sort by

57 publications mentioning hsa-mir-638

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-638. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 419
Using a series of assays (for example, a reporter assay to validate that SOX2 is the only and direct target, miR-638 alterations drove SOX2 expression, miR-638 expression was inversely correlated with SOX2 expression in CRC tissues, SOX2 knockdown phenocopied the overexpression of miR-638, and SOX2 overexpression in miR-638 -transfected cells rescued miR-638 -induced function), SOX2 was finally identified as the functional target gene of miR-638 in CRC. [score:15]
miR-638 overexpression downregulated SOX2 expression, and miR-638 inhibition upregulated SOX2 expression. [score:15]
Furthermore, the inhibition of miR-638 induced CRC cell lines to develop mesenchymal-like cell features (e. g., reduced cell-cell contact, increased lamellipodium stretching, decreased expression of the epithelial cell marker ZO-1/E-cadherin, increased expression of the mesenchymal cell marker vimentin, and increased cell migration and invasion), and we confirmed that SOX2 is a direct target of miR-638. [score:10]
Moreover, miR-638 overexpression inhibited HCT-116 and SW1116 cell migration by 23.4% and 33.1%, respectively, whereas the inhibition of miR-638 expression enhanced cell migration up to 22.6% and 23.5%, respectively (Figure 2D, Additional file 4: Figure S1B). [score:9]
Our data revealed that miR-638 overexpression inhibited SOX2 mRNA expression by 69.97% and 61.02% compared with the negative control group in the HCT-116 and SW1116 cells, respectively; furthermore, SOX2 mRNA levels were upregulated in antagomiR-638 -transfected HCT116 and SW1116 cells (Figure 4D). [score:9]
Moreover, the SOX2 protein expression levels were downregulated in the miR-638 mimic -transfected CRC cell lines compared with the negative control (mimics negative control), and SOX2 expression was upregulated in the antagomiR -transfected CRC cell lines compared with the negative control (antagomiR negative control; Figure 4E). [score:9]
After validating the expression of these miRNAs through qRT-PCR in CRC tissues, we found that miR-638, which has been reported to be downregulated in human gastric cancers [31], basal cell carcinomas [32], and chronic lymphocytic leukemias [33], was obviously downregulated in CRC cancer tissues compared with adjacent tissues. [score:8]
Figure 4 miR-638 suppresses SOX2 expression by directly targeting its 3′-UTR. [score:8]
The inhibition of miR-638 by an antagomiR promoted cell invasion and a mesenchymal-like transition (lamellipodium stretching increased and cell-cell contacts decreased, which was accompanied by the suppression of the epithelial cell marker ZO-1/E-cadherin and the upregulation of the mesenchymal cell marker vimentin). [score:8]
The data show that the SOX2 mRNA expression level in the miR-638 high -expression group was only 73.04% of that observed in the miR-638 low -expression group (Figure 4F). [score:7]
After the cells were co -transfected with the SOX2 overexpression construct and miR-638, we confirmed SOX2 overexpression by Western blotting and then detected the expression of the epithelial cell marker ZO-1/E-cadherin and the mesenchymal cell marker vimentin. [score:7]
B) The overexpression of miR-638 mimics in SW1116 cells increased the expression of the epithelial cell marker ZO-1/E-cadherin and decreased the expression of the mesenchymal cell marker vimentin. [score:7]
Taken together, these results indicate that the inhibition of miR-638 in SW1116 cells resulted in mesenchymal-like features (such as stretched lamellipodia, reduced cell-to-cell contact, decreased epithelial cell marker ZO-1 and E-cadherin expression, and increased mesenchymal cell marker vimentin expression). [score:7]
C) miR-638 expression was correlated with tumor differentiation, and the miR-638 expression level was downregulated to 27.28% in moderately differentiated samples and to 61.29% in poorly differentiated samples compared with its levels in well-differentiated samples. [score:7]
SOX2 overexpression in miR-638 -transfected SW1116 cells decreased the expression of the epithelial cell marker ZO-1/E-cadherin and increased the expression of the mesenchymal cell marker vimentin. [score:7]
In contrast, the expression of the antagomiR to miR-638 decreased ZO-1/E-cadherin expression and increased vimentin expression. [score:7]
To determine whether SOX2 is involved in the miR-638 -induced inhibition of invasion and mesenchymal-like transition in CRC cells, we increased SOX2 expressions using an overexpression construct in miR-638 mimic -transfected CRC cells. [score:7]
In contrast, miR-638 overexpression resulted in epithelial-like features (such as increased cell-to-cell contact, increased ZO-1 and E-cadherin expression, and decreased vimentin expression). [score:7]
One study has provided evidence that miR-638 is downregulated at the invasive front of CRC [16]; however, its expression and function were not addressed. [score:6]
The RNAi -mediated knockdown of SOX2 phenocopied the invasion-inhibiting effect of miR-638; furthermore, SOX2 overexpression blocked the miR-638 -induced CRC cell transition to epithelial-like cells. [score:6]
miR-638 directly inhibits SOX2 expression by interacting with its 3′-UTR. [score:6]
miR-638, which was downregulated in non-small-cell lung cancer (NSCLC) tissues, aggravated DNA damage (induced by benzo (a) pyrene) by suppressing breast cancer 1 (BRCA1). [score:6]
B) miR-638 expression was downregulated in 83.33% of the 36 pairs of tissues. [score:6]
These data indicate that the knockdown of SOX2 can suppress CRC cell migration and invasion, similar to miR-638 overexpression. [score:6]
Taken together, these results indicate that miR-638 inhibited SOX2 expression through direct binding to the 3′-UTR of SOX2. [score:6]
Based on the miR-638 expression levels in the CRC tissue samples, we sorted these 36 samples into low- and high -expression groups (unpaired t-test). [score:5]
To understand the biological effect of miR-638 deregulation on the development of colorectal carcinoma, gain- or loss-of-function analyses were performed using an overexpression or silencing strategy through the transfection of miR-638 mimics or antagomiRs (using an Amaxa Nucleofector device) into the CRC cell lines HCT-116 and SW1116 (the miR-638 levels in the CRC cells were confirmed through qRT-PCR; Figure 2A and 2B). [score:5]
In this study, we found that miR-638 exhibited reduced expression in CRC tissues, and this loss of expression promoted cell invasion and a mesenchymal-like transition. [score:5]
Next, we determined the SOX2 mRNA and protein expression levels in HCT-116 and SW1116 cells with altered miR-638 expression levels. [score:5]
A) The overexpression of miR-638 mimics in SW1116 cells increased cell-to-cell contacts, and the overexpression of the antagomiR to miR-638 promoted lamellipodium stretching and decreased cell-to-cell contacts. [score:5]
A) SOX2 overexpression rescued the miR-638 -induced transition to epithelial-like cells, as verified by the level of expression of the epithelial cell marker ZO-1/E-cadherin and the mesenchymal cell marker vimentin by Western blotting. [score:5]
F) miR-638 expression was inversely correlated with SOX2 mRNA expression in CRC tissues. [score:5]
SOX2 overexpression rescues the miR-638 -induced inhibition of invasion and mesenchymal-like transition. [score:5]
SOX2 overexpression reversed the miR-638 inhibition of cell invasion and cell migration (Figure 7C and D, Additional file 8: Figure S3). [score:5]
The overexpression of SOX2 reversed the miR-638 inhibition of cell invasion (C) and cell migration (D). [score:5]
In this study, we confirmed that miR-638 exhibited reduced expression in CRC, and its expression was correlated with tumor differentiation grade. [score:5]
Figure 2 miR-638 overexpression inhibits cell invasion and migration. [score:5]
Furthermore, we detected SOX2 mRNA expression levels in CRC tissues in which miR-638 expression was detected. [score:5]
In addition to the four miRNAs described above, miR-638 was markedly downregulated in CRC tissues. [score:4]
These data demonstrate that SOX2 was frequently highly expressed in CRC tissues compared with adjacent non-cancerous tissues and was associated with tumor grade, in contrast to the miR-638 expression levels in CRC. [score:4]
The expression levels of miR-638 were decreased in 83.33% the samples (30/36; Figure 1B, Additional file 3: Table S1b) and a 22.98% decrease in expression in the CRC tissue samples compared with adjacent noncancerous tissue samples (2.323 to 1.789, p < 0.0001; Figure 1A). [score:4]
Moreover, one study indicated that miR-638 is downregulated at the invasive fronts of colorectal liver metastases based on microarray analysis [16]. [score:4]
Moreover, we identified SOX2, a factor that can induce pluripotent stem cells [17], as a direct, functional target of miR-638. [score:4]
A) We analyzed the expression levels of miR-638 in 36 pairs of CRC tissues and observed a 22.98% decrease in expression in the CRC tissue samples compared with adjacent noncancerous tissue samples, p < 0.0001 (paired t-test). [score:4]
Further data showed that miR-638 loss induced a mesenchymal-like transition (such as reduced cell-to-cell contacts, stretched lamellipodia, and upregulation of the mesenchymal cell marker vimentin). [score:4]
These results demonstrate that the loss of miR-638 promotes invasion and a mesenchymal-like transition by directly targeting SOX2 in vitro. [score:4]
Figure 3 The inhibition of miR-638 induces a mesenchymal-like transition in SW1116 cells. [score:3]
The miR-638 levels in all four CRC cell lines (HCT116, LoVo, SW1116, and SW480) were downregulated compared with that of normal colorectal tissues (Figure 1D). [score:3]
miR-638 overexpression reduced the number of invasive HCT-116 and SW1116 cells by 37.6% and 43.0%, respectively; however, antagomiR-638 enhanced cell invasion up to 20.8% and 27.6%, respectively (Figure 2C, Additional file 4: Figure S1A). [score:3]
SOX2 overexpression in miR-638 -transfected SW1116 cells decreased cell-to-cell contacts and promoted lamellipodium stretching. [score:3]
To confirm this hypothesis, we first examined the morphology of SW1116 cells with altered miR-638 expression levels. [score:3]
In summary, our results suggest that miR-638 is a potential invasion -associated tumor suppressor in CRC. [score:3]
miR-638 suppresses cell invasion and migration. [score:3]
These results demonstrate that miR-638 showed reduced expression levels in CRC and was inversely correlated with tumor differentiation. [score:3]
First, we predicted the target genes of miR-638 from miRNA. [score:3]
The results showed that miR-638 more drastically suppressed the luciferase activity of the SOX2 3’-UTR-containing reporter gene construct than the other three constructs (Figure 4A). [score:3]
Moreover, miR-638 expression levels were correlated inversely with SOX2 mRNA levels in human CRC tissues. [score:3]
Click here for file miR-638 Prediction targets. [score:3]
The representative figures of cell migration and invasion in miR-638 mimic- and SOX -overexpressing cells. [score:3]
Taken together, these data indicate that SOX2 can rescue the miR-638 -induced inhibition of cell invasion and mesenchymal-like transition. [score:3]
To further determine whether SOX2 was a bona fide target of miR-638, we mutated the predicted binding site of miR-638 on the SOX2 3′-UTR (Figure 4B) and found that the mutant SOX2 3 ′-UTR reporter gene completely abolished miR-638 -mediated repression (Figure 4C). [score:3]
We defined miR-638 as a new, invasion -associated tumor suppressor miRNA in vitro. [score:3]
Figure 1 miR-638 exhibits reduced expression in CRC tissues. [score:3]
To further determine whether SOX2 is involved in miR-638 -induced CRC cellular invasiveness, we inhibited SOX2 using siRNA, which was confirmed through Western blotting (Figure 6A). [score:3]
The loss of miR-638 expression in poorly differentiated CRC tissues and its role in promoting cell migration and invasion suggest that miR-638 may be involved in the EMT process. [score:3]
Click here for file The representative figures of cell migration and invasion in miR-638 mimic- and SOX -overexpressing cells. [score:3]
In the miR-638 mimic -transfected SW1116 cells, the epithelial cell marker zonula occludens-1 (ZO-1) and E-cadherin were upregulated compared with SW1116 cells transfected with the NC mimics. [score:3]
SOX2 overexpression rescued the miR-638 -induced transition to epithelial-like cells, as verified by the cell motility change. [score:3]
miR-638 and SRY-box 2 (SOX2) expression levels were detected in 36 tumor samples and their adjacent, non-tumor tissues from patients with CRC, as well as in 4 CRC cell lines, using real-time quantitative RT-PCR (qRT-PCR). [score:3]
Identification of the target genes of miR-638 is essential for the elucidation of its biological functions. [score:3]
miR-638 shows reduced expression in colorectal carcinoma. [score:3]
We found that miR-638 expression was differentially impaired in CRC specimens and dependent on tumor grade. [score:3]
To further evaluate the correlation between miR-638 and SOX2 expression in human CRC, we assessed SOX2 expression using immunohistochemistry (IHC) in a CRC tissue array (90 pairs of CRC tissues; Additional file 3: Table S2b). [score:3]
Subsequently, we examined the effect of miR-638 on CRC cell invasion and migration in vitro and found that miR-638 particularly inhibited cell invasion and migration, which suggested that miR-638 is an anti-oncomiR and invasion-related miRNA in CRC. [score:3]
Figure 7 SOX2 overexpression rescues the miR-638 -induced transition to epithelial-like cells. [score:3]
After transfection with miR-638 mimics for 48 hours, the relative luciferase activity of the plasmid containing the SOX2 3′UTR was inhibited by 45% by miR-638, and the relative luciferase activity of other plasmids exhibited no significant change. [score:3]
These findings define miR-638 as a new, invasion -associated tumor suppressor of CRC. [score:3]
B) SOX2 overexpression rescued the miR-638 -induced transition to epithelial-like cells, as verified by the cell morphology change. [score:3]
The cell-to-cell contacts were increased in the cells with miR-638 overexpression; in contrast, when antagomiR-638 was transfected, lamellipodium formation was promoted and cell-to-cell contracts were decreased (Figure 3A). [score:3]
These data show that miR-638 inhibited CRC cell invasion and migration. [score:3]
A) The luciferase activity of the luciferase reporter plasmid containing the 3′-UTRs of four putative miR-638 target genes was assessed using the Dual Luciferase Reporter Gene Assay. [score:2]
Luciferase reporter and Western blot assays were used to validate SOX2 as a target gene of miR-638. [score:2]
A reporter assay revealed that miR-638 repressed the luciferase activity of a reporter gene coupled to the 3′-untranslated region of SOX2. [score:2]
D) miR-638 expression was reduced in CRC cell lines compared with normal colon tissue samples. [score:2]
miR-638 elicited an apparent effect on the cell motility of CRC cells. [score:1]
B) A potential miR-638 binding site and the mutated sequence in the SOX2 3′UTR for the seed region are shown. [score:1]
C) The luciferase activity of the reporter vector containing either the wild-type (WT) or mutant (MT) SOX2 3′-UTR was assessed after cells were transfected with miR-638 mimics; the mutant abolished the repression by transfection with the miR-638 mimic. [score:1]
Click here for file Representative figures for cell migration and invasion in miR-638 mimic- and antagomiR-638 -transfected cells. [score:1]
miR-638 plays certain roles in pathology and physiology. [score:1]
Invasion (A) and migration (B) were examined after transfection with miR-638 mimics and pCDNA_SOX2 in CRC cells for 48 h. Click here for file Tables (S1a, S2a, S3, S5). [score:1]
Loss of miR-638 promotes a mesenchymal-like transition in CRC cells. [score:1]
The regulation of SOX2 expression by miR-638 was assessed using qRT-PCR and Western blot assays, and the effects of exogenous miR-638 and SOX2 on cell invasion and migration were evaluated in vitro using the HCT-116 and SW1116 CRC cell lines. [score:1]
In the present study, we sought to determine the role of miR-638 in CRC progression. [score:1]
Invasion (A) and migration (B) were examined after transfection with miR-638 mimics and pCDNA_SOX2 in CRC cells for 48 h. This work was supported by the Natural Science Foundation of the Shanghai Science and Technology Committee (No. [score:1]
We transfected the miR-638 mimics and SOX2 siRNA into HCT-116 and SW1116 cells using an Amaxa Nucleofector (Amaxa, Koeln, Germany). [score:1]
Representative figures for cell migration and invasion in miR-638 mimic- and antagomiR-638 -transfected cells. [score:1]
The results revealed that SOX2 -depleted cells showed significantly reduced cell invasion (Figure 6B, Additional file 6: Figure S2A) and migration (Figure 6C, Additional file 6: Figure S2B), which mimicked the effect of miR-638. [score:1]
These data suggest that miR-638 may be involved in the interaction between or conversion of epithelial and mesenchymal cells. [score:1]
Furthermore, miR-638 was correlated with tumor differentiation grade. [score:1]
The accession numbers for miR-638 is MIMAT0003308, and that for SOX2 is NM_003106.2. [score:1]
[1 to 20 of 100 sentences]
2
[+] score: 348
Because it is generally accepted that miRNAs exert their function by inhibiting the expression of their target genes, miR-638 may execute its tumor-inhibiting function by downregulating targets that normally have tumor-promoting function. [score:14]
Interestingly, a recent study reported that the downregulation miR-638 can promote CRC cell invasion and EMT though inhibiting SOX2, a target of miR-638 reported in lung cancer [21, 22], confirming that miR-638 exerts important function in CRC by regulation different targets. [score:11]
We revealed that DNM2 expression was frequently downregulated in CRC and positively correlated with miR-638 expression, indicating that they may share common regulatory mechanisms (Supplementary Figure S6A and B). [score:9]
Both miR-638 and TSPAN1 expression data were available for a total of 103 paired tumors and NCTs, and the results showed that the protein levels of TAPAN1 in the CRC tissues were inversely correlated with the miR-638 levels (Spearman r = −0.341, p < 0.0001; Figure 4C), suggesting that the increased TSPAN1 expression in CRC might due to miR-638 underexpression. [score:7]
In the present study, we validated that the miR-638 expression was significantly decreased in CRC compared with NCT in an expanded CRC cohort, and miR-638 can inhibit CRC cell proliferation, invasion and induce cell cycle arrest in G1 phase by directly targeting TSPAN1, a molecular that appears to be an independent prognostic factor for CRC. [score:7]
The statistical results were consistent with the expression microarray data, and miR-638 expression was remarkably downregulated (more than 1. 5-fold) in 55.8% (63/113) of the CRC tissues compared to the corresponding NCTs (p < 0.0001, Figure 1A and B). [score:7]
To further confirm the effect of promoter hypermethylation on the expression of miR-638, HCT-116 and LoVo cells were treated with the DNA methyltransferase inhibitor 5-aza-dC, and we found that the expression of miR-638 in the treated CRC cells was significantly restored compared with untreated cells (Figure 6E). [score:6]
The data for the miRNA expression microarray showed that miR-638 was downregulated in CRC [16]. [score:6]
An mRNA was designated as “downregulated” if its expression in miR-638 -transfected cells was greater than 2-fold lower than that in the corresponding control cells. [score:6]
miR-638 represses CRC cell growth, invasion and cell cycle progression by downregulating TSPAN1 expression. [score:6]
No significant relationship was found between miR-638 expression in CRC and tumor size, location, stage, or grading (p > 0.05), but patients with low miR-638 expression showed shortening survival when compared to patients with high miR-638 expression (p = 0.028, Figure 1C). [score:6]
To identify new miRNAs associated with CRC, we performed miRNA expression profiling and found that miR-638 is significantly downregulated in CRC, suggesting that miR-638 is a new CRC -associated miRNA [16, 22]. [score:6]
Furthermore, the ectopic expression of TSPAN1 using a plasmid of TAPAN1 open reading frame (ORF) promoted cell proliferation, which could not be repressed by the overexpression of miR-638 (Figure 5A and C). [score:5]
TargetScan and miRanda algorithms were then used to search for putative protein-coding gene targets of miR-638. [score:5]
After adjustment for age, gender, tumor size, TNM stage and grading, a Cox multivariate analysis indicated that miR-638 expression is a potential prognostic factor for survival (adjusted HR = 0.392, 95% CI = 0.201-0.776, p = 0.006) Figure 1 (A) miR-638 expression was detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR) in 113 paired CRC and adjacent noncancerous tissues (NCTs). [score:5]
Likewise, TSPAN1 overexpression could significantly abrogate miR-638 -dependent inhibitory effect on the G1/S transition and cell invasion (Figure 5D and 5E, Supplementary Figure S4). [score:5]
miR-638 expression was markedly downregulated in tumor tissues when compared to the corresponding NCTs (U6 small nuclear RNA was used as an internal control). [score:5]
We inhibited TSPAN1 expression with siRNA and found that the TSPAN1 -depleted cells exhibited decreased cell proliferation, which phenocopied the proliferation-repressing effect of miR-638, whereas miR-638 silencing could not restore cell proliferation in TSPAN1 -depleted CRC cells (Figure 5A and B). [score:5]
After adjustment for age, gender, tumor size, TNM stage and grading, a Cox multivariate analysis indicated that miR-638 expression is a potential prognostic factor for survival (adjusted HR = 0.392, 95% CI = 0.201-0.776, p = 0.006) Figure 1 (A) miR-638 expression was detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR) in 113 paired CRC and adjacent noncancerous tissues (NCTs). [score:5]
A recent paper showed that miR-638 could inhibit cell growth by targeting Sp2 in gastric cancer [23]. [score:5]
Figure 2 (A) The upregulation of miR-638 repressed the proliferation of HCT-116 and LoVo cells, whereas the knockdown of miR-638 enhanced the cellular growth rate of HCT-116 and LoVo cells. [score:5]
Our previous expression profiling data revealed that miR-638 was downregulated in CRC compared with the corresponding noncancerous tissues (NCTs) [16]. [score:5]
Xia et al showed that the downregulation of miR-638 promotes proliferation and invasion by regulating SOX2 and induces epithelial-to-mesenchymal transition (EMT) in non-small-cell lung cancer [21]. [score:5]
As showed in Figure 3C, the expression of the reporter gene in the recombinant plasmids containing the 3′UTR of TSPAN1, STC2, PLD1, DEF6 or HSPA5, were significantly inhibited by miR-638, particularly STC2 and TSPAN1 (Figure 3C). [score:5]
miR-638 posttranscriptionally reduces TSPAN1 expression by targeting its 3′UTR. [score:5]
Our data demonstrated that the overexpression of TSPAN1 is due to the underexpression of miR-638 in CRC. [score:5]
An siRNA sequence for TSPAN1 (5′-AGUGCCUGCCAUCAAGAAATT-3′), miR-638 mimics and inhibitor (anti-miR-638, chemically modified antisense oligonucleotides designed to specifically target mature miR-638) were synthesised by Ribobio (China). [score:5]
Recently, the downregulation of miR-638 has also been reported in gastric cancer [19, 20], lung cancer [21], and CRC [22], suggesting that miR-638 might play an important role in human tumorigenesis. [score:4]
In this study, we confirmed the downregulation of miR-638 in CRC tissue in an expanded cohort of CRC, and revealed the favourable effect of miR-638 on the survival of CRC patients. [score:4]
Collectively, these data prove that miR-638 represses CRC cell proliferation, invasion and cell cycle progression by directly targeting TSPAN1. [score:4]
To further confirm that TSPAN1 is a direct target of miR-638 in CRC, we mutated the predicted binding site of miR-638 in the TSPAN1 3′UTR (Figure 3E), and found that the mutant 3′UTR was completely refractory to miR-638 -mediated luciferase reporter repression in both HEK-293T and HCT-116 cells (Figure 3F). [score:4]
miR-638 inhibits CRC cell proliferation, invasion and regulates cell cycle progression. [score:4]
In summary, we determined that miR-638 is frequently downregulated in CRC, which is attributed to, at least in part, the promoter methylation. [score:4]
miR-638 inhibits CRC cell proliferation, invasion and regulates cell cycle G1/S transition. [score:4]
Downregulation of miR-638 in CRC predicts poor survival. [score:4]
The predicted binding sites in the 3′UTRs of the potential target genes of miR-638 were amplified by nested PCR and cloned into the region directly downstream of a CMV promoter -driven firefly luciferase cassette in the pcDNA3.0 vector (pLuc) [16]. [score:4]
miR-638 represses cell proliferation, invasion and regulates cell cycle progression by targeting TSPAN1 in CRC. [score:4]
We analyzed CNVs in 44 paired significant changes CRC and adjacent NCT tissues and didn't observed with regard to the copy numbers of miR-638 gene between CRC and NCT samples (data not shown), suggesting that CNV may not be an important mechanism leading to the downregulation of miR-638. [score:4]
Downregulation of miR-638 is caused by promoter hypermethylation in CRC cells. [score:4]
Taken together, these data suggest that miR-638 downregulation in CRC cells is attributable to promoter methylation. [score:4]
LoVo and HCT-116 cells stably expressing miR-638 or the control (2×10 [6]) were injected s. c. into the right flank of each nude mouse. [score:3]
Screening of candidate target genes of miR-638. [score:3]
The relative expression levels of miR-638 in 8 CRC cell lines were also much lower than in normal colon epithelium mucosae (Supplementary Figure S1). [score:3]
Taken together, these data suggest that TSPAN1 is a potential functional target of miR-638 in CRC. [score:3]
We used qRT-PCR to verify the 9 candidate genes in HCT-116 and LoVo cells transfected with miR-638, and found that 8 of the 9 genes were downregulated in the miR-638 -transfected cells compared with the control cells (Figure 3B). [score:3]
A total of eight genes were indeed downregulated in the miR-638 -transfected CRC cells compared to the control cells (* p<0.05). [score:3]
The sequence was then cloned into the lentivirus expression vector pWPXL to generate pWPXL-miR-638. [score:3]
TSPAN1 is overexpressed in CRC and its levels are inversely correlated with the levels of miR-638. [score:3]
Figure 3 in CRC (A) Initial screening of miR-638 target genes in LoVo cells transfected with miR-638 mimic using microarray and bioinformatic predictions. [score:3]
Figure 6(A) Schematic illustration of the spatial arrangement of CpG islands in the promoter region of miR-638 gene and the selected target sequences used for the DNA methylation analysis. [score:3]
To investigate the molecular mechanism by which miR-638 suppresses CRC cell proliferation, genomic-wide expression profiling was first performed in miR-638- or NC -transfected LoVo cells using a microarray. [score:3]
To further confirm this result, we used qRT-PCR to examine the expression level of mature miR-638 in an expanded cohort of 113 CRC patients. [score:3]
miR-638 expression is frequently reduced in CRC. [score:3]
Taken together, our primary data indicate that promoter hypermethylation is a potential mechanism for miR-638 underexpression in CRC. [score:3]
Together, these data suggest that miR-638 inhibit CRC proliferation by repressing the cell cycle progression at the G1/S transition in CRC cells. [score:3]
TSPAN1 levels are negatively correlated with miR-638 expression and CRC survival. [score:3]
The final concentration of the miR-638 mimics or inhibitors in the transfection mixture was 50 nM. [score:3]
Of the 156 cases, 146 were subjected to the TSPAN1 detection and 113 were examined for their miR-638 expression. [score:3]
In addition, attenuating promoter methylation was sufficient to restore miR-638 expression in CRC cells. [score:3]
miR-638 inhibited CRC proliferation, invasion and cell cycle progression by sliencing TSPAN1, a molecule that is closely related to the prognosis of CRC. [score:3]
Compared to the control, a total of 1,704 downregulated genes (>2-fold change) were identified in the miR-638 -transfected LoVo cells (Supplementary Table S1). [score:3]
Functional studies provide the first line of evidence that miR-638 can inhibit cell growth and cell cycle progression at the G1/S transition in CRC cells. [score:3]
In the present study, we revealed, for the first time, that TSPAN1 is a functional target of miR-638 in CRC. [score:3]
Interestingly, miR-638 has also been reported to be aberrantly expressed in other human tumors [19– 22]. [score:3]
Quantitative methylation analysis should be performed in CRC tissues to filter out low level background methylation by setting a proper cutoff value and therefore could determine the exact relationship between the promoter methylation levels and the miR-638 expression. [score:3]
Given that miR-638 inhibited CRC cell proliferation, we next sought to exam whether miR-638 has any impact on cell cycle progression of CRC cells. [score:3]
In agreement with these results, the endogenous TSPAN1 protein levels were also decreased in miR-638 -overexpressing CRC cells and could be restored in miR-638 -depleted CRC cells (Figure 3G). [score:3]
Therefore, we chose TSPAN1 and STC2 as candidate targets of miR-638 for the subsequent functional analysis. [score:3]
In addition, we also observed the inhibitory effect of miR-638 on CRC cell invasion. [score:3]
The decreased expression of miR-638 in CRC suggests that miR-638 may contribute to tumorigenesis. [score:3]
LoVo or HCT-116 cells stably expressing miR-638 or the vector control were washed from subconfluent cell culture plates with PBS and then resuspended with DMEM at a concentration of 1×10 [7] cells/mL. [score:3]
Screening of candidate target genes of miR-638 in CRC. [score:3]
The potential regulation of DNA methylation on miR-638/DNM2 should be elucidated in future work. [score:2]
Furthermore, methylated tumors showed decreased miR-638 expression compared with unmethylated tumors (Figure 6C). [score:2]
The results of a clony formation assay confirmed that the overexpression of miR-638 can repress the clony formation of CRC cells (p < 0.01, Figure 2B). [score:2]
To investigate the possible molecular mechanisms that mediate the downregulation of miR-638 in CRC, we performed a promoter methylation analysis. [score:2]
A cell proliferation assay showed that the ectopic expression of miR-638 significantly reduced the growth of LoVo and HCT-116 cells, whereas the silencing of miR-638 significantly promoted cell proliferation (p < 0.01, Figure 2A). [score:2]
As shown in Figure 2D, cell number in G1 phase was significantly elevated and the cell population in S phase reduced in miR-638 -overexpressing LoVo and HCT-116 cells compared with control cells. [score:2]
The complementary site of the seed region of miR-638 was selected for mutation. [score:2]
TaqMan microRNA assays (Applied Biosystems, USA) were used to determine the expression levels of miR-638 with U6 small nuclear RNA as an internal control. [score:2]
To further evaluate whether TSPAN1 is a direct functional target of miR-638 in CRC cells, we performed a series of functional restoration assays using HCT-116 and LoVo cells. [score:1]
miR-638 induced G1-phase arrest in CRC cells (* p<0.05, ** p<0.01). [score:1]
The mutant 3′UTR of TSPAN1, which carries the mutated sequence in the complementary site of the seed region of miR-638, was generated from the pLuc-TSPAN1 3′UTR-WT plasmid by overlap-extension PCR. [score:1]
miR-638 silencing promoted cell growth, but did not promote cell proliferation in TSPAN1 -depleted CRC cells. [score:1]
In addition, we revealed that promoter methylation appear to be an important mechanism medicating the silencing of miR-638 in CRC. [score:1]
However, little was known about the exact function and potential mechanisms of miR-638 in human tumors [21– 23]. [score:1]
Plasmids of pWPXL, pWPXL-miR-638 or pWPXL-TSPAN1 were transfected into HEK-293T cells using Lipofectamine 2000 reagent (Invitrogen, USA) with the packaging plasmid ps-PAX2 and the envelope plasmid pMD2G; the virus particles were harvested 48 hours later. [score:1]
RNA was extracted from the treated cells using the TRIzol reagent and was subjected to a qRT-PCR analysis for miR-638. [score:1]
The miR-638 gene is an intronic miRNA located on the first intron of DNM2. [score:1]
In contrast, the cell population of G1 phase was reduced and cell number in S phase was increased in miR-638 -depleted CRC cells (Figure 2E). [score:1]
These data show the extensive function of miR-638 in tumorigenesis. [score:1]
Approximately 5,000 HEK-293T cells per well and 12,000 HCT-116 cells per well were plated into 96-well plates and were cotransfected with 50 nM of miR-638 mimic (or NC), 50 ng of the luciferase reporter, and 5 ng of the pRL-CMV Renilla luciferase reporter using 0.5 μL Lipofectamine 2000 (Invitrogen, USA) per well. [score:1]
The promoter CpG island of miR-638 gene is hypermethylation in CRC cells. [score:1]
The first CpG island overlaps with the miR-638 sequence and the second CpG island is located in ~5Kb upstream of the miR-638 gene. [score:1]
Two CpG islands were found in the promoter region of miR-638 gene using online database tools (http://genome. [score:1]
A total of 5×10 [5] LoVo cells were seeded in 6 cm [2] culture plates and transfected with miR-638 mimic or negative control as described above. [score:1]
We found that one CpG island located ~5-kb upstream of the miR-638 sequence is hypermethylated in most of CRC tissues and cell lines. [score:1]
However, the exact function and mechanisms of miR-638 in CRC are largely unknown. [score:1]
[1 to 20 of 98 sentences]
3
[+] score: 283
Ectopic expression of miR-638 can repress tumor growth and inhibit angiogenesis by downregulating VEGF. [score:8]
Overexpression of miR-638 significantly suppresses the growth of gastric cancer cells [6], while downregulation of miR-638 promotes proliferation and invasion of human NSCLC cells [9] and colorectal carcinoma cells [10]. [score:8]
Using four different miRNA target gene prediction databases, we found that VEGF is one of the potential direct target genes for miR-638. [score:6]
For instance, miR-638 was significantly downregulated and may play a cancer suppressing role in human gastric cancer [6], basal cell carcinoma [7], breast cancer [8], non-small cell lung cancer [9], colorectal carcinoma [10], and chronic lymphocytic leukemia [11]. [score:6]
Using the miRNA target prediction tools, we predicted that the vascular endothelial growth factor (VEGF) might be a direct target of miR-638. [score:6]
As our in vivo study indicated that overexpression of miR-638 in the mouse tumor xenografts led to reduced VEGF mRNA and protein expression as compared with the control xenografts without miR-638 overexpression. [score:6]
miR-638 also inhibits cell proliferation, invasion and regulates cell cycle by suppressing TSPAN1 in human colorectal carcinoma [10]. [score:6]
Taken together, the above data suggest that miR-638 directly suppress VEGF expression in HCC. [score:6]
We therefore hypothesized that downregulation of miRNA-638 promotes angiogenesis and growth of hepatocellular carcinoma by targeting the VEGF signaling pathway. [score:6]
For instance, miR-638 inhibits cell proliferation by inhibiting Sp2 in gastric cancer [6]. [score:5]
To uncover the mechanisms by which miR-638 affects the malignant phenotype of HCC, we searched for its potential target genes in the TargetScan (http://www. [score:5]
A recent study showed that miR-638 expression was upregulated in HCC tissues as compared with normal liver tissues [16]. [score:5]
Furthermore, miR-638 overexpression significantly reduced VEGF mRNA and protein expression in both SMMC-7721 (Figure 2C upper) and MHCC-97H cells (Figure 2C lower). [score:5]
HCC patients in the miR-638 low -expression group had a median survival period of 21.23 months, whereas HCC patients in the miR-638 high -expression group had a median survival period of 50.33 months (Figure 1D). [score:5]
Overexpression of miR-638 significantly inhibited tumor growth and reduced angiogenesis in a mouse tumor xenograft mo del. [score:5]
These results indicate that miR-638 plays an important role in the development and progression of HCC by directly suppressing VEGF. [score:5]
These data indicate that miR-638 is capable of inhibiting tumor growth and VEGF expression in vivo. [score:5]
In this regard, overexpression of miR-638 may repress the HCC growth and inhibit HBV replication simultaneously. [score:5]
Furthermore, the expression of miR-638 was increased and the expression of the VEGF protein was reduced in miR-638 -treated tumors (Figure 5D and 5E). [score:5]
Moreover, our current study showed that overexpression of miR-638 in SMMC-7721 and MHCC-97H cells decreased VEGF mRNA and protein expression. [score:5]
However, in colorectal liver metastases, miR-638 has been shown to be significantly downregulated [17]. [score:4]
In conclusion, our findings showed that miR-638 is downregulated and inversely correlated with tumor size, portal vein invasion and poor prognosis in HCC. [score:4]
Compared with control cells, ectopic expression of miR-638 by pre-miR-638 vectors dramatically repressed the tube-forming capacity of HUVECs, whereas suppressing endogenous miR-638 by anti-miR-638 vectors promoted the tube-forming capacity of HUVECs (Figure 4A, 4B). [score:4]
VEGF is a direct target of miR-638 in HCC. [score:4]
miR-638 is downregulated in HCC. [score:4]
And samples with higher levels of miR-638 expression in tumor tissues than those in adjacent non-tumor tissues were considered miR-638 high -expression. [score:4]
Downregulation of miR-638 in colorectal cancer predicts poor survival [10]. [score:4]
In addition, several other cancer-related genes have been suggested as direct targets of miR638. [score:4]
For VEGF 3′-untranslated region (UTR) luciferase reporter assay, 100 ng of wild-type or mutant reporter constructs (pGL3 cm-VEGF-3′UTR-WT or pGL3 cm-VEGF-3′UTR-MUT) were co -transfected into HEK293 cells in 96-well plates with 100 nmol/L miR-638 or 100 nmol/L miR-NC expression vector and Renilla plasmid by using lipofectamine 2000 (Invitrogen). [score:4]
However, whether these cancer-related genes are also direct targets of miR-638 in HCC remains unknown. [score:4]
To explore the role of miR-638 in the development and progression of HCC, miR-638 expression was examined in HCC cell lines and clinical HCC specimens. [score:4]
Samples with lower levels of miR-638 expression in tumor tissues than those in adjacent non-tumor tissues were considered miR-638 low -expression. [score:4]
In NSCLC, downregulation of miR-638 has been shown to promote cell proliferation and invasion and to induce mesenchymal-like transition through a SOX2 -dependent pathway [9]. [score:4]
As shown in Figure 2B, overexpression of miR-638 significantly decreased the luciferase activity of wild-type VEGF but not that of mutant VEGF. [score:3]
Although the above evidence suggests that miR-638 may play an important role in tumorigenesis and tumor progression, the expression and functional role of miR-638 in HCC remained largely unknown. [score:3]
Figure 1(A) qRT-PCR analysis of miR-638 expression in human normal hepatic cell line HL-7702 cells and HCC cell lines (MHCC-97L, HepG2, Hep3B, SMMC-7721 and MHCC-97H). [score:3]
To validate whether VEGF was a direct target gene of miR-638, a luciferase reporter assay was conducted. [score:3]
The analysis of relationship between the relative expression level of miR-638 and clinicopathological feature in HCC. [score:3]
Spearman's correlation was used to explore the association between miR-638 and VEGF expression in the matched hepatocellular carcinoma tumor specimens. [score:3]
Curves of OS were plotted by Kaplan-Meier methods according to miR-638 expression levels. [score:3]
We also commercially synthesized 2′-O-methyl -modified antisense oligonucleotide of miR-638 was used as miR-638 inhibitor (named anti-miR-638). [score:3]
More importantly, we found that miR-638 was inversely correlated with VEGF protein expression in clinical HCC samples. [score:3]
A recent study reported that the expression of miR-638 was higher in liver cancer tissues than normal liver tissues [16]. [score:3]
In addition, the relative miR-638 expression levels were inversely correlated with tumor size and portal vein invasion (P = 0.016, P = 0.012, respectively, Table 1). [score:3]
Similarly, 69% of clinical HCC samples have lower levels of miR-638 expression in tumor tissues than those in adjacent non-tumor tissues from the same patient (P < 0.01, Figure 1B). [score:3]
Inverse correlation between miR-638 and VEGF expression in HCC tissues. [score:3]
miR-638 inhibits tumor angiogenesis in vitro and in vivo To confirm that miR-638 is a potential angiogenesis suppressor in HCC, we investigated the influence of miR-638 on the angiogenesis both in vitro and in vivo. [score:3]
In this study, both in vitro and in vivo data indicated that miR-638 is capable of suppressing HCC angiogenesis. [score:3]
miR-638 inhibits tumor angiogenesis in vitro and in vivo. [score:3]
The expression of miR-638 was reduced in HCC cell lines and clinical specimens. [score:3]
Consistent with the results observed in clinical HCC samples, significantly lower expression of miR-638 was observed in several HCC cell lines than normal human hepatic cells. [score:3]
The difference in the median survival period between miR-638 low- and high -expression groups was statistically significant (P < 0.001). [score:3]
Here we also showed that a very high copy number of miRNA-638 is required to produce a modest reduction of VEGF expression in cultured HCC cells. [score:3]
miR-638 inhibits hepatocellular carcinoma tumor growth in vivo. [score:3]
In the current study, we assessed the miR-638 expression in a relatively large sample sizes (100 HCC samples). [score:3]
Thus, miR-638 may be a new prognosis marker and a potential target for HCC treatment. [score:3]
Furthermore, we found that low miR-638 expression was correlated with poor prognosis of HCC patients. [score:3]
The relative miR-638 expression levels of the high group (n = 31) and the low group (n = 69) were shown in Figure 1C. [score:3]
A recent study showed that miR-638 mimics can significantly inhibit HBV replication [30]. [score:3]
Figure 5miR-638 inhibits HCC progression in vivo miR-638 and control vector -transfected SMMC-7721 cells were injected subcutaneously into different posterior flanks of the same nude mice. [score:3]
miR-638 inhibits HCC progression in vivo. [score:3]
The primers were as follows: miR-638-RT:5′-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAGGCCGC-3′; miR-638-F:5′-ATCCAGTGCGTG TCGTG-3′; miR-638-R:5′-TGCTAGGGATCGCGGGCGGGTG-3′; U6-F:5′-GCTTCGGCAGCACATATACTAAAAT-3′; U6-R:5′-CGCTTCACGAATTTGCGTGTCAT-3′; VEGF-F:TG CAGATTATGCGGATCAAACC; VEGF-R:TGCATTCAC ATTTGTTGTGCTGTAG;GAPDG-F:TGAAGGTCGGA GTCAACGGATT; GAPDH-R:CCTGGAAGATGGTGA TGGGATT; The miR-638 expression vector (pre-miR-638) and control vector were constructed with synthetic oligonucleotides and cloned in between the 5′ EcoRI and 3′ HindIII sites of the pcDNA6.2-GW/EmGFP vector (Invitrogen) according to the manufacturer's instructions. [score:2]
Recently, dysregulation of miR-638 has been described in several different types of human tumors. [score:2]
However, how miR-638 regulates cancer cells growth remains elusive. [score:2]
The primers were as follows: miR-638-RT:5′-GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACAGGCCGC-3′; miR-638-F:5′-ATCCAGTGCGTG TCGTG-3′; miR-638-R:5′-TGCTAGGGATCGCGGGCGGGTG-3′; U6-F:5′-GCTTCGGCAGCACATATACTAAAAT-3′; U6-R:5′-CGCTTCACGAATTTGCGTGTCAT-3′; VEGF-F:TG CAGATTATGCGGATCAAACC; VEGF-R:TGCATTCAC ATTTGTTGTGCTGTAG;GAPDG-F:TGAAGGTCGGA GTCAACGGATT; GAPDH-R:CCTGGAAGATGGTGA TGGGATT; The miR-638 expression vector (pre-miR-638) and control vector were constructed with synthetic oligonucleotides and cloned in between the 5′ EcoRI and 3′ HindIII sites of the pcDNA6.2-GW/EmGFP vector (Invitrogen) according to the manufacturer's instructions. [score:2]
Dysregulation of miR-638 has been described in several different types of human tumors, including human gastric cancer [6], basal cell carcinoma [7], breast cancer [8], nonsmall-cell lung cancer [9], colorectal carcinoma [10] and chronic lymphocytic leukemia [11]. [score:2]
The tube formation assay was done using HUVECs in the tumor cell–conditioned medium (serum-free conditioned medium from high or low miR-638 expression group and control group). [score:2]
As shown in Figure 5A, tumor growth was significantly suppressed by LV-miR-638 as compared with the LV-miR-ctrl. [score:2]
Figure 2(A) Conserved miR-638 seed region sequence in the 3′-UTR of VEGF among different species. [score:1]
miR-638 was one of four miRNAs identified from genome-wide serum miRNA profiling that predict survival in nasopharyngeal carcinoma patients [21]. [score:1]
The sequence of anti-miR-638: 5′-AGGCCGCCACCCGCCCGCGATCCCT-3′. [score:1]
To assess the effects of miR-638 on tumor growth in vivo, miR-638 and control vector -transfected SMMC-7721 cells were injected subcutaneously into different posterior flanks of the same nude mice. [score:1]
To confirm that miR-638 is a potential angiogenesis suppressor in HCC, we investigated the influence of miR-638 on the angiogenesis both in vitro and in vivo. [score:1]
Moreover, miR-638 promotes melanoma metastasis, protects melanoma cells from apoptosis and autophagy [14], and aggravate DNA damage in the benzo(a)pyrene -induced carcinogenesis [15]. [score:1]
In vitro HUVEC tube network formation assayThe tube formation assay was done using HUVECs in the tumor cell–conditioned medium (serum-free conditioned medium from high or low miR-638 expression group and control group). [score:1]
Similarly, the average tumor weight of LV-miR-ctrl infected tumors was remarkably heavier than that of LV-miR-638 infected tumors at day 30 (Figure 5C). [score:1]
As shown in Figure 4C and 4D, the amount of MVD in the miR-638 group was remarkably lower than that in the control group. [score:1]
pLUC-VEGF vector or pLUC-VEGF mut vector was co -transfected with miR-638. [score:1]
We found that clinical HCC samples have lower levels of VEGF protein in tumor tissues than those in adjacent non-tumor tissues from the same patient (Figure 3A), and the VEGF protein levels miR-638 levels were inversely correlated with VEGF levels (r = − 0.793, P < 0.001, Figure 3B). [score:1]
As shown in Figure 2A, the region complementary to the miR-638 seed region was found in the 3′-UTR of human VEGF. [score:1]
We found that the majority of HCC patients, 69 out of 100, has lower levels of miR-638 in cancer tissues than adjacent non-cancerous tissues. [score:1]
The above results strongly indicated that miR-638 is involved in the progress of HCC, and may serve as a novel biomarker for the prognosis of HCC. [score:1]
These results suggest that miR-638 represses tumor angiogenesis in HCC. [score:1]
The relationship between the expression of miR-638 and clinicopathologic characteristics was conducted with Chi-square test. [score:1]
1 × 10 [6] SMMC-7721 cells infected with LV-miR-638 and LV-miR-ctrl were suspended in 100 mL PBS and then injected subcutaneously into either side of the posterior flank of the same female nude mouse. [score:1]
At day 30, the average volume of LV-miR-ctrl infected tumors was significantly larger than that of LV-miR-638 infected tumors (Figure 5B). [score:1]
To further investigate the relationship between VEGF and miR-638, we examined the expression of VEGF and miR-638 in 60 FFPE HCC specimens. [score:1]
But that does not mean miRNA-638's repression on VEGF production is not significant. [score:1]
[1 to 20 of 88 sentences]
4
[+] score: 266
We found that miR-638 knock-down in COPD fibroblasts preferentially leads to over -expression of its predicted targets and that overexpressed targets are enriched amongst gene targets anti-correlated with miR-638 expression in emphysematous lung tissue. [score:14]
While the positive correlations imply that miR-638 is part of a regulatory network in which upstream regulators lead to microRNA-mRNA target coexpression (incoherent regulatory circuit), we show evidence that miR-638 is an important regulator in the network as well, as it is anti-correlated with those targets it directly inhibits most in COPD fibroblasts. [score:14]
The 100 most upregulated predicted targets by fold change with miR-638 inhibition in fibroblasts were enriched amongst predicted targets anti-correlated with miR-638 expression in emphysema (P < 0.001, Kolmogorov-Smirnov test; Figure  4B). [score:12]
Unsupervised hierarchical clustering of the pathways significantly enriched amongst upregulated microRNAs identified several distinct clusters of downregulated functional categories associated with expression of multiple upregulated microRNAs, including miR-638 (Figure  3). [score:12]
The majority of miR-638 correlations are in the positive direction, consistent with the red line shifted right, while the targets over-expressed with miR-638 inhibition are mostly anti-correlated, consistent with the blue line shifted left. [score:8]
Furthermore, several miR-638 gene targets involved in these processes were dysregulated in vitro with miR-638 inhibition and anti-correlated with miR-638 expression in lung tissue with increasing emphysema severity. [score:8]
Differences in overall expression of miR-638 predicted targets between inhibitor and control experiments was determined by two-tailed Kolmogorov-Smirnov testing (limma, R) [24]. [score:7]
Our fibroblast dataset was compared to our emphysema dataset by using a gene set created from the 100 most upregulated miR-638 predicted targets (by fold change) between miR-638 inhibitor experiments and control experiments. [score:7]
Inhibition of miR-638 in lung fibroblasts leads to overexpression of its predicted targets. [score:7]
The microRNAs upregulated with increasing emphysema severity included broadly conserved and poorly conserved microRNAs, with the most upregulated including miR-520e and miR-302d from the miR-93 family, miR-92a, miR-638, miR-211, and miR-150. [score:7]
Thus, although miR-638 is positively correlated with two-thirds of its predicted targets in emphysema, those targets that are most affected with modulation of this microRNA in COPD fibroblasts are anti-correlated with miR-638 expression in emphysema. [score:7]
GSEA analysis revealed enrichment of many of the same biological pathways among the genes increased in fibroblasts after miR-638 inhibition as those whose expression was anti-correlated with miR-638 expression in emphysema (FDR <0.25; Figure  4C; Additional file 6: Table S5). [score:7]
miR-638 inhibition in fibroblasts led to upregulation of pathways that were also dysregulated in emphysematous lung tissue and involved in responses consistent with accelerated lung aging and the oxidative stress response. [score:7]
miR-638 inhibition caused modest changes in the expression of many target genes (1.15 to 1.4 fold change for significant genes in our experiments), similar to previously published studies on microRNA transfection [40, 41]. [score:7]
miR-638 was chosen as it had many correlated targets, was anti-correlated with multiple pathways involved in ECM dysregulation and tissue repair by GSEA, and has been shown previously to be expressed in normal human lung fibroblasts [39]. [score:6]
Figure 4 Changes in miR-638 predicted target gene expression with mir-638 knockdown. [score:6]
GSEA identified multiple pathways dysregulated in the aging response to oxidative stress that were enriched both in fibroblasts after miR-638 inhibition and anti-correlated with miR-638 expression in emphysema. [score:6]
We observed a significant enrichment of miR-638 predicted targets amongst upregulated genes in miR-638 knockdown experiments compared to controls (P = 2.6 × 10 [-10], Kolmogorov-Smirnov test; Figure  4A). [score:6]
We studied the function of miR-638, a microRNA whose expression increases with increasing emphysema severity, in regulating gene expression in human lung fibroblasts. [score:6]
Predicted miR-638 targets that participate in these functions and are over-expressed with miR-638 knock-down and anti-correlated with miR-638 in emphysema are listed in blue. [score:6]
miR-638 inhibition in fibroblasts led to upregulation of pathway gene sets involved in DNA repair, cell-cycle maintenance and traverse, RNA transcription, mitochondrial biogenesis, telomere maintenance, and processing of damaged proteins. [score:6]
The most highly connected microRNAs in the network included miR-638, miR-18a-3p, miR-483-3p, miR-181d, and miR-30c, which had greater than 50 positively or negatively correlated predicted targets, suggesting that these microRNAs may be important regulators of gene expression associated with emphysema severity. [score:6]
Pathways upregulated with miR-638 knock-down in fibroblasts are shown above this in blue. [score:5]
Gene targets of miR-638 in these pathways were amongst those negatively correlated with miR-638 expression in emphysema. [score:5]
We next examined the specific effects of miR-638 on the expression of its predicted targets in primary human lung fibroblasts obtained from a subject with severe COPD, as fibroblasts play a key role in the aberrant tissue repair and ECM maintenance observed in emphysema pathogenesis [37, 38]. [score:5]
miR-638 targets are involved in oxidative stress-related pathways and are anti-correlated with miR-638 expression in emphysematous lung tissue. [score:5]
A subset, including miR-638, miR-30c, and miR-181d, had expression levels that were associated with those of their predicted mRNA targets. [score:5]
Click here for file Pathway gene sets anti-correlated with miR-638 in emphysema and upregulated with miR-638 knock-down in fibroblasts. [score:5]
Inhibition of miR-638 expression in lung fibroblasts led to modulation of these same emphysema-related pathways. [score:5]
miR-638 overexpression in bronchial epithelial cells also increases DNA damage and decreases DNA repair, both of which contribute to cellular senescence and tissue repair dysregulation, after exposure to benzo(a)pyrene, a polycyclic aromatic hydrocarbon and component of cigarette smoke [48]. [score:4]
We demonstrated that miR-638, which was upregulated in emphysema, likely participates in COPD pathology by responding to oxidative stress, contributing to an accelerated lung aging response and leading to an impaired ability of the damaged lung to replace the damaged ECM. [score:4]
Furthermore, miR-638 may regulate gene expression pathways related to the oxidative stress response and aging in emphysematous lung tissue and lung fibroblasts. [score:4]
Five of these microRNAs (miR-638, miR-181d, miR-18a-3p, miR-30c, and miR-483-3p) were correlated with ≥50 of their predicted targets, suggesting that these microRNAs may play a key role in gene regulation in emphysema. [score:4]
A candidate microRNA, miR-638, was further studied in human lung fibroblasts derived from patients with severe COPD to better understand its role in regulating gene expression patterns associated with emphysema pathogenesis in vivo. [score:4]
Given our pathway and microRNA-target interaction analyses, we propose that miR-638 contributes to accelerated lung aging and oxidative stress responses in emphysema (Figure  5). [score:3]
We propose that miR-638 is involved in fine-tuning these processes and as its expression is increased with emphysema it contributes to increased cellular senescence, decreased tissue repair and increased tissue damage. [score:3]
Transfection experiments (n = 3) with miR-638 inhibitors and controls were performed using the HiPerFect transfection reagent (QIAGEN). [score:3]
miR-638 was chosen as it has many correlated targets and was previously found to be associated with cellular senescence and DNA damage [39, 48], suggesting it contributes to accelerated lung aging as well. [score:3]
Sixty-nine (56%) of these pathways were also anti-correlated with miR-638 expression in emphysematous lung tissue, and previously implicated in oxidative stress and accelerated lung aging responses. [score:3]
We have shown that the downstream inhibition of multiple genes by at least one of these microRNAs, miR-638, likely functions to affect emphysema pathogenesis. [score:3]
MicroRNA inhibitors in a final concentration of 50 nM (QIAGEN) for mir-638 were added dropwise to the cells. [score:3]
in fibroblasts and comparison of fibroblast and emphysema datasets GSEA analysis was done to determine biological pathways enriched with miR-638 inhibition. [score:3]
These findings clearly suggest that miR-638 contributes to the gene expression changes related to emphysema severity. [score:3]
GSEA analysis was done to determine biological pathways enriched with miR-638 inhibition. [score:3]
These results demonstrate that by modulating miR-638 in lung fibroblasts obtained from a patient with COPD, we can reproduce emphysema-related patterns of gene expression observed in lung tissue and further suggest a role for miR-638 in emphysema pathogenesis. [score:3]
We knocked down miR-638 in primary human lung fibroblasts and measured global gene expression using Affymetrix Human Gene 1.0 ST arrays. [score:2]
To evaluate the functional significance of miR-638 expression in emphysema, we identified the canonical pathways affected by miR-638 knock-down in fibroblasts, and studied the overlap with genes and pathways correlated with miR-638 in emphysematous lung tissue. [score:2]
This gene set was run against a list of genes ranked by their correlation with miR-638. [score:1]
Figure 5 Potential role for miR-638 in the pathogenesis of emphysema. [score:1]
[1 to 20 of 49 sentences]
5
[+] score: 221
The patients with high PLD1 expression (scored 2 or 3) showed poor prognosis compared with low PLD1 expression (scored 0 or 1) patients (P = 0.0272) As our previous research has found that miR-638 is down-regulated in CRC (Huang et al., 2011; Zhang et al., 2014), we intend to clarify whether miR-638 is down-regulated in GC. [score:10]
As Fig.   5A and 5B showed, PLD1 protein expression in GC was upregulated in 71/120 cases compared with paired NCTs, and was inversely correlated with the miR-638 levels (P < 0.05, Fig.   5C), which suggested that the increased PLD1 expression in GC was caused by miR-638 under -expression. [score:9]
Among the 12 potential tumor-related targets, 7 genes were significantly down-regulated in MKN-45 and SGC-7901 cells transfected with miR-638 and were considered to be the candidate targets of miR-638 (Fig.   3A). [score:7]
As our previous research has found that miR-638 is down-regulated in CRC (Huang et al., 2011; Zhang et al., 2014), we intend to clarify whether miR-638 is down-regulated in GC. [score:7]
gastric cancer miR-638 cell proliferation PLD1 MicroRNAs (miRNAs) are endogenous 19–25 nt RNAs that play important gene-regulatory roles in animals and plants through binding to the 3′untranslated region (3′UTR) of target mRNAs, and they can take part in cell development, differentiation and proliferation (Bartel, 2009; Sreekumar et al., 2011). [score:7]
Because the deletion of DNA sequence coding for miRNAs can result in the downregulation of corresponding miRNAs, so we checked the pri-miR-638 copy number by qPCR in 24 pairs of GC tissues and NCTs to determine the reason of miR-638 downregulation in GC. [score:7]
Furthermore, phospholipase D1 (PLD1), a putative cell apoptosis suppressor in GC, is characterized as a direct and functional target of miR-638, which provides a possible regulation pathway for PLD1 and a candidate target forthediagnostics and treatment of GC. [score:7]
Figure 5 Upregulation of PLD1 is inversely correlated with the miR-638 expression in GC. [score:6]
We checked the expression of miR-638 in 64 paired of GC tissues and NCTs, and observed significantly down-regulation of miR-638 in GC, which was in consistent with a previous report (Shrestha et al., 2014). [score:6]
Figure 1 The expression of miR-638 was down-regulated in GC. [score:6]
Expression of miR-638 is down-regulated in GC tissues. [score:6]
Taken together, all of these results proved that miR-638 inhibits cell proliferation via directly targeting PLD1. [score:6]
In addition, PLD1 identified as functional target of miR-638 in this study, was upregulated in GC and was closely related to the prognosis of GC patients. [score:6]
The enhanced expression of miR-638 can inhibit cell proliferation in vitro. [score:5]
The result showed that the miR-638 expression was down-regulated in 36 of 64 (56.25%) GC tissues when compared to the corresponding NCTs (P < 0.001, Fig.   1A and 1B). [score:5]
Furthermore, we revealed that PLD1 over -expression could significantly promoted cell proliferation, which could not be repressed by either the exogenous or endogenous overexpression of miR-638 (Fig.   4C–E). [score:5]
Beta-actin served as an internal controlTo further verify that PLD1 is a direct target gene of miR-638 in human GC, we generated a luciferase reporter plasmid which carried the mutated binding site of miR-638 in the PLD1 3′UTR. [score:4]
Beta-actin served as an internal control To further verify that PLD1 is a direct target gene of miR-638 in human GC, we generated a luciferase reporter plasmid which carried the mutated binding site of miR-638 in the PLD1 3′UTR. [score:4]
The down-regulation of miR-638 in GC suggests that it may involve in GC tumorigenesis. [score:4]
The present study showed that miR-638 is frequently down-regulated in GC, which partly attributed to the copy number of miR-638 locus; and miR-638 functions as a new repressor of GC cell proliferation. [score:4]
MiR-638 represses GC cell proliferation in vitroThe down-regulation of miR-638 in GC suggests that it may involve in GC tumorigenesis. [score:4]
Our previous work showed that miR-638 was downregulated in human CRC, and loss of miR-638 promotes CRC cell proliferation (Zhang et al., 2014). [score:4]
A panel of 12 genes were indeed down-regulated by miR-638. [score:4]
Down-regulation of miR-638 was first identified in human non-small-cell lung cancer (NSCLC) tissues (Li et al., 2012b). [score:4]
Our previous study revealed promoter methylation is a potential mechanism accounting for the down-regulation of the miR-638 in CRC. [score:4]
In this study, we found that loss of miR-638 repressed cell proliferation and colony formation in GC via its direct target, PLD1. [score:4]
Among them, we found that miR-638 is also down-regulated in GC as it in CRC. [score:4]
As miR-638 had been verified to be down-regulated in CRC, we want to clarify whether it is also abnormal in human GC. [score:4]
Other groups found that the loss of miR-638 could promote cell invasion and a mesenchymal-like transition in CRC cells (Ma et al., 2014), and downregulation of miR-638 promotes cell invasion and proliferation in NSCLS (Xia et al., 2014). [score:4]
In addition, miR-638 expression was not significantly associated with gender, age, tumor location, size, stage, and grading (P > 0.05). [score:3]
The miR-638 lentivirus expression vector pWPXL-miR-638 was constructed as described (Zhang et al., 2014). [score:3]
Taken together, these results suggest that PLD1 is a potential target gene of miR-638 in GC. [score:3]
Figure 3 Identification of PLD1 as the target of miR-638. [score:3]
Interestingly, we found that pri-miR-638 copy number was lower in GC tissues compared with their NCT counterparts (P < 0.05, Fig.   1C), suggesting that down-regulation of miR-638 in GC was modulated by the loss of DNA copy number. [score:3]
We reported here that loss of miR-638 caused overexpression of PLD1 in GC cells. [score:3]
Cell proliferation assay revealed that miR-638 overexpression significantly reduced the growth rates of MKN-45 and SGC-7901 cells (P < 0.05, Fig.   2A), and colony formation assay confirmed that miR-638 inhibited the proliferation function of GC cells (P < 0.05, Fig.   2C). [score:3]
In contrast, silencing miR-638 expression significantly promoted the growth of MKN-45 and SGC-7901 cells (P < 0.05, Fig.   2B). [score:3]
MiR-638 represses proliferation through directly targeting PLD1 in human GC cells. [score:3]
In conclusion, all these data show that miR-638 has the function of growth inhibitory. [score:3]
These results suggest that miR-638/PLD1 signalling could be a useful marker in GC and potential therapeutic targets for the treatment of GC patients. [score:3]
PLD1 levels are negatively correlated with miR-638 expression and GC prognosis. [score:3]
We observed that the copy numbers of pri-miR-638 were decreased in GC compared with NCT samples, suggesting that it account for, at least partly, the downregulation of miR-638 in GC. [score:3]
In line with these results, the endogenous PLD1 protein level was also decreased in miR-638-overexpression GC cells and could be restored in miR-683 -depleted GC cells (Fig.   3E). [score:3]
To validate this issue, we examined the mature miR-638 expression level in 64 GC tissues using qRT-PCR. [score:3]
To further examine whether PLD1 is a direct functional target of miR-638 in GC cells, we performed a series of functional restoration assays. [score:3]
Also, in miR-638 transfection group, the proliferation ability of GC cells were decreased, whereas anti-miR-638 could not restore cell proliferation in PLD1-knockdown GC cells (Fig.   4B). [score:2]
The complementary site of the seed region of miR-638 was selected for mutation. [score:2]
Figure 2 MiR-638 inhibits GC cell proliferation in vitro. [score:2]
The 3′UTRs of potential miR-638 target genes were amplified from genomic DNA using PrimerSTAR Premix (TaKaRa). [score:2]
Figure 4 MiR-638 repressed GC cell proliferation by inhibiting PLD1. [score:2]
These data suggest a key role of miR-638 in human tumorigenesis. [score:1]
Approximately 5,000 HEK-293T cells or 10,000 GC cells (MKN-45 and SGC-7901) per well were plated into 96-well plates and were cotransfected with 50 nmol/L of miR-638 mimic (or NC), 50 ng of the luciferase reporter, and 10 ng of the pRL-CMV Renilla luciferase reporter using 0.5 μL Lipofectamine 2000 (Invitrogen, USA) per well. [score:1]
The miR-638 gene is an intronic miRNA located on the first intron of DNM2. [score:1]
MiR-638 directly binds to the 3′UTR of PLD1. [score:1]
The free energy of hybrids between miR-638 and PLD1 was −21.1 kcal/mol. [score:1]
The mutant 3′-UTR of PLD1, which carried the mutated sequence in the complementary site for the seed region of miR-638, was constructed based on the p-Luc-PLD1 3′UTR-WT plasmid by overlap-extension PCR. [score:1]
[1 to 20 of 56 sentences]
6
[+] score: 212
In GC, miR-638 has been reported down-regulated in cancer tissues and could suppress GC cell proliferation by targeting Sp2 and cyclinD1 [13, 14]. [score:8]
Here, to further explore whether the effect of miR-638 was dependent on SOX2, we co -transfected miR-638 inhibitor and siRNA of SOX2 in GC cell lines (SC-M1 and SGC-7901) depending on the mentioned result that inhibition of miR-638 could up-regulate SOX2. [score:8]
MiR-638 up-regulation decreased the invasive ability of SGC-7901 and SC-M1 cells (p < 0.05), while miR-638 down-regulation increased the invasive ability of SGC-7901 and SC-M1 cells (p < 0.05; Figure 3A and 3B). [score:7]
Although miR-638 has been reported to be of inhibitory effect in the GC cell proliferation by other groups [13, 14], we found it also could regulate the invasion of GC by targeting SOX2, a factor that can regulate the self-renewal of stem cells and induce stem cell-like features of cancer cells. [score:7]
MiR-638 mimics could decrease SOX2 expression; meanwhile, miR-638 inhibitor could increase SOX2 expression (Figure 4B). [score:7]
It revealed that silencing of SOX2 by siRNA could suppressed the promotion of cells proliferation and invasion induced by down-regulated miR-638. [score:6]
Of these targets, SOX2 were significantly down-regulated after transfecting GC cell lines SC-M1 and SGC-7901 with miR-638 mimics, confirmed by qRT-PCR (Figure 4B). [score:6]
Up-regulation of SOX2 caused by miR-638 inhibitor promoted GC cells proliferation and invasion in vitro, and silencing of SOX2 prevented GC cells proliferation and invasion in vitro. [score:6]
We also found that SOX2 had a negative correlation with miR-638 in GC tissues, and miR-638 overexpression could decrease SOX2 expression level by directly binding the 3’-UTR of SOX2. [score:6]
The result indicated that SOX2 could be down-regulated by miR-638 through directly binding to its 3′ -UTR. [score:5]
Herein, we confirmed that miR-638 expression is down-regulated in human GC tissues compared to adjacent tissues. [score:5]
The NC oligonucleotides (miR-control), miR-638 mimics (hsa-miR-638 mimics), NC inhibitor (anti-miR-control), and hsa-miR-638 inhibitor (anti-miR-638) were designed and synthesized by RiboBio (Guangzhou, China). [score:5]
MiR-638 expression was down-regulated in human GC tissues. [score:5]
We used the TargetScan databases (Figure 4A) to search for potential targets for miR-638, and found some potential genes from these databases. [score:5]
SOX2 expression was higher in GC and could be regulated directly by miR-638. [score:5]
SOX2 expression was lower in GC and regulated directly by miR-638. [score:5]
Meanwhile, we took the cells transfected with miR-638 inhibitor and cells co -transfected with miR-638 inhibitor and siRNA-control as the control groups. [score:5]
Knocking-down SOX2 with siRNA reversed the promotion of GC cells proliferation and invasion caused by down-regulation of miR-638. [score:5]
What's more, we performed assay to confirm that whether the change of miR-638 expression could affect the expression of SOX2 in vitro. [score:4]
in vitro, down -regulating SOX2 by siRNA could counteract the effect of miR-638 inhibitor on GC cells proliferation and invasion. [score:4]
miR-638 is down-regulated in human GC tissues. [score:4]
Figure 3 (A) Transwell assay was performed after GC cell lines were transfected with miR-638 mimics, miR-638 inhibitor, NC and inhibitor NC for 24 h. The representative images of invasive cells at the bottom of the membrane stained with Giemsa were presented as shown. [score:4]
Knockdown of SOX2 antagonized the pro-invasion and pro-proliferation functions of miR-638 inhibitor. [score:4]
In addition, miR-375, miR-378, and miR-638 were revealed to be the most commonly down-regulated miRNAs [11, 12], but more in vivo and in vitro evidence is required to confirm the role of these miRNAs in GC. [score:4]
Results showed that the expression level of SOX2 was obviously decreased in cells (SC-M1 and SGC-7901) co -transfected with miR-638 inhibitor and siRNA-SOX2 compared to the control group (p<0.05, Figure 5A). [score:4]
Figure 2 (A) miR-638 expression in cell lines transfected with miR-638 mimics, miR-638 inhibitor and controls was determined by a qRT-PCR assay. [score:4]
And in GC cell lines (SGC-7901 and SC-M1), aberrant expression of miR-638 was related to the cell proliferation and invasion. [score:3]
Therefore, SOX2 may be the candidate tumor-related targets of miR-638. [score:3]
As one of the microRNAs, miR-638 has been found to be a tumor suppressor in some cancers, such as breast cancer [19], acute myeloid leukemia (AML) [20], non-small-cell lung cancer (NSCLC) [21], and digestive system neoplasms including gastric caner [13, 14], liver cancer [22, 23] and colon cancer [24]. [score:3]
Meanwhile, miR-638 inhibition could promote cell proliferation (p < 0.05, Figure 2B). [score:3]
Figure 4 (A) Initial screening result of miR-638 target gene by bioinformatics prediction. [score:3]
From the result of correlation analysis between miR-638 expression level and clinicopathological characteristics, there was no significantly correlation between tumor staging and miR-638 expression. [score:3]
Moreover, miR-638 expression was negatively correlated to lymph metastasis in GC (P<0.05). [score:3]
However, miR-638 expression level was not correlated with age, sexuality, tumor stage, degree of differentiation, or distant metastasis in the GC samples (Table 1). [score:3]
Furthermore, the number of G0/G1 phase cells was remarkably decreased in the miR-638 -inhibitor group relative to the control group (p < 0.05, Figure 2C and 2D). [score:3]
A correlation analysis between the miR-638 expression level and the clinicopathological characteristics of patients with GC was presented in Table 1. MiR-638 expression was lower in patients with high TNM stage (III–IV) than those with low stage (I–II) (P<0.05). [score:3]
In the above, we have confirmed the inhibitory effect of miR-638 on proliferation and invasion of GC cell lines. [score:3]
Figure 5 (A) GC cells were co -transfected with miR-638 inhibitor, siRNA-SOX2 and the relative control. [score:3]
We also applied flow cytometry to study the effect of miR-638 on cell cycle regulation. [score:2]
We further estimated the effect of miR-638 on cell invasion using the Transwell invasion assay after transfection with miR-638 mimics or inhibitor. [score:2]
Luciferase activity assay showed that the luciferase intensity in pMir–SOX2 was suppressed by miR-638 mimics, but not in pMir–SOX2–MUT vector (Figure 4C). [score:2]
Significant lower miR-638 level was detected in 50 of the 68 GC tissues compared with adjacent tissues (Figure 1A and 1C), and relative average expression level of miR-638 was 5.637±1.214 in tumor specimens vs 11.220±3.148 in adjacent tissues. [score:2]
MiR-638 inhibited the invasive ability of GC cell lines. [score:2]
To evaluate the role of miR-638 in the development of GC, gain- or loss-of-function tests were performed by transfecting SGC-7901 and SC-M1 with miR-638 mimics, inhibitor and corresponding controls. [score:2]
miR-638 regulates cell proliferation and cell cycle in vitro. [score:2]
miR-638 changed the invasiveness of GC cell lines in vitroWe further estimated the effect of miR-638 on cell invasion using the Transwell invasion assay after transfection with miR-638 mimics or inhibitor. [score:2]
MiR-638 suppressed cell growth and induces cell cycle arrest in GC cells. [score:2]
It showed that SOX2 was negatively regulated by miR-638 both in SC-M1 and SGC-7901 cell lines. [score:2]
In this study, miR-638 was not found to affect GC cells apoptosis (result not shown). [score:1]
To further examine the relationship between miR-638 and SOX2, the wild 3′-UTR fragment containing the predicted site of SOX2 (pMir–SOX2) and its corresponding mutant sequence (pMir–SOX2–MUT) as a control group were cloned into pMir luciferase vector. [score:1]
In this study, we intended to explore the role of miR-638 in GC. [score:1]
miR-638 changed the invasiveness of GC cell lines in vitro. [score:1]
Cells transfected miR-638 mimics or mimics-NC were plated into 24-well plate, and then wild type or mutant luciferase constructs were transfected into cells using Invitrogen Lipofectamine®2000 (Thermo Fisher Scientific, Inc. [score:1]
The accession numbers of has-miR-638 and SOX2 were MIMAT0003308 and NM_003106.2, respectively. [score:1]
Ren Y et al also found miR-638 acting as an oncogene in esophageal squamous cell carcinoma (ESCC) and breast cancer [26], paradoxical with Tan X et al. [19]. [score:1]
Moreover, by correlation analysis, a significant negative correlation was observed between miR-638 and SOX2 (R = 0.2092; P < 0.001, Figure 4E) in cancer tissues. [score:1]
But the role of miR-638 in GC still needs to be confirmed, and more specific mechanism should be illuminated. [score:1]
All these results of correlation analysis indicated that miR-638 might take part in the metastasis of GC. [score:1]
A correlation analysis between the miR-638 expression level and the clinicopathological characteristics. [score:1]
So it is promising to illuminate the mechanism underlying miR-638 and SOX2 on the proliferation and invasion of GC cells. [score:1]
To evaluate the expression level of mature miR-638, we conducted qRT-PCR in GC tissues and matched adjacent tissues from 68 cases of GC patients. [score:1]
However, in other studies, miR-638 was found to protect melanoma cells from apoptosis and autophagy [25], and promote starvation- or rapamycin -induced autophagy in ESCC and breast cells (KYSE450 and MCF-7) [26]. [score:1]
For instance, attenuated miR-638-SOX2 axis was reported to promote the invasion by inducing epithelial-mesenchymal transition in non-small-cell lung cancer [21], colorectal carcinoma [36], hepatocellular carcinoma [22]. [score:1]
We found that the proliferation ability of GC cells was impaired after transfected with the miR-638 mimics 48h. [score:1]
But Bhattacharya A et al. reported that miR-638 could protect melanoma cells from apoptosis and autophagy and promote melanoma metastasis [25]. [score:1]
The predicted miR-638 binding sequences in the 3’-UTR of SOX2 mRNA were cloned in a pMir luciferase reporter vector (Applied Biosystems, Carlsbad, CA, USA). [score:1]
[1 to 20 of 66 sentences]
7
[+] score: 195
Other miRNAs from this paper: hsa-mir-146a, hsa-mir-146b
Herein, we found that miR-638 was suppressed in EWS cells and overexpression of miR-638 suppressed cell growth, induced cell apoptosis and inhibited tubule formation of EWS cells, which might be mediated through directly targeting VEGFA. [score:12]
Treatment of miR-638 suppressed expression of both mRNA and protein level of VEGFA in EWS cells, and restored the expression of VEGFA could partially reversed the inhibitory effects of miR-638 in EWS cells could further identified the target role of VEGFA in EWS. [score:11]
We found that the luciferase activity of the VEGFA_WT was notably suppressed after overexpression of miR-638 compared with scramble control, while the luciferase activity of the VEGFA_MT remained unaffected (Figure 3B) identifying that VEGFA was directly targeted by miR-638. [score:7]
Down-regulation of miR-638 expression in EWS cell lines. [score:6]
Extraneous expression of miR-638 could suppress cell growth and tube formation by down -regulating VEGFA in EWS cell lines. [score:6]
In colorectal carcinoma cells, miR-638 could suppress cell proliferation and epithelial to mesenchymal transition by targeting Sox-2 [5]. [score:5]
We found that the expression of miR-638 was significantly suppressed in EWS cell lines comparing with the MSCs, which were thought to be the origin cells of EWS. [score:5]
Accompanied with restored expression of VEGFA, the suppressive effects on cell proliferation and encouraged cell apoptosis were partially abolished in SK-ES-1 cells after treatment with miR-638 (Figure 4B,C). [score:5]
To figure out the mechanisms of miR-638 -mediated tumor suppression, we searched for the putative target genes of miR-638. [score:5]
Overexpression of VEGFA reverses the suppressed effects of miR-638. [score:5]
To determine the expression of miR-638 and target genes, the total RNA was obtained from EWS cells with a TRIzol reagent (Life Technologies, Darmstadt, Germany). [score:5]
Restored the expression of miR-638 inhibited the proliferation rates of EWS cell lines, arrested the cell cycle progression and induced cell apoptosis of EWS cells consistently. [score:5]
As shown in Figure 4A, forced expression of VEGFA restored the VEGFA expression SK-ES-1 cells upon transfection with miR-638. [score:5]
The expression of miR-638 was suppressed in EWS cells. [score:5]
In accordance with the hypothesis, we also found that exogenetic expression of VEGFA restored the suppressive effects of miR-638 on tube formation of SK-ES-1 cells (Figure 4D). [score:5]
Companied with the overexpression of miR-638, the survival rates of EWS cells significantly suppressed (the P-values for 48 h were 0.018 in SK-ES-1 and 0.047 in RD-ES cells, and the P-values for 72 h were 0.0482 in SK-ES-1 and 0.0045 in RD-ES cells, relative to the scramble groups respectively) (Figure 2A). [score:5]
For example, miR-638 regulates cell differentiation and proliferation by targeting cyclin -dependent kinase 2 (CDK-2) in leukemic cells [15]; and in BRCA1 -deficient triple negative breast cancer tumors, miR-638 and miR-146 were suggested to perform as potential biomarkers for improved overall survival [14]. [score:4]
Herein, we found that, other than the suppression on the malignant biological characteristics, significant suppression on the tube formation of EWS cells upon transfection with miR-638, which means miR-638 might participate in the regulation of neo-angiogenesis of EWS. [score:4]
These results suggested that VEGFA was a directly target gene of miR-638 in EWS. [score:4]
As shown in Figure 3C,D, both the mRNA and protein levels of VEGFA were significantly down-regulated by miR-638 in EWS cell lines. [score:4]
These results allegedly signify that miR-638 is down-regulated in EWS cell lines. [score:4]
Together, these findings strongly support that miR-638 regulates the expression of VEGFA in EWS cells transcriptionally. [score:4]
MiR-638 directly targets VEGFA. [score:3]
Figure 4(A) Cells overexpressing scramble or miR-638 were transfected with pcDNA3.1 or pcDNA-VEGFA. [score:3]
In summary, our findings provide the first evidence that the expression of miR-638 significantly decreased and negative correlated to cell growth in EWS cell lines. [score:3]
As shown in Figure 1A, comparing with MSCs, EWS cells showed significantly lower expression of miR-638 (A673 for P = 0.0059, SK-ES-1 for P = 0.0006, and RD-ES for P = 0.0005 vs relative scramble groups). [score:3]
To analyze miR-638 expression, total RNA was reversely transcribed using First-Strand cDNA Synthesis kit (Invitrogen). [score:3]
Since the expression of miR-638 in SK-ES-1 and RD-ES cells than A673 cells, these two cells were chosen for subsequent experiments. [score:3]
Herein, we will explore its expression and putative effects of miR-638 in EWS cells. [score:3]
At the same time, Xia et al. also found miR-638 perform suppressive effects on the malignant phenotype of non-small-cell lung cancer cells (NSCLCs) [6]. [score:3]
These findings consistently suggested that VEGFA was involved in miR-638 -mediated tumor suppressive effects in EWS cells. [score:3]
Vascular endothelial cell growth factor A (VEGFA) was an important member of VEGF family, which reported to be a target gene of miR-638. [score:3]
Normalized miR-638 expression level detected by Quanti-Tect SYBR Green PCR Detection System. [score:3]
These results suggested that miR-638 performs as a tumor suppressor in EWS. [score:3]
Figure 3(A) Schematic representation of the 3′UTR of VEGFA mRNA containing the putative miR-638 target site. [score:3]
To underlying the molecular mechanisms of miR-638 -mediated growth suppression in EWS cells, the bioinformatics analysis from three publicly available miRNA databases were used to search the candidate genes associated with miR-638. [score:3]
Thus, we will further figure out whether it is involved in miR-638 -mediated suppressive effects on EWS cells. [score:3]
Concomitantly, the incidence of apoptosis was significantly higher in EWS cells with exogenous expression of miR-638 than the scramble groups (SK-ES-1, early apoptosis: 12.8% vs 8.2%, P = 0.0378; and RD-ES, early apoptosis 13.8% vs 8.6%, P = 0.0331) (Figure 2C). [score:3]
MiR-638 inhibits EWS cell growth and tube formation in vitro. [score:2]
Dysregulation of miR-638 has been discovered in a cohort of tumors, including HCC [11], NSCLC [12], osteosarcoma [13], breast cancer [14], leukemia [15], melanoma [7], gastric cancer [16] as well as colorectal carcinoma [5, 17]. [score:2]
Exogenous expression of miR-638 in EWS cells revealed significant arrest of EWS cells in G0-G1 phase and obvious decline in S phase compared with controls. [score:2]
Transfection of miR-638 mimic significantly increased miR-638 expression in SK-ES-1 and RD-ES cells, as compared with transfected scramble cells. [score:2]
To figure out whether it was also involved in the suppressive effects of miR-638 in EWS cells, the rescue assays were performed. [score:2]
MiR-638 inhibited cell growth and tube formation of EWS in vitro. [score:2]
The results demonstrated that overexpression of miR-638 could obviously repress cell viability compared with controls in SK-ES-1 and RD-ES cells. [score:2]
Firstly, the putative target role of VEGFA of miR-638 in EWS cells was identified using luciferase reporter assays. [score:2]
Transfection with miR-638 significantly suppressed the tube-forming capacity of EWS cells compared with control cells, as the branches formed in EWS cells transfected with miR-638 was obviously decreased (SK-ES-1, branches formed: 152 vs 51, P = 0.0073; RD-ES, branches formed: 144 vs 77, P = 0.0234, relative to scramble groups) (Figure 2D). [score:2]
The tube network formation assays were performed in EWS cell lines (SK-ES-1, RD-ES) under serum-free conditioned medium (high miR-638 expression group and control group). [score:2]
Then, further research of the effects of miR-638 on EWS cells was performed. [score:1]
In this study, we firstly explored the putative effects of miR-638 in EWS cells. [score:1]
The effects of miR-638 on cell cycle were shown in Figure 2B. [score:1]
Among these gene reported, miR-638 is a newly reported miRNA, whose biological function has not been unified in EWS yet. [score:1]
EWS cell plated in 24-well plates at a density of 2 × 10 [5] per well for 24 h, were cotransfected with miR-638 mimic (40 nM/well) and the VEGFA_WT or VEGFA_MUT (40 ng/well) and pRL-TK Renilla luciferase reporter (10 ng/well) with the Lipofectamine 3000 (Invitrogen, USA). [score:1]
To explore the putative role of miR-638 in EWS, the expression of miR-638 was firstly measured using Quanti-Tect SYBR Green PCR Detection System in several EWS cell lines, including A673, SK-ES-1, and RD-ES. [score:1]
[1 to 20 of 54 sentences]
8
[+] score: 75
Statistical analyses of our data revealed that 71 miRNAs out of 939 examined were expressed by this set of MSC lines at all passages and the expression of 11 miRNAs were significantly different between passages 3 and 7, while the expression of 7 miRNAs was significantly different between passages 3 and 5. The expression of these identified miRNAs was evaluated using for both the first set of MSC lines (n = 6) and a second set of MSC lines (n = 7) expanded from passages 4 to 8. By only 2 miRNAs, miR-638 and miR-572 were upregulated at passage 7 compared to passage 3 in the first set of MSC lines by 1.71 and 1.54 fold, respectively; and upregulated at passage 8 compared to passage 4 in the second set of MSC lines, 1.35 and 1.59 fold, respectively. [score:11]
Similar findings were observed in non-cancerous cells such as human vascular smooth muscle cells where high expression of miR-638 inhibited proliferation and migration by targeting the NOR1/cyclin D pathway [76]. [score:7]
The general consensus that high expression of miR-638 inhibits cell proliferation is consistent with our findings where MSCs at higher passages exhibit higher expression of miR-638, but lower proliferation potential [30, 37]. [score:7]
In our study, only miR-572 and miR-638 expression was observed to be significantly upregulated in two different sets of MSCs. [score:6]
MiR-638 which exhibited similar upregulation in expression at later passages as miR-572 in aging MSCs has been identified in a number of different carcinomas including colorectal, gastric, hepatocellular, nasopharyngeal, esophageal squamous cell, pancreatic adenocarcinoma, ovarian cancer and triple negative breast cancer [59, 64– 73]. [score:6]
While the expression of miR-572 and miR-638 was consistently observed to be statistically upregulated at later passages, the number of other statistically significant miRNAs varied between the microarray and platforms. [score:6]
These phenotypic changes may have corresponded with the gene expression differences observed between passages; therefore it is conceivable that some of these changes also correspond with the upregulation of miR-572 and miR-638 at later passages in MSCs. [score:6]
In tumor derived cells and cell lines representative of colorectal carcinoma, leukemia, gastric carcinoma and triple negative breast cancer, the ectopic or overexpression of miR-638 inhibited cell proliferation and arrested the cell cycle in the G1 phase [69, 71, 72, 74, 75]. [score:5]
By microarray analysis, 11 miRNAs were also observed to be significantly different between early and late passages; however, only two miRNAs, miR-572 and miR-638, were observed to be upregulated at later passages. [score:4]
In the first set of MSCs, only miR-572 and miR-638 were observed to be significantly (p < 0.05) upregulated 1.54 and 1.71 fold, respectively, at passage 7 compared to passage 3 (Additional file 8: Table S5). [score:3]
The presented work has thoroughly shown that the expression of 2 miRNAs, miR-572 and miR-638, may be used to distinguish early and late passaged MSCs. [score:3]
The expression of miR-638 and miR-572 can distinguish MSCs from two different passages of cell culture. [score:3]
Additionally, this research group also attempted to establish a MSC miRNA signature by identifying consistently expressed miRNAs where two on their list were miR-572 and miR-638. [score:3]
In contrast, for the second set of MSCs, 6 out of the 11 miRNAs (miR-196b-5p, miR-16-5p, miR-1202, miR-572, miR-638, and miR-15b-5p) evaluated for cellular aging were statistically significant (p < 0.05) between passage 4 and 8. miRNAs, miR-572 and miR-638 were significant in the second set of MSCs and upregulated at the later passage by 1.59 and 1.35, respectively. [score:2]
In addition, we identified 2 miRNAs (miR-572 and miR-638) that changed as a result of cellular passaging through in vitro expansion. [score:1]
Based on the statistical significance of miRNAs miR-572 and miR-638 across two different platforms and using two different sets of MSCs, these results are likely to be highly replicable. [score:1]
The miR-638 also exhibited the largest fold change between passages 3 and 7, 1.45 and 1.49, as well as fold changes between passages 3 and 5, 1.28 and 1.38. [score:1]
[1 to 20 of 17 sentences]
9
[+] score: 50
miR-638 down-regulation is found in stomach adenocarcinoma versus the corresponding normal tissues (p=0.0092, p=0.0003, and p=0.0095, respectively) (B) Aberrant expression of hsa-miR-720 on tissue microarray. [score:6]
In contrast, the expression of hsa-miR-638 was significantly downregulated in stomach adenocarcinoma tissues (n=19) versus normal stomach tissues (n=6) (p=0.0095) (Figure 4A). [score:6]
The statistical results show that the expression of hsa-miR-638 is significantly upregulated in hepatocellular liver cancer tissues (n=20) versus normal liver tissues (n=5) (p=0.0092), and in cervix uteri squamous cell carcinoma tissues (n=18) versus normal cervix uteri tissues (n=7) (p=0.0003). [score:6]
To further validate the relationship between the HES-miRNAs and various solid malignant tumors, we focus on three non-conserved or primate-specific HES-miRNAs, hsa-miR-638, -720, and -1280 (Table 1), of highly expressed or exhibit expression changes during week 4-6 of human embryonic development for further functional investigation. [score:4]
Noticeably, the peak expression values of 5 of these miRNAs, miR-638, -663, -936, -1246, and -1275, are at 5 weeks of human embryonic development. [score:4]
Significant up-regulation of miR-638 can be observed in hepatocellular liver cancer and cervix uteri squamous cell carcinoma. [score:4]
Statistical analyses of three HES-miRNAs (hsa-miR-638, -720, and -1280) expression using in situ hybridization. [score:3]
hsa-miR-638 expression in stomach adenocarcinoma and corresponding normal tissues. [score:3]
0069230.g004 Figure 4Statistical analyses of three HES-miRNAs (hsa-miR-638, -720, and -1280) expression using in situ hybridizationHigh-density multiple organ tumor and normal tissue microarrays containing 500 tissue-dots with 18 tumor types and normal corresponding control tissues. [score:3]
The blue staining signal indicates expression of hsa-miR-638. [score:3]
Figure S5 hsa-miR-638 expression in cervix uteri adenocarcinoma and corresponding normal tissues. [score:3]
Comparative analyses of the expression of hsa-miR-638, -720, and -1280 in normal and malignant tissues. [score:3]
The miRNAs that only can be discovered in human or other primates, including miR-638, -663, -720, -936, -1246, -1268, -1275, and -1280, were separated below. [score:1]
Remarkably, among HES-miRNAs, eight miRNAs, hsa-miR-638, -663, -720, -936, -1246, -1268, -1275, and -1280, are extremely non-conserved, even though most are primate-specific (Figure S4) [70, 72]. [score:1]
[1 to 20 of 14 sentences]
10
[+] score: 43
We also demonstrated 1) upregulation of tumor-suppressing transcriptional factors, the noncoding microRNA-638 and microRNA-923, and 2) downregulation of proteins associated with the PI3K/PI3K/AKT signaling pathway in bostrycin -treated cells, suggesting that bostrycin may be a new PI3K/AKT signal pathway -targeting drug for the treatment of pulmonary adenocarcinoma. [score:11]
It is possible that upregulation of microRNA-638 and microRNA-923 and downregulaton of the PI3K/AKT pathway proteins played a role in induction of cell cycle arrest and apoptosis in bostrycin -treated cells. [score:7]
It is tempting to speculate that upregulation of microRNA-638 and microRNA-923 in bostrycin -treated A549 cells, accompanied by downregulation of the PI3K/AKT signaling pathway -associated proteins, p110α and p-Akt, are significantly related. [score:7]
We used to demonstrate a significant upregulation in the levels of microRNA-638 and microRNA-923 in bostrycin -treated A549 cells. [score:4]
We also found the upregulation of microRNA-638 and microRNA-923 in bostrycin -treated cells. [score:4]
We would like to dissect these pathways in greater detail in our upcoming studies, using luciferase assays to demonstrate direct targets of microRNA-638 and microRNA-923 in bostrycin -treated cells. [score:3]
Expression levels of microRNA-638 and microRNA-923 were determined as described. [score:3]
Figure 3 Relative change in expression of microRNA-638 and microRNA-923 in A549 cells treated with bostrycin detected by microRNA real time PCR. [score:3]
We selected microRNA-638 and microRNA-923 for further validation with real-time since these two microRNAs showed the most significant difference. [score:1]
[1 to 20 of 9 sentences]
11
[+] score: 36
A comprehensive list of potential miRNA targets for AML therapy is summarized in Table 2. Table 2 miRNA target genes or pathways References miR-141 PI3K/Akt/mTOR[113] miR-125a ErbB pathway[10] miR-125b Mcl-1[11, 12] miR-22-3p, let-7e-5p PLK1[114] miR-34a PD-L1[80] miR-638 CDK2[34] miR-181a, b and c PRKCD, CTDSPL and CAMKK1[6, 36, 96, 97] miR-191-5p, miR-142-3p PPP2R2A[19, 115] miR-181b MDR[36] miR-21, miR-196b HOX[98] miR-29a/b/c Dnmts[19, 22] Both single miRNAs and panel of miRNAs have potential prognostic value complementing information gained from cytogenetics, gene mutations, and altered gene expression. [score:8]
Overexpression of miR-638 inhibited proliferation and promoted differentiation, while inhibition of miR-638 promoted proliferation and reduced differentiation. [score:7]
miR-638 is frequently down-regulated in various solid tumors, and it represses BaP -induced carcinogenesis by targeting breast cancer 1 (BRCA1) [34]. [score:6]
CDK2 has been identified as an miR-638 target and CDK2 overexpression rescued the miR-638- repressed colony formation of HL-60 cells. [score:5]
Considering that CDK2 is also commonly down-regulated during granulopoiesis, the miR-638/CDK2 axis may serve as a marker for prognosis or treatment response. [score:4]
However, miR-638 overexpression was not sufficient to overcome the failure of leukemic cells to differentiate. [score:3]
Thus, further studies in exploring the miR-638 regulatory network is necessary for fully clarifying the contribution of miR-638 to myeloid leukemia [35]. [score:2]
Lin et al recently saw that miR-638 was reduced in primary AML samples vs cells undergoing normal hematopoiesis [35]. [score:1]
[1 to 20 of 8 sentences]
12
[+] score: 33
For example, upregulated miRNAs targeted CDC7 (targeted by miR-30a-5p and miR-630) and CDK2 (targeted by miR-638), while downregulated miRNAs targeted CDKN1A (targeted by miR-299-5p), CDKN1B (targeted by miR-218-5p and miR-495-3p) and CCNA2 (targeted by miR-218-5p). [score:21]
Consistent with this, the results of the present study demonstrated that the miRNAs that were upregulated by UVB irradiation targeted intrinsic apoptosis pathway-related genes, including NAIP (targeted by miR-30a-5p), XAF1 (targeted by miR-638) and XIAP (targeted by miR-630). [score:12]
[1 to 20 of 2 sentences]
13
[+] score: 28
Among them, the expression patterns of 7 up-regulated (hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459) and 1 down-regulated miRNA (hsa-miR-4443) were consistent with the microarray data. [score:9]
8 of the most significantly up-regulated miRNAs (hsa-miR-4530, hsa-miR-4492, hsa-miR-4505, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p and hsa-miR-4459) and 3 of the most significantly down-regulated microRNAs (hsa-miR-29a-3p, hsa-miR-4443, hsa-miR-27b-5p) were selected as representatives for confirmation. [score:7]
As shown in Figure  4, the expressions of hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 detected by qRT-PCR were consistent with the microarray data with significance (P < 0.05). [score:3]
The expressions of hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 detected by qRT-PCR were consistent with the microarray data. [score:3]
Up -expression of hsa-miR-638 was identified by microarray technology in chikungunya virus infection in human cells [26]. [score:3]
Kumar et al. [27] reported hsa-miR-638 decreased the levels of HBV transcripts or HBV gene products. [score:1]
Furthermore, hsa-miR-638 has previously been reported to be associated with virus infection. [score:1]
But all of the 8 miRNAs including hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 were found to be related with EV71 infection for the first time. [score:1]
[1 to 20 of 8 sentences]
14
[+] score: 26
ESC obviously upregulated hsa-miR-107 and hsa-miR-638 expression, but only target genes of hsa-miR-107, MCL1, SALL4 and Bcl2, were changed greatly. [score:8]
Increased expression of hsa-miR-638 was only observed in MHCC97H cells treated by ESC, while the expression of hsa-miR-106b-5p did not change in any of these two cancer cell lines. [score:5]
Real-time PCR results showed that hsa-miR-107, hsa-miR-638 expressions were obviously different in MHCC97H cells and the difference of hsa-miR-107 in the HepG2 cells was obviously observed (Fig.   4b). [score:3]
Expressions of hsa-miR-107 and hsa-miR-638 increased obviously in HCC cells treated by ESC. [score:3]
Expressions of hsa-miR-107, hsa-miR-638 in HCC cells treated by ESC were significantly increased. [score:3]
Among of them, 12miRNAs (hsa-miR-139-5p, hsa-miR-638, hsa-miR-107, hsa-miR-331-3p, hsa-miR-21-3p, hsa-miR-134-5p, hsa-miR-16-1-3p, hsa-miR-339-5p, hsa-miR-106b-5p, hsa-miR-423-3p, hsa-miR-491-3p, hsa-miR-24-3p) were related to cancers. [score:1]
According to the references, we selected hsa-miR-107, hsa-miR-638, hsa-miR-106b-5p to be verified with real-time PCR in MHCC97H and HepG2 cells. [score:1]
According to the professional knowledge and literature (Table  2), 3 differential miRNAs (hsa-miR-107, hsa-miR-638, hsa-miR-106b-5p) that related to cancers were singled out for real-time PCR validation. [score:1]
hsa-miR-107, hsa-miR-638, hsa-miR-106b-5p were selected to be validated with real-time PCR method in HepG2 and MHCC97H cells. [score:1]
[1 to 20 of 9 sentences]
15
[+] score: 23
However, miR-638 was overexpressed in OVCAR-3 cells, and RNU48 underexpressed in OV167 and OV202 cells relative to OSE(tsT) cells (P < 0.05, ANOVA LSD post-hoc test; Figure 2B) suggesting that miR-638 and RNU48 may not be appropriate to use as normalizers. [score:5]
[A] The expression of candidate biomarkers, miR-200a, miR-200b, miR-200c and miR-182 and [B] the expression of candidate normalizers, miR-103, miR-638, miR-92a and RNU48 in SEOC and OSE(tsT) cell lines by qRT-PCR normalized to Z30 and plotted as log [10] ratios. [score:5]
This finding, in conjunction with the significant differential expression observed in a single SEOC cell line (P < 0.05, Figure 2B), led to our rejection of miR-638 as a candidate normalizer. [score:3]
[B] Heatmap showing expression relative to OSE(tsT) cells (ie OSE(tsT) set to log [2]0) for candidate biomarkers in SEOC cell lines (miR-200a, b, c, and miR-182) and candidate endogenous controls for normalization (miR-638, miR-92a and miR-103). [score:3]
For the current study, miR-103, miR-92a, miR-638 and RNU48 were assessed as potential endogenous normalizers and miR-103 chosen as it had low differential expression between the SEOC and healthy cohorts (P = 0.768). [score:3]
However, for miR-638, a trend towards higher C [T]s in the SEOC cohort was observed (P = 0.063; Figure 3). [score:1]
No correlations were found between subject age and miR-103, miR-92a or miR-638 levels (Additional file 1: Figure S1), and no significant differences between the SEOC and healthy groups were observed for miR-103 (P = 0.768) or miR-92a (P = 0.367; Figure 3). [score:1]
From this list, miRNA previously reported to be detected in serum or plasma were selected for further analysis, specifically, miR-92a, miR-103 [12, 14, 27] and miR-638 [28] (Figure 1B). [score:1]
We found no association between subject age and serum miRNA levels for miR-200a, b, c, (or miR-103, miR-92a, miR-182, miR-638 or RNU48). [score:1]
[1 to 20 of 9 sentences]
16
[+] score: 17
While the correlation between changes in miRNA expression and clinical disease severity suggests that these miRNAs may play a role in the pathogenesis of LN, it is currently unknown whether changes in miR-638 expression are pathogenic or an epiphenomenon [60]. [score:7]
Increased tubulointerstitial expression of miR-638 was positively correlated with proteinuria and SLE Disease Activity Index (SLEDAI) score. [score:5]
miR-638 expression, on the other hand, was underexpressed in glomerular tissue but higher in tubulointerstitial tissue. [score:5]
[1 to 20 of 3 sentences]
17
[+] score: 16
While lack of available experimental data precluded systematic questioning, we were able to analyze the target and/or co-regulated mRNAs for hsa-miR-328, hsa-miR-494, hsa-miR-513 and hsa-miR-638 (Table S5). [score:4]
Table S5 Compilation of target genes and/or genes co-regulated with hsa-miR-328, hsa-mir-494, hsa-mir-513 and hsa-mir-638. [score:4]
Ontology enrichment analysis for target genes of hsa-miR-328, hsa-miR-494, hsa-miR-513 and hsa-miR-638. [score:3]
Ten most significantly enriched processes for the genes targeted by hsa-miR-328, hsa-miR-494, hsa-miR-513 and hsa-miR-638 were scored and ranked in respect to the obtained p-values. [score:3]
While 44 miRNAs showed a greater enrichment in the cytosolic Hy3-labeled RNA fraction, 13 miRNAs were significantly and reproducibly enriched in the mitochondrial Hy5-labeled RNA sample (ranging from 1.5- to 56-fold), namely hsa-miR-1973, hsa-miR-1275, hsa-miR-494, hsa-miR-513a-5p, hsa-miR-1246, hsa-miR-328, hsa-miR-1908, hsa-miR-1972, hsa-miR-1974, hsa-miR-1977, hsa-miR-638, hsa-miR-1978 and hsa-miR-1201 (Figure 5A). [score:1]
hsa-miR-638 Chr19: 10829095–10829119 (+) 19p13.2 IntragenicHosted in DNM2 (mitochondrial localization [40]). [score:1]
[1 to 20 of 6 sentences]
18
[+] score: 16
By contrast, intracellular miR-638 expression was significantly increased 2.43-, 5.41- and 15.81-fold in the presence of 1.0, 3.3, and 10.0 μM GW4869 in HuH-7 cells, and 5.01-, 7.00-, and 9.57-fold, respectively, in SW480 cells when compared with expression in the presence of 0 μM GW4869 (P<0.01; Fig. 3D–E). [score:4]
Specifically, extracellular miR-638 expression in HuH-7 cells was decreased 3.92- and 16.67-fold in the presence of 3.3 and 10.0 μM GW4869, respectively. [score:3]
These data suggest that SMPD3 plays an important role in the release of a number of microRNAs, including miR-638, and that microRNAs accumulated in cells following the inhibition of exosome membrane formation by GW4869. [score:3]
Subsequent RT-qPCR experiments showed a significant decrease in miR-638 expression in the SW480 and HuH-7 cells and supernatants following treatment with GW4869 (P<0.01). [score:3]
Small/microRNAs, such as miR-638, are secreted into extracellular spaces via a ceramide -dependent mechanism. [score:1]
Moreover, the high evolutionary conservation of SMPD3 indicates an important role in the release of miR-638 and other microRNAs into extracellular spaces. [score:1]
Various microRNAs, including miR-638, were decreased in culture supernatants from GW4869 -treated cells (Table II). [score:1]
[1 to 20 of 7 sentences]
19
[+] score: 16
For example, miR-21-5p was found to be significantly deregulated in colorectal cancer [25]; overexpression of miR-21-5p as a predictive marker for complete tumor regression to neoadjuvant chemo radiotherapy in rectal cancer patients [26]; overexpression of miR-638 inhibited the processes of tumor angiogenesis in vitro and in vivo [27]; miR-1246 was commonly upregulated in cancer cells by treatment with SAHA and DZNep and leading to apoptosis, cell cycle arrest and reduced migration of AGS and HepG2 cells [28]; miR-663a is upregulated by administration of the human cathelicidin AMP in the colon cancer cell line HCT-116, over -expression of miR-663a caused anti-proliferative effects both in vitro and in vivo [29]. [score:16]
[1 to 20 of 1 sentences]
20
[+] score: 14
miR-638 was also shown to cause differentiation and proliferation of leukemic cells by targeting cyclin -dependent kinase 2 (CDK2) [48], and inhibition of cell proliferation by targeting phospholipase D1 in gastric cancer [49]. [score:7]
Lin Y. Li D. Liang Q. Liu S. Zuo X. Li L. Sun X. Li W. Guo M. Huang Z. miR-638 regulates differentiation and proliferation in leukemic cells by targeting cyclin -dependent kinase 2 J. Biol. [score:4]
miR-92a was suggested to target p21 in various cancer cell lines [45], and miR-1826 was shown as a prognostic biomarker for colorectal cancer [46], whereas miR-638 promotes melanoma metastasis and protects these cells from autophagy and apoptosis [47]. [score:3]
[1 to 20 of 3 sentences]
21
[+] score: 13
15 µl of RT reactions contained 10× RT buffer, 0.15 µl of 100 mM dNTPs with dTTP, 0.188 µl of RNase -inhibitor (20 units/µl), 1 µl of MultiScribe™ Reverse Transcriptase (50 units/µl), 1 µl of each of microRNA specific stem-loop primers (has-miR-92, 4374013; has-miR-638, 4380986; Applied Biosystems) and 10.16 µl of input RNA. [score:2]
We have revealed that microRNA-638 (miR-638) is stably present in human plasmas, and microRNA-92a (miR-92a) dramatically decreased in the plasmas of acute leukemia patients. [score:1]
The ratio of miR-92a/miR-638 in plasma has strong potential for clinical application as a novel biomarker for detection of leukemia. [score:1]
B. Comparison of the ratio of miR92a signal intensity to miR-638 signal intensity by TaqMan qRT-PCR among the plasmas of normal and leukemia. [score:1]
In summary, we have shown that the ratio of miR-92a/miR-638 in blood is firmly associated with diagnosis in acute leukemia patients. [score:1]
In order to improve the precision of the data, we tried to use the miR-638 as standardization. [score:1]
The ratio of miR-92a and miR-638 serves as leukemia biomarkers. [score:1]
Especially, the signal of miR-638 was the top rank regardless of the sexes and ages. [score:1]
What are the physiological roles of miR-638 and miR-92a in the blood vessels and why miR-92a is decreased in plasma of the acute leukemia patients are intriguing questions but remain unclear. [score:1]
Especially, the ratio of miR-92a/miR-638 in plasma was very useful for distinguishing leukemia patients from healthy body. [score:1]
In this report, we describe that the ratio of miR-92a/miR-638 in plasma was the very sensitive marker for AML and ALL. [score:1]
These data suggested that miR-638 was physiologically necessary in blood, and might be a useful internal control for quantification of microRNAs in plasma. [score:1]
[1 to 20 of 12 sentences]
22
[+] score: 8
Lu X et al. [67]confirmed that Bafilomycin A1 inhibits the growth and metastatic potential of the BEL-7402 liver cancer cells and induces miR-923, miR-1246, miR-149, miR-638 and miR-210 upregulation, which may represent promising targets for anti-cancer therapies. [score:8]
[1 to 20 of 1 sentences]
23
[+] score: 8
When compared with expression profiles of miRNAs associated with renal cancer, there was a 15% overlap with the miRNAs described in a recent report [54]; however, only miR-376a [67] out of the highly upregulated miRNAs, and miR-638, miR-200b and miR-200c from the highly downregulated miRNAs, were found to be in common between our studies and other studies [67], [70], [71], [72]. [score:8]
[1 to 20 of 1 sentences]
24
[+] score: 8
In the work led by Tilghman et al., DTT (10 μM) or BPA (10 μM) activate ERα in MCF-7 breast cancer cells which down-regulated the expression of miR-21, let-7a-f, miR-15b, and miR-28b and increased the expression miR-638, miR-663, and miR-1915 (Tilghman et al., 2012). [score:8]
[1 to 20 of 1 sentences]
25
[+] score: 8
We identified the five miRNAs that were most consistently upregulated (miR-21, miR-106a, miR-17, miR-18a and miR-20a) and two most consistently downregulated (miR-378 and miR-638) in at least four profiling studies. [score:7]
Three of these miRNAs were reported in five microarray studies (miR-21, miR-106b and miR-378), four were reported in four studies (miR-17, miR-18a, miR-20a and miR-638), and seven were reported in three studies (miR-19a, miR-20b, miR-25, miR-30d, miR-923, miR-375, and miR-148a). [score:1]
[1 to 20 of 2 sentences]
26
[+] score: 7
Furthermore, Zhao et al. found that miR-638 overexpression and Sp2-siRNA markedly suppressed cell proliferation with decreasing expression of cyclin D1 and induced G1 phase cell cycle arrest in vitro (34). [score:7]
[1 to 20 of 1 sentences]
27
[+] score: 7
b– d qPCR analysis of miR-200c (b), miR-638 (c), and let-7i (d) expression in 27 EC and 12 EN tissues. [score:3]
Compared with those in EN tissues, three miRNAs (miR-200c, miR-638, and let-7i) were significantly downregulated in EC tissues (fold change cutoff ≥ 2.0 and P < 0.05) (Fig.   1a). [score:3]
However, there were no significant differences in miR-638 and let-7i levels between EC and EN tissues (Fig.   1c, d). [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 7
Calcified valves significantly upregulated several miRNAs (miR-638, miR-4739, miR-4774-3p) and downregulated some miRNAs (miR-4492, miR-449c-5p, miR-1245b-3p, miR-6806-3p, miR-8087). [score:7]
[1 to 20 of 1 sentences]
29
[+] score: 7
The relationship between spontaneous apoptosis and baseline miRNA expression was examined by Pearson correlation analysis, resulting in significant negative correlations for 29 miRNAs, most of them expressed at high levels, including miR-29a-3p, let-7g-5p, miR-29b-3p, let-7f-5p, let-7a-5p, miR-26b-5p, miR-19b-3p, or miR-155-5p, and positive correlations for 9 miRNAs, all of them expressed at low levels, including miR-1246, or miR-638 (S4 Table). [score:7]
[1 to 20 of 1 sentences]
30
[+] score: 7
Prior studies using borderline tissue from colorectal liver metastases have validated the liver invasion front-specific down-regulation of miR-19b, miR-194, let-7b and miR-1275, and the tumor invasion front-specific down-regulation of miR-143, miR-145, let-7b and miR-638 [24]. [score:7]
[1 to 20 of 1 sentences]
31
[+] score: 6
Li P Liu Y Yi B Wang G You X Zhao X Summer R Qin Y Sun J MicroRNA-638 is highly expressed in human vascular smooth muscle cells and inhibits PDGF-BB -induced cell proliferation and migration through targeting orphan nuclear receptor NOR1. [score:6]
[1 to 20 of 1 sentences]
32
[+] score: 6
Using TaqMan qPCR assays, we confirmed that four miRNAs, miR-100, miR-125b, miR-22 and miR-720, were commonly upregulated miRNAs in EMT; five miRNAs, miR-200c, miR-141, miR-205, miR-663 and miR-638, were commonly downregulated miRNAs in EMT (Figure 1B and Table S2). [score:6]
[1 to 20 of 1 sentences]
33
[+] score: 6
In 4 of the 7 cases (miR-21, miR-638, miR-768-3p and miR-768-5p), the direction of the change in expression was not consistent across all three treatments, however in all 4 cases the direction of the change induced by radiation was also induced by either etoposide or H [2]O [2]. [score:5]
01 +0.81 miR-638 −0.48 −0.76 +0.46 miR-768-3p +0.82 +0.91 +0.91 miR-768-5p +0.87 +0.89 +0.79miRNA microarrays were run using 1522 cells treated with either radiation, H [2]O [2] or etoposide. [score:1]
[1 to 20 of 2 sentences]
34
[+] score: 6
Simultaneously, miRNA-149, miRNA-638, and miRNA-491 were up-regulated due to HCV infection and enhance the viral replication by inhibiting the AKT/PI3 kinase (Conrad and Niepmann, 2014). [score:6]
[1 to 20 of 1 sentences]
35
[+] score: 6
For further confirmation of the microarray analysis, we examined the expression of 18S rRNA and miR-638, the most abundant miRNA detected in the exosomes by qPCR. [score:3]
In particular, 4 of these miRNA (miR-638, -149*, -4281 and let-7e) were negatively regulated by repeated depolarization in this compartment. [score:2]
The transcripts were detected significantly above background (P < 0.0001), with 18S rRNA and miR-638 emerging at cycles 26.2 and 10.5 respectively, confirming the presence of both transcripts in the vesicles analysed by microarray as well as the novel samples. [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 6
In another study, 5 serum miRNAs (let-7i-3pm, miRNA-5706, miRNA-4463, miRNA-3665, and miRNA-638) were up-regulated and 4 miRNAs (miRNA-124-3p, miRNA-128, miRNA-29a-3p, and lep-7c) were down-regulated in Chinese women with PCOS compared with control subjects [32]. [score:6]
[1 to 20 of 1 sentences]
37
[+] score: 5
Alterations in miRNA expression have been observed in CRC, and several dysregulated miRNAs, including miR-625-3p [8], miR-99-5b [9], miR-361-5p [10], miR-17-5p [11], miR-137 [12], miR-95 [13], miR-23a [14, 15], miR-155 [16], miR-150 [17], miR-191[18], miR-339-5p [19], miR-429 [20], miR-345 [21], miR-22 [22], miR-638 [23] and miR-138 [24], have been shown to regulate CRC cell growth, apoptosis and metastasis. [score:5]
[1 to 20 of 1 sentences]
38
[+] score: 5
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-145, hsa-mir-200c, hsa-mir-429
Interestingly, hsa-miR-638 is known as a TP53 -targeting miRNA [58], further illustrating the complexity of this signaling. [score:3]
Moreover, hsa-miR-638 has recently come into focus as another promising candidate, as it has been shown that hsa-miR-638 regulates SOX2 in NSCLC [57]. [score:2]
[1 to 20 of 2 sentences]
39
[+] score: 5
In recent years, increasing numbers of studies have reported the impact of viral infections on the cellular miRNAome; for example, the expression levels of 108 human miRNAs were shown to change more than 2.0-fold in hepatitis C virus (HCV)-infected human hepatoma cells, and the differentially-expressed miRNAs, including miR-24, miR-149*, miR-638 and miR-1181, were shown to be involved in virus entry, replication and propagation [14]. [score:5]
[1 to 20 of 1 sentences]
40
[+] score: 5
Results showed that miR-323b-5p, miR-221-3p, miR-524-5p, and miR-188-3p were underexpressed in albuminuric relative to nonalbuminuric patients, while miR-214-3p, miR-92b-5p, hsa-miR-765, hsa-miR-429, miR-373-5p, miR-1913, and miR-638 were overexpressed [71]. [score:5]
[1 to 20 of 1 sentences]
41
[+] score: 5
Decreased miRNA expression ranged from Log2 fold of −1.12 (hsa-miR-638) to −10.70 (hsa-miR-20a). [score:3]
06 hsa-miR-595 5.29 hsa-miR-92b −9.97 hsa-miR-601 5.88 hsa-miR-765 4.47 hsa-miR-98 5.05 hsa-miR-99a 6.41 TGF-β -treated hsa-miR-20b −1.29 hsa-let-7a 1.38 hsa-miR-221 −1.25 hsa-let-7d 1.43 hsa-miR-605 −4.64 hsa-let-7e 2 hsa-miR-638 −1.40 hsa-miR-125a-5p 2.87 hsa-miR-663 −2.06 hsa-miR-146a 2.72 hsa-miR-720 −2.40 hsa-miR-21 1.14 hsa-miR-23a 1.20 hsa-miR-23b 1.14 hsa-miR-30c 1.89 hsa-miR-483-5p 1.38 hsa-miR-574-5p 2.23 hsa-miR-99b 1.63 10.1371/journal. [score:1]
06 hsa-miR-595 5.29 hsa-miR-92b −9.97 hsa-miR-601 5.88 hsa-miR-765 4.47 hsa-miR-98 5.05 hsa-miR-99a 6.41 TGF-β -treated hsa-miR-20b −1.29 hsa-let-7a 1.38 hsa-miR-221 −1.25 hsa-let-7d 1.43 hsa-miR-605 −4.64 hsa-let-7e 2 hsa-miR-638 −1.40 hsa-miR-125a-5p 2.87 hsa-miR-663 −2.06 hsa-miR-146a 2.72 hsa-miR-720 −2.40 hsa-miR-21 1.14 hsa-miR-23a 1.20 hsa-miR-23b 1.14 hsa-miR-30c 1.89 hsa-miR-483-5p 1.38 hsa-miR-574-5p 2.23 hsa-miR-99b 1.63 10.1371/journal. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 4
In colorectal carcinoma, Tspan1 mRNA is targeted by microRNA-638 suggesting that some tetraspanins are prone to this latter regulatory mechanism [44]. [score:4]
[1 to 20 of 1 sentences]
43
[+] score: 4
In addition, upregulation of miR-638 (P<0.005), miR-663 (P<0.005), and miR-1915 (P<0.005) was observed after treatment of MCF7 cells with E [2], BPA or DDT (Table 2). [score:4]
[1 to 20 of 1 sentences]
44
[+] score: 4
At least three miRNA families were up-regulated: MiR-638 in all three cell lines, miR-34a in the highly aggressive line, miR-424 in the non-aggressive line, in a concordance with previous reports [63]. [score:4]
[1 to 20 of 1 sentences]
45
[+] score: 4
A large number of overexpressed IR-responsive miRNAs that we identified in our work were found to be deregulated in human cancers, such as hsa-mir-513 [55], hsa-mir-744 [56], hsa-mir-92a [57], [58], hsa-mir-1228* [59], hsa-mir-671-5p [60], hsa-mir-638 [38], hsa-mir-370 [61], and hsa-mir-675 [62]. [score:4]
[1 to 20 of 1 sentences]
46
[+] score: 4
Nineteen of the downregulated miRNAs in chronic patients were found to be associated with carcinogenesis in various organs and tissues, such as miR-1207 [40], miR-3162-5p [41, 42], miR-3196 [43, 44], miR-371b-5p [45], miR-574-5p [46, 47], miR-1225-5p [48], miR-4485 [49], miR-572 [50], miR-4299 [51], miR-3679-5p [52], miR-3940-5p [53], miR-638 [54, 55], miR-1202 [56], miR-5787 [57], miR-1973 [58], miR-4532 [59], miR-1275 [60], miR-4728-5p [61], and miR-1915-3p [62]. [score:4]
[1 to 20 of 1 sentences]
47
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Differential expression of miR-18a, miR-532, miR-218, miR-625, miR-193a, miR-638, miR-550 and miR-633 can be used as a marker to predict prednisone response in pediatric ALL patients [76]. [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
miR-638 was demonstrated to inhibit the recruitment of H2AX to DNA break sites [159]. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 2
The start binding positions 304 of hsa-miR-762 and 308 of hsa-miR-3677 were highly conserved among more than five hundred NS1 genes in type 2 while positions 765 of hsa-miR-637 and 773 of hsa-miR-3663-5p were highly conserved among almost three hundred NS1 sequences in dengue type 3. More than two hundred nucleoprotein (NP) genes of rabies virus were predicted with highly conserved start binding positions 122 of hsa-miR-939, 359 of hsa-miR-770-5p, and 820 of hsa-miR-2277-3p and hsa-miR-638. [score:1]
The start binding positions 304 of hsa-miR-762 and 308 of hsa-miR-3677 were highly conserved among more than five hundred NS1 genes in type 2 while positions 765 of hsa-miR-637 and 773 of hsa-miR-3663-5p were highly conserved among almost three hundred NS1 sequences in dengue type 3. More than two hundred nucleoprotein (NP) genes of rabies virus were predicted with highly conserved start binding positions 122 of hsa-miR-939, 359 of hsa-miR-770-5p, and 820 of hsa-miR-2277-3p and hsa-miR-638. [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 2
The experiments were also conducted on primary human dermal fibroblasts and similar results were obtained with miR-503 and miR-638 showing maximal induction over the course of the CHIKV infection (Figure 1c ). [score:1]
We confirmed time dependent induction of specific miRNAs (miR-663, miR-638, miR-503 and miR-744) in response to CHIKV infection thus validating the microarray data. [score:1]
[1 to 20 of 2 sentences]
51
[+] score: 1
Indeed, some miRNAs that have been previously linked to carcinogenesis of different organs and tissues, such as miR-2861 [47, 48], miR-4530 [49], miR-638 [50], miR-371b-5p [51], miR-1225-5p [52, 53], miR-296-5p [54, 55], miR-4787-5p [56], miR-4281 [57], miR-4455 [58], miR-197-3p [59], miR-369-5p [60, 61] and miR-505-3p [62] which were found to be altered in brucellosis in our analysis. [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-671
For example, we recently reported that miR-638 may serve as a potential novel microRNA for triple negative breast cancer (TNBC) treatment [5]. [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
Wan Y. Cui R. Gu J. Zhang X. Xiang X. Liu C. Qu K. Lin T. Identification of four oxidative stress-responsive microRNAs, miR-34a-5p, miR-1915-3p, miR-638, and miR-150-3p, in hepatocellular carcinomaOxid. [score:1]
[1 to 20 of 1 sentences]
54
[+] score: 1
As previous studies displayed, the commonly used reference genes include miR-16, miR-142-3p, 18S rRNA, miR-638, let-7a, miR-1249, miR-295, 5SRNA, U6, U6B, RNU38B, RNU43, RNU62, and SNORD43 [104]. [score:1]
[1 to 20 of 1 sentences]
55
[+] score: 1
16 healthy controls 723 microRNA Microarray (Agilent Technologies) miRNA-638 miRNA-92a Lung CancerChen et al. [24] Tumor vs. [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
When analysing our microarray data of exosomal miRNA in malignant ascites samples, miR-16 presented the lowest coefficient of variation (CV = 4%) among the candidate internal standards, including miR-638 (CV = 8%), let-7a (CV = 8%), and 142-3p (CV = 23%). [score:1]
[1 to 20 of 1 sentences]
57
[+] score: 1
This study demonstrated that miR-583 and miR-638 were presented at higher levels in the sera of LGDHS than those of LKYDS in CHB patients. [score:1]
[1 to 20 of 1 sentences]