of GPR55 inhibited the expression of GPR55 and its main target genes, similar to miR-675-5p (right). [score:8]
miR-675-5p functions as a novel tumor suppressor in NSCLC and the anti-oncogenic activity may involve its inhibition of the target gene GPR55. [score:7]
Down-regulation of miR-675-5p promoted cell growth, proliferation, colony formation, invasion and migration, and promoted the tumorigenicity graft growth of nude mice in vivo (P < 0.01); whereas up-regulation of miR-675-5p had the contrary effects. [score:7]
The hsa-miR-675-5p -inhibition sequence was constructed as follows: (Forward) hsa-miR-675-5p -inhibition-Age I-F AATTCAAAAATGGTGCGGAGAGGGCCCACAGTG, (Reverse) hsa-miR-675-5p -inhibition-EcoR I-R CCGGCACTGTGGGCCCTCTCCGCACCATTTTTG. [score:7]
Up-regulation of GPR55 is inversely associated with down-regulation of miR-675-5p in clinical specimens of NSCLC. [score:7]
Therefore, down-regulation of miR-675-5p suppresses lung cancer progression and metastasis through regulation of GPR55. [score:7]
Moreover, knockdown of the expression of GPR55 using GPR55-specific siRNA (si-GPR55) (Fig6A, lane 4) abrogated the effects induced by miR-675-5p down-regulation (Figure  7, right, lane 4). [score:7]
Therefore, miR-675-5p could be a novel tumor-suppressor miRNA, and its down-regulation might contribute to lung cancer progression and metastasis through regulating GPR55 function. [score:7]
In Ltep-a-2 cells with miR-675-5p down-regulated expression, the protein levels of p-ERK, Cyclin D, GTP-RhoA, MMP9 and MMP2 (right, lane 2) were significantly increased compared with the negative control(right, lane 1) and si-GPR55 treatment abrogated the increased expression of these genes induced by miR-675-5p in the cells (right, lane 4). [score:7]
We are exploring the correlation between miR-675-5p and other target candidates and determining whether miR-675-5p can biologically regulate the potential targets in a different study. [score:6]
The expression of retinoblastoma (RB) protein which a known direct target of miR-675 has not changed in A549 cells and HTB-182 cells transfected with LV-miR-675-5p-precursor. [score:6]
However, the expression of these genes did not change in Ltep-a-2 cells (stable down-regulation of miR-675-5p) transfected with non-specific control siRNA (si-NC) (Figure  7, right, lane 3). [score:6]
However, the protein levels of retinoblastoma (RB) protein, a known direct target of miR-675 in colorectal cancer and another target prediction of miR-675-5p, IkB kinase TBK1 protein, was also reported to be necessary in mediating KRAS -driven tumorigenicity in lung cancer remained unchanged in A549 cells and HTB-182 cells transfected with LV-miR-675-5p-precursor (Additional file 2: Figure S1 and Additional file 3: Figure S2) [18, 19, 27]. [score:6]
In the present study, we first found that miR-675-5p was frequently down-regulated in lung tumor tissues and the reduced miR-675-5p expression was closely related to advanced stage and lymph node metastasis of NSCLC. [score:6]
However, the expression of these genes has not changed in Ltep-a-2 cells (stable down-regulation of miR-675-5p) transfected with non-specific control siRNA (si-NC) (Figure 7, right, lane 3). [score:6]
Moreover, knockdown expression of GPR55 abrogated the effects induced by miR-675-5p -inhibitor. [score:6]
Recent studies have shown that miR-675 expression was up-regulated in several cancer types, such as glioma [15], gastric cancer [16, 17], colorectal cancer [18] and hepatocellular cancer [19]. [score:6]
Upon up-regulation of miR-675-5p, the percentage of A549 and HTB-182 cells in G0/G1 phase increased from 54.7% ± 8.1% in controls to 71.2% ± 8.5% and from 52.6% ± 8.0% in controls to 70.0% ± 8.6%, respectively (P < 0.01), indicating that overexpression of miR-675-5p resulted in G1 phase arrest in NSCLC cells. [score:6]
Overexpression of miR-675-5p inhibits tumor growth of NSCLC cells in vivo. [score:5]
Overexpression of miR-675-5p inhibits proliferation, colony formation, migration, and invasion of NSCLC cells. [score:5]
Figure 2 Overexpression of miR-675-5p inhibited proliferation and colony formation of NSCLC cells. [score:5]
The expression of the non-canonical IkB kinase TBK1 protein which a target prediction of miR-675 has not changed in A549 cells and HTB-182 cells transfected with LV-miR-675-5p-precursor. [score:5]
Therefore, we cannot exclude the possibility that these candidate targets for miR-675-5p besides GPR55 could mediate tumor-suppressive function of miR-675-5p. [score:5]
Figure 4 Overexpression of miR-675-5p inhibits NSCLC in vivo. [score:5]
Furthermore, we demonstrated that miR-675-5p overexpression could suppress NSCLC cell proliferation, migration and invasion in vitro and tumor growth in vivo. [score:5]
Because H19 is unchanged, we speculate down-regulation of miR-675-5p in NSCLC results from post-transcriptional regulation instead of transcriptional repression of miR-675-5p’s primary transcript H19. [score:5]
Another example is pRB, a tumor suppressor that is targeted by miR-675 in colorectal cancer in which miR-675 acts as an oncogene [18, 19] and IkB kinase TBK1 [27]. [score:5]
Using bioinformatics software (DIANA TOOL, Targetscan, miRanda) to predict miR-675-5p potential target gene, combined with the literature and through the test screening, GPR55 was selected as a further object of study. [score:5]
Herein, we showed that miR-675-5p could suppress the carcinogenesis of NSCLC through inhibition of growth, proliferation, migration and invasion. [score:5]
We have provided the following lines of evidence that miR-675-5p inhibits tumor growth, proliferation and migration in part by suppressing GPR55. [score:5]
To explore whether miR-675-5p exerts its functions through the GPR55-ERK and/or GPR55-RhoA pathways that contribute to cancer proliferation, development and progression [28- 31], we examined a number of the main GPR55 signaling downstream target genes, including phosphorylation of extracellular signal regulated kinase (p-ERK), ERK, Cyclin D1 protein (cyclin D1), active form of RhoA (GTP-RhoA), matrix metalloproteinase-2(MMP2), and MMP9. [score:5]
Expression of p-ERK, cyclin D1, GTP-RhoA, MMP2 and MMP9 were decreased in A549 and HTB-182 cells that stably overexpressed miR-675-5p (Figure  7, left and middle, lane 3). [score:5]
To explore the possible mechanism underlying the inhibitory effect on cell growth by overexpression of miR-675-5p, cell cycle analysis was performed (Figure  2B). [score:5]
Therefore, future studies to identify additional novel targets of miR-675-5p and other miRNAs that can also regulate GPR55 will allow us to have deep understanding of the mechanisms underlying the development and progression of NSCLC. [score:5]
These data indicate that miR-675-5p suppresses progression of NSCLC through inhibition of the versatile tumor-promoting GPR55. [score:5]
Furthermore, enforced miR-675-5p expression inhibited lung cancer cell growth, proliferation, clone formation, migration and invasion in vitro, and tumorigenicity in vivo. [score:5]
Up-regulation of miR-675 in the prostate cancer cell line significantly decreased the level of TGFBI and repressed cell migration. [score:4]
Downregulation of miR-675-5p may result from reduced conversion of H19 into pre-miR-675 and/or reduced conversion of pre-miR-675 into mature miR-675-5p. [score:4]
These results indicated that GPR55 was a direct downstream target for miR-675-5p in NSCLC cells. [score:4]
These observations suggest that the effects of miR-675-5p down-regulation on the promotion of cancer cell proliferation, migration and invasion could be diminished by si-GPR55. [score:4]
Furthermore, miR-675-5p overexpression suppressed the migratory and invasive abilities of the NSCLC cells as determined by transwell assay (Figure  3A). [score:4]
Figure 1 Down-regulation of miR-675-5p is inversely associated with advanced stage and lymph node metastasis of NSCLC. [score:4]
GPR55 is a direct downstream target of miR-675-5p. [score:4]
To explore the relationship between miR-675-5p and GPR55 in clinical specimens, we compared GPR55 expression data from immunohistochemistry analysis with results of miR-675-5p expression level from qRT–PCR analysis on specimens of these NSCLC tissues. [score:4]
Interestingly, the cells transfected with LV-miR-675-5p inhibitor displayed higher proliferation, migration and invasion potential when compared with the cells transfected with both LV-miR-675-5p inhibitor and si-GPR55 (Figure  6B-F). [score:4]
Figure 5 GPR55 is a direct downstream target of miR-675-5p. [score:4]
These findings suggest miR-675 regulates its target genes and cancer cell behaviors in a cell or tissue type-specific in cancer. [score:4]
To confirm whether GPR55 was a direct target of miR-675-5p, a dual-luciferase reporter system was used, employing co-transfection of miR-675 mimic and a luciferase reporter plasmid containing the 3′UTR of human GPR55. [score:4]
For the colony formation assay, LV-miR-675-5p -inhibition, LV -negative control transfected A549 and HTB-182 cells or miR-675-5p -inhibition, pGC FU -RNAi-NC-LV (Negative control) transfected Ltep-a-2 cells (1000/well) were allowed to grow in culture dish(10-cm) and maintained in media containing 10% FBS, replacing the medium every 4 days. [score:4]
H19 has been shown to be the primary miRNA precursor of miR-675 in both human and mice and also been identified as a developmental reservoir of miR-675 that suppresses growth [45, 46]. [score:4]
These data indicate that miR-675-5p inhibits GPR55 signaling in NSCLC, which involved tumor development and progression. [score:4]
Therefore, overexpression of miR-675-5p might reduce cell proliferation of NSCLC mainly through G1 phase arrest. [score:3]
Another study found low expression of miR-675 in adrenal cortical carcinoma and metastatic prostate cancer cells [20, 21], implying that miR-675 may play different roles depending on the tumor type. [score:3]
Indeed, we identified at least 12 other potential targets of miR-675-5p using bioinformatic prediction analysis, including some tumor-related genes. [score:3]
Expression of miR-675-5p is inversely associated with advanced stage and lymph node metastasis of NSCLC. [score:3]
Therefore, the low miR-675-5p expression was closely related to the progression and metastasis of NSCLC. [score:3]
Figure 6 Requirement of GPR55 for miR-675-5p induced suppression of NSCLC cell proliferation, migration and invasion. [score:3]
Spearman’s correlation analysis was used to determine correlation between miR-675-5p and GPR55 expression. [score:3]
The expression of miR-675-5p in patients with non-small cell lung cancer had a negative correlation with lymph node metastasis (P < 0.01) and TNM stage (P < 0.05). [score:3]
Expression levels of miR-675-5p were determined by qRT-PCR and normalized against an endogenous control (U6 RNA). [score:3]
LV-miR-675-precursor, LV -negative control transfected A549 and HTB-182 or miR-675-5p -inhibition, or pGC FU -RNAi-NC-LV (Negative control) transfected Ltep-a-2 cells (3000/well) were allowed to grow in 96-well plates. [score:3]
For instance, TGFBI was recently proposed as a biologically relevant miR-675-5p target in prostate cancer [20]. [score:3]
Furthermore, the expression level of miR-675-5p in tumor tissues decreased statistically with increasing stage of NSCLC (P < 0.05) (Figure  1B). [score:3]
We also transfected with si-GPR55 into A549 NSCLC cells, which have high endogenous GPR55 levels (new Additional file 4: Figure S3) and lower endogenous miR-675-5p levels (Figure  1D), and the expression of GPR55 in the cells determined by Western blotting. [score:3]
The relationship between miR-675-5p expression and clinicopathologic parameters was analyzed using the Pearson X [2] test. [score:3]
A549 cells stably expressing miR-675-5p and negative control vector were injected subcutaneously into nude mice. [score:3]
Figure 7 miR-675-5p -mediated inhibition of the GPR55 signaling pathway. [score:3]
The expression of miR-675-5p was analyzed by real-time quantitative PCR (qRT-PCR). [score:3]
The luciferase reporter assay showed that GPR55 was a direct target gene of miR-675-5p. [score:3]
We found that the expression level of miR-675-5p was significantly lower in NSCLC tissues than in the corresponding normal lung tissues, and inversely associated with advanced stage and lymph node metastasis of NSCLC. [score:3]
We noticed that miR-675-5p was underexpressed in NSCLC by using microarray (our unpublished data). [score:3]
Additional file 1: Table S2 79 targets prediction of miR-675-5p from websites DIANA TOOL. [score:3]
In addition, we identified the pro-oncogenic GPR55 gene as a target of miR-675-5p. [score:3]
Next, we searched candidate target genes of miR-675-5p using publicly available databases. [score:3]
However, the antioncogenic properties of miR-675-5p might not solely be explained by its ability to regulate a single gene alone, because a single miRNA can potentially regulate dozens to hundreds of genes in tumorigenesis [42]. [score:3]
In addition, miR-675-5p expression was significantly lower in NSCLC that displayed lymph node metastasis than in NSCLC that did not (P = 0.0055). [score:3]
Furthermore, our evidence suggests that miR-675-5p is a potential therapeutic target in NSCLC. [score:3]
Taken together, miR-675-5p might have tumor-suppressor function. [score:3]
Figure 8 Inverse correlation between the expression of GPR55 and miR-675-5p in clinical specimens of NSCLC. [score:3]
These findings suggest the possibility for miR-675-5p as a therapeutic target in NSCLC. [score:3]
In addition, THE orphan G protein-coupled receptor 55 (GPR55) was identified as a functional target of miR-675-5p. [score:3]
There was an inverse correlation between miR-675-5p and GPR55 expressions in these specimens (Figure  8D, R = -0.825, P < 0.001). [score:3]
GPR55 is identified as a target of miR-675-5p. [score:3]
The versatile functions of miR-675-5p in tumor cell proliferation, migration and invasion suggest its potential application as a prognostic predictor and cancer therapeutic target. [score:3]
Levels of miR-675-5p and GPR55 were normalized to U6 and β-actin, respectively, to yield a 2 [-ΔΔCt] value for relative expression of each transcript. [score:3]
In addition, western blot analysis showed that GPR55 protein expression was clearly decreased in A549 cells and HTB-182 cells transfected with LV-miR-675-5p-precursor (Figure  5 C and D). [score:3]
These results provided further evidence that miR-675-5p plays a tumor suppressive role in NSCLC cancer. [score:3]
The sequence was amplified and cloned into the pGCsil-GFP Vector to generate pGCsil-GFP-miR-675-5p -inhibition. [score:3]
miR-675-5p expression was significantly inversely associated with metastasis and Classification of Malignant Tumours (TNM) classification of the patients (Table  1, P < 0.005). [score:3]
To confirm reduced expression of miR-675-5p in NSCLC, we evaluated the expression of miR-675-5p in 80 pairs of frozen NSCLC tissues and the corresponding normal lung tissues using quantitative reverse transcriptase PCR (qRT-PCR). [score:3]
MiR-675-5p inhibits the GPR55 signaling pathway. [score:2]
Our report revealed a novel miR-675-GPR55 axis in regulation of NSCLC. [score:2]
The expression levels of miR-675-5p in NSCLC tissues were significantly reduced compared to those in adjacent non-cancerous tissues (P < 0.001). [score:2]
qRT-PCR assays were performed to detect miR-675-5p and GPR55 expression using the PrimeScript RT reagent Kit and SYBR Premix Ex Taq (GeneCopoeia, USA) according to the manufacturer’s instructions. [score:2]
For wound-healing assay, cells (1 × 10 [6] cells) were seeded in six-well plates, cultured overnight and transfected with miR-675-precursor, negative control or miR-675-5p -inhibition, pGC FU -RNAi-NC-LV (Negative control). [score:2]
The luciferase reporter assay was used to assess the target genes of miR-675-5p in non-small cell lung cancer cells. [score:2]
Interestingly, methylthiazol tetrazolium assay (MTT) showed that forced expression of miR-675-5p impaired the growth rate of the NSCLC cells (Figure  2A). [score:2]
In A549 and HTB-182 cells with miR-675-5p overexpression, the protein levels of p-ERK, Cyclin D, GTP-RhoA, MMP9 and MMP2 (left and middle, lane 3) were significantly decreased compared with the control. [score:2]
The relative expression levels for miR-675-5p in these six NSCLC cell lines were 0.224, 0.343, 0.378, 0.562, 0.541, and 0.673, respectively, as compared with that of HBE cells, respectively (Figure  1D). [score:2]
Similarly, colony formation assays showed that cell proliferation in both A549 cells and HTB-182 cells were significantly repressed by forced expression of miR-675-5p (Figure  2C). [score:2]
In this study, we aimed to evaluate the possible roles and related target genes of miR-675-5p in tumorigenesis of NSCLC. [score:1]
To validate the hypothesis, we transfected LV-miR-675-precursor or scrambled sequence (negative control) into A549 and HTB-182 NSCLC cells that had low basal levels of miR-675-5p in NSCLC cell lines (Fig1D). [score:1]
This study examined the role of miR-675-5p in non- small cell lung cancer (NSCLC). [score:1]
A549 cells grown in 96-well plate were co -transfected with 50 nM miR-675 mimic or mimic negative control, 100 ng of GPR55-3′UTR-Wt or GPR55-3′UTR-Mut, using the Lipofectamie 2000 (Invitrogen, USA). [score:1]
Intriguingly we did not observe any significant alteration at the protein levels of pRB and TBK1 by miR-675-5p in NSCLC cells (Additional file 2: Figure S1 and Additional file 3: Figure S2). [score:1]
miR-675-5p Progression NSCLC GPR55 Lung cancer is a malignant tumor with the highest morbidity and mortality in the world, which is a serious threat to human health and life security [1]. [score:1]
These data support GPR55 as a downstream mediator of miR-675-5p function in NSCLC. [score:1]
Further studies are required to fully understand the detailed mechanisms of miR-675-5p in NSCLC carcinogenesis and as a potential therapeutic approach. [score:1]
Figure 3 The effect of miR-675-5p on in vitro migration and invasiveness of NSCLC cells. [score:1]
The hsa-miR-675-precursor sequence was constructed as follows: (Forward) hsa-miR-675-Age I-F ACCGGTGGAGGGCGAAGC, (Reverse) hsa-miR-675-EcoR I-R GAATTCAAAAACTCCTGAGAG. [score:1]
The average tumor volume of A549 cells stably transfected with miR-675-5p was 1.23 ± 0.096 cm [3], which was significantly smaller than tumors in the negative control group (1.86 ± 0.132 cm [3]) (Figure  4B). [score:1]
, Shanghai, China) to generate pGCsil-GFP-miR-675 and the pGCsil-GFP Vector only as negative control. [score:1]
We evaluated the expression of miR-675-5p in NSCLC tissues and the corresponding normal lung tissues using quantitative reverse transcriptase PCR. [score:1]
Therefore, GPR55 may mediate cell proliferation, migration and invasion of NSCLC induced by miR-675-5p. [score:1]
Given that miR-675-5p impaired the proliferation, migration and invasion of NSCLC cells in vitro, we examined whether miR-675-5p could affect tumorigenicity in vivo. [score:1]
We also measured miR-675-5p expression in six NSCLC cell lines (95-D, A549, HTB-182, NCI-H1299, SPCA-1, Ltep-a-2) and a normal human bronchial epithelial cell line (HBE). [score:1]
Accumulating evidence suggests that miR-675-5p plays important roles in human carcinogenesis. [score:1]
Among the candidates, GPR55 exhibited one of the highest prediction scores and the most complementary structure with miR-675-5p (Additional file 1: Table S2). [score:1]
The RNA levels of miR-675-5p in NSCLC tissues were less than 30% of that in the matching normal tissues (Figure  1A). [score:1]
[1 to 20 of 129 sentences]
2
[+] score: 128
Placental explants were incubated with the scrambled inhibitor PNA conjugate, the miR-145 inhibitor PNA conjugate, the miR-675 inhibitor PNA conjugate, the scrambled miR inhibitor or the selective miR-145 inhibitor (50nM) for 24 or 48h. [score:11]
To determine whether miRNA inhibitor conjugates could be used to promote growth signalling in human placental tissue, first trimester and term placental explants were cultured with scrambled-, miR-145 inhibitor- or miR-675 inhibitor conjugates, or with commercially available scrambled- or miR-145 inhibitors that lacked the CCGKRK targeting sequence. [score:11]
In this proof of principle study, we have explored the feasibility of using a miRNA inhibitor as putative therapeutic in pregnancy, designed placental homing peptide-microRNA inhibitor conjugates synthesised from peptide nucleic acids, and demonstrated that targeted inhibition of miR-145 and miR-675 expression within the placenta leads to enhanced CTB turnover in human first trimester explants and increased fetal and placental weights in mice. [score:11]
This could be achieved by two approaches: firstly, as demonstrated in our study, miRNAs that are highly expressed in the first trimester (such as miR-145 and miR-675), and are negative regulators of growth and development, could be targeted for inhibition in women identified as being at high risk of impaired placentation. [score:9]
PCR analysis of miRNA expression in placentas harvested at E18.5 showed that treatment with the miR-675 inhibitor conjugate significantly reduced miR-675 expression (Figure 4G), but median placental miR-145 expression was not significantly changed at this time point (Figure 4H). [score:9]
Three homing peptide-miRNA inhibitor peptide nucleic acid (PNA) conjugates were synthesised by Cambridge Research Biochemicals: (i) a scrambled miRNA inhibitor sequence conjugated to the peptide CCGKRK via a disulphide linkage (5'- ACCACGCCTCTCGCCAGTGTCAC-Cys-Cys-Gly-Lys-Arg-Lys-3'); (ii) a miR-145 inhibitor sequence conjugated to the peptide CCGKRK via a disulphide linkage (5'-CAGGTCAAAAGGGTCCTTAGGGA-Cys-Cys-Gly-Lys-Arg-Lys-3'); and (iii) a miR-675 inhibitor sequence conjugated to the peptide CCGKRK via a disulphide linkage (5'-ACCACGCCTCTCCCGGGTGTCAC-Cys-Cys-Gly-Lys-Arg-Lys-3'). [score:9]
Of interest is our observation that placental miR-675 expression was quite varied in mice treated with the scrambled inhibitor conjugate (Figure 4H); placentas were randomly selected for analysis and expression level did not correlate with placental uterine horn position, the pregnant dam from which the placentas came, or individual fetal or placental weights. [score:7]
miR-145-5p target sequence: 5' GUCCAGUUUUCCCAGGAAUCCCU 3' (conserved sequence between mouse and human); mmu miR-675-5p target sequence: 5' UGGUGCGGAAAGGGCCCACAGU 3'; hsa miR-675-5p target sequence: 5' UGGUGCGGAGAGGGCCCACAGUG 3'. [score:7]
Mice were intravenously injected with 100 µl of vehicle (PBS) or 1 mg/kg of the scrambled inhibitor PNA conjugate, the miR-145 inhibitor PNA conjugate or the miR-675 inhibitor PNA conjugate on E12.5, E14.5 and E16.5 of pregnancy. [score:7]
C57/BL6J mice were intravenously injected with PBS, a scrambled miRNA inhibitor conjugate (1mg/kg), a miR-145 inhibitor conjugate or a miR-675 inhibitor conjugate at three-time points during pregnancy. [score:7]
We have previously demonstrated a reduction in miR-675 expression in the human placenta in the third trimester 16, but its gene targets and function remain to be established. [score:5]
miR-675 expression was not significantly reduced in first trimester explants incubated with the miR-675 inhibitor conjugate (Figure 6C), but this may reflect the small sample size and the inherent biological variability of human tissue samples. [score:5]
Analysis of placental weight distribution indicated that 6 placentas weighed below the 10 [th] centile in PBS treated mice, and 5 placentas weighed below the 10 [th] centile in mice treated with the scrambled inhibitor conjugate, but no placentas fell below the 10 [th] weight centile in either miR-145 or miR-675 inhibitor conjugate -treated mice, suggestive of a growth-promoting effect. [score:5]
Mice injected with the miR-675 inhibitor conjugate exhibited a significant increase in median placental weight at E18.5, compared to mice injected with PBS or the scrambled inhibitor conjugate (Figure 4A). [score:4]
We demonstrate expression of miR-145 in mouse placenta for the first time, propose that this molecule controls placental weight gain and validate a previous report that miR-675 is a negative regulator of murine placental growth 25. [score:4]
3'UTRs 3'-untranslated region CTB cytotrophoblasts DMEM Dulbecco's modified Eagle medium EVT extravillous trophoblast FAM 5(6)-carboxyfluorescein FGR fetal growth restriction IGF-I insulin-like growth factor-I IGF-II insulin-like growth factor-II miR-145 microRNA-145 miR-675 microRNA-675 miRNA microRNA. [score:3]
We have previously shown that microRNA (miR)-145 negatively regulates IGF-I -induced cytotrophoblast proliferation in human placental explants 16, and a recent publication has identified miR-675 as a regulator placental growth/function in the mouse 25. [score:3]
Despite these challenges, we still achieved a significant inhibition of miR-675 with our current dosing regimen. [score:3]
These reasons may also explain why a significant increase in proliferation was not observed in the harvested mouse placentas despite miR-675 inhibition. [score:3]
The miR-145 and miR-675 inhibitor conjugates also significantly increased median fetal weight at E18.5, compared to mice injected with PBS (Figure 4C); however, fetal weight distribution curves showed that the number of fetuses falling below the 10 [th] centile remained unchanged. [score:2]
Work by our group and others has identified numerous miRNAs, including miR-675, miR-145, let-7a, miR-377 and miR-483, that influence events in early pregnancy 15, and can either positively or negatively regulate CTB proliferation in explants of human placental tissue 16- 19. [score:2]
The downstream targets of miR-675 have already been characterised in the mouse placenta and include the igfr1 gene 25. [score:1]
[1 to 20 of 22 sentences]
3
[+] score: 83
The VCR contains a target site for miR-675 [13], a target site for the miR-16 family of microRNAs [24, 25] and a target site for miR-376c [26]. [score:7]
The 4.8-kb gigaloop is a putative structure formed by pairing of VCR and a complementary sequence (cVCR) Figure 2. Conserved sequences of stratum 1 (shared by Homo and Callorhinchus IGF1R 3'-UTRs): (a) the 3' end of the long IGF1R transcript; (b) a miR-7-3p target site that has been lost from the Pelodiscus sequence; (c) let-7-3p target site; (d) miR-186 target site; (e) The VCR with predicted binding sites for miR-376c, miR-675 (derived from the imprinted H19 RNA) and miR-16. [score:7]
We undertook a comparative sequence analysis of vertebrate IGF1R 3'-UTRs to determine the evolutionary history of miR-675 target sequences and to identify conserved features that are likely to be involved in post-transcriptional regulation of IGF1R translation. [score:6]
IGF1R mediates the fetal growth-promoting effects of IGF-II [6] and binding of miR-675-3p to the 3'-UTR of Igf1r mRNA inhibits translation of the receptor [13]. [score:5]
The 3'-untranslated region (3'-UTR) of the mouse Igf1r mRNA is targeted by miR-675-3p derived from the imprinted H19 long noncoding RNA. [score:5]
If the latter scenario is correct, then the VCR is likely to have been an original target of miR-675 and miR-376 which evolved to target its sequence. [score:5]
The 3'-untranslated region (3'-UTR) of the murine Insulin-like growth factor 1 receptor (Igf1r) gene was subsequently found to possess two target sites for miR-675-3p [20]. [score:5]
Therefore, miR-675-3p is predicted to function as a maternally expressed inhibitor of fetal growth. [score:5]
By contrast to the deeply conserved target site for miR-675 in the VCR, the second reported target site for miR-675 [13] is found only in the Igf1r 3'-UTRs of house mice and their close relatives. [score:5]
Either the miR-675 and miR-376 binding sites were targets for unidentified ancient microRNAs, perhaps still present in Pelodiscus and Callorhinchus, or the more recent imprinted microRNAs evolved to target sequences that were conserved for functions unrelated to binding by microRNAs. [score:5]
Although the VCR was ‘disordered’ in many predicted structures, the miR-675 target site was sometimes recovered as part of a strong double helix (15 bp, –25.8 kcal/mol) formed with a complementary sequence (cVCR), 4.5 kb distant located between the stems of the megaloop (Fig.  5b). [score:3]
A comparison to other long transcripts with predicted target sites for miR-675-3p (KCNN3, TAOK1, PYGO1, MRPL19, ANKH and ADAM22) suggests that 185 is a ‘middling’ number of predicted microRNAs for a transcript of this length. [score:3]
The miR-675 and miR-16 target sites are proximal to the polyadenylation site and thus included within the short transcript. [score:3]
It is notable that miR-675 and miR-376 are both imprinted and maternally expressed [12, 27]. [score:3]
The initial impetus for the present study was to examine the evolutionary history of the miR-675-3p target sequences reported for mouse Igf1r mRNA [13]. [score:3]
Third, the VCR is targeted by multiple imprinted microRNAs (including miR-675-3p derived from the H19 RNA). [score:3]
The maternally expressed H19 long noncoding RNA is not only the substrate for the production of miR-675 but also acts as a competing endogenous RNA (ceRNA) or ‘molecular sponge’ for absorbing other microRNAs [74, 75]. [score:3]
These complexities may partly explain the difficulty of assigning an unambiguous function to H19 and miR-675 in the regulation of cell proliferation. [score:2]
By contrast, the miR-675 binding site of the VCR was often located within a long single-stranded bulge or in weakly bonded secondary structures. [score:1]
Stratum 3 also corresponds to the conjectured origin of genomic imprinting and microRNA-675 (Fig.  1a). [score:1]
The 1.3 kb 3'-UTR of the ‘short’ transcript terminates within the VCR, which also includes a conserved miR-675-3p -binding site. [score:1]
One conserved hairpin was shown to be processed as the pre-miRNA for miR-675 [12]. [score:1]
By contrast, miR-675 is known only from marsupial and eutherian mammals [35, 36] and miR-376 only from eutherian mammals [27]. [score:1]
[1 to 20 of 23 sentences]
4
[+] score: 80
Since we found the upregulation of Egr1 in HMGA1P7 overexpressing MEFs performing RNA-seq analysis [1], we tested whether it could be responsible for the miR-483-5p and miR-675-5p upregulation. [score:9]
The results reported in Figure 1 confirm the overexpression of miR-483-5p, miR-483-3p, miR-675-5p, miR-21-3p, and the downregulation of miR-187-3p in HMGA1P7 overexpressing MEFs in comparison with the WT ones. [score:8]
These results suggest that Egr1 could regulate miR-483 and miR-675 expression by upregulating H19 and Igf2 genes. [score:7]
Then, we converged our studies on the miR-483-5p and miR-675-5p, which showed the most upregulated fold-change in HMGA1P7 overexpressing MEFs by miRNA-seq analyses. [score:6]
Moreover, as expected from previous results, qRT-PCR showed upregulation of miR-483-5p and miR-675-5p following HMGA1P7 pseudogene overexpression in NIH3T3 cells (Figure 4A). [score:6]
Furthermore, miR-675-5p has been found overexpressed in metastatic colon cancer cells and it is able to induce resistance to 1,25(OH)2D3 by targeting VDR [24, 34]. [score:5]
These evidences are coherent with the conclusion that HMGA1P7 requires mature miRNAs to regulate Egr1 levels and then upregulates miR-483-5p and miR-675-5p. [score:5]
3.2. miR-483-5p and miR-675-5p are Upregulated in HMGA1P7 Mouse Tissues. [score:4]
Taken together, these data deeply endorse the assumption that HMGA1P7 could act as ceRNA for Egr1, which in turn upregulates miR-483-5p and miR-675-5p. [score:4]
As expected from previous data, qRT-PCR analysis showed that miR-483-5p and miR-675-5p were also upregulated in heart and spleen from HMGA1P7 adult transgenic mice (Figure 2). [score:4]
Here, we demonstrate that HMGA1P7 upregulates miR-483 and miR-675 through the activation of Egr1 by a ceRNA mechanism. [score:4]
Among them, we focused our attention on two of the most overexpressed miRNAs: miR-483 and miR-675. [score:3]
HMGA1P7 Pseudogene Sustains miR-483-5p and miR-675-5p Expression via a ceRNA Mechanism with Egr1. [score:3]
It has been reported that early growth response protein 1 (Egr1) controls the expression of H19 [40] and Igf2 [41] and that, intriguingly, miR-483 is located within the second intron of Igf2 gene [42] and miR-675 is encoded by the first exon of H19 gene [40]. [score:3]
Feng Y. Yang C. Hu D. Wang X. Liu X. miR-675 promotes disease progression of non-small cell lung cancer via activating NF-κB signaling pathwayCell Mol. [score:3]
Intriguingly, it has been extensively demonstrated that miR-483 and miR-675 are two oncomiRs since they have been found overexpressed in many tumours such as prostate [18], gastric [19], Wilms’ [20], adrenocortical [21], esophageal [22], breast [23], colon [24], and lung tumours [25]. [score:3]
In this study, we focused on miR-483-5p and miR-675-5p since they are involved in carcinogenesis and they belong to the H19/ Igf2 locus, which has been already linked to HMGA1P7 ceRNA network [1, 40, 42]. [score:1]
Indeed, Egr1 controls the transcription of H19 and Igf2 whose mRNAs maturation generates miR-483-5p and miR-675-5p [40, 41]. [score:1]
Consequently, H19 and Igf2 mRNAs increase and, with them, so do miR-483-5p and miR-675-5p amounts. [score:1]
[1 to 20 of 19 sentences]
5
[+] score: 71
Values are represented as mean ± S. D. Abolishment of expression of H19 and miR-675 in H19 knockout miceExpression of H19 in livers of wild type, maternal H19 knockout, and paternal H19 knockout mice was determined by RT-PCR at ages of 5, 10, 15, 20, 30, and 60 days after birth (Fig 3A). [score:8]
Similar to H19, miR-675 was only expressed when H19 was intact at the maternal allele (H19 [M+/P+] and H19 [M+/P-]) while knockout on the paternal allele (H19 [M+/P-]) was inconsequential to miR-675 expression. [score:6]
Prior literature has shown proper processing of miR-675 can slow growth in the placenta, and increases of miR-675 downregulate IGF1R, which causes IGF signaling to be inhibited [35]. [score:6]
The pattern of means for both miR-675-3p and miR-675-5p expression followed H19 expression. [score:5]
Certain wild type individuals, despite normally expressing H19 at early ages, showed very little miR-675 expression, indicating large interindividual variation. [score:5]
miR-675 has been shown to inhibit IGF1R indicating uninhibited IGF signaling may be the cause of the overgrowth phenotype and increases in cell proliferation. [score:5]
Abolishment of expression of H19 and miR-675 in H19 knockout mice. [score:4]
0187557.g003 Fig 3Expression of H19 and miR-675 RNA in mouse livers with H19 knockout on different parental alleles. [score:4]
H19 knockout on the maternal allele abolishes expression of both H19 and miR-675 despite the status of the paternal allele (Fig 3). [score:4]
Expression of H19 and miR-675 RNA in mouse livers with H19 knockout on different parental alleles. [score:4]
Using two different sets of primers directed against each miR-675 variant, their expression was determined by RT-PCR (Fig 3B). [score:3]
Inhibition of IGF1R by miR-675 may be the mechanism by which H19 controls liver growth. [score:3]
No significant differences were found, but a trend of an increase in IGF1R expression at the protein level was found for each age measured, suggesting a loss of miR-675 expression may be the cause for the overgrowth phenotype and the increase in cell proliferation. [score:3]
Essentially, H19 maternal allele knockout mice (H19 [M-/P+]) are also miR-675 knockout mice. [score:3]
Gene expression at the RNA level of H19, miR-675-3p, miR-675-5p, IGF2, IGF1, IGF1R, β-catenin, cyclin D1, CYP3A16, CYP3A11, CYP2B10, CYP2C29, and GAPDH was determined by TaqMan assays from Life Technologies (Carlsbad, CA, USA) according to the manufacturer's protocol. [score:2]
RNA expression of H19 (A) and miR-675-3p and miR-675-5p (B) in mouse livers at ages 5, 10, 15, 20, 30, and 60 days after birth (n = 4 per group) was determined by RT-PCR in wild type (H19 [M+/P+]), maternal H19 knockout (H19 [M-/P+]), and paternal H19 knockout (H19 [M+/P-]) mice measured as fold-changes compared to the wild type. [score:2]
Two different conserved microRNAs, miR-675-3p and miR-675-5p, are produced from the first exon of H19 [24]. [score:1]
H19’s action is potentially through miR-675. [score:1]
H19 potentially impacts liver growth and proliferation through the action of miR-675. [score:1]
H19 encodes a microRNA, miR-675, within its first exon [34]. [score:1]
[1 to 20 of 20 sentences]
6
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
7
[+] score: 30
Next, we examined whether the inhibition of H19 gene expression affected the expression of miR-675, located at exon 1 of the gene (Figure. [score:7]
Notably, knockdown of H19 gene expression in NCCIT cells had no effect on the expression of miR-675 relative to the control NCCIT cells (Figure. [score:6]
D. miR-675 expression in NCCIT cells was stable, and was not affected by H19 down-regulation as detected by qPCR (n = 3). [score:6]
Notably, H19 knockdown had no effect on mir-675 expression, indicating that the observed effects of H19 knockdown could be attributed exclusively to H19 lncRNA. [score:5]
In addition to the H19 lncRNA, miR-675, a highly conserved microRNA involved in the regulation of developmental genes, is expressed from the H19 gene [2]. [score:5]
The genomic site of miR-675, the target site of H19-shRNA and the primer sites used in qPCR assays are marked. [score:1]
[1 to 20 of 6 sentences]
8
[+] score: 29
We found that 50-fold overexpression of miR-675-3p had no effect on placental weight, suggesting that overexpressed miR-675 target(s) might regulate placental growth, but that underexpression of putative miR-675 target(s) had no phenotypic effect. [score:12]
Overexpression of non-mammalian (drosophila, C. elegans) and endogenous mouse miRNAsIt was previously reported that miRNAs derived from C. elegans or other lower species are difficult to express efficiently in mammalian cells in vitro 1. We therefore sought to compare the expression efficiency of endogenous mouse miRNAs (mir-107, mir-122, mir-675) and exogenous miRNAs from two non-mammalian species, namely drosophila (mir-14 and mir-276), and C. elegans (mir-77, mir-230). [score:7]
It was previously reported that miRNAs derived from C. elegans or other lower species are difficult to express efficiently in mammalian cells in vitro 1. We therefore sought to compare the expression efficiency of endogenous mouse miRNAs (mir-107, mir-122, mir-675) and exogenous miRNAs from two non-mammalian species, namely drosophila (mir-14 and mir-276), and C. elegans (mir-77, mir-230). [score:5]
This approach also led to the effective expression of endogenous mouse miRNAs, including miR-107-3p, miR-122-5p, and miR-675-3p (Fig. 2b). [score:3]
This included the drosophila miR-14 (n = 5–9) and miR-276a (n = 5–15), the C. elegans miR-77 (n = 5–12) and miR-230 (n = 6–10), and mouse miR-107-3p (n = 6–15), miR-122-5p (n = 3–12), and miR-675-3p (n = 6–11). [score:1]
Interestingly, one of the miRNAs we tested, miR-675, has been previously shown to restrict murine placental size, with oversized placentas in mice deficient in miR-675 45. [score:1]
[1 to 20 of 6 sentences]
9
[+] score: 15
We analyzed the number of validated target genes that were differentially expressed in SCZ individuals and revealed a lower frequency compared with the respective miR-137 targets (Additional file  1: Table S6, differentially expressed targets: let-7a 14%, miR-21-5p 11%, miR-93-5p 14%, miR-451a 0%, and miR-675-5p 0%). [score:10]
We selected the following five microRNAs that are expressed in the DLPFC but are not differentially expressed in SCZ individuals: let-7a, miR-21-5p, miR-93-5p, miR-451a, and miR-675-5p. [score:5]
[1 to 20 of 2 sentences]
10
[+] score: 10
miR-483 and miR-675 appear to be a pair of intragenic miRNAs that regulate the expression of this imprinting region. [score:4]
However, the dysexpression of miR-483 in liver fibrosis and HCC might result from other mechanism, such as H19 gene and its intragenic miRNA miR-675. [score:3]
The long non-coding RNA H19 functions as a precursor of miR-675, which in turn suppresses Igf1r [30, 31]. [score:3]
[1 to 20 of 3 sentences]
11
[+] score: 8
Recently Steck et al reported that expression of this miRNA was elevated in human OA as was the long non-coding RNA, H19, which harbors miR-675 [85]. [score:3]
It will be interesting to further dissect how regulation of chondrocytes by H19/miR-675 and IGF2/miR-483 affects cartilage matrix production and maintenance. [score:2]
In vitro studies showed that miR-675 indirectly affected levels of COL2A1 in differentiated human articular chondrocytes [32]. [score:2]
Interestingly, H19/miR-675 is located within an imprinted domain on human chromosome 11. [score:1]
[1 to 20 of 4 sentences]
12
[+] score: 8
Other miRNAs from this paper: hsa-mir-675
However, miR-675 is barely detectable in fetal liver despite the vast levels of H19, suggesting that the expression of miR-675 and H19 is not co-regulated in liver 19. [score:4]
Bottom: qPCR of liver Bcl2, H19, miR-675, and ileum Fgf15 expression in GFP or Bcl2 mice. [score:3]
The miR-675 was encoded in H19 exon1 and was reportedly co-activated with H19 during muscle differentiation 18. [score:1]
[1 to 20 of 3 sentences]
13
[+] score: 8
Other miRNAs from this paper: hsa-mir-21, mmu-mir-21a, hsa-mir-675, mmu-mir-21b, mmu-mir-21c
Indeed, Aparna et al. found that the maternal-specific H19-DMR deletion led to the upregulation of Igf2 and to an increase in IGF-1R translation, the latter of which is normally suppressed by H19-derived miR-675 [34]. [score:8]
[1 to 20 of 1 sentences]
14
[+] score: 7
The two remaining miRNAs downregulated in Ercc1 [−/−] MEFs, miR-369-5p and miR-675-3p, showed no expression changes in Ercc1 [−/Δ] mouse livers (data not shown). [score:6]
We analyzed the levels of 13 miRNAs confirmed to be dysregulated in P7 Ercc1 [−/−] MEFs compared to P3 Ercc1 [−/−] MEFs (miR-680, miR-320, miR-22, miR-449a, miR-455*, miR-675-3p, miR-128, miR-497, miR-543, miR-450b-3p, miR-872, miR-369-5p and miR-10b) in RNA samples prepared from the livers of WT young (20 weeks), the progeroid Ercc1 [−/Δ] mice, and WT old mice (30 months). [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
Another study demonstrated that H19 and hsa-mir-675 were upregulated in human colon cancer cell lines and primary colorectal cancer tissues [43]. [score:4]
For example, lincRNA H19 (H19, imprinted maternally expressed transcript (non-protein coding)), which hosts hsa-mir-675, was implicated in human tumor growth [39] in esophageal [40] and breast cancer [41], and different carcinomas and hepatic metastases [42]. [score:3]
[1 to 20 of 2 sentences]
16
[+] score: 6
It also encodes the conserved microRNAs miR-675-3p and-5p, which target Smad1, Smad5 and Cdc6, and thus promotes skeletal muscle differentiation and regeneration [8]. [score:3]
H19 was shown to promote skeletal muscle differentiation through the Igf2 signaling pathway or miR-675 -mediated gene suppression [8, 9]. [score:3]
[1 to 20 of 2 sentences]
17
[+] score: 5
Other miRNAs from this paper: mmu-mir-22, mmu-mir-214
In addition, a microRNA, miR-675 is embedded in the first exon of H19 and is reported to be co-expressed with H19 [30]. [score:3]
However, in this case, hepatic levels of miR-675 did not show any significant alteration in the db/db mice (Fig.   3c) indicating that this microRNA and its host (H19) are possibly not coregulated, at least, in the diabetic mice liver. [score:2]
[1 to 20 of 2 sentences]
18
[+] score: 5
Other miRNAs from this paper: mmu-mir-202
For example, we detected that H19, a well-known paternally imprinted gene, was the most significantly down-regulated lncRNA in the adult testis and contained mmu-mir-675 (Figure 6A). [score:4]
A recent study has demonstrated that H19 can indeed be processed in vivo to give rise to the 23 nt-long miR-675 miRNA and that this ability is conserved in humans and mice [66]. [score:1]
[1 to 20 of 2 sentences]
19
[+] score: 5
Other miRNAs from this paper: hsa-mir-675
Recently, this H19-derived miR-675 was shown to regulate tumor suppressor RB in human colorectal cancer favoring its progression [44]. [score:4]
An evolutionarily conserved microRNA miR675 has been also described in the H19 exon 1 [42], [43]. [score:1]
[1 to 20 of 2 sentences]
20
[+] score: 5
Kim N-H, Choi S-H, Lee TR, Lee C-H, Lee A-Y. Cadherin 11, a miR-675 target, induces N-cadherin expression and epithelial-mesenchymal transition in melasma. [score:5]
[1 to 20 of 1 sentences]
21
[+] score: 5
Kim N. H. Choi S. H. Kim C. H. Lee C. H. Lee T. R. Lee A. Y. Reduced MiR-675 in exosome in H19 RNA-related melanogenesis via MITF as a direct target J. Investig. [score:3]
MiR-675 was shown to be involved in H19-stimulated melanogenesis by targeting Mitf gene [22]. [score:2]
[1 to 20 of 2 sentences]
22
[+] score: 5
Several miRNAs are regulated by Sox9 (e. g. miR-140 and miR-455) [13– 15] or regulate Sox9 expression (e. g. miR-675 and miR-145) [16, 17]. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 5
Such a difference might reveal additional inconsistencies in the properties of the two cell types, possibly through mir675 expression (which is derived from H19). [score:3]
As the receptor for IGF2, IGF1r, is regulated by mir675, it would be of interest to examine IGF2 signaling in these cells. [score:2]
[1 to 20 of 2 sentences]
24
[+] score: 4
For example, let-7 miRs regulate opioid tolerance by repressing translation of mu opioid receptor mRNA, miR-154 and miR-675 are increased in mice trained to self administer morphine [26, 27], morphine decreases miR-133b in immature rat hippocampal neuron cultures [28], and morphine increases miR-15b and decreases miR-181b in human monocyte-derived macrophages [29]. [score:4]
[1 to 20 of 1 sentences]
25
[+] score: 4
Other miRNAs from this paper: hsa-mir-675
A recent study has also concluded that H19 plays a crucial role in regulating skeletal muscle differentiation and generation mediated by miR-675-3p and miR-675-5p, which are encoded within H19 by knockdown of H19 in myoblast cells and knockout of H19 in mouse satellite cells, respectively [14]. [score:4]
[1 to 20 of 1 sentences]
26
[+] score: 3
Other miRNAs from this paper: hsa-mir-483, mmu-mir-483, hsa-mir-675
The targets of the Mir483 and Mir675 miRNAs are unknown. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 3
We identified 22 highly expressed intergenic pri-miRNAs hosting kidney miRNAs including the Wilms tumor (renal neoplasm) -associated and imprinted transcript, H19, [52] a precursor for mir-675 [53] and the mir-17-92 cluster Mirhg1 pri-miRNA, with the latter being involved in embryonic lung proliferation and differentiation [54] (Additional file 9). [score:3]
[1 to 20 of 1 sentences]
28
[+] score: 3
Other miRNAs from this paper: hsa-mir-483, mmu-mir-483, hsa-mir-675
Bi-maternal misexpression of one or more of these transcripts (too much H19 or Mir675 or missing Igf2as, Mir483 or Ins2) or other, yet unidentied ICR-controlled transcripts, by strict biallelic insulation must contribute to the death of +/(mChβGI) [2] pups. [score:2]
These transcripts, H19 microRNA (Mir675) [75], Igf2 antisense RNAs (Igf2as) [76], [77] and Mir483 within an intron of Igf2 [78] could be also misregulated by biallelic insulation. [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 3
MicroRNAs showing higher level of endogenous expression included miR-31 (252% of control), miR-183 (12.5% of control), miR-675-3p (2.2% of control) and miR-3074-5p (3.7% of control). [score:3]
[1 to 20 of 1 sentences]
30
[+] score: 3
Other miRNAs from this paper: hsa-mir-675
H19 sequences that contain miR-675-3p and miR-675-5p were excluded in the probe design to avoid non-specific binding 20. [score:1]
The nucleotide sequences containing miR-675-3p and miR-675-5p were excluded from the design. [score:1]
Dey et al. showed that H19 lncRNA encodes miR-675-3p and miR-675-5p, which stimulate myogenesis. [score:1]
[1 to 20 of 3 sentences]
31
[+] score: 2
For instance, our recent study showed that miR-9-5p, miR-675-5p and miR-138-5p damaged skeletal cell proliferation and differentiation [2]. [score:1]
MiR-9-5p, miR-675-5p and miR-138-5p Damages the Strontium and LRP5-Mediated Skeletal Cell Proliferation, Differentiation, and Adhesion. [score:1]
[1 to 20 of 2 sentences]
32
[+] score: 1
Dey BK Pfeifer K Dutta A The h19 long noncoding rna gives rise to micrornas mir-675-3p and mir-675-5p to promote skeletal muscle differentiation and regenerationGenes Dev. [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
This observation is intriguing since H19, a maternally expressed noncoding RNA near Igf2, also is characterized by having an evolutionarily conserved microRNA miR-675 [51]. [score:1]
[1 to 20 of 1 sentences]
34
[+] score: 1
Other miRNAs from this paper: mmu-mir-27b, mmu-mir-140, mmu-mir-17, mmu-mir-224, mmu-mir-146b
Among the rest, miR-224 (H [2] = 81.8%; P < 0.001), miR-146b–5p (H [2] = 80.4%; P < 0.001), miR-27b–3p (H [2] = 64.0%; P = 0.001), miR-675–5p (H [2] = 62.5%; P = 0.001), and miR-140–5p (H [2] = 60.0%; P = 0.002) were also significantly heritable. [score:1]
[1 to 20 of 1 sentences]
35
[+] score: 1
Other miRNAs from this paper: mmu-mir-150
This miR-675 150 -mediated B cell function is also critical for the activation of T cells and 676 macrophages residing in adipose tissues, eventually exerting profound impacts on the 677 function of adipocytes. [score:1]
[1 to 20 of 1 sentences]
36
[+] score: 1
Other miRNAs from this paper: hsa-mir-675
For example, H19 hosts miR-675 in its first exon 57 58. [score:1]
[1 to 20 of 1 sentences]
37
[+] score: 1
The Igf2-H19 cluster encodes miR-675 and miR-483 but their precise role in stem cells is not known. [score:1]
[1 to 20 of 1 sentences]
38
[+] score: 1
One study has indicated that lncRNA H19 generates miR-675 in colorectal cancer [59]. [score:1]
[1 to 20 of 1 sentences]