sort by

22 publications mentioning hsa-mir-660

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-660. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 44
Based on the fold changes, qRT-PCR was performed to validate microarray results on 12 miRNAs, specifically miRNAs up-regulated in both heart and plasma (miR-660-3p, miR-665, miR-1285-3p and miR-4491), down-regulated in heart but up-regulated in plasma (miR-206 and miR-1268b), up-regulated in heart but down-regulated in plasma (miR-130-3p, miR-199a and miR-330-3p), down-regulated in both heart and plasma (miR-221-30, miR-487b-3p and miR-4288), were chosen for validation test in the plasma of 45 control and 45 CHF patients. [score:19]
Analysis of miRNAs expression revealed that miR-660-3p, miR-665, miR-1285-3p, miR-4491 and miR-130a-3p were relatively cardiac-enriched, while the remaining miRNAs showed a non-cardiac highly expression patterns (Supplemental Figure 1). [score:5]
Among the 10 successfully validated miRNAs, only 4 cardiac fibroblast-derived miRNAs (miR-660-3p, miR-665, miR-1285-3p and miR-4491) were upregulated both in heart and circulation. [score:4]
Then, we identified 3 cardiac fibroblast-derived circulating miRNAs (miR-660-3p, miR-665 and miR-1285-3p) significantly upregulated in CHF (in heart and circulation) and correlated to CHF severity, holding promises as diagnostic biomarker for CHF. [score:4]
Four cardiac fibroblast-derived miRNAs (miR-660-3p, miR-665, miR-1285-3p and miR-4491) were found significantly upregulated in heart and plasma during heart failure. [score:4]
In this study, 4 cardiac fibroblast-derived circulating miRNAs (miR-660-3p, miR-665, miR-1285-3p and miR-4491) performed better than other miRNAs in distinguishing CHF and indicating disease severity. [score:3]
As a result, 8 of the 12 selected miRNAs (miR-660-3p, miR-665, miR-1285-3p, miR-4491, miR-206, miR-1268b, miR-130-3p and miR-330-3p) were successfully validated in the second cohort. [score:1]
However, most miRNAs provided here have not been well studied before (including miR-660-3p, miR-665, miR-1285-3p and miR-4491), probably due to the following reasons. [score:1]
Further bioinformatics analysis aids us in the interpretation of the biological functions of these cardiac-related miRNAs (miR-660-3p, miR-665, miR-1285-3p and miR-4491) in CHF. [score:1]
The results showed that 4 cardiac fibroblast derived circulating miRNAs (miR-660-3p, miR-665, miR-1285-3p and miR-4491) all exhibited high accuracy for diagnosis (> 0.9). [score:1]
Interestingly, as shown in Figure 4, we found significant correlations with LVEF% (P < 0.05) for 3 cardiac fibroblast-derived circulating miRNAs, namely miR-660-3p, miR-665 and miR-1285-3p, while the other miRNAs showed no significant correlation. [score:1]
[1 to 20 of 11 sentences]
2
[+] score: 39
Other miRNAs from this paper: hsa-mir-532, hsa-mir-663b
Excel file showing potential target genes of hsa-miR-660 generated using TargetScan Human release 6.2 (June 2012) [53]. [score:5]
Although no previous study has linked these microRNAs to islet function, we found sex differences in islet expression of six target genes for hsa-miR-660 and hsa-miR-532 (for example, XPOT and SPIRE1). [score:5]
We next used TargetScan Human Release 6.2 (June 2012) [53] to find potential target genes of hsa-miR-660 and hsa-miR-532 (Additional files 19 and 20). [score:5]
Additional file 21: Differentially expressed target genes of hsa-miR-660 and hsa-miR-532. [score:5]
Excel file showing the differentially expressed target genes of hsa-miR-660 and hsa-miR-532 between female and male human islets. [score:5]
Also, potential target genes of hsa-miR-660 showed lower gene expression in female compared with male human islets. [score:4]
Additional file 19: Target genes for hsa-miR-660. [score:3]
Differential methylation between sexes is associated with altered levels of microRNAs miR-660 and miR-532 and related target genes. [score:3]
We found two microRNAs located on the X chromosome, hsa-miR-660 and hsa-miR-532, that exhibited lower DNA methylation and higher expression levels in pancreatic islets from female compared with male donors (Figure  7). [score:2]
Two of these microRNAs, hsa-mir-660 and hsa-miR-532, also showed elevated expression in parallel with decreased DNA methylation in female compared with male islets. [score:2]
[1 to 20 of 10 sentences]
3
[+] score: 34
Although miR-15 and miR-16 are mainly reported to be tumor suppressors, they have been reported to be upregulated in various kinds of cancer and be correlated with tumor cells metastasis, indicating their potential roles as oncomiRs 5. miR-660 expression was used as a good candidate for prognosis prediction in breast cancer 19. [score:8]
Among these miRs, up-regulation of miR-16, miR-15a, miR-28 and miR-660 were also seen significantly changes in high HIP1 expressers in a large and independent cohort of TCGA patients (Fig. 3). [score:6]
Among the 18 upregulated expression of miRNAs, 4 miRNAs including miR-15a, miR-16-2, miR-28 and miR-660 were validated in a large cohort of patients. [score:6]
For example, CCND3 gene regulated by miR-28-5p involved in P53 pathway, Wnt signaling pathway, cell cycle and Jak-STAT signaling pathway (Table S7), several targeted genes (ZYX, VCL, PDPK1, MAPK9, COL1A1, Tables S8 and 9) of miR-15/16 were involved in adhesion or migration processes; LFNG in notch signaling pathway was regulated by miR-660 (Table S10), etc. [score:5]
By means of miRNA-mRNA integrative analysis, we found several targeted genes of miR-28-5p, miR-15a, miR-16 and miR-660. [score:3]
In the KEGG analysis, these targeted genes of miR-28-5p, miR-15a and miR-16, miR-660 respectively involved in 77, 70, 83 and 33 different metabolic networks with oncogenic potential (Table S7–10). [score:3]
Importantly, HIP1 interference in THP-1 cell line dramatically reduced the expression of miR-16, miR-15a, miR-28 and miR-660 (Fig. 5A). [score:3]
[1 to 20 of 7 sentences]
4
[+] score: 25
The ANOVA test showed significant differences between control, MGUS, diagnostic and CR samples in the expression levels of miR-16 (P < 0.001), miR-17 (P < 0.001), miR-19b (P < 0.001), miR-20a (P = 0.002), miR-660 (P < 0.001) and miR-25 (P < 0.001), with the highest levels of expression observed in samples from healthy controls. [score:5]
A non-significant trend towards a difference in miR-331 expression was observed, and there were no significant differences between expression levels of miR-16, miR-17, miR-20a, miR-25 or miR-660. [score:5]
Downregulation of circulating miR-660 has been reported in plasma from lung cancer patients [40]. [score:4]
Moreover, the expression of five of these miRNAs miR-16, miR-17, miR-19b, miR-20a and miR-660 – increased at the time of CR, and two of the 14 miRNAs miR-19b and miR-331 – were linked to PFS after ASCT. [score:3]
The components of the 14-miRNA signature can be classified in five expression clusters: miR-16, miR-17-92 cluster and paralogs, miR-23/24/27a, miR-331 and miR-660. [score:3]
The analysis of the 14 miRNAs identified in the screening phase confirmed the differential expression of five miRNAs between the diagnostic and CR samples of the patients with MM: miR-16 (P = 0.028), miR-17 (P = 0.016), miR-19b (P = 0.009), miR-20a (P = 0.017) and miR-660 (P = 0.048) (Figure 2). [score:3]
miR-16, miR-17, miR-19b, miR-20a and miR-660 as markers of CR. [score:1]
Differential serum levels of miR-16, miR-17, miR19b, miR-20a, miR-25 and miR-660 in patients with multiple myeloma (MM) at diagnosis (Dx) and at complete remission (CR), in patients with monoclonal gammopathy of undetermined significance (MGUS), and in healthy controls (HC). [score:1]
[1 to 20 of 8 sentences]
5
[+] score: 12
In the miRNA-target gene regulatory network, IL-8 was cotargeted by the three miRNAs (miRNA-23a, miRNA-203 and miRNA-660). [score:6]
In the miRNA-gene regulatory network of radioresistant NPC cells, IL-8 was cotargeted by the three down-miRNAs (miRNA-203, miRNA-23a and miRNA-660) (Figure 2, Table 4), which was validated by qRT-PCR analysis (Figure 1C). [score:4]
In this network, ten genes (SOCS6, SMAD2, CDKN2B, PPARGC1A, FOS, FOSL2, IL8, IRS2, JAK1, WDR32) were coregulated by six miRNAs (miRNA-23a, miRNA-24, miRNA-30a, miRNA-545, miRNA-203, miRNA-660) (Figure 2, Table 4). [score:2]
[1 to 20 of 3 sentences]
6
[+] score: 10
Of these, 14 (miR-23b, miR-28, miR-98, miR-103, miR-107, miR-193a,0, miR-324-5p, miR-324-3p, miR-331, miR-374, miR-432, miR-502, and miR-660) were upregulated and 6 (miR-31, miR-451, miR-452, miR-565, miR-594 and miR-659) were downregulated. [score:7]
[27]-  57 miR-565 (n)↓(this study)-  58 miR-594 (n)↓(this study)   59 miR-659 (n)↓↓↓(this study)-   60 miR-660 (n) ↑↑↑ (this study) -    In bold are human-specific MR-miRs (hMR-miRs, 16 in total); Italicized are microRNAs shown to be differentially expressed during myogenesis in non- human cells; microRNAs with a known function in myogenesis are underscored. [score:3]
[1 to 20 of 2 sentences]
7
[+] score: 8
Previous studies have demonstrated that rifampin also inhibited anti-angiogenesis by regulating the expression of multiple miRNAs (miR-34b, miR-886-3p, miR-218, miR-576-3p, miR-200c, miR-616, miR-660, miR-335, miR-92a), and further induced the gene expression of BIRC3, CAV1, CAV2, FN1, ITGA1 and THBS1. [score:8]
[1 to 20 of 1 sentences]
8
[+] score: 8
Fortunato O. Boeri M. Moro M. Verri C. Mensah M. Conte D. Caleca L. Roz L. Pastorino U. Sozzi G. Mir-660 is downregulated in lung cancer patients and its replacement inhibits lung tumorigenesis by targeting MDM2-p53 interaction Cell Death Dis. [score:7]
In addition, among these, miR-660 was demonstrated to possess a therapeutic role in lung cancer cells and in vivo mo dels [18]. [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 7
Real-time of the selected miRNA confirmed the trends observed in the microarray analysis; however, the expression differences of miR-503 and miR-660 were not statistically significant (Fig. 4). [score:3]
The expression difference of miR-503 and miR-660 was not statistically significant in the qPCR analysis (Fig. 4B). [score:3]
Besides the abovementioned miRNAs promoting myoblast differentiation, a few identified molecules such as miR-29b [49], miR-31 [50], miR-9 [51], miR-145 [52], miR-194 [53], miR-378 [54], miR-449 [55], miR-503 [11, 27], miR-542, [56], and miR-660 [11] were described in the literature as skeletal muscle-related. [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 6
31 miR-411 –3.3 1.30E-07 14q32.31miR-494 [†] –2.0 1.90E-12 14q32.31 miR-503 –4.0 1.50E-15 Xq26.3 miR-532-5p –4.1 4.80E-19 Xp11.23miR-598 [†] –1.9 5.80E-10 8p23.1 miR-660 –2.4 1.60E-07 Xp11.23 Of the UV-regulated miRNAs 10 were found to be regulated by both UVA and UVB. [score:3]
31 miR-411 –3.3 1.30E-07 14q32.31miR-494 [†] –2.0 1.90E-12 14q32.31 miR-503 –4.0 1.50E-15 Xq26.3 miR-532-5p –4.1 4.80E-19 Xp11.23miR-598 [†] –1.9 5.80E-10 8p23.1 miR-660 –2.4 1.60E-07 Xp11.23Of the UV-regulated miRNAs 10 were found to be regulated by both UVA and UVB. [score:3]
[1 to 20 of 2 sentences]
11
[+] score: 6
Relative expression levels of (B) miR-532-5p, (C) miR-188-3p, (D) miR-362-5p, (E) miR-501-3p, (F) miR-660-3p, and (G) miR-502-5p in triple -negative breast cancer tissues (n = 19) and adjacent normal tissues (n = 4) are shown. [score:3]
miR-532-5p (Figure  2B; mean fold change 2.4), miR-188-3p (Figure  2C; mean fold change 2.5), miR-362-5p (Figure  2D; mean fold change 4.0), miR-501-3p (Figure  2E; mean fold change 5.3), miR-660-3p (Figure  2F; mean fold change 2.2), and miR-502-5p (Figure  2G; mean fold change 3.0) were all markedly up-regulated in the triple -negative breast cancers compared to the normal breast tissue controls. [score:3]
[1 to 20 of 2 sentences]
12
[+] score: 4
Interestingly, many of the genes containing such highly differentiated SNPs in the Alu-miRNA sites within their 3′UTRs (listed in Table 1) have target sites (encompassing these SNPs) for miRNAs that are primate-specific (miR-661 29, miR-1202 53), human-specific (miR-4739, miR-5095) 54, involved in the regulation of p53 signaling (miR-660 55, miR-661 29, miR-1285 56) or in the apoptosis pathway (miR-17 44 45, miR-30b 57, miR-106a-3p 45, miR-612 58). [score:4]
[1 to 20 of 1 sentences]
13
[+] score: 3
miRNA target prediction analysis revealed that hsa_circ_0004018 could sponge miR-30e-5p, miR-647, miR-92a-5p, miR-660-3p, and miR-626, additionally implying its role in tumorigenesis of HCC [140]. [score:3]
[1 to 20 of 1 sentences]
14
[+] score: 2
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUAInterestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
miRNA Sequence miR-574-5pUGA GUGUGUGUGUGUGA GUGUGU miR-941CACCCGGCU GUGUGCACAU GUGC miR-3149UUU GUAUGGAUAU GUGUGUGUAU miR-1238-5p GUGA GUGGGAGCCCCA GUGUGUG miR-545-3pUCAGCAAACAUUUAU UGUGUGC miR-2278GAGAGCA GUGUGUGUUGCCUGG miR-3148UGGAAAAAACUG GUGUGUGCUU let-7b-5pUGAG GUA GUAG GUU GUGUG GUU miR-493-3pUGAAG GUCUACU GUGUGCCAGG miR-1180UUUCCGGCUCGC GUGG GUGUGU miR-539-5pGGAGAAAUUAUCCUUG GUGUGU miR-32-3pCAAUUUA GUGUGUGUGAUAUUU miR-206UGGAAU GUAAGGAA GUGUGUGG miR-1299UUCUGGAAUUC UGUGUGAGGGA miR-3911U GUGUGGAUCCUGGAGGAGGCA miR-297AUGUAU GUGUGCAU GUGCAUG miR-610UGAGCUAAAU GUGUGCUGGGA miR-1228-5p GUGGGCGGGGGCAG GUGUGUG miR-595GAA GUGUGCC GUG GUGUGUCU miR-4455AGG GUGUGUGUGUUUUU miR-3650AG GUGUGUCU GUAGA GUCC miR-147a GUGUGUGGAAAUGCUUCUGC miR-660-3pACCUCCU GUGUGCAUGGAUUA Interestingly, most of the trinucleotide repeats contain base “U” and “G”, although it can be noticed that this type of SSR is less represented. [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 2
Other miRNAs from this paper: hsa-mir-17, hsa-mir-28, hsa-mir-223, hsa-mir-127, hsa-mir-188, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-30e, hsa-mir-362, hsa-mir-363, hsa-mir-367, hsa-mir-379, hsa-mir-196b, hsa-mir-450a-1, hsa-mir-431, ssc-mir-28, hsa-mir-493, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-500a, hsa-mir-501, hsa-mir-502, hsa-mir-450a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-506, hsa-mir-508, hsa-mir-509-1, hsa-mir-532, hsa-mir-615, bta-mir-127, bta-mir-30e, bta-mir-17, bta-mir-450a-2, bta-mir-532, bta-mir-363, bta-mir-660, hsa-mir-891a, hsa-mir-892a, hsa-mir-509-2, hsa-mir-450b, hsa-mir-892b, hsa-mir-708, hsa-mir-509-3, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-1248, ssc-mir-17, bta-mir-155, bta-mir-188, bta-mir-194-2, bta-mir-196b, bta-mir-223, bta-mir-28, bta-mir-362, bta-mir-367, bta-mir-379, bta-mir-431, bta-mir-493, bta-mir-500, bta-mir-502a-1, bta-mir-502a-2, bta-mir-502b, bta-mir-615, bta-mir-708, bta-mir-1248-1, bta-mir-1248-2, ssc-mir-450a, bta-mir-2320, bta-mir-1388, bta-mir-194-1, bta-mir-450a-1, eca-mir-30e, eca-mir-367, eca-mir-684, eca-mir-196b, eca-mir-615, eca-mir-708, eca-mir-194-1, eca-mir-493a, eca-mir-17, eca-mir-1248, eca-mir-28, eca-mir-127, eca-mir-379, eca-mir-431, eca-mir-493b, eca-mir-155, eca-mir-194-2, eca-mir-188, eca-mir-223, eca-mir-362, eca-mir-363, eca-mir-450a, eca-mir-450b, eca-mir-450c, eca-mir-500-1, eca-mir-500-2, eca-mir-501, eca-mir-502, eca-mir-508, eca-mir-509a, eca-mir-532, eca-mir-660, ssc-mir-30e, ssc-mir-196b-1, ssc-mir-450b, ssc-mir-127, ssc-mir-532, ssc-mir-708, ssc-mir-1285, ssc-mir-500, hsa-mir-514b, ssc-mir-363-1, ssc-mir-450c, hsa-mir-500b, ssc-mir-194b, ssc-mir-155, ssc-mir-362, bta-mir-3601, ssc-mir-615, ssc-mir-2320, bta-mir-450b, ssc-mir-194a, ssc-mir-196b-2, ssc-mir-363-2, ssc-mir-493, hsa-mir-892c, eca-mir-1388, eca-mir-514b, eca-mir-506a, eca-mir-509b, bta-mir-194b, ssc-mir-1388, ssc-mir-223, ssc-mir-660, bta-mir-194b-2, bta-mir-1949
In pig we found a cluster on chrX of mir-532, mir-188, mir-500, mir-362, mir-500, mir-660, and a mature unknown miRNA picked up by miRDeep. [score:1]
A more difficult case is the mir-532 cluster located on chrX in human (Additional file 1: Figure S14), which contains 8 known miRNAs from miRBase: mir-532, mir-188, mir-500a, mir-362, mir-501, mir-500b, mir-660, mir-502. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 1
miR-660 positively correlated with seven different transporters, miR-766 positively correlated with three transporters, and miR-886-3p and let-7g positively correlated with two transporters. [score:1]
[1 to 20 of 1 sentences]
17
[+] score: 1
They found that levels of miR-629 and miR-660 were able to independently differentiate xenografted mice from controls with 100% sensitivity and 100% specificity [78]. [score:1]
[1 to 20 of 1 sentences]
18
[+] score: 1
Overall, the 40 combinations consisted of 15 different miRNAs (miR-20b, miR-24, miR-28-3p, miR-132-3p, miR-140-3p, miR-146b-5p, miR-155, miR-191, miR-193a-5p, miR-328, miR-331, miR-381, miR-532, miR-628-5p, and miR-660) that were used for further analysis. [score:1]
[1 to 20 of 1 sentences]
19
[+] score: 1
miRNA △△Ct2 [−] [△△Ct] hsa-miR-1290 −10.05 1063.66 hsa-miR-1275 −9.36 655.36 hsa-miR-1260 −9.25 609.09 hsa-miR-574-3p −4.49 22.48 hsa-miR-454 −4.45 21.93 hsa-miR-148a −4.38 20.85 hsa-miR-539 −4.36 20.57 hsa-miR-223 −4.27 19.29 hsa-miR-142-5p −4.27 19.26 hsa-miR-485-3p −4.21 18.56 hsa-miR-548c-5p −4.13 17.56 hsa-miR-17 −4.12 17.41 hsa-miR-484 −4.10 17.17 hsa-miR-652 −4.09 17.01 hsa-miR-660 −4.07 16.78 hsa-miR-20b −4.06 16. [score:1]
[1 to 20 of 1 sentences]
20
[+] score: 1
Other miRNAs from this paper: hsa-mir-105-1, hsa-mir-105-2, hsa-mir-126, hsa-mir-574
Functional classification of these biomarkers includes growth and proliferation (Ki-67, survivin, NGAL), invasion and metastasis (p53, MMP-9, SK1, DcR3, COX2, EZH2, microRNAs miR-105, and miR126), epithelial–mesenchymal transition (EMT) (WNT5A/B, Pea3), immune response (PD-L1), therapy resistance (HER2Δ16, pSTS3, KLK10), survival (miR-574-3p, miR-660-5p, PIWIL3, PIWIL4), and many others (35). [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
Notably, this cluster was located adjacent to another cluster containing Letter Fluency Score, as well as miR-660-5p (Fig.   3). [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
56076:+ X_39130 136,780.7 268,282 uacccauugcauaucggaguug 22 hsa-miR-660-5p hsa-mir-660 97.7 2.00E − 17 X:48,640,826.. [score:1]
[1 to 20 of 1 sentences]