sort by

121 publications mentioning hsa-mir-33b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-33b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 536
A recent article reports that overexpression of miR-33a or miR-33b induces a significant G1 arrest in cancer cell lines through targeting the cyclin -dependent kinase 6 (CDK6) and cyclin D1 (CCND1) genes (Cirera-Salinas et al, 2012), supporting that the miR-33 family is a regulator of cell cycle progression both directly (targeting CDK6 and CCND1) and indirectly (targeting c-Myc to reduce cyclin E expression). [score:14]
When miR-33b was reintroduced, c-Myc expression was down-regulated, along with its transactivation targets cyclin E and ODC, while Gadd45α (a c-Myc-repressed target) was upregulated (Fig 2A). [score:13]
Like lovastatin treatment, exogenous miR-33b overexpression in Daoy cells resulted in down-regulation of c-Myc, cyclin E and ODC and upregulation of Gadd45α (Supporting Information Fig S7A), as well as decreased MYC mRNA levels (Supporting Information Fig S7B). [score:9]
The expression of maternal embryonic leucine zipper kinase (MELK), a key regulator of neural stem cell proliferation (Nakano et al, 2005), was upregulated with miR-33b overexpression. [score:9]
c-Myc and its transcriptional targets, cyclin E and ODC, are down-regulated by miR-33b, but not miR-33a or miR-33bM, while GADD45α is up-regulated. [score:9]
We next turned to HeLa cells, in which miR-33b down-regulated c-Myc expression, reduced the levels of cyclin E and ODC, and upregulated Gadd45α (Supporting Information Figs S8A and S8B). [score:9]
miR-33b overexpression leads to down-regulation of c-Myc and its transactivational targets. [score:8]
Through a small-scale screening with FDA-approved compounds, we found that lovastatin, a small natural chemical (MW 404 Da), increases the expression of miR-33b and down-regulates c-Myc expression and function in medulloblastoma cells with an endogenous miR-33b gene; lovastatin treatment also attenuates the growth of tumours orthotopically xenografted with these cells. [score:8]
On the other hand, Gadd45α, a c-Myc-repressed target, was upregulated when miR-33b was overexpressed (Fig 1I). [score:8]
Furthermore, miR-33a, a homolog of miR-33b, was recently found to be upregulated by metformin to inhibit c-Myc expression in breast cancer cells and mouse xenografts. [score:8]
Lovastatin upregulates miR-33b expression and adversely impacts c-Myc expression and function in medulloblastoma cells. [score:8]
Lovastatin is found to upregulate miR-33b and subsequently inhibit c-Myc expression and function. [score:8]
We found that miR-33b overexpression down-regulated the protein levels of Abca1 and Pim1 in both Daoy and D283 cells (Supporting Information Figs S9A and S9C), demonstrating the efficacy of target repression. [score:8]
At minimum, the expression of both miR-33a and SREBF1 is upregulated by lovastatin (Fig 4): miR-33a may enhance the function of miR-33b since they share target genes (Horie et al, 2010; Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010) and the SREBF1 gene is implied to be pro-apoptotic (Gibot et al, 2009). [score:8]
As shown in Fig 4I, the expression of c-Myc was upregulated with miR-33b inhibition without lovastatin treatment. [score:8]
In the absence of miR-33b expression data, these results implicate the association between down-regulation of SREBF1 (the host gene of miR-33b) and MYC overexpression and poor prognosis in medulloblastoma. [score:8]
We have found that lovastatin, a natural compound first identified in the 1970s and one of the most wi dely used statins to lower cholesterol, upregulates the expression of miR-33b and reduces c-Myc expression and function in medulloblastoma cells (Daoy) with miR-33b alleles. [score:8]
Overexpression of an exogenous MYC gene in 293T cells did not increase the expression levels of miR-33b (Supporting Information Fig S3), indicating that miR-33b expression is unlikely to be regulated by c-Myc. [score:8]
miR-33b negatively regulates c-Myc expression through direct targeting of its 3′UTR in 293T cells. [score:7]
In the present study, we use a screening assay to identify FDA-approved chemicals that modulate the expression of miR-33b to down-regulate the expression and oncogenic activities of c-Myc. [score:7]
To establish the causative effect of c-Myc down-regulation mediated by miR-33b upon lovastatin treatment, we introduced antisense miR-33b inhibitors (Anti-miR-33b) into Daoy cells prior to lovastatin treatment. [score:6]
Lovastatin treatment led to miR-33b upregulation and lowered expression of miR-9, c-Myc and cyclin E in tumours of Daoy cells, but not in tumours of D283 cells (Fig 5B–D; Supporting Information Fig S11B). [score:6]
B. miR-33b expression was elevated and miR-9 was down-regulated in tumours with Daoy cells upon lovastatin treatment. [score:6]
Reintroduction of miR-33b in D283 medulloblastoma cells down-regulates c-Myc expression and function. [score:6]
As shown in Supporting Information Fig S4A, miR-33b down-regulated the expression of c-Myc and cyclin E in HO15.19 cells with 3′UTRWT, but not in those with 3′UTRMut. [score:6]
Overexpression of miR-33b down-regulated c-Myc protein levels in a dose -dependent manner (Fig 1F). [score:6]
Lovastatin upregulates miR-33b expression in medulloblastoma cells. [score:6]
We found that miR-33b reintroduction down-regulated the expression of miR-9 (Fig 2D) and resulted in a reduction in cell migration (Fig 2E). [score:6]
Figure 2 Protein levels of c-Myc and its transcriptional targets cyclin E and ODC are down-regulated by miR-33b. [score:6]
miR-33b overexpression results in down-regulation of miR-9. miR-33b reduces cell migration. [score:6]
Protein levels of c-Myc and its transcriptional targets cyclin E and ODC are down-regulated by miR-33b. [score:6]
We found that Bcl2 was upregulated by lovastatin treatment in Daoy, but not in D283 cells (Supporting Information Figs S9B and S9D); when miR-33b was overexpressed, Bcl2 levels were reduced in Daoy cells, but were increased in D283 cells (Supporting Information Figs S9A and S9C). [score:6]
miR-33b inhibition rescues c-Myc down-regulation by lovastatin treatment. [score:6]
It should be noted that there are genes other than MYC negatively regulated by miR-33 and that lovastatin, like any other drug, impacts the expression of numerous genes beyond inhibiting HMG-CoA reductase. [score:6]
In addition, mevalonate inhibited the induction of miR-33b/a and SREBF1c and c-Myc down-regulation by lovastatin in Daoy cells. [score:6]
Other statins also upregulated miR-33b and inhibited Daoy growth, but less significantly (Supporting Information Fig S5B). [score:6]
More importantly, c-Myc down-regulation by lovastatin was rescued when miR-33b inhibitors were added (comparing lane 4–2 in the left panel, Fig 4I). [score:6]
Like any other miRNAs (Baek et al, 2008), miR-33b represses the expression of multiple targets like Abca1 and Pim1, in addition to c-Myc. [score:5]
When the miR-33b and miR-33a minigenes were introduced into 293T cells, miR-33b was overexpressed ∼25-fold, while miR-33a was overexpressed approximately fivefold. [score:5]
Next, we performed Assay 2 using 54 miRNAs that were predicted to target MYC and found that miR-33b and miR-203 down-regulated the reporter with the MYC 3′UTR downstream (Fig 1C; Supporting Information Fig S1B). [score:5]
When miR-33b expression is inhibited in Daoy cells treated with lovastatin, c-Myc reduction is rescued and increased cell cycle arrest is reversed. [score:5]
It is noteworthy that c-Myc expression was down-regulated by miR-33b, but not miR-33a, which differs from miR-33b by only two nucleotides (UA compared with CG) in the middle of their mature sequences (Fig 1H). [score:5]
In addition, miR-33b overexpression led to a larger percentage of Daoy cells arrested at the G1 phase (Supporting Information Fig S7C), decreased cell proliferation (Supporting Information Fig S7D), and lowered miR-9 expression (Supporting Information Fig S7E) along with reduced cell migration (Supporting Information Fig S7F). [score:5]
In neurobasal medium, the mRNA levels of MYC and two stem cell markers, SRY (sex determining region Y)-box 2 (SOX2) and CD133 (i. e., Prominin 1), were reduced with miR-33b overexpression, while in growth medium, miR-33b introduction resulted in decreased expression of MYC, but not of CD133 and SOX2 (Fig 3C). [score:5]
Along with down-regulation of cyclin E, a greater percentage of D283 cells were arrested at the G1 phase when miR-33b was overexpressed compared with the vector control (Fig 2B). [score:5]
We are cognizant that lovastatin has pleiotropic effects as it may interact with diverse signalling pathways and targets, in addition to inducing miR-33b expression. [score:5]
miR-33b expression reduces cell proliferation in the presence of exogenously expressed c-Myc with a native but not with a mutant 3′UTR. [score:5]
Nonetheless, these results demonstrate that miR-33b overexpression and lovastatin treatment have a similar impact on c-Myc expression and function in Daoy cells. [score:5]
Immunocytometry shows that miR-33b expression results in reduced expression of Musashi in neurobasal medium. [score:5]
A qPCR assay showed that in Daoy cells, lovastatin induced miR-33b and SREBF1 (1c and 1a) expression in a dose -dependent manner, while MYC mRNA was down-regulated (Fig 4C, top and middle; Supporting Information Fig S5A). [score:5]
miR-33b overexpression increased G1 cell cycle arrest (Supporting Information Fig S8C) and inhibited cell proliferation in HeLa cells (Supporting Information Fig S8D). [score:5]
Mevalonate inhibits lovastatin -induced miR-33b and miR-33a expression. [score:5]
For an inhibitor of miR-33b, we used Anti-miR™ miRNA inhibitor (Ambion Inc, Austin, TX) with the Negative Control #1 as a control to Anti-miR-33b. [score:5]
The steady-state levels of MYC mRNA were significantly reduced with miR-33b overexpression (Fig 1G), indicating that mRNA degradation likely contributed to miR-33b -mediated MYC suppression. [score:5]
These results suggest that miR-33b loss is a novel mechanism of c-Myc dysregulation in a subset of medulloblastomas and that miR-33b is a potent tumour suppressor that represses the oncogenic action of c-Myc. [score:4]
miR-33b down-regulates the expression of Rluc upstream of the 3′UTR of MYC driven by a constitutively active promoter in Assay 2. The y-axis denotes the RLU of Rluc normalized to that of luc from the pGL3-Promoter compared with that of the vector control. [score:4]
We suggest that miR-33 upregulation and subsequent c-Myc attenuation are critical to the anti-neoplasia action of these potential cancer prevention and treatment agents. [score:4]
This suggests that miR-33b-triggered reduction of cell proliferation is mediated by c-Myc down-regulation in HeLa cells. [score:4]
This supports that miR-33b induction plays a causal role in c-Myc down-regulation by lovastatin. [score:4]
In this work, we have identified that miR-33b that is frequently lost in medulloblastoma negatively regulates c-Myc expression and adversely affects cell proliferation, cell cycle progression, cell migration and anchorage-independent colony formation. [score:4]
miR-33b regulates c-Myc expression and function in medulloblastoma cells. [score:4]
When a MYC 3′UTR mutation that disrupts its binding to the seed sequence of miR-33b was used in Assay 2, we found that the down-regulation of Rluc by miR-33b was abrogated (Fig 1E). [score:4]
As expected, with the perturbation of these two E-boxes, the expression of luc was significantly reduced, and the regulation of luc by miR-33b was abolished (Fig 1D). [score:4]
Immunoblotting analyses show that down-regulation of c-Myc by miR-33b is dose dependent and miR-203 does not reduce c-Myc protein levels. [score:4]
Differential mRNA expression levels of stem cell markers CD133 and SOX2 in cells with or without miR-33b in neurobasal medium (left) or growth medium (right). [score:3]
Re -expression of miR-33b in a cell line without endogenous miR-33b decreases c-Myc protein levels, reduces anchorage-independent growth, and attenuates orthotopic xenografts in immuno -deficient mice. [score:3]
Out of 727 chemicals, 12 reduced the viability of Daoy cells ≥40% and increased miR-33b expression ≥2-fold (Fig 4A and Supporting Information Table S1). [score:3]
In addition, D283 cells with miR-33b overexpression formed significantly fewer colonies on soft agar (Fig 2F). [score:3]
We first found that miR-33b is a negative regulator of c-Myc through direct binding to the 3′UTR of the MYC mRNA. [score:3]
Importantly, the negative impact of miR-33b on cell proliferation of this cell line was reversed by the introduction of an exogenous MYC gene with a 3'UTR that cannot be targeted by miR-33b, but not by that with a WT 3'UTR (Supporting Information Fig S8D). [score:3]
Xenograft mo dels of medulloblastoma with lovastatin treatment or miR-33b overexpression. [score:3]
These results suggest that reintroduction of miR-33b represses c-Myc expression and function in D283 cells. [score:3]
When equal amounts of miR-33b and miR-33bM minigenes were introduced into 293T cells, miR-33bM was overexpressed approximately fivefold, instead of ∼25-fold. [score:3]
Morphological change of D283 cells with stable expression of miR-33b in growth medium. [score:3]
Figure 3 Morphological change of D283 cells with stable expression of miR-33b in growth medium. [score:3]
We also treated UW228 cells, another medulloblastoma cell line without 17p11.2 abnormality or MYC amplification (Stearns et al, 2006), with lovastatin and found there was a significant induction of miR-33b and SREBF1c and a decrease in c-Myc expression (Supporting Information Fig S6). [score:3]
These data support the causative relationship between miR-33b overexpression and c-Myc repression upon lovastatin treatment in Daoy cells. [score:3]
To determine whether the negative effect of miR-33b on cell proliferation is due to c-Myc repression, we attempted to restore c-Myc expression in medulloblastoma cells using exogenous c-Myc constructs with or without c-Myc 3'UTR. [score:3]
We performed Assay 1 in 293T cells using hundreds of miRNA minigenes in our genetic library (Lu et al, 2011) and found that 4 miRNAs (miR-33a, miR-33b, miR-212 and miR-203) significantly down-regulated the c-Myc -dependent reporter (Fig 1B; Supporting Information Fig S1A). [score:3]
These data suggest the expression of these genes is impacted by unknown confounders other than miR-33b upon lovastatin treatment. [score:3]
For D283 cells stably expressing miR-33b without lovastatin treatment, mice were maintained for 6 weeks; two animals were injected with the vehicle. [score:3]
NegControl, Negative Control #1; Anti-miR-33b, Anti-miR™ miR-33b inhibitors (Ambion). [score:3]
Finally, we determined whether exogenous miR-33b expression reduces the tumorigenicity of D283 cells. [score:3]
In addition, lovastatin -induced G1 cell cycle arrest was also abolished with miR-33b inhibition (right panel, Fig 4I). [score:3]
miR-33b -expressing D283 neurospheres had lower levels of Musashi. [score:3]
Correspondingly, introduction of miR-33b, but not miR-33a or miR-33bM, reduced the protein levels of c-Myc, as well as two known c-Myc transactivational targets, cyclin E and ornithine decarboxylase (ODC). [score:3]
To further verify that miR-33b specifically targets MYC, we introduced two c-Myc constructs into a MYC -null cell line, HO15.19 (Mateyak et al, 1997); both constructs have a native c-Myc coding sequence, but one has a wild-type 3′UTR (3′UTRWT) and the other has a mutant 3′UTR in which the miR-33b binding site was disrupted (3′UTRMut, Fig 1D). [score:3]
As medulloblastoma is thought to originate from abnormal stem cells (Blazek et al, 2007), we show that miR-33b introduction into D283 cells prompts cell morphology change and reduces neurosphere formation, accompanied by lowered expression of c-Myc and certain neural stem cell markers. [score:3]
We noted that the overexpression of miR-33b ranged from ∼2- to 10-fold when determined 6–48 h posttransfection, higher than that with lovastatin treatment (approximately 2-fold, Fig 4C). [score:3]
Abca1 and Pim1 are two reported miR-33 target genes (Horie et al, 2010; Ibrahim et al, 2011; Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010; Thomas et al, 2012). [score:3]
Modulation of Rluc expression by miR-33b is abolished with a mutant MYC 3′UTR. [score:3]
qRT-PCR shows that MYC mRNA levels are reduced when miR-33b is overexpressed. [score:3]
Mutating two E-boxes of the E2F2 promoter abolishes the regulation of luc expression by miR-33b in Assay 1. RLU of cells with both the parental vector and the mutant promoter construct (pE2F2Mut-luc) is used as a reference. [score:3]
Even in regular growth medium, there is a major morphological change (multicell aggregates become desegregated single-cell suspensions) in D283 cells stably expressing miR-33b (Fig 3A). [score:3]
When cultured in neurobasal medium, D283 cells expressing miR-33b formed fewer neurospheres compared to the control (Fig 3B). [score:2]
The human miR-33b gene is located in intron 17 of the sterol regulatory element binding transcription factor 1 (SREBF1) gene at the genomic locus 17p11.2, which is frequently lost in medulloblastoma (Aldosari et al, 2000; Frühwald et al, 2001; Seranski et al, 1999). [score:2]
The miR-33b binding site is present in MYC 3′UTRs from human, chimpanzee, and rhesus, but not those from mouse, rat, dog, and other mammals; the miR-33b gene is only present in primates (Supporting Information Fig S2B) (Griffiths-Jones et al, 2006), suggesting that miR-33b is a primate-specific regulator of c-Myc. [score:2]
In addition, cells proliferated at a slower rate with miR-33b overexpression as determined by the MTT assay (Fig 2C). [score:2]
: Here we show that miR-33b, located in the genomic locus 17p11.2 that is frequently lost in medulloblastoma, is a negative regulator of c-Myc in medulloblastoma cells. [score:2]
We also subjected Daoy cells with or without miR-33b overexpression to the neurosphere formation assay and found that no neurospheres were formed. [score:2]
: Here we show that miR-33b, located in the genomic locus 17p11.2 that is frequently lost in medulloblastoma, is a negative regulator of c-Myc in medulloblastoma cells. [score:2]
Identification of miR-33b as a negative regulator of c-Myc. [score:2]
We performed a small-scale screening assay to identify FDA-approved compounds that reduce medulloblastoma cell viability and increase miR-33b expression using Daoy, a medulloblastoma cell line with an intact 17p11.2 and no gene amplification of MYC (Stearns et al, 2006). [score:2]
To determine whether MYC is a bona fide miR-33b target gene, we performed Assay 1 using a mutant E2F2-luc construct in which two of its four E-boxes (c-Myc binding sites) were disrupted (Sears et al, 1997). [score:2]
There was significantly less tumour expansion in brain ventricles of mice injected with cells carrying miR-33b (Fig 5F; Supporting Information Fig S11D), and these tumours expressed a lower level of c-Myc and cyclin E compared to the control (Fig 5G; Supporting Information Fig S11E). [score:2]
We monitored cellular apoptosis using flow cytometry when Daoy or D283 cells were treated with lovastatin (10 µM) or transfected with miR-33b and found little apoptosis in either cell lines. [score:1]
Lovastatin treatment increases the RNA levels of miR-33b and SREBF1 and reduces that of MYC in Daoy but not in D283 cells. [score:1]
miR-33b decreases anchorage-independent colony formation. [score:1]
The effect of lovastatin on increased miR-33b RNA levels is at least partially due to activation of the genetic promoter of the SREBF1∼miR-33b gene. [score:1]
We constructed a mutant miR-33b (miR-33bM) minigene with a mature sequence the same as miR-33a and a precursor similar to pre-miR-33a. [score:1]
In addition, reintroduction of miR-33b into the medulloblastoma cell line D283 lacking the endogenous miR-33b gene reduces orthotopic xenograft tumour growth in immuno -deficient mice. [score:1]
In addition, miR-33b led to increased G1 arrest in HO15.19 cells carrying MYC with 3′UTRWT (Supporting Information Fig S4C). [score:1]
These results indicate that the miR-33b gene is critical to medulloblastoma's response to lovastatin treatment. [score:1]
Neurosphere formation of D283 cells with miR-33b stimulation is impaired in neurobasal medium. [score:1]
Collectively, these data implicate that miR-33b is a bona fide negative regulator of c-Myc in our assays. [score:1]
The miR-33b allele is located at 17p; loss of this locus is the most commonly reported cytogenetic change in medulloblastoma (de Bont et al, 2008; Seranski et al, 1999), a tumour type with c-Myc overproduction (de Bont et al, 2008). [score:1]
These data suggest that lovastatin activates miR-33b through the cholesterol biosynthetic pathway. [score:1]
miR-33b decreases cell proliferation. [score:1]
These data support that miR-33b has a negative impact on the morphology and neurosphere formation of D283 cells. [score:1]
G. IHC analyses of tumours with D283 cells carrying miR-33b or the parental vector. [score:1]
On the left is a schematic representation of miR-33b complementary binding to MYC 3′UTRWT and 3′UTRMut in which the miR-33b binding site is compromised. [score:1]
miR-33b leads to increased G1 arrest. [score:1]
Lovastatin treatment activates the luciferase reporter driven by the SREBF1∼miR-33b promoter in Daoy and D283 cells. [score:1]
The RAI1 gene in 17p11.2 is responsible for most features of SMS (Girirajan et al, 2006), yet the contribution of miR-33b to variable features and overall severity of the SMS syndrome remains elusive. [score:1]
Schematic representation of the binding of miR-33b, a miR-33b mutant (miR-33bM), or miR-33a to the MYC 3′UTR. [score:1]
We folded the precursors of miR-33b and miR-33a (Zuker, 2003) and found the structure of pre-miR-33b was more stable than that of pre-miR-33a (Supporting Information Fig S2A). [score:1]
There are two transcript isoforms of this gene (SREBF1a and SREBF1c) and both contain miR-33b. [score:1]
F. H&E staining of tumours xenografted with D283 cells carrying miR-33b or the parental vector. [score:1]
Therefore, activation of the transcription or enhanced processing of miR-33 to constrain the oncogenic activities of c-Myc represents one of the potential anti-cancer properties of statins or metformin. [score:1]
[1 to 20 of 129 sentences]
2
[+] score: 464
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-200b
Re -expression of HMGA2 and Twist1 reverses miR-33b -dependent self-renewal and invasion-relevant phenotypes in vitroTo determine whether the phenotypes associated with ectopic miR-33b expression could be reversed via the restoration of its target gene expression, we transfected miR-33b -expressing MDA-MB-231 cells with individual expression constructs of HMGA2 or Twist1 rendered miRNA insensitive by deletion of their 3′UTRs. [score:13]
Because both SALL4 and Twist1 can upregulate polycomb group protein Bmi-1 at the transcriptional level, miR-33b may simultaneously inhibit the downstream targets SALL4 and Twist1 to further suppress Bmi-1. In addition, miRNA can act pleiotropically; therefore, HMGA2, SALL4 and Twist1 are the ideal targets of miR-33b in modulating the stemness of breast cancer cells. [score:12]
To determine whether the phenotypes associated with ectopic miR-33b expression could be reversed via the restoration of its target gene expression, we transfected miR-33b -expressing MDA-MB-231 cells with individual expression constructs of HMGA2 or Twist1 rendered miRNA insensitive by deletion of their 3′UTRs. [score:11]
qRT-PCR and western blot analyses also revealed that the inhibition of miR-33b in MCF-10A cells upregulated the expression of the miR-33b downstream targets HMGA2, SALL4 and Twist1, as well as the stem cell markers Bmi-1, Nanog, Oct4 and Sox2 (Fig. 5F,G). [score:10]
The overexpression of miR-33b suppressed the expression of the miR-33b targets HMGA2, SALL4 and Twist1, as well as the stemness-related proteins Bmi-1, Nanog, Oct4 and Sox2 (Fig. 3G), in agreement with the qRT-PCR results. [score:9]
We found that the mutation of the 3′UTR binding sites of miR-33b target genes SALL4 and Twist1 abrogated the suppressive effect on the luciferase activity induced by the ectopic expression of miR-33b (Fig. 2E). [score:8]
Our data demonstrated that miR-33b dramatically downregulated the expression of HMGA2, SALL4 and Twist1 in breast cancer cells to suppress cell self-renewal. [score:8]
The ectopic expression of miR-33b downregulated the expression of ADAM9, HMGA2, LDHA, SALL4, SNAI2 and Twist1 by more than 30% but had minimal effects on HIF-1α, RAC1, Yes1 and ZEB1 in these two breast cancer cell lines (Fig. 2A,B). [score:8]
LOX can regulate p-FAK to promote cell migration and invasion 32 and support cell adhesion to fibronectin (FN); thus, we used western blotting to examine the protein levels of LOX, FN and p-FAK, which were dramatically downregulated upon miR-33b expression (Fig. 4F). [score:7]
miR-33b acts as a metastatic suppressor in vivoBecause our in vitro data revealed that miR-33b expression was highly associated with pro-metastatic traits, we further asked whether miR-33b could suppress tumor metastasis in vivo. [score:7]
Second, we used qRT-PCR to screen putative miR-33b targets with more than 30% of reduced expression upon miR-33b overexpression in MDA-MB-231 and BT-549 cells. [score:7]
HMGA2, SALL4 and Twist1 are bona fide downstream targets of miR-33b in breast cancer cellsTo decipher the regulatory role of miR-33b in breast cancer, we aimed to identify direct downstream targets of miR-33b and to further investigate its underlying molecular mechanism as a tumor-suppressive miRNA. [score:7]
Because miR-33b inhibited breast cancer stem-like cell self-renewal, and its expression is inversely related to the metastatic potential in breast cancer cell lines, we further addressed whether miR-33b could suppress the migration and invasive abilities of breast cancer cells. [score:7]
Because the overexpression of miR-33b inhibited the self-renewal, cell migration and invasion of breast cancer cells in vitro, we asked whether the inhibition of miR-33b enhances self-renewal and cell mobility. [score:7]
The mRNA levels of the metastasis-related genes LOX, MMP-2, MMP-9 and CXCR4 were upregulated upon miR-33b inhibition in MCF-10A cells (Fig. 6C), and miR-33b knockdown also increased the protein levels of LOX, FN and p-FAK (Fig. 6D). [score:7]
miR-33b inhibits the stem cell-like properties of breast cancer cells in vitroAfter having identified these three main downstream targets of miR-33b, we further examined which specific phenotypes are regulated by miR-33b in breast cancer pathogenesis. [score:6]
In summary, our study has demonstrated that miR-33b expression is downregulated in breast tumor samples and is inversely correlated with lymph node metastatic status. [score:6]
Because our in vitro data revealed that miR-33b expression was highly associated with pro-metastatic traits, we further asked whether miR-33b could suppress tumor metastasis in vivo. [score:5]
To examine the inhibitory effects of lentivirus -based antagomir expression, we performed qRT-PCR to detect the levels of miR-33b. [score:5]
To further determine whether miR-33b could regulate the expression of these genes by directly binding to miRNA-responsive elements in the 3′UTR, we mapped the miR-33b binding sites in the 3′UTR of HMGA2, SALL4 and Twist1. [score:5]
We used qRT-PCR to analyze the mRNA level of the stem cell markers Oct4, Sox2, Bmi-1 and Nanog in BT-549 and MDA-MB-231 cells and found that miR-33b expression decreased the expression of these genes at the mRNA level (Fig. 3F). [score:5]
Control represents the scrambled miRNA used for miR-33b overexpression, and vector represents the empty vector used for HMGA2 and Twist1 re -expression. [score:5]
As shown in Supplementary Fig. 5A–C, all of these three miR-33b target mRNAs were upregulated in invasive breast cancer tissues compared with normal breast tissues. [score:5]
The ectopic expression of miR-33b in BT-549 and MDA-MB-231 cells dramatically suppressed cell migration (Fig. 4A,B) and invasion (Fig. 4C,D). [score:5]
Upon the overexpression of miR-33b, we did not detect any significant changes in these proteins, indicating that miR-33b did not inhibit migration and invasion through MET (Supplementary Fig. 3A). [score:5]
To decipher the regulatory role of miR-33b in breast cancer, we aimed to identify direct downstream targets of miR-33b and to further investigate its underlying molecular mechanism as a tumor-suppressive miRNA. [score:5]
First, we used three in silico algorithms (Targetscan, miRanda and Pictar) to predict miR-33b target genes with high binding possibilities 23. [score:5]
In addition to inhibiting the stemness of breast cancer cells, our data demonstrated that miR-33b inhibits metastasis, at least partly, by remo deling the extracellular matrix. [score:5]
We found that the ectopic expression of miR-33b in BT-549 and MDA-MB-231 cells decreased the expression of MMP-2, MMP-9, LOX and CXCR4 (Fig. 4E). [score:5]
In the 16 cases of breast cancer patients with lymph node metastasis, 12 (75%) exhibited low miR-33b expression, while only 4 (30.77%) of 13 cases of cancers without lymph node metastasis presented low-level miR-33b expression. [score:5]
We further employed western blot analysis to examine the miR-33b downstream targets and expression of these stemness markers at the protein level. [score:5]
However, miR-33 can downregulate p53 by directly binding to the p53 3′UTR to promote self-renewal in murine hematopoietic stem cells 46. [score:5]
miR-33b can inhibit the self-renewal of breast cancer cells and their migration and invasion capabilities by targeting HMGA2, SALL4 and Twist1. [score:5]
After the initial screening of target genes using online databases and two confirmed miR-33b target genes ABCA1 and SIRT6 as a reference for screening, we obtained the following candidates: ADAM9, HIF-1α, HMGA2, LDHA, RAC1, SALL4, SNAI2, Twist1, Yes1 and ZEB1. [score:5]
These proteins were upregulated after miR-33b knockdown in MCF-10A cells. [score:5]
Compared with the noncancerous breast epithelial cell line MCF-10A, miR-33b expression was significantly downregulated in the highly metastatic breast cancer cell lines MDA-MB-231 and BT-549 (Fig. 1F). [score:5]
Collectively, these data indicate that miR-33b can inhibit breast cancer stem-like cell self-renewal by targeting HMGA2, SALL4 and Twist1. [score:5]
Collectively, these data suggest that miR-33b inhibits tumorigenesis and suppresses breast cancer cell metastasis in vivo. [score:5]
In 17 cases presenting as advanced stage III, 12 (70.59%) of the cases have low-level miR-33b expression in cancer tissues; however, in 12 early stages (stages I and II), only 4 (33.33%) presented with low levels of miR-33b expression. [score:5]
Altogether, these data showed that miR-33b suppresses cell migration and invasion in vitro by regulating Twist1 and HMGA2. [score:4]
miR-33b is downregulated in breast cancer. [score:4]
Finally, we cloned the wild-type and mutant 3′UTRs of these candidate target genes into luciferase constructs to examine whether miR-33b can directly bind to these mRNAs. [score:4]
First, we used a lentivirus -based antagomir expression system to knockdown endogenous miR-33b in MCF-10A cells 33. [score:4]
miR-33b was significantly downregulated by approximately 50% after the lentiviral infection of anti-miR-33b and anti-pre-miR-33b (Fig. 5A). [score:4]
miR-33b is downregulated in breast cancer tissue samples and breast cancer cell lines. [score:4]
miR-33b downregulated the levels of these proteins in BT-549 and MDA-MB-231 cells. [score:4]
Knockdown of miR-33b promotes the migration and invasion capabilities of MCF-10A cells, and re -expression of HMGA2 and Twist1 reverses miR-33b -dependent self-renewal and invasion-relevant phenotypes of MDA-MB-231 cells. [score:4]
miR-33b can decrease the levels of MMP-2, MMP-9, LOX, CXCR4, FN and p-FAK in breast cancer cells by regulating downstream targets. [score:4]
After having identified these three main downstream targets of miR-33b, we further examined which specific phenotypes are regulated by miR-33b in breast cancer pathogenesis. [score:4]
Because both Twist1 and HMGA2 can regulate the proteins responsible for ECM degradation, we speculated that miR-33b may regulate migration and invasion in breast cancer cells via matrix remo deling. [score:3]
HMGA2, SALL4 and Twist1 are bona fide downstream targets of miR-33b. [score:3]
We designed two pairs of oligonucleotides specifically targeting precursor miR-33b (pre-miR-33b) and mature miR-33b. [score:3]
In situ hybridization analysis also revealed that miR-33b expression in human breast cancer tissues was much lower than in matched normal tissues (Fig. 1B). [score:3]
We also found that miR-33b expression was inversely related with the metastatic potential of breast cancer cell lines. [score:3]
miR-33b inhibits tumor growth and lung metastasis of breast cancer cells in vivo. [score:3]
The ectopic expression of miR-33b in BT-549 and MDA-MB-231 cells decreased the size and number of mammospheres in primary, secondary and tertiary cultures (Fig. 3A,B). [score:3]
As shown in Fig. 3E, the ectopic expression of miR-33b abated the CD44 [+]/CD24 [−] subpopulation of MDA-MB-231 cells from 95.5% to 69.8%. [score:3]
Supplementary information Supplementary information (A) qRT-PCR analysis of miR-33b expression in human breast cancer tissue samples and their matched normal breast tissues from 29 breast cancer patients. [score:3]
In miR-33b -expressing cells, both HMGA2 and Twist1 reversed, at least partially, miR-33b-imposed migration and mammosphere formation defects (Fig. 6E–I). [score:3]
HMGA2, SALL4 and Twist1 are bona fide downstream targets of miR-33b in breast cancer cells. [score:3]
miR-33b inhibits breast cancer cell stemness. [score:3]
miR-33b suppresses breast cancer cell migration and invasion in vitro. [score:3]
Interestingly, microarray data in a recent report showed that miR-33b expression is decreased with metastatic stage progression in human breast cancer 37. [score:3]
However, at the 10-, 50-, 100- and 1,000-cell levels, BT-549/ctrl and MDA-MB-231/ctrl cells formed more mammospheres than BT-549/miR-33b and MDA-MB-231/miR-33b cells (Fig. 3C,D), indicating that miR-33b inhibits the self-renewal of breast CSCs in vitro. [score:3]
Thus, we examined whether the ectopic expression of miR-33b could induce the mesenchymal-epithelial transition (MET) in BT-549 and MDA-MB-231 cells. [score:3]
miR-33b suppresses breast cancer cell migration and invasion in vitroRecently, CSCs have been linked to tumor metastasis capacity. [score:3]
miR-33b acts as a metastatic suppressor in vivo. [score:3]
As shown in Fig. 2C,D, the overexpression of miR-33b dramatically decreased the luciferase activity of HMGA2, SALL4 and Twist1 by 25-50% but did not alter the luciferase activity of ADAM9, LDHA and SNAI2. [score:3]
To narrow down the target genes of miR-33b, we employed different analytic strategies. [score:3]
To determine the role of miR-33b in breast cancer progression, we examined miR-33b expression in breast cancer tissue samples by qRT-PCR. [score:3]
Our study is the first to identify miR-33b as a suppressor of CSC stemness. [score:3]
All of these data suggest that Twist1, HMGA2 and SALL4 are bona fide downstream targets of miR-33b. [score:3]
Using in silico analysis and dual-luciferase reporter assays, we identified HMGA2, SALL4 and Twist1 as direct downstream target genes of miR-33b. [score:3]
miR-33b expression was inversely correlated with clinical stages and metastatic status of breast cancer. [score:3]
miR-33b was downregulated in the breast cancer samples compared with the paired normal breast tissues (Fig. 1A). [score:3]
We performed qRT-PCR to analyze the endogenous mRNA levels of these genes upon the overexpression of miR-33b in BT-549 and MDA-MB-231 cells (Supplementary Fig. 1). [score:3]
These data suggest that miR-33b can suppress the migration and invasion of breast cancer cells in vitro. [score:3]
Initially, we focused on the three major downstream targets of miR-33b: HMGA2, SALL4 and Twist1. [score:3]
Moreover, miR-33b could inhibit tumor growth and the lung metastasis of breast cancer cells in vivo. [score:3]
Re -expression of HMGA2 and Twist1 reverses miR-33b -dependent self-renewal and invasion-relevant phenotypes in vitro. [score:3]
In addition, although the three target genes of miR-33b, HMGA2, SALL4 and Twist1, are EMT inducers, our gain-of-function and loss-of-function assays in different breast cancer cell lines and a mammary epithelial cell line showed that miR-33b regulation of tumor metastasis is independent of the EMT-related program. [score:3]
In this study, we reported that miR-33b was downregulated in breast tumor samples from patients compared with adjacent normal breast tissues. [score:3]
We further employed western blotting to detect the protein expression of downstream metastatic genes of miR-33b. [score:3]
Furthermore, miR-33b suppresses the lung metastasis of breast cancer cells in vivo. [score:3]
The CD44 [+]/CD24 [−] immunophenotype has been successfully used as a biomarker to identify cancer stem-like cells in breast cancer cell populations 6. Therefore, we used fluorescence-activated cell sorting (FACS) to analyze whether ectopic miR-33b expression modulated the CSC subpopulation in MDA-MB-231 cells. [score:3]
Collectively, these results indicate that the inhibition of miR-33b can promote the self-renewal of MCF-10A cells. [score:3]
Therefore, miR-33b may exert tumor-suppressive functions and impede breast tumor metastasis. [score:3]
Therefore, we first addressed whether miR-33b could suppress the stemness of breast cancer cells. [score:3]
miR-33b inhibits the stem cell-like properties of breast cancer cells in vitro. [score:3]
miR-33b suppresses the migration and invasion of breast cancer cells in vitro. [score:3]
However, knockdown of miR-33b did not exhibit a toxicity effect on MCF-10A cell viability (Supplementary Fig. 4). [score:2]
For HMGA2, which has two potential miR-33b binding sites, mutation of either binding site 1 or binding site 2 reversed the decreased luciferase activity induced by miR-33b. [score:2]
The Transwell assay showed that the inhibition of miR-33b in MCF-10A cells drastically enhanced migration (Fig. 6A) and invasion capabilities (Fig. 6B). [score:2]
We further asked how miR-33b regulated breast cancer cell migration and invasion. [score:2]
Next, we explored whether miR-33b knockdown could augment self-renewal in MCF-10A cells. [score:2]
Our results revealed a new miRNA that regulates both stemness and metastasis in breast cancer cells, indicating that miR-33b may serve as a new diagnostic and prognostic biomarker for breast cancer metastasis. [score:2]
Next, we cloned each 3′UTR of these 6 genes into pmiR-Report constructs and performed dual luciferase reporter assays to investigate whether miR-33b could directly regulate the expression of these genes. [score:2]
The knockdown of miR-33b in MCF-10A cells increased the CD44 [+]/CD24 [−] stem cell subpopulation from 10.4% to 36.8% for MCF-10A/sh-miR-33b cells and from 10.4% to 37.1% for MCF-10A/sh-pre-miR-33b cells (Fig. 5E). [score:2]
Knockdown miR-33b promotes the self-renewal of MCF-10A cells. [score:2]
Moreover, we found that miR-33b does not alter the 3′UTR activity of the well-established EMT transcription factor SNAI2, suggesting that miR-33b regulates HMGA2, SALL4 and Twist1 in breast cancer cells without impacting EMT. [score:2]
For the stable knockdown miR-33b in MCF-10A cells, pLL3.7-puro containing anti-miR-33b, anti-pre-miR-33b shRNA or control plasmid (control hairpin) was co -transfected with pMDL, REV and VSVG at the ratio (quantity) of 5:5:2:3. The transfection and lentiviral infection processes were similar to those described previously 48. [score:2]
Altogether, these data showed that knockdown of miR-33b promotes cell migration and invasion in vitro. [score:2]
Knockdown of miR-33b promotes the self-renewal, migration and invasion of MCF-10A cells. [score:2]
At the 1-cell level, ectopic expression of miR-33b in BT-549 and MDA-MB-231 cells showed no difference in sphere formation compared with their control cells. [score:2]
Quantification of primary, secondary and tertiary mammospheres formed by BT-549/ctrl and BT-549/miR-33b cells. [score:1]
The correlation between the miR-33b expression level and clinical and pathologic characteristics of breast cancer is summarized in Fig. 1E. [score:1]
Therefore, HMGA2, SALL4 and Twist1 are functionally relevant effectors of miR-33b. [score:1]
Moreover, the levels of miR-33b were negatively correlated with the progression of clinical stage (Fig. 1C) and lymph node metastasis status (Fig. 1D). [score:1]
We found two putative binding sites in the HMGA2 3′UTR, one putative binding site in the SALL4 3′UTR and one putative miR-33b binding site in the Twist1 3′UTR and then used Quickchange PCR 24 to obliterate these binding sites in the 3′UTR of HMGA2, SALL4 and Twist1. [score:1]
Interestingly, a recent report demonstrated that miR-33a, another member of the miR-33 family, promotes the self-renewal of glioma-initiating cells 38. [score:1]
These defects could not be ascribed to toxicity resulting from ectopic miR-33b (Supplementary Fig. 2A,B). [score:1]
We further investigated whether the inhibition of miR-33b in MCF-10A cells could result in a pro-invasive phenotype. [score:1]
These FACS results suggested that miR-33b can decrease the cancer stem-like cell pool of breast cancer cells. [score:1]
Bioluminescence imaging showed that mice bearing the 4T1/ctrl cells formed multiple large metastases, while 4T1/mmu-miR-33 cells displayed relatively weak metastasis both in orthotopic implantation and tail vein injection (Fig. 7B,C). [score:1]
Hsa-miR-33b containing flank region was amplified from human genomic DNA and inserted into pCDH-CMV-EF1α-GFP+puro (System Biosciences). [score:1]
However, miR-33b did not induce EMT in MCF-10A cells (Supplementary Fig. 3B). [score:1]
We used highly metastatic mouse breast cancer cells 4T1 to generate luciferase-labeled 4T1/ctrl and 4T1/mmu-miR-33 cells (Supplementary Fig. 6) and injected them into the orthotopic site or tail vein of mice. [score:1]
For the generation of miR-33b stable cell lines, a lentivirus -mediated packaging system containing four plasmids, pCDH-miR33b or control plasmid (scrambled miRNA), pMDL, REV and VSVG at the ratio (quantity) of 5:5:2:3, was used. [score:1]
Next, we investigated the impact of miR-33b on the expression of stem markers. [score:1]
Bioluminescence imaging showing that mice bearing the MDA-MB-231/ctrl cells displayed significant lung metastases and a larger size and a higher weight of tumors; however, we only detected few metastases in the mice injected with MDA-MB-231/miR-33b cells (Fig. 7D–F). [score:1]
Quantification of primary, secondary and tertiary mammosphere formation formed by MDA-MB-231/ctrl and MDA-MB-231/miR-33b cells. [score:1]
No correlation was observed between the miR-33b level and the age or pathologic grade status of breast cancer. [score:1]
Mice injected with 4T1/ctrl cells at the mammary fat pad formed tumors with a larger size and a higher weight than mice injected with 4T1/mmu-miR-33 cells at the orthotopic site (Fig. 7A). [score:1]
We further investigated miR-33b expression in the noncancerous human mammary epithelial cell line MCF-10A and in the following breast cancer cell lines: the non-metastatic cell line MCF-7, moderately metastatic cell lines SK-BR-3 and MDA-MB-453, and highly metastatic cell lines BT-549 and MDA-MB-231. [score:1]
We also injected luciferase-labeled MDA-MB-231/miR-33b cells and the control cells into the orthotopic site or tail vein of nude mice. [score:1]
However, whether miR-33b plays functional roles in tumorigenesis and metastasis remains unclear. [score:1]
293T or MDA-MB-231 cells were seeded into a 24-well plate and cotransfected with miR-33b or control and 3′UTR-luciferase plasmids. [score:1]
[1 to 20 of 127 sentences]
3
[+] score: 402
Therefore, we asked whether cordycepin can inhibit melanoma migration by targeting miR-33b and downregulating HMGA2 and Twist1 expression. [score:10]
Since HMGA2 and Twist1 are transcriptional regulators, more studies are needed to clarify whether HMGA2 and Twist1 directly or indirectly regulate cell motility and expression of MMPs and CD44 in response to cordycepin treatment and miR-33b upregulation. [score:10]
Cordycepin targets miR-33b to inhibit orthotopic and experimental melanoma metastasis to multiple organs in vivoTo determine whether cordycepin influences spontaneous melanoma metastasis, we implanted nontargeting control (sh-NT) or sh-miR-33b -expressing Lu1205 cells to the right flank of nude mice and determined the primary tumor growth and metastasis to multiple organs by bioluminescence imaging. [score:9]
It was reported that the expressions of miR-33a and miR-33b were independently regulated in that miR-33a expression was controlled by SREBP-2, while miR-33b expression was triggered by LXR [21]. [score:8]
We found that cordycepin treatment enhanced the expression of TIMP-1 and miR-33b knockdown attenuated TIMP-1 upregulation in both Lu1205 and A375 cells (Figure 5C). [score:7]
To further validate the regulatory role of miR-33b, we inhibited miR-33b with lentivirus -based antagomir expression system to specifically knockdown precursor miR-33b (pre-miR-33b) and mature miR-33b in Lu1205 cells. [score:7]
In conclusion, we provide strong evidence supporting the idea that cordycepin is able to inhibit the expression of HMGA2, Twist1 and ZEB1 by targeting miR-33b. [score:7]
This implies that cordycepin downregulates cell migratory machinery and cytoskeletal remo deling by targeting miR-33b. [score:6]
Upregulation of miR-33b by cordycepin further resulted in MET and inhibited melanoma metastasis in vivo. [score:6]
Altogether, these data suggest that the loss of miR-33b leading to the upregulation of HMGA2, Twist1 and ZEB1 expressions may contribute to metastasis. [score:6]
In the current study, we found that cordycepin could suppress melanoma invasion via MMPs and metastasis via actomyosin machinery through LXR/RXR activation -dependent upregulation of miR-33b (Figure 7F). [score:6]
Herein, we report that cordycepin might regulate focal adhesion assembly and MMP expression through modulating the expression of the Twist1 gene via miR-33b. [score:6]
Thus, miR-33b upregulated by cordycepin not only inhibited early stages of metastasis, but also repressed cell migration and invasion. [score:6]
These results suggest that cordycepin upregulates miR-33b expression in a LXR/RXR activation -dependent manner. [score:6]
To determine the functional roles of cordycepin -upregulated miR-33b in melanoma, we attempted to identify the downstream targets of miR-33b. [score:6]
In this study, we reported that miR-33b was upregulated by cordycepin and miR-33b expression was negatively correlated with clinical stages of melanoma. [score:6]
Cordycepin targets miR-33b to inhibit orthotopic and experimental melanoma metastasis to multiple organs in vivo. [score:5]
Cordycepin suppressed HMGA2, Twist1 and ZEB1 expressions through miR-33b. [score:5]
These data implied that focal adhesion assembly and cytoskeletal rearrangement were located in the downstream of HMGA2 and Twist1 whose expressions were diminished by cordycepin -induced miR-33b expression. [score:5]
miR-33b silencing or overexpressing HMGA2 or Twist1 reverted the suppressive effect of cordycepin on focal adhesion formation. [score:5]
Knockdown of miR-33b in untreated cells did not significantly upregulate HMGA2, Twist1 and ZEB1 3′UTR activities. [score:5]
This implied that cordycepin may target HMGA2, ZEB1 and Twist1 gene expression via miR-33b. [score:5]
To narrow down the target genes of miR-33b, we employed in silico algorithms to predict miR-33b target genes with binding likehood. [score:5]
We demonstrated for the first time that miR-33b can suppress EMT through modulating the expression ZEB1. [score:5]
Cordycepin may initiate distinct signaling pathways to induce miR-33b expression and prescribe the downstream targets of miR-33b. [score:5]
In addition, miR-33b antagomir attenuated the inhibitory effect of cordycepin on the expressions of MMP-2, MMP-9 and CD44 which are associated with tumor invasiveness at mRNA levels (Figure 5C). [score:5]
Cordycepin suppresses HMGA2 and Twist1 -mediated melanoma migration by targeting miR-33b. [score:5]
To determine whether cordycepin influences spontaneous melanoma metastasis, we implanted nontargeting control (sh-NT) or sh-miR-33b -expressing Lu1205 cells to the right flank of nude mice and determined the primary tumor growth and metastasis to multiple organs by bioluminescence imaging. [score:5]
To further determine whether miR-33b could regulate the expressions of these genes by directly binding to miR-responsive elements in 3′UTR, we analyzed the miR-33b binding sites in these genes' 3′UTR. [score:5]
The regulation of downstream gene expression by miR-33b diverges from the well-established induction of genes related to lipid metabolism. [score:4]
miR-33b targets ZEB1 to regulate EMT following cordycepin treatment. [score:4]
miR-33b is a member of human miR-33 family and has been reported to regulate lipid metabolism and cholesterol homeostasis by targeting the downstream genes. [score:4]
Using linear regression analysis, miR-33b displayed a significant negative correlation with the expressions of HMGA2, Twist1 and ZEB1, consistent with these genes being regulated by miR-33b in melanoma (Figure 3B–3D). [score:4]
Identification of HMGA2, Twist1 and ZEB1 as the direct targets of miR-33b in response to cordycepin treatment. [score:4]
We also found that melanoma migration and invasiveness was mediated by miR-33b though directly targeting high mobility group AT-hook 2 (HMGA2), Twist1 and human zinc finger E-box binding homeobox 1 (ZEB1). [score:4]
We speculate that the target gene transcription regulation abilities of miR-33b are largely dependent on cellular environment. [score:4]
Knockdown of pre-miR-33b or miR-33b in Lu1205 cells rescued relative luciferase activities of ZEB1, HMGA2 and Twist1 3′UTR which have been suppressed by cordycepin treatment (Figure 2C). [score:4]
In sharp contrast, miR-200b, miR-200c, miR-205 and miR-211 knockdown did not significantly alter the motility of melanoma, suggesting that miR-33b would be the sole miRNA responsible for cordycepin -mediated suppression of melanoma migration (Figure 4C). [score:4]
Knockdown of miR-33b promoted epithelial-mesenchymal transitions (EMT) of cordycepin -treated Lu1205 and A375 cells and re -expression of ZEB1 reversed miR-33b -dependent MET phenotype of Lu1205 cells. [score:4]
While cordycepin significantly reduced Lu1205 and A375 invasiveness (p < 0.01), miR-33b knockdown rescued the cell invasion suppressed by cordycepin (Figure 5A). [score:4]
In contrast, miR-33b knockdown or HMGA2, Twist1 or ZEB1 overexpression significantly attenuated the effect of cordycepin on lifespan of tumor-bearing mice. [score:4]
miR-33b knockdown in melanoma cells rescued the suppressive effect of cordycepin on metastasis (Figure 7A–7B). [score:4]
miR-33b binds to the 3′ UTR of HMGA2, ZEB1 and Twist1 to regulate their expression in cordycepin -treated melanoma cell lines. [score:4]
Likewise, disruption of miR-33b binding regions in Twist1 and ZEB1 prevented the reporter from cordycepin -mediated downregulation of luciferase activity. [score:4]
200 μg/ml cordycepin treatment and ectopic expression of miR-33b mimic dramatically reduced the luciferase activities of HMGA2, ZEB1 and Twist1 to the same extent (Figure 2B). [score:3]
Figure 3 (A) Relationship of miR-33b, HMGA2, Twist1 and ZEB1 relative expression and melanoma clinicopathological features. [score:3]
The elevated expressions of miR-33b, miR-200b, miR-200c, miR-205 and miR-211 were verified by realtime-PCR (Figure 1A–1B). [score:3]
Figure 1 (A–B) qRT-PCR reveals upregulation of miR-33b, miR-200b, miR-200c, miR-205 and miR-211 in Lu1205 and A375 melanoma cells which received 200 μg/ml cordycepin compared with their matched untreated controls. [score:3]
Figure 5 (A) Matrigel-coated transwell invasion assay revealed that the miR-33b knockdown rescued cordycepin -mediated inhibition of Lu1205 and A375 invasion. [score:3]
Quantitative analysis revealed that cordycepin incubation decreased the size and number of focal adhesions via miR-33b, which could be rescued by restoring HMGA2 or Twist1 expressions (Figure 4H–4I). [score:3]
In contrast, ectopic expression of miR-33b or cordycepin treatment abolished the stress fiber structure in Lu1205 cells. [score:3]
Patients whose tumors express low miR-33b levels had reduced metastasis and relapse-free survival. [score:3]
qRT-PCR was used to quantify miR-200b, miR-200c, miR-205, miR-33b, and miR-211 and mRNA expressions. [score:3]
Ectopic expression of miR-33b significantly increased the cell-free gap area for Lu1205 and A375 cell lines (Figure 4C). [score:3]
sh-miR-33b transfection abrogated the suppressive effect of cordycepin on cell motility. [score:3]
In addition, silencing LXRβ and RXRα attenuated the induction of miR-33b expression by cordycepin (Figure 1I). [score:3]
Cordycepin suppresses melanoma migration through miR-33b. [score:3]
Silencing miR33b reverted cordycepin -mediated suppression of invasive, migratory and epithelial-mesenchymal transition (EMT) phenotype in vitro and melanoma metastasis in vivo. [score:3]
These data may imply that miR-33b is not only a sensor for cordycepin treatment but also functions as tumor-suppressor miRNA to have prognostic significance. [score:3]
N-cadherin expression was weak in primary tumor which was transfected by sh-NT and treated with cordycepin in comparison with vesicle -treated or cordycepin -treated/sh-miR-33b -transfected melanoma cells. [score:3]
miR-33b expression levels in FFPE melanoma tissue samples from 72 patients with clinical TNM stage 0–IV were detected with in situ hybridization and quantified by ImageJ for grey value. [score:3]
In the current study, we found that cordycepin induces the binding of LXR/RXR to LXRE of SREBP-1 promoter and silencing LXRβ/RXRα abrogated cordycepin -induced miR-33b expression. [score:3]
miR-33b is located in intron of SREBP-1 and is expressed when liver X receptor (LXR) binds to LXRE region of SREBP-1 promoter as a heterodimer with the retinoid X receptor (RXR) [21– 23] (Figure 1D). [score:3]
To circumvent the early step of metastasis and specifically investigate whether miR-33b inhibits melanoma extravasation and colonization, we injected sh-NT or sh-miR-33b -expressing GFP-tagged melanoma cells via tail vein and monitored lung metastasis. [score:3]
In the current study, we showed that miR-33b by binding to 3′UTR of ZEB1 to suppress EMT process. [score:3]
miR-33b silencing, or overexpressing HMGA2 or Twist1 in cordycepin -treated Lu1205 cells restored actin polymerization. [score:3]
This suggested that mesenchymal-epithelial transition (MET) was necessary for miR-33b -suppressed melanoma metastasis. [score:3]
In agreement with western blotting results, immunofluorescence staining suggested that miR-33b silencing or ZEB1 overexpressing reverted cordycepin -mediated epithelial differentiation of melanoma cells (Figure 6C). [score:3]
miR-33b levels were detected with in situ hybridization and HMGA2, Twist1 and ZEB1 expression levels were assessed with immunohistochemistry. [score:3]
All data suggest that HMGA2, Twist1 and ZEB1 are the downstream targets of miR-33b. [score:3]
miR-33b seed in melanoma patients was negatively correlated with HMGA2, Twist1 and ZEB1 expression levels. [score:3]
Among those, miR-33b, miR-200b, miR-200c, miR-205 and miR-211 exhibited more than 5-fold increase in their expression in response to 200 μg/ml cordycepin. [score:3]
On the contrary, GFP-Lu1205 or GFP-A375 cells were trapped in the lung vein in cordycepin+sh-NT group, suggesting that cordycepin reduced cell extravasation by targeting miR-33b. [score:3]
Cordycepin induces miR-33b expression in melanoma cell lines. [score:3]
Cordycepin suppresses spontaneous metastasis through miR-33b. [score:3]
Cordycepin inhibits HMGA2 and Twist1 -mediated melanoma invasion via miR-33b. [score:3]
Cordycepin suppresses melanoma invasion through miR-33b. [score:3]
Cordycepin mediates miR-33b expression in melanoma cells in a LXR/RXR dependent manner. [score:3]
Our study provides a better understanding of the novel action mechanism of cordycepin underlying melanoma metastasis, indicating that miR-33b could be potential targets for melanoma therapy. [score:3]
These target genes shared one or two common regions of miR-33b seeding sequences. [score:3]
The suppressive effect of cordycepin on MMP-2/-9 activities could be reverted by miR-33b antagomir. [score:3]
Of note, previous studies indicated that miR-33b expression was inversely correlated with malignancy of human breast cancer [45]. [score:3]
In contrast, miR-33b knockdown reverted the trend and promoted mesenchymal differentiation of Lu1205 and A375 cells. [score:2]
Since miR-33b displayed the most prominent increase, it may be of functional importance in regulating melanoma invasion and metastasis. [score:2]
miR-33b knockdown restored the robust N-cadherin staining in the cell membrane and cytosol of primary tumor in response to cordycepin treatment. [score:2]
Cordycepin treatment or miR-33b knockdown did not affect the growth of the primary tumors, but did reduce the metastatic potential of cells in the spontaneous metastasis assay, therefore, indicating the involvement of miR-33b in the cordycepin-regulated melanoma invasiveness. [score:2]
H&E staining verified bioluminescence results for the involvement of miR-33b in cordycepin-regulated melanoma liver metastasis (Figure 7C). [score:2]
In the context of cordycepin treatment, knockdown of miR-33b promoted the wound healing capacities (Figure 4C). [score:2]
Then, we analyzed the effect of miR-33b knockdown on ZEB1, HMGA2 and Twist1 3′UTR activity. [score:2]
Knockdown of miR-33b in cordycepin -treated Lu1205 and A375 melanoma cells increased the levels of phosphorylated FAK, Src, and MLC and RhoA-GTP. [score:2]
To determine whether miR-33b plays roles in cordycepin -mediated suppression of melanoma invasiveness, a Matrigel -based invasion assay was employed. [score:2]
miR-33b knockdown rescued the abilities of Lu1205 and A375 cells to extravasate and colonize in the lung. [score:2]
Compared with the untreated counterparts, miR-33b had a greater than 18.5-fold higher expression in cordycepin -treated invasive cell lines. [score:2]
Then, we cloned each 3′UTR of these 3 genes into pGL3-vector and conducted dual luciferase reporter assay to investigate whether miR-33b could directly regulate the expressions of these genes. [score:2]
miR-33b is located in intron 17 of the endoplasmic reticulum (ER)-bound sterol regulatory element -binding protein-1 (SREBP-1) gene on chromosome 17 [46]. [score:2]
miR-33 also binds to 3′UTR of carnitine O-octaniltransferase (CROT), Carnitine palmitoyltransferase 1A (CPT1a) and hydroxyacyl-CoA-dehydrogenase (HADHB) to regulate fatty acid metabolism [47]. [score:2]
However, in miR-33b mimic -transfected or cordycepin -treated cells, small focal adhesions were only visible at cell periphery and almost disengaged with thin stress fibers. [score:1]
For in situ hybridization (ISH), biotin-labeled probes were purchased from Exiqon for human miR-33b and a control scramble miRNA probe. [score:1]
miR-33b levels in melanoma patient tissue samples were negatively correlated with those of HMGA2, Twist1 and ZEB1. [score:1]
Cells were untransfected or transfected with sh-NT or sh-miR-33b for 24 hr before being treated or untreated with 200 μg/ml cordycepin for 24 hr. [score:1]
The wound area in cordycepin/sh-miR-33b group reached 70% and 50% sealing for Lu1205 and A375 after 24 hr of wound scratch. [score:1]
The antagomir pairs reduced miR-33b levels in the context of cordycepin treatment by approximately 80% (data not shown). [score:1]
Cordycepin boosted miR-33b levels in a dose -dependent manner in both invasive cell lines (Figure 1C). [score:1]
To assess whether there is an association between the levels of HMGA2, Twist1 or ZEB1 and miR-33b in melanoma, we analyzed their levels in 72 melanoma patient samples. [score:1]
miR-33b was negatively correlated with the grading of malignancy of melanoma (Figure 3A). [score:1]
Lu1205 were transfected with sh-NT, sh-pre-miR-33b or sh-miR-33b for 24 hr before being treated or untreated with 200 μg/ml cordycepin for 24 hr. [score:1]
Therefore, miR-33b may be a marker to classify the metastatic stages. [score:1]
miR-33 is co-transcribed with SREBP genes, reducing cholesterol export [21, 46]. [score:1]
In addition, we found that miR-33b represses in vivo melanoma lung, liver and bone metastasis. [score:1]
There were two putative miR-33b binding sites in HMGA2 and one putative binding site in Twist1 and ZEB1. [score:1]
In vesicle+sh-NT and cordycepin+sh-miR-33b cohorts, cells were completely cleared from the circulation in lung, 48-hr after tail vein injection. [score:1]
HMGA2, Twist1 and ZEB1 3′UTR activities were increased by 1.9-fold, 1.6-fold and 3.1-fold in Lu1205/cordycepin/sh-miR-33b cells, respectively. [score:1]
In situ hybridization and immunohistochemistryFor in situ hybridization (ISH), biotin-labeled probes were purchased from Exiqon for human miR-33b and a control scramble miRNA probe. [score:1]
Figure 7 (A) Bioluminescence images of primary tumor, lung, liver and bone from sh-NT or sh-miR-33b stable Lu1205 cells following 28 days post implantation. [score:1]
Bottom, quantification of number of migrated Lu1205 cells which were transfected with sh-NT or sh-miR-33b before being treated or untreated with cordycepin. [score:1]
Quickchange PCR was employed to change the miR-33b seeding sequences in 3′UTRs of HMGA2, Twist1 and ZEB1. [score:1]
Figure 6 (A) sh-miR-33b transfection or (B) ZEB1 overexpression reverted cordycepin-mediate MET in both Lu1205 and A375 cells as measured with. [score:1]
The 28-day tumor weight and size were comparable for control+sh-NT, cordycepin+sh-NT and cordycepin+sh-miR-33b groups (Figure 7A–7B). [score:1]
A recent study suggests that another membrane of miR-33 family, miR-33a, enhances glioma-initiating cell self-renewal through PKA and NOTCH pathways [48]. [score:1]
[1 to 20 of 119 sentences]
4
[+] score: 290
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-122
Application Primers (5′→3′) Length of the Product (bp) ABCA1 target siteF c gagctcGCCAATTTCAGCCAAGAAGTGA 70R ccc aagcttCTTTGGGAGTAACCTATCCCCAG ABCG1 target siteF c gagctcAGGAAGAAGAAATAGAAGGGAA 267R ccc aagcttACAGAAAACCACAAAGATGAAA NPC1 target siteF c gagctcCTGGACTGCTCAACCACTGAC 211R ccc aagcttGCCTCTCCCATTGGAATGTA NPC1 target siteF AGAGACAAAAATTGCAT CAACCTGCATTTA 211 R GCAATTTTTGTCTCTATTTTTAGGGGGG CROT target siteF c gagctcATTTGCAACAGCAATGCAAG 197R ccc aagcttAGTGCTCCACTGGCAAAAAC CROT target site 1 mutationF ATCTCCCAAGTATGTTTGC GCTGTTGAGGCA 197 R GCAAACATACTTGGGAGATATGGTGTTG CROT target site 2 mutation F CCCAAGCTTAGTGCTCCACTGGCAAAAAC 197RCGAGCTCATTTGCAACAGCA GCGCAAGTAGTA HADHB target siteF c gagctcATGGGGGGACTGCTGAAGGAGT 256R ccc aagcttGAGATTAGTGTGGTTACGACGA HADHB target site 1 mutationF TGTTTTCATTAGTGC GCTGAAATGGCATTGCC 256 R GCACTAATGAAAACATACATACAGTCCT HADHB target site 2 mutationF TGCATTGAAATGGC GCTGCCAGGCACAGGA 256R TCCTGTGCCTGGCA GCGCCATTTCAATGCA ADRP target siteF c gagctcGGCTGCTGACTTGGTAGGAG 415R cg acgcgtCACAACCAGGCATTGCTCTA IRS2 target siteF c gagctcGCCCAACTCATGTCCTGTCA 358R ccc aagcttAGTTCAGTAAGGCTGGCGAC GPT2 target siteF c gagctcACAGCAGACAGGGAACACTT 223R cg acgcgtATCTGCAAGTCGAAAGCCAG AMPKα1 target siteF c gagctcAACAAAGGCGCTGAAAAAACTA 321R ccc aagcttCTGAATAAAGGGGGAAGGAACA miR-33 overexpressionF g gaattcCCTAAAGCTGGAGCCTTCCT 203R ccg ctcgagCGGCTCGCTATTTTAGTTGC miR-33 point mutation 1F GTGCATTGTAGTTGC GCTGCATGTGACGGCA 203 R GCAACTACAATGCACTACAGCTGCCACC miR-33 point mutation 2F AGTGCATTGTAGTTGCGC AACATGTGACGG 203 R GCGCAACTACAATGCACTACAGCTGCCAThe underlined lowercase letters represent the SacI and MluI enzyme loci; the lowercase letters without underlines denote base protection; and the underlined capital letters represent mutation bases. [score:37]
Luciferase activity did not differ significantly in the CROT, HADHB and NPC1 genes; this result suggests that miR-33 combines with the target genes according to a seed sequence to inhibit the expression of target genes. [score:9]
The selected target genes from this region all report either one or two target miRNA-33 binding sites, as per extended analysis of the nine-target-gene sequence in the 3′ UTR region. [score:7]
This result suggests that target Site 1 is a miR-33 target site in the HADHB gene, possibly because the two HADHB target sites are near each other. [score:7]
Previous studies indicate that the overexpression of miR-33 can reduce the oxidation of fatty acid in liver cells, whereas the inhibition of endogenous miR-33 can increase the expression of carnitine O-octanoyltransferase (CROT), CPT1A, cyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase, beta subunit (HADHB) and AMP-activated protein kinase (AMPK). [score:7]
These findings indicate that the miR-33 seed sequences and the target sites are key to inhibiting the gene expression of miR-33. [score:7]
We speculate that miR-33 does not target the inhibition of these genes, possibly because the target sequences are low in species conservatism. [score:7]
To determine the role of the miRNA-33 target site, we allow the 2–5 bases at the 5′ end to mutate; therefore, they cannot combine with the target site of the target gene. [score:7]
The NPC1 gene inhibits miR-33 in response to the mutations of NPC1 target points. [score:6]
miR-33 also regulates insulin signals considerably; therefore, its overexpression can weaken the expression of the IRS2 gene. [score:6]
Thus, the study on the regulation of miR-33 expression in geese is significant to livestock production and to the treatment of fatty liver disease in humans. [score:6]
The inhibition of endogenous miR-33 can enhance the expression of the CROT, CPT1A, HADHB and AMPK genes, as well as enhance fatty acid oxidation [7, 8]. [score:5]
Mut-miR-33 represents the mutation of miR-33, and mut-box represents the mutation of target sites. [score:5]
Figure 3Target binding sites of the miR-33 target gene. [score:5]
Thus, miRNA-33 is successfully overexpressed and can verify the target genes. [score:5]
The online software programs TargetScan, miRDB and miRCosm were used to predict the target genes of miRNA-33 with reference to the gene sequence of chickens. [score:5]
The overexpression of miR-33 can reduce the ABCA1 mRNA expression in livers and reduce the HDL levels in plasma by 25% [12]. [score:5]
After predicting the target genes of miRNA-33, we chose several important target genes, such as ABCA1, ABCG1, NPC1, CROT, HADHB, ADRP, IRS2, GPT2 and AMPKα1. [score:5]
The target genes of miR-33 were predicted using three online software programs, namely TargetScan, miRDB and miRCosm. [score:5]
The results showed that the expression level of miR-33 was significantly higher in the group transfected with the overexpression vector of miRNA-33 than in the control group transfected with the empty carrier pcDNA3.1 (Figure 4). [score:5]
Either the overexpression vector pcDNA3.1-miRNA-33 or the control vector pcDNA3.1, the report vector pMIR-REPORT of the target genes and the internal vector PhRL-TK were cotransfected into CHO cells (Figure 5). [score:5]
Studies have shown that either miRNA-33 overexpression or silence can reduce or increase the level of ABCA1 and ABCG1 mRNA expression in the liver. [score:5]
According to the instructions for the dual-luciferase reporter assay system kit (Promega, Madison, WI, USA), the luciferase -based target in vitro assay was applied to test whether miR-33 could bind to the 3′ untranslated region (UTR) of predicted target genes. [score:5]
The CROT and HADHB genes display two target points on the complementary sequence of the 3′ UTR in combination with the miR-33 seed during target gene prediction. [score:5]
Previous studies indicate that miR-33 can inhibit CROT and HADHB expression to limit the oxidation of fatty acid in the liver cells of humans and mice [22, 23]. [score:5]
The fragment containing miR-33 precursor was cloned into expression plasmid pcDNA3.1 by EcoRI and Xho I digestion to construct the miR-33 overexpression plasmid. [score:5]
As a result, the target point cannot be combined with the miR-33 seed sequence. [score:3]
The overexpression of miR-33 a/b can reduce the oxidation of fatty acid in liver cells, which can, in turn, result in the accumulation of excess triglycerides in human liver cells [7, 8]. [score:3]
Prediction of the miRNA-33 Target Gene in Landes Geese. [score:3]
Prediction of miR-33 Target Genes. [score:3]
miR-33 in the macrophage of mice can be targeted to adenosine triphosphate binding cassette transporters G1 (ABCG1) [9] and can promote excessive cholesterol output. [score:3]
Thus, we infer that they are not the target genes of miR-33. [score:3]
According to the design primers of the seed region, we constructed the pcDNA3.1-miR-33 overexpression plasmid and pMIR-REPORT-3′ UTR recombinant plasmid containing point mutation. [score:3]
The repeated experiment results indicate that in comparison with the control group, luciferase activity in the ABCA1, ABCG1, IRS2, GPT2, ADRP and AMPKα1 genes did not change significantly in the miRNA-33 overexpression group. [score:3]
Moreover, the overexpression of miR-33 can limit the oxidation of fatty acid in liver cells. [score:3]
The CROT, HADHB and NPC1 genes are the target genes of miR-33 in Landes geese. [score:3]
Hence, both sites are miR-33 target sites in the CROT gene. [score:3]
Verification of the miRNA-33 Target Site. [score:3]
Previous studies have reported that miR-33 is important in cholesterol homeostasis; thus, its overexpression limits the cholesterol excretion capability of liver cells. [score:3]
We further designed point mutation primers of the miR-33 target gene. [score:3]
Analysis of miRNA-33 Expression in the Fatty Liver of Geese. [score:3]
The expression of miR-33 in goose liver does not increase after 0 and 10 days of overfeeding (Figure 2). [score:3]
Verification of the miR-33 Target Site. [score:3]
The overexpression vectors were transfected into CHO cells and used to detect miRNA-33 levels. [score:3]
With reference to the literature, we chose a target sequence area that combines with and complements the miR-33 seed sequence area. [score:3]
Verification of the miRNA-33 Target Gene. [score:3]
In this study, we derived ABCA1, ABCG1, NPC1, CROT, HADHB, AMPKα1, IRS2, GPT2 and ADRP from the 774 target genes of miR-33 by prediction. [score:3]
Given the easy reach of points, the miR-33 seed sequence is preferably combined with target Point 1. In addition, Gerin et al. obtained results for human liver cancer cells that were consistent with those of the current study [8]. [score:3]
Expression Rule of miR-33 in Goose Fatty Liver. [score:3]
Verification of miR-33 Target Gene. [score:3]
In this study, miR-33 expression increases significantly after 19 days of overfeeding in comparison with the control group. [score:3]
The report vectors of the 2–5 base at the 5′ end of miRNA-33 and of either the 2–3 or the 5–6 base at the 3′ end of target gene are mutated. [score:3]
Additionally, we designed a pair of amplification primers of the miR-33 precursor sequence to synthesize the miR-33 overexpression vector and two pairs of mutation primers of the miR-33 mature sequence. [score:2]
These results suggest that miR-33 can not only regulate cholesterol metabolism, but also adjust the level of fatty acid and glucose metabolism. [score:2]
R000017200 10934219 6. Horie T. Ono K. Horiguchi M. Nishi H. Nakamura T. Nagao K. Kinoshita M. Kuwabara Y. Marusawa H. Iwanaga Y. MicroRNA-33 encoded by an intron of sterol regulatory element -binding protein 2 (Srebp2) regulates HDL in vivo Proc. [score:2]
miRNA-33 expression level was detected with the TaqMan microRNA assay real-time fluorescent quantitative PCR technology. [score:2]
Previous research also suggests that the miR-33 can regulate all aspects of fat metabolism by limiting the flow of cholesterol and of fatty acid degradation. [score:2]
Additionally, the results of our study will provide important information regarding the mechanism of goose hepatic steatosis through regulation of miR-33. [score:2]
In the gene intron of the sterol-regulatory element binding protein (SREBP) in fruit flies, mice, chickens, humans and other species, the highly conserved miRNA family miR-33 cooperates with these proteins to form a negative feedback loop. [score:2]
Different primer pairs (Table 1) were used in PCR reactions to amplify putative miR-33 target sites in the 3′ UTR of different genes and native or mutated miR-33. [score:2]
The concentrations of pcDNA3.1, pcDNA3.1-miR-33 and the mutation plasmid of miR-33 were diluted to 100 ng/μL. [score:2]
Marquart T. J. Allen R. M. Ory D. S. Baldán A. miR-33 links SREBP-2 induction to repression of sterol transporters Proc. [score:1]
Moreover, geese miRNA contained the complete mature miRNA-33 sequence, which is identical to that of chicken miRNA. [score:1]
Furthermore, the NPC1 3′ UTR gene in humans contains two miRNA-33 binding sites. [score:1]
Control group: pcDNA3.1 + pmiR-report + phRL-TK; miRNA-33: pcDNA3.1-miR-33 + pmiR-report + phRL-TK; mut-miR-33: pcDNA3.1-mut-miR-33 + pmiR-report + phRL-TK; mut-Box: pcDNA3.1-miR-33 + mut-pmir-report + phRL-TK. [score:1]
4.4. miRNA-33 Real-Time Reverse Transcription Polymerase Chain Reaction. [score:1]
The sequence above is the precursor sequence of miRNA-33 in Landes geese. [score:1]
Precursor Sequence of the miRNA-33 of Landes Geese. [score:1]
This finding suggests that when the sites mutate individually, another site can still be combined with the seed sequence of miRNA-33. [score:1]
In addition, part of the sequence is important to gene function as a potential miR-33 action point. [score:1]
Specifically, Rayner et al. reported that the NPC1 3′ UTR gene in humans contains two miRNA-33 binding sites. [score:1]
Rayner K. J. Sheedy F. J. Esau C. C. Hussain F. N. Temel R. E. Parathath S. van Gils J. M. Rayner A. J. Chang A. N. Suarez Y. Antagonism of miR-33 in mice promotes reverse cholesterol transport and regression of atherosclerosis J. Clin. [score:1]
Hence, we believe that miR-33 may contribute significantly to the inducement of fatty liver in geese. [score:1]
The repeated experiment results show that the luciferase activity in the CROT, HADHB and NPC1 genes did not change significantly when the seed sequence points of miRNA-33 were mutated. [score:1]
[1 to 20 of 74 sentences]
5
[+] score: 260
Other miRNAs from this paper: hsa-mir-33a, mmu-mir-33
Interestingly, the expression of ABCA1, a very well-established miR-33 target gene, only increased significantly at the protein level (Fig 2G), suggesting that this gene is likely regulated at the translational level by miR-33. [score:8]
Taken together, these results suggest that the increased expression of SREBP-responsive genes in mice treated with miR-33 ASO is not due to a direct effect of miR-33 on SREBP1 but rather to its inhibitory action on NFYC, which is a SREBP co-activator. [score:6]
Moreover, the expression of HMGCR, the rate-limiting enzyme of cholesterol biosynthesis, and the LDLR were also upregulated when we silenced miR-33 in mice (Fig 2G). [score:6]
Surprisingly, we found that miR-33 fails to repress the 3′UTR activity of both genes, suggesting that miR-33 does not regulate their expression directly (Supplementary Fig S1C and D). [score:5]
Together, these results demonstrate that long-term anti-miR-33 therapy in mice fed a HFD results in a derepression of numerous miR-33 target genes involved in cholesterol export and fatty acid oxidation but causes a significant increase in the expression of genes associated with cholesterol and fatty acid synthesis, thus leading to moderate hepatic steatosis. [score:5]
Mechanistically, we found that miR-33 inhibition raises NFYC expression. [score:5]
As expected, anti-miR-33 therapy significantly increased the mRNA expression of previously identified miR-33 target genes, including receptor-interacting protein 140 (RIP140), CROT, CPT1A, HADHB, nuclear co-activator 3 (SRC3), AMPK, and SRC1 (Fig 2F–J). [score:5]
To investigate whether miR-33 directly regulates genes involved in fatty acid and cholesterol metabolism, we used a combination of bioinformatic approaches (targetscan, pictar, and mirwalk) to identify potential novel targets of miR-33. [score:5]
This finding could explain why sustained derepression of miR-33 in vivo increases hepatic NFYC levels leading to increased expression of SREBP-regulated genes, such as FAS, ACC, HMGCR, and LDLR. [score:4]
To directly assess the effect of miR-33 on these predicted target genes, we cloned the 3′UTR of HMGCR and SREBP1 into luciferase reporter plasmids. [score:4]
demonstrates that long-term anti-miR-33 therapy results in a pronounced upregulation of major urinary proteins that can make up 5% of the total RNA transcripts in the male murine liver. [score:4]
In addition to the effect of miR-33 in controlling cholesterol efflux and HDL-C synthesis, miR-33 also regulates the expression of genes involved in fatty acid oxidation and insulin signaling, including CROT, CPT1A, HADHB, AMPK, and IRS2 (Gerin et al, 2010; Davalos et al, 2011). [score:4]
Note the pronounced upregulation of MUP (white box) in response to miR-33 ASO. [score:4]
These effects appear to be mediated by the upregulation of genes involved in fatty acid synthesis in the liver of mice treated with miR-33 ASOs. [score:4]
Instead, we found that NFYC, a member of the three NF-Y subunits required for DNA binding and full transcriptional activation of SREBP-responsive genes, was upregulated in the livers of mice administered with miR-33 ASO. [score:4]
Interestingly, SRC3- and RIP140 -deficient mice are resistant to obesity and hepatic steatosis, suggesting that the upregulation of these genes observed in anti-miR-33 -treated mice might result in lipid accumulation in the liver (Leonardsson et al, 2004; Coste et al, 2008). [score:4]
However, we could not identify SREBP1 as a direct target of miR-33 using 3′UTR luciferase experiments. [score:4]
A qRT-PCR analysis of hepatic miR-33 expression levels in the livers of mice treated with PBS, control ASO, or miR-33 ASO, and fed a chow diet (CD). [score:3]
demonstrates that prolonged anti-miR-33 therapy results in marked changes in protein expression. [score:3]
Moreover, we also found increased levels of ApoB-100, the main VLDL/LDL -associated lipoprotein, in mice treated with miR-33 inhibitors (Fig 1K). [score:3]
To gain insights into the functional importance of miR-33 in humans, two independent groups assessed the efficacy of inhibiting miR-33 in non-human primates. [score:3]
Because HDL-C levels and increased reverse cholesterol transport (RCT) have shown a strong inverse correlation with atherosclerotic vascular disease, several groups decided to study the efficacy of anti-miR-33 therapy during the progression and regression of atherosclerosis. [score:3]
Recent studies have demonstrated that specific inhibition of a tiny RNA (miR-33) results in increased circulating HDL levels and prevents against the progression of atherosclerosis. [score:3]
Finally, we further explored the impact of long-term miR-33 treatment on hepatic protein expression using a proteomic approach. [score:3]
Even though these results are promising for treating cardiovascular diseases, the safety and physiological effect of prolonged miR-33 silencing remains to be elucidated. [score:3]
We and others have previously shown that short-term treatment with miR-33 inhibitors markedly increases plasma HDL-C levels and enhances the regression of atherosclerosis (Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010, 2011a, b; Horie et al, 2013). [score:3]
Importantly, NFYC, a miR-33 target gene and a co-activator of the SREBP genes, was also increased in the livers of mice treated with miR-33 ASO. [score:3]
Even though all these studies strongly demonstrate that manipulation of miR-33 levels in vivo markedly influences lipid metabolism and atherogenesis, the absence of miR-33b in rodents limits the translational and physiological relevance of these findings. [score:3]
Carlos Fernandez-Hernando has patents on the use of miR-33 inhibitors. [score:3]
Importantly, the expression level of genes involved in fatty acid synthesis, such as NFYC, SREBP1, ACC, and FASN, was also increased in miR-33 ASO -treated mice (Fig 2F). [score:3]
Mechanistically, they found that miR-33 -deficient mice have increased SREBP1 expression and activation, leading to a transcriptional activation of genes involved in fatty acid synthesis. [score:3]
K Representative Western blot of plasma ApoB-100 expression of mice treated with PBS, control ASO, or miR-33 ASO and fed a HFD for 20 weeks. [score:3]
A number of studies have recently identified miR-33 as a potential therapeutic target for treating cardiometabolic disorders including atherosclerosis and metabolic syndrome (Rayner et al, 2011b; Horie et al, 2012, 2013). [score:3]
Further studies are necessary to understand the complex gene regulatory network controlled by miR-33, as well as the role of miR-33 in regulating metabolism in individual tissues such as the liver, adipose tissue, and brain. [score:3]
G qRT-PCR analysis of hepatic miR-33 expression levels of mice treated with PBS, control ASO, or miR-33 ASO, and fed a high-fat diet (HFD). [score:3]
In addition to the established role of miR-33 in controlling plasma HDL levels, inhibition of miR-33 in vitro markedly increases fatty acid oxidation (Davalos et al, 2011), suggesting that anti-miR-33 therapy might be useful to reduce hepatic lipid accumulation and treat patients with NAFLD. [score:3]
Figure 1 A qRT-PCR analysis of hepatic miR-33 expression levels in the livers of mice treated with PBS, control ASO, or miR-33 ASO, and fed a chow diet (CD). [score:3]
However, the fact that the genetic ablation of miR-33 protects against the progression of atherosclerosis in apoE [−/−] mice suggests that long-term anti-miR-33 therapy should be beneficial for treating atherosclerotic vascular disease (Horie et al, 2012). [score:3]
While Moore and Temel's study claimed a marked reduction of plasma VLDL-TGs (Rayner et al, 2011a), Näär and colleagues reported that the inhibition of miR-33 in non-human primates does not influence circulating VLDL-TGs (Rottiers et al, 2013). [score:3]
Importantly, hepatic expression of genes involved in fatty acid synthesis such as FAS, ACC, and SREBP1 was increased in mice treated with miR-33 antisense oligonucleotides. [score:3]
Nevertheless, the adverse effects reported in miR-33 -deficient mice and in this study raise awareness that long-term inhibition of miR-33 might cause adverse effects, such us hypertriglyceridemia and hepatic steatosis. [score:3]
Since increased RCT correlates inversely with the incidence of coronary artery disease, several groups studied the efficacy of anti-miR-33 therapy during the progression and regression of atherosclerosis. [score:3]
We treated mice fed a chow diet and high-fat diet with miR-33 inhibitors (miR-33 ASO). [score:3]
Even though these studies are encouraging, the effect of prolonged miR-33 inhibition has not been studied yet. [score:3]
Therefore, antagonism of miR-33 in vivo could potentially represent a novel therapy for treating major risk factors associated with metabolic syndrome including low HDL-C, hypertriglyceridemia, insulin resistance, and non-alcoholic fatty liver disease. [score:3]
The most remarkable difference between the miR-33 antisense therapy and genetic studies is that the ability to increase plasma HDL-C levels was lost in the two progression studies using anti-miR-33 oligos, while miR-33 [−/−] apoE [−/−] mice still had increased circulating HDL-C. These results suggest that miR-33 ASO delivery may not completely inhibit miR-33 activity in the liver. [score:3]
Taken together, our findings demonstrate that long-term pharmacological inhibition of miR-33 leads to dyslipidemia and moderate hepatic steatosis. [score:3]
To gain insights into the potential mechanism behind the hypertriglyceridemia observed in mice treated with miR-33 ASO, we analyzed the effect of anti-miR-33 therapy on hepatic lipid metabolism and gene expression. [score:3]
Unexpectedly, we found that chronic inhibition of miR-33 results in hypertriglyceridemia and moderate hepatic steatosis. [score:3]
These findings open new questions about how miR-33 regulates lipid and glucose metabolism at the organismal level. [score:2]
This finding was not unexpected given the role of miR-33 in regulating glucose metabolism. [score:2]
In addition to NFYC, we found that SRC1 and RIP140, two transcriptional regulators that control adipogenesis and lipid metabolism, were derepressed in mice treated with miR-33 ASO (Fig 2). [score:2]
Indeed, a bioinformatic analysis of biological processes shows that the proteins altered in the liver of mice administered with miR-33 ASO were significantly enriched (FDR< 0.001) for the regulation of glucose metabolism as well as other metabolic processes (Supplementary Fig S2). [score:2]
Further research is required to better understand the complex gene regulatory network controlled by miR-33. [score:2]
Transcriptional activation of SREBP1 and SREBP2 also increases miR-33a and miR-33b levels, suggesting that miR-33a/b are regulated with their host genes (Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010). [score:2]
Similar to mice fed a chow diet, hepatic miR-33 expression was significantly reduced in mice receiving miR-33 ASO compared to PBS or Cont ASO (Fig 1G). [score:2]
Taken together, these results demonstrate the complex network of genes that miR-33 regulates. [score:2]
Similar to our previous short-term studies, miR-33 ASO -treated mice showed a marked reduction of hepatic miR-33 expression (Fig 1A) and had increased total cholesterol and HDL-C (Fig 1B and C) compared with those receiving PBS or control anti-miR (Cont ASO). [score:2]
Finally, we found that nuclear transcription Y subunit gamma (NFYC), a miR-33 target gene, was markedly increased in mice administered with miR-33 ASO compared to control miRNA -treated mice. [score:2]
LG, AS, AB, MM, and CFH conceived and designed the experiments; LG, AS, CMR, RMA, LG, XY, SL, and AW performed the experiments; LG, AS, CMR, AW, LG, RMA, XY, SL, EAF, YS, AB, MM, and CFH analyzed the data; CE provided control and anti-miR-33 oligonucleotides; LG and CFH wrote the manuscript. [score:1]
Therefore, we assessed the long-term efficacy of anti-miR-33 therapy in controlling lipid metabolism. [score:1]
Figure 3A, B Liver protein extracts from control ASO (green color) and miR33 ASO -treated (red color) mice were quantified using difference gel electrophoresis (DIGE, n = 4 per group) (A). [score:1]
Moreover, they highlight the marked effect that prolonged anti-miR-33 therapy causes in multiple metabolic pathways. [score:1]
Analysis of the plasma lipoprotein distribution showed that miR-33 ASO -treated mice had a significant increase in cholesterol associated with the HDL fraction and TGs in the VLDL fraction (Fig 1L and M). [score:1]
Here, we demonstrate that long-term treatment with miR-33 ASO in mice fed a CD increases plasma HDL-C levels without any adverse effect. [score:1]
We further analyzed the effect of long-term administration of miR-33 ASO in high-fat diet (HFD) fed mice. [score:1]
These studies demonstrated in most cases that antagonism of miR-33 in vivo delays the progression and enhances the regression of atherosclerosis (Rayner et al, 2011b; Marquart et al, 2013; Rotllan et al, 2013). [score:1]
were reproduced by using a dye-swap (B): control ASO (red color), miR-33 ASO (green color). [score:1]
The human genome encodes for two isoforms of miR-33: miR-33a, which is encoded within intron 16 of the SREBP2 gene and miR-33b, which is located within intron 17 of the SREBP1 gene. [score:1]
E, F Circulating triglyceride (TG) levels (E) and body weight (F) of mice injected with PBS, control ASO, or miR-33 ASO, and fed a CD. [score:1]
Interestingly, the hepatic lipid accumulation was only observed in miR-33 ASO -treated mice fed a HFD but not in mice fed a CD (Fig 2A–E). [score:1]
Prolonged miR-33 silencing results in significant alterations in enzymes associated with glucose metabolism. [score:1]
were randomized into three groups (n = 15 mice): no treatment (PBS), 2′F/MOE anti-miR-33 (TGCAATGCAACTACAATGCAC) oligonucleotide, and 2′F/MOE mismatch control (TCCAATCCAACTTCAATCATC) oligonucleotide (the mismatched bases are underlined). [score:1]
Most of the previous studies using miR-33 ASOs were performed over a short period of time and using atheroprone mouse mo dels such as apoE [−/−] and Ldlr [−/−] mice. [score:1]
Of note, antagonism of miR-33 in vivo or genetic ablation of miR-33 results in a significant increase of circulating high-density lipoprotein cholesterol (HDL-C) levels (Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010). [score:1]
D Lipoprotein profile analysis obtained from pooled plasma of mice administered PBS, control ASO, or miR-33 ASO. [score:1]
While Baldan's group found that a 12-week anti-miR-33 therapy failed to sustain increased circulating HDL-C and prevent atherogenesis (Marquart et al, 2013), we reported that miR-33 ASO successfully reduced the progression of atherosclerosis despite the insignificant alteration of HDL-C levels (Rotllan et al, 2013). [score:1]
Interestingly, we found that miR-33 has predicted binding sites in the 3′UTR of SREBP1 and HMGCR (Supplementary Fig S1A). [score:1]
Surprisingly, we found that prolonged silencing of miR-33 results in hepatic lipid accumulation and increased plasma TG levels in mice fed a HFD. [score:1]
Surprisingly, we found that long-term administration of miR-33 ASO results in hypertriglyceridemia and moderate hepatic steatosis. [score:1]
To determine the efficacy of long-term anti-miR-33 therapy in raising plasma HDL-C levels and preventing hepatic steatosis, we administered miR-33 ASO to mice fed a CD (12 weeks) and HFD (20 weeks). [score:1]
However, the efficacy of anti-miR-33 therapy on the progression of atherosclerosis is controversial (Horie et al, 2012; Marquart et al, 2013; Rotllan et al, 2013). [score:1]
Our findings provide the first evidence that long-term anti-miR-33 therapy results in adverse effects, including hypertriglyceridemia and moderate hepatic steatosis. [score:1]
Anti-miR-33 therapy causes a profound alteration in the liver proteome. [score:1]
We found that proteins involved in glucose metabolism were highly altered in mice treated with miR-33 ASO (Supplementary Table S1). [score:1]
These results were similar to those reported here using miR-33 ASO. [score:1]
Thus, in the present study, we tested the efficacy of long-term anti-miR-33 therapy on lipoprotein metabolism and the hepatic lipid profile in C57BL/6 mice fed a chow diet (CD) or high-fat diet (HFD). [score:1]
Nevertheless, miR-33 [−/−] /apoE [−/−] -deficient mice developed smaller atherosclerotic plaques than apoE [−/−] mice (Horie et al, 2012). [score:1]
Mmu-miR-33 quantification and quantitative real-time PCR were performed in triplicate using SYBR Green Master Mix (SA Biosciences) on an iCycler Real-Time Detection System (Eppendorf). [score:1]
K Representative of ABCA1, NPC1, SRC1, RIP140, CROT, and NFYC from liver lysates of mice treated with PBS, control ASO, or miR-33 ASO. [score:1]
Long-term anti-miR-33 therapy results in hypertriglyceridemia in mice fed a HFD. [score:1]
In the single-regression study published, Moore's group demonstrated that 4-week treatment with 2′F/MOE anti-miR-33 oligonucleotides accelerated the regression of atherosclerosis in Ldlr [−/−] mice with established atherosclerotic plaques (Rayner et al, 2011b). [score:1]
Treatment of African green monkeys with anti-miR-33 oligonucleotides significantly increased circulating HDL-C (30–40%) in both studies (Rayner et al, 2011a; Rottiers et al, 2013). [score:1]
Data information: All the data represent the mean ± SEM; (PBS n = 10, control ASO n = 12 and miR-33 ASO n = 12) and * P < 0.05 comparing miR-33 ASO group with PBS and control ASO groups. [score:1]
Furthermore, neutral lipid staining using Oil Red O confirmed the accumulation of lipids in mice treated with miR-33 ASO (Fig 2E). [score:1]
A–D Hepatic content of triglycerides (A), diglycerides (B), free fatty acids (C), and cholesterol esters (D) quantified from liver tissue of mice treated with PBS, control ASO, or miR-33 ASO for 20 weeks and fed a chow diet (CD) or high-fat diet (HFD). [score:1]
Collectively, these results suggest that while prolonged miR-33 ASO treatment in chow-fed mice increases circulating HDL-C without affecting plasma TG levels, long-term anti-miR-33 therapy in HFD-fed mice results in hypertriglyceridemia. [score:1]
Antagonism miR-33 in mice fed a HFD results in moderate hepatic steatosis. [score:1]
N Body weight of mice treated with PBS, control ASO, or miR-33 ASO for 20 weeks and fed HFD. [score:1]
A, B Liver protein extracts from control ASO (green color) and miR33 ASO -treated (red color) mice were quantified using difference gel electrophoresis (DIGE, n = 4 per group) (A). [score:1]
Long-term anti-miR-33 therapy increases plasma triglyceride levels in high-fat diet fed mice. [score:1]
L, M Cholesterol (L) and triglyceride (M) distribution in different lipoprotein fractions isolated from mice treated with PBS, control ASO, or miR-33 ASO, and fed a HFD. [score:1]
Previous short-term studies (4 weeks) showed that mice fed a chow diet (CD) and treated with anti-miR-33 oligonucleotides have increased circulating HDL-C without affecting the cholesterol distribution in other lipoproteins fractions. [score:1]
Data represent the mean ± SEM; (PBS n = 3, control ASO n = 6 and miR-33 ASO n = 6) and * P < 0.05 comparing PBS and miR-33 ASO group with control ASO group. [score:1]
Data represent the mean ± SEM; (PBS n = 3, control ASO n = 6 and miR-33 ASO n = 6) and * P < 0.05 comparing miR-33 ASO group with PBS and control ASO group. [score:1]
H-J Plasma cholesterol (H), HDL-C (I) and triglyceride (J) levels of mice treated with PBS, control ASO, or miR-33 ASO for 4 and 12 weeks and fed a HFD. [score:1]
B, C Plasma cholesterol (B) and HDL-C (C) levels in the livers of mice treated with PBS, control ASO, or miR-33 ASO for 4 and 12 weeks and fed a CD. [score:1]
Of note, numerous genes associated with glucose and lipid metabolism were altered in miR-33 ASO -treated mice. [score:1]
These reports demonstrated that miR-33 silencing in mice results in increased circulating HDL-C and bile secretion, thereby enhancing mobilization of sterols accumulated from the peripheral tissue through the reverse cholesterol transport (RCT) pathway (Rayner et al, 2011b; Allen et al, 2012). [score:1]
Similarly, non-human primates treated with anti-miR-33 oligonucleotides also exhibit increased HDL-C levels (Rayner et al, 2011a; Rottiers et al, 2013). [score:1]
Surprisingly, plasma TG levels were also significantly elevated in mice receiving miR-33 ASO (Fig 1J). [score:1]
To determine whether long-term anti-miR-33 therapy was also efficient in increasing plasma HDL-C, we treated C57BL6 mice with 2′fluoro/methoxyethyl (2′F/MOE) phosphorothioate-backbone -modified anti-miR-33 oligonucleotides (miR-33 ASO). [score:1]
While miR-33b conservation is lost in lower mammals, including rodents, miR-33a is highly conserved from Drosophila to humans. [score:1]
Chronic miR-33 ASO administration results in moderate hepatic steatosis. [score:1]
Similar to our results, Horie and colleagues have recently reported that miR-33 [−/−] mice develop obesity, fatty liver, and hypertriglyceridemia. [score:1]
F–J qRT-PCR analysis of genes involved in fatty acid synthesis (F), cholesterol metabolism (G), fatty acid oxidation and lipolysis (H), glucose metabolism (I) and lipoprotein metabolism (J) in liver tissues from mice treated with PBS, control ASO or miR-33 ASO. [score:1]
Figure 2A–D Hepatic content of triglycerides (A), diglycerides (B), free fatty acids (C), and cholesterol esters (D) quantified from liver tissue of mice treated with PBS, control ASO, or miR-33 ASO for 20 weeks and fed a chow diet (CD) or high-fat diet (HFD). [score:1]
COS7 cells were plated into 12-well plates and co -transfected with 1 μg of the indicated 3′UTR luciferase reporter vectors and miR-33 mimics or control mimics (CM) (Life Technologies) utilizing Lipofectamine 2,000 (Invitrogen). [score:1]
Further studies will be important for elucidating the molecular mechanism and tissue specificity by which miR-33 controls cholesterol, fatty acid, and glucose metabolism. [score:1]
Liver lysates were obtained from mice treated with miR-33 ASO or Cont ASO and fed a HFD for 20 weeks. [score:1]
Together, these data suggest that prolonged anti-miR-33 therapy in mice fed a HFD could be deleterious for treating atherosclerosis and dyslipidemias. [score:1]
E Representative liver sections isolated from mice treated with PBS, control ASO, or miR-33 ASO stained with H&E, picrossirius red, and Oil Red O. Scale bar = 70 μm. [score:1]
[1 to 20 of 122 sentences]
6
[+] score: 253
One previous report indicated that miR-33b directly inhibited c-Myc expression in medulloblastoma cells, suggesting that miR-33b might act as a tumor suppressor through targeting c-Myc in gastric cancer 12. [score:10]
Furthermore, in 10 paired GC samples (only 68C/68N with metastasis) with down-regulated miR-33b, more than half of them showed up-regulated expression of c-Myc. [score:9]
More importantly, re-introduction of miR-33b could obviously inhibit gastric tumorigenesis and suppress tumor growth in vivo, which strengthened our conclusion that miR-33b function as a tumor suppressor in GC. [score:7]
Our data showed DNA methylation of CpG island 1/2 upstream of miR-33b existed in both adjacent normal tissues and cancer tissues, but, the overall methylation degree in down-regulation group was obviously higher than that in up-regulation group (p < 0.05) (Fig. 5A). [score:7]
However, an analysis of c-Myc protein levels in 10 cancer tissues with down-regulated miR-33b indicated that only ~50% samples showed up-regulated c-Myc. [score:7]
Studies have reported that miR-33b acted as a tumor suppressor by directly targeting oncogene c-Myc 12. [score:6]
These results indicated that miR-33b might inhibit tumor migration, invasion and proliferation by directly targeting oncogene c-Myc in GC. [score:6]
To determine whether aberrant hypermethylation is responsible for down-regulation of miR-33b expression in GC patients, we next examined the methylation status in CpG island 1/2/3 upstream of miR-33b. [score:6]
In this work, the expression of miR-33b was analyzed in 150 GC cases from several hospitals and showed down-regulated tendency in more than 55% patients. [score:6]
MSP assay was performed in 42 paired GC samples, including 21 patients with lower miR-33b levels (down-regulation group) and 21 patients with higher miR-33b levels (up-regulation group). [score:6]
Through the expression analysis of miR-33b in MGC-803 and HGC-27 cells treated with AZA and/or TSA, we highly suspected methylation was one of the regulatory mechanisms of miR-33b expression. [score:6]
Overexpression of miR-33b in GC cells inhibits cell proliferation, migration and invasion. [score:5]
These results suggested that miR-33b might act as a tumor suppressor through inhibiting not only cell proliferation but cell metastasis in GC. [score:5]
As expected, the data in miR-33b mimic treated MGC-803 and HGC-27 cells showed strongly inhibitory roles of miR-33b in cell migration, invasion and growth, demonstrating that miR-33b acted as a tumor suppressive gene in vitro. [score:5]
Furthermore, reintroduction of miR-33b suppressed gastric tumorigenicity via targeting c-Myc in vitro and in vivo. [score:5]
To find out the cause of the lower expression of miR-33b in GC, we first examined the expression of miR-33b in 5′-AZA and/or TSA treated GC cells. [score:5]
In summary, our results indicated that deregulation of miR-33b in GC was associated with pM stage and pTNM stage and the expression of miR-33b could be negatively regulated by aberrant DNA methylation. [score:5]
Meanwhile, to investigate whether miR-33b’s host gene-SREBF1 was regulated by DNA methylation, we also examined the level of SREBF1 and found that there was significant up-regulated SREBF1 expression in 5′-AZA treated MGC-803 and HGC-27 cells, suggesting that both miR-33b and its host gene could be silenced together by the hypermethylation of CpG island (Fig. 4C). [score:5]
Given that miR-33b is an important regulator in GC, we planned to analyze the regulatory mechanism of miR-33b expression. [score:5]
In view of these observations, we speculated that ectopic expression of miR-33b might suppress tumor cell proliferation. [score:5]
The results showed that there was a 1.5-fold increase of miR-33b level after treatment of 5′-AZA also both AZA and TSA, a 1.2-fold increase after treatment of TSA in MGC-803 cells, a 3-fold increase after treatment of 5′-AZA, a 2-fold increase after treatment of TSA and a 2.5-fold increase after treatment of both AZA and TSA in HGC-27 cells (Fig. 4B), suggesting that miR-33b expression in GC cells might be regulated by DNA methylation. [score:4]
Therefore, MSP and qMSP analysis were performed to analyze the accurate status of DNA methylation in CpG islands 1/2/3, and indicated that the hypermethylation of CpG island 1/2 might regulate the expression of miR-33b in gastric cancer. [score:4]
miR-33b is methylation -dependently down-regulated in GC cell lines. [score:4]
We are cognizant that miR-33b negatively regulates the expression of c-Myc in GC cells. [score:4]
Down-regulation of miR-33b in gastric cancer cells is associated with hypermethylation of miR-33b upstream region. [score:4]
Furthermore, we found that miR-33b level was significantly down-regulated in patients with metastasis than that without metastasis. [score:4]
To further study the relationship between miR-33b expression and clinicopathological of GC, the levels of miR-33b in GC tissues (including fully clinical information) were statistically analyzed (non-parametric test). [score:3]
Among them, 85 cases showed reduced level of miR-33b in tumor tissues compared with their adjacent normal tissues, whereas 65 cases showed up-regulated miR-33b level in GC (Fig. 1A). [score:3]
The expression analysis of miR-33b in GC tissues and its relationship with clinicopathological factors. [score:3]
In this work, MGC-803 and HGC-27 cells were transfected with miR-33b mimics and immunoblotting was performed to analyze the expression of c-Myc. [score:3]
All of these data suggest that miR-33b might act as a tumor suppressor in GC. [score:3]
Expression of miR-33b in GC and its relationship with clinicopathological. [score:3]
The data suggested that the hypermethylation of the CpG islands upstream of miR-33b might lead to the low expression of miR-33b in GC and further possibly resulted in aberrant cell migration and invasion during gastric carcinogenesis. [score:3]
miR-33b targets c-Myc in GC cells and patients. [score:3]
The expression level of miR-33b in GC tissues was also significantly lower than that in adjacent non-neoplastic tissues. [score:3]
It seemed that the miR-33 level was negatively correlated with expression of c-Myc in GC (Fig. 3C–E). [score:3]
To this aim, we started to search for the mRNA targets of miR-33b in gastric cancer. [score:3]
miR-33b suppresses gastric tumorigenicity in vivo. [score:3]
Taken together, these data indicated that re-introduction of miR-33b significantly inhibited the gastric tumorigenicity in the nude mouse xenograft mo del. [score:3]
The results also showed that the average expression of miR-33b in gastric cancer samples was significantly lower than that in the adjacent non-neoplastic tissues (p < 0.05) (Fig. 1B). [score:3]
Aberrant expression of miR-33b in GC maybe result from long-range control of part of 3 CpG islands or collaboration of them. [score:3]
To assess the expression of miR-33b in GC, q-PCR analysis using TaqMan probes was conducted in 150 pairs of clinic GC tissue and matched adjacent normal tissue samples. [score:3]
Accordingly, the wound healing assay showed that cell migration was inhibited in miR-33b mimic -transfected GC cells compared to the scramble mimic -transfected ones (Fig. 2D), suggesting the inhibitory effects of miR-33b on tumor cell migration. [score:3]
These data indicated that re-introduction of miR-33b obviously inhibited the metastasis of GC cells in vivo. [score:3]
miR-33b inhibits tumorigenicity in nude mice. [score:3]
The data showed that miR-33b mimics injection decreased expression of Ki-67 in the tumor tissues (Fig. 6E). [score:3]
The methylation analysis of miR-33b regulatory regions in GC cases. [score:2]
Then, miR-33b mimics and scrambled control diluted in Lipofectamine 2000 (Invitrogen) solution (100 nmol mimics in 100 μl total volume) were injected directly into the tumors, respectively. [score:2]
Furthermore, we detected the DNA methylation status using MSP and q-MSP in MGC-803 and HGC-27 cells, the assay revealed that CpG island 1 upstream of miR-33b had higher methylation level in MGC-803 and HGC-27 cells, which was consistent with the lower expression of miR-33b in these GC cell lines. [score:2]
The expression level of miR-33b mimics in GC cells was assayed by real-time PCR. [score:2]
To validate whether miR-33b targets c-Myc in GC, immunoblotting assay was carried out in GC cells and showed that c-Myc was about 2-fold lower in MGC-803 cells transfected with miR-33b mimics, however there was no obvious change in HGC-27 cells (Fig. 3B). [score:2]
5 × 10 [6] HGC-27 cells were subcutaneously injected into nude mice and miR-33b mimics (or scramble control) were directly into the tumor every 7 days. [score:2]
Meanwhile, we estimate the effect of miR-33b in regulating metastatic ability of gastric cancer cells in vivo. [score:2]
Meanwhile, we investigated the possibly regulatory mechanism of miR-33b expression in gastric cancer. [score:2]
To detect whether miR-33b possesses the ability to inhibit cell invasion, transwell invasion assay was performed. [score:2]
About 5 × 10 [6] HGC-27 cells were injected subcutaneously in posterior flanks of immunocompromised nude mice and then miR-33b mimics (or scramble control) were directly injected into the tumors. [score:2]
Moreover, the median level of miR-33b in stage IV cases was significantly lower than that in stage II and III cases (Fig. 1C). [score:1]
Interestingly, we found that the lower level of miR-33b was associated with pM stage (p = 0.038, metastasis vs non metastasis) and pTNM stage (p = 0.006, stage I vs IV; p = 0.002, stage II vs IV; p = 0.038, stage III vs IV) in GC patients. [score:1]
We next investigated the mechanism that miR-33b acted as a tumor suppressor in GC. [score:1]
GC patients with metastasis also had a lower level of miR-33b than those without metastasis (Fig. 1D). [score:1]
In addition, there was no significant difference between the expression level of miR-33b and other clinicopathologic characteristics, including gender, age, venous invasion, position, borrmann typing, pT stage, pN stage in GC (Supplementary Table S2). [score:1]
Since the miR-33b level in 4 GC cell lines is significantly lower than that in normal gastric tissues, we chose the higher malignant cell lines to study the roles of miR-33b. [score:1]
Analysis of the effect of miR-33b in nude mice. [score:1]
Since hypermethylation is a general event in carcinogenesis, we initially analyzed the genome locus of miR-33b gene and identified three CpG islands upstream of it (Fig. 4A). [score:1]
How to cite this article: Yin, H. et al. DNA Methylation mediated down -regulating of MicroRNA-33b and its role in gastric cancer. [score:1]
HGC-27 and MGC-803 cells were grown in normal culture medium containing 50 nmol/L miR-33b or scramble control for indicated time points. [score:1]
Moreover, when we analyzed the correlation between miR-33b levels and clinicopathological information of GC patients, we found that miR-33b gradually decreased in stage II/III/IV of GC patients. [score:1]
Biological role of miR-33b in GC cells promoted us to study its mechanism in gastric carcinogenesis. [score:1]
These data suggested that miR-33b might be not necessarily linked with the occurrence of GC, while it is possibly correlated with tumor progression and metastasis. [score:1]
Our clinicopathological analysis promoted us to analyze the biological function of miR-33b in GC cells. [score:1]
Here, we found three CpG islands upstream of miR-33b gene. [score:1]
In agreement with the tumor growth curve, the volumes and weights of tumors treated by miR-33b mimics were significantly lower than scramble control -injected tumors. [score:1]
Finally, we investigated whether miR-33b could suppress gastric tumorigenicity in vivo. [score:1]
Transfection was carried out using Lipofectamine 2000 (Invitrogen) with miR-33b mimics (50 nmol/L) or scramble (50 nmol/L) accordance with the manufacturer’s procedure (Invitrogen). [score:1]
There is a 1.5-fold increase of miR-33b level after treatment of 5′-AZA (1 μM) also both AZA and TSA, a 1.2-fold increase after treatment of TSA (300 nM) in MGC-803 cells, a 3-fold increase after treatment of 5′-AZA (1 μM), a 2-fold increase after treatment of TSA (300 nM) and 2.5-fold increase after treatment of both AZA and TSA in HGC-27 cells. [score:1]
Sequence analysis upstream of miR-33b gene was performed in the human genome database and three CpG Islands around miR-33b are found. [score:1]
As expected, there was significant reduction in cell invasiveness after miR-33b transfection in both MGC-803 and HGC-27 cell lines (Fig. 2E). [score:1]
Of them, the higher malignant cell lines MGC-803 and HGC-27 cells were selected to analyze the role of miR-33b. [score:1]
Methylation analysis of miR-33b CpG islands in GC cases. [score:1]
For Western blots and other functional analysis, Cells (≈70% confluent) were transfected with miR-33b mimics or scramble using Lipofectamine 2000. [score:1]
After alignment, we truly found the binding site of miR-33b in the 3′UTR of c-Myc mRNA (Fig. 3A). [score:1]
After 5 weeks, the tumors were harvested and it was noteworthy that tumors formed in the miR-33b group were much smaller than those from the scramble group (Fig. 6A,B). [score:1]
We analyzed the methylation status of three CpG islands upstream of miR-33b in a group of primary GC samples and adjacent normal tissue, respectively. [score:1]
Methylation index analysis of miR-33b CpG island 1 in GC cases. [score:1]
[1 to 20 of 84 sentences]
7
[+] score: 212
MiR-33 Target Genes Were Altered in the Livers of MiR-33 [−/−] Mice on an Apoe [−/−]It has already been shown that miR-33 targets several genes that affect cholesterol and fatty acid synthesis. [score:5]
Previously, we and others have shown that miR-33 targeted the 3′ untranslated region (UTR) of Abca1 and Abcg1. [score:5]
However, some of the previously validated targets of miR-33, such as RIP140 and CROT, were upregulated in miR-33 [−/−] Apoe [−/−] mice compared with miR-33 [+/+] Apoe [−/−] mice, whereas CPT1a and AMPKα were not. [score:5]
[37] Therefore, the enhanced expression of RIP140 under miR-33 deficiency may have affected the expression of IL-6. It is also possible that elevation of M2 markers may indicate the healing process of atherosclerosis in miR-33 [−/−] Apoe [−/−] mice and that the phenotypic changes in macrophages may involve feedback mechanisms. [score:5]
A previous article indicated that the inhibition of miR-33 by antisense oligonucleotide enhanced M2 marker expression in macrophages. [score:5]
ABCA1, ABCG1, and RIP140 were also upregulated in miR-33 [−/−] Apoe [−/−] macrophages. [score:4]
16– 18, 22 mRNA expression of ABCA1 and protein expression of ABCA1 and ABCG1 were significantly increased in PEMs from miR-33 [−/−] Apoe [−/−] mice compared with PEMs from miR-33 [+/+] Apoe [−/−] mice (Figure 5A and 5B). [score:4]
Mice transplanted with miR-33 [−/−] Apoe [−/−] bone marrow showed a significant reduction in lipid content in atherosclerotic plaque compared with mice transplanted with miR-33 [+/+] Apoe [−/−] bone marrow, without an elevation of HDL-C. Some of the validated targets of miR-33 such as RIP140 (NRIP1) and CROT were upregulated in miR-33 [−/−] Apoe [−/−] mice compared with miR-33 [+/+] Apoe [−/−] mice, whereas CPT1a and AMPKα were not. [score:4]
Many genes are altered in miR-33 -deficient mice, and detailed experiments are required to establish miR-33 targeting therapy in humans. [score:3]
16– 18 Moreover, antisense inhibition of miR-33 resulted in a regression of the atherosclerotic plaque volume in LDL-receptor -deficient mice. [score:3]
Further detailed experiments will be needed to determine whether targeting miR-33 could be a suitable approach for such treatment. [score:3]
Thus, the suppression of miR-33 in macrophages may also be beneficial for the prevention of plaque rupture. [score:3]
[38] RIP140 has been shown to be one of the targets of miR-33. [score:3]
It has already been shown that miR-33 targets several genes that affect cholesterol and fatty acid synthesis. [score:3]
These results indicated that miR-33 expression in macrophages did not contribute to serum HDL-C levels, which is consistent with the results that the liver and intestine are the major sources of HDL-C. 39, 40 Table 2. Serum Lipid Profiling of MiR-33 [+/+] Apoe [−/−] Mice Transplanted With MiR-33 [+/+] Apoe [−/−] and MiR-33 [−/−] Apoe [−/−] BM by Standard Method TC, mg/dL HDL-C, mg/dL LDL-C, mg/dL TG, mg/dLmiR-33 [+/+] Apoe [−/−] BM recipient (n=6) 833.5±70.4 12.0±1.4 195.0±15.2 56.3±8.3miR-33 [−/−] Apoe [−/−] BM recipient (n=8) 984.9±54.7 12.1±1.3 209.9±9.0 43.9±6.6 P NS NS NS NS Values are mean±SE. [score:3]
These results indicated that miR-33 expression in macrophages did not contribute to serum HDL-C levels, which is consistent with the results that the liver and intestine are the major sources of HDL-C. 39, 40 Table 2. Serum Lipid Profiling of MiR-33 [+/+] Apoe [−/−] Mice Transplanted With MiR-33 [+/+] Apoe [−/−] and MiR-33 [−/−] Apoe [−/−] BM by Standard Method TC, mg/dL HDL-C, mg/dL LDL-C, mg/dL TG, mg/dLmiR-33 [+/+] Apoe [−/−] BM recipient (n=6) 833.5±70.4 12.0±1.4 195.0±15.2 56.3±8.3miR-33 [−/−] Apoe [−/−] BM recipient (n=8) 984.9±54.7 12.1±1.3 209.9±9.0 43.9±6.6 P NS NS NS NS Values are mean±SE. [score:3]
Previously, we and others showed that miR-33 targets ABCA1 in macrophages and the liver. [score:3]
These results indicate that miR-33 deficiency improved macrophage cholesterol efflux by increasing the expressions of macrophage ABCA1 and ABCG1. [score:3]
Thioglycollate-elicited peritoneal macrophages from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice were cultured in the presence or absence of acLDL plus ACAT inhibitor for 24 hours. [score:3]
[19] miR-33 deficiency also reduced the expression of VCAM-1, which may have influenced atherosclerotic plaque formation. [score:3]
In this study, we showed that ABCA1 and CROT in the livers of miR-33 [−/−] Apoe [−/−] mice were upregulated compared with those in miR-33 [+/+] Apoe [−/−] mice, whereas CPT1a and AMPKα were not. [score:3]
Figure 7. miR-33 deficiency reduced the iNOS -positive areas in atherosclerotic plaque and induced coordinated M1 and M2 marker expression in PEMs. [score:3]
These data suggest that it may be possible to inhibit miR-33a and miR-33b pharmacologically to raise HDL-C for the treatment of dyslipidemia and atherosclerosis. [score:3]
Moreover, the real targets of miR-33 in vivo can only be clarified by the genetic deletion of miR-33, and the results obtained by antisense oligonucleotide -based medicine may be different from those obtained in miR-33 -deficient mice. [score:3]
MiR-33 Target Genes Were Altered in the Livers of MiR-33 [−/−] Mice on an Apoe [−/−] Background. [score:2]
To obtain miR-33 and apoE double -knockout mice (miR-33 [−/−] Apoe [−/−]), miR-33 [−/−] mice were mated with Apoe [−/−] mice, which were backcrossed to C57BL/6 mice for 10 generations. [score:2]
Together, these data demonstrate that miR-33 deficiency serves to raise HDL-C, improve cholesterol efflux in macrophages, and prevent the progression of atherosclerosis and suggest that miR-33 should be considered as a potential target to prevent the progression of atherosclerosis. [score:2]
To elucidate the contribution of miR-33 in macrophages to the development of atherosclerosis in vivo, we used bone marrow transplantation (BMT) to generate Apoe [−/−] mice selectively deficient in leukocyte miR-33. [score:2]
20– 22 Because both knockout mice had a BL/6 background, miR-33 [−/−] Apoe [−/−] mice also had a BL/6 background. [score:2]
Treatment of PEMs in culture with acLDL plus ACAT inhibitor (free cholesterol loading) demonstrated that PEMs from miR-33 [−/−] Apoe [−/−] mice were significantly resistant to apoptosis compared with those from miR-33 [+/+] Apoe [−/−] mice. [score:2]
[38] Figure 9. Expression of ABCA1 and CROT in livers and RIP140 in macrophages is elevated in miR-33 [−/−] Apoe [−/−] mice compared with miR-33 [+/+] Apoe [−/−] mice. [score:2]
[38] Figure 9. Expression of ABCA1 and CROT in livers and RIP140 in macrophages is elevated in miR-33 [−/−] Apoe [−/−] mice compared with miR-33 [+/+] Apoe [−/−] mice. [score:2]
Recent reports, including ours, have indicated that miR-33 controls cholesterol homeostasis based on knockdown experiments using antisense technology. [score:2]
20, 21 Because both lines have a BL/6 background, miR-33 [−/−] Apoe [−/−] double -knockout mice also had a BL/6 background. [score:2]
Because mice transplanted with miR-33 [−/−] Apoe [−/−] BM showed reduced lipid accumulation in atherosclerotic plaque compared with mice transplanted with miR-33 [+/+] Apoe [−/−] BM, we analyzed free cholesterol (FC)–induced apoptosis in PEMs by treating macrophages with acLDL and acyl-CoA:cholesterol acyl-transferase (ACAT) inhibitor. [score:2]
Our results indicate that miR-33 deficiency raises both HDL-C and macrophage cholesterol efflux and strongly suggest that miR-33 should be considered as a potential target for the prevention of atherosclerosis. [score:2]
The serum lipid profile of recipient mice is shown in Table 2. Serum HDL-C levels of miR-33 [+/+] Apoe [−/−] BM recipients were the same as those in miR-33 [−/−] Apoe [−/−] BM recipients, which were similar to the levels in miR-33 [+/+] Apoe [−/−] mice in Figure 4A. [score:1]
Moreover, the effect of miR-33 deletion in macrophages is not as simple as the shift from the M1 to M2 phenotype reported previously. [score:1]
E, Proportion of the Ly-6C [low] monocyte subset to total monocytes in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
G, Quantitative real-time PCR analysis of proinflammatory (M1) and anti-inflammatory (M2) markers in residual PEMs from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
G, Western analysis of NRIP1 (RIP140) in peritoneal macrophages from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
As shown in Figure 8A and 8B, the VCAM-1 -positive area in atherosclerotic plaque in miR-33 [−/−] Apoe [−/−] was significantly less than that in miR-33 [+/+] Apoe [−/−] mice (P=0.0008). [score:1]
Atherosclerotic lesions were significantly reduced in miR-33 [−/−] Apoe [−/−] mice of both sexes (male: P=0.0314, 0.44±0.025 versus 0.36±0.021 mm [2]; female: P=0.0372, 0.66±0.042 versus 0.54 ± 0.036 mm [2]; Figure 10D and 10E). [score:1]
Values from miR-33 [+/+] Apoe [−/−] were set at 100%. [score:1]
D, Serum apoA-I levels in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice; * P<0.05. [score:1]
As shown in Figure 7A and 7B, the iNOS -positive area in atherosclerotic plaque in miR-33 [−/−] Apoe [−/−] mice was significantly less than that in miR-33 [+/+] Apoe [−/−] mice (P=0.0057). [score:1]
However, there was no difference in total cholesterol, free cholesterol, cholesterol ester, or triglyceride levels in the livers of miR-33 [+/+] Apoe [−/−] mice and miR-33 [−/−] Apoe [−/−] mice (Figure 9D). [score:1]
Figure 8. miR-33 deficiency reduced the VCAM-1 -positive area in atherosclerotic plaque. [score:1]
In the present study, we crossed miR-33 -deficient mice (miR-33 [−/−]) with apoE -deficient mice (Apoe [−/−]) to examine the impact of miR-33 deletion on the progression of atherosclerosis and demonstrated that genetic loss of miR-33 raises circulating HDL-C and decreases atherosclerotic plaque size. [score:1]
These results indicated that deficiency of miR-33 elevated serum cholesterol efflux capacity, possibly through the elevation of HDL-C levels. [score:1]
The results of the present BMT experiment revealed that deletion of macrophage miR-33 significantly reduced the lipid content in atherosclerotic plaque. [score:1]
D, Representative microscopic images of cross-sections of proximal aorta in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] male and female mice. [score:1]
Moreover, we assessed the in vivo function of miR-33 deficiency in leukocytes by BMT from miR-33 [+/+] Apoe [−/−] or miR-33 [−/−] Apoe [−/−] mice into miR-33 [+/+] Apoe [−/−] or miR-33 [−/−] Apoe [−/−] mice. [score:1]
The miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice were fed a WTD containing 0.15% cholesterol beginning at age 6 weeks, and atherosclerotic lesions were analyzed at age 22 weeks (Figure 1A). [score:1]
Figure 2. miR-33 deficiency reduced lipid accumulation and macrophage content in atherosclerotic plaque. [score:1]
B, Western analysis of ABCA1, CROT, CPT1a, and AMPKα in livers from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
H, Densitometry of NRIP1 (RIP140) in peritoneal macrophages from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
The total leukocyte count in miR-33 [−/−] Apoe [−/−] mice was significantly less than that in miR-33 [+/+] Apoe [−/−] mice (Figure 6A). [score:1]
Moreover, we measured the level of RIP140 (NRIP1), which has been shown to be one of the targets of miR-33 in macrophages of these mice. [score:1]
We reported previously that miR-33 [−/−] in C57/BL6 mice increases HDL-C by up to 40%. [score:1]
Generation of MiR-33 and ApoE Double-Knockout Mice. [score:1]
We also observed the effect of loss of miR-33 in BMT experiments in miR-33 [−/−] Apoe [−/−] recipients. [score:1]
BM recipients were female miR-33 [+/+] Apoe [−/−] mice (8 weeks old). [score:1]
Figure 11. miR-33 deficiency ameliorated free-cholesterol loading -induced macrophage apoptosis. [score:1]
C, Densitometry of ABCA1, CROT, CPT1a, and AMPKα in livers from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Lipid accumulation area in atherosclerotic lesions was reduced in miR-33 [−/−] Apoe [−/−] mice transplanted with miR-33 [−/−] Apoe [−/−] BM. [score:1]
A, Representative microscopic images of the lipid accumulation area in cross-sections of proximal aorta in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] male mice. [score:1]
Peripheral blood was collected from the orbital sinuses of 12-week-old miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice that were given an NC diet using heparin-coated capillary tubes. [score:1]
B, Representative images of the en face analysis of the total aorta in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] male mice. [score:1]
B, Representative HPLC analysis of serum cholesterol from male miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Atherosclerotic plaque formation in miR-33 [−/−] Apoe [−/−]mice transplanted with miR-33 [−/−] Apoe [−/−] BM was comparable with that in miR-33 [−/−] Apoe [−/−]mice transplanted with miR-33 [+/+] Apoe [−/−] BM (0.46±0.023 versus 0.42±0.020 mm [2]; Figure 12B and 12C). [score:1]
Figure 5. miR-33 deficiency improved cholesterol efflux in macrophages. [score:1]
[47] This result was obtained from the administration of antisense miR-33 for a certain period. [score:1]
[45] However, we also detected a higher frequency of Ly6C [high] monocytes in miR-33 [−/−] Apoe [−/−] mice than in miR-33 [+/+] Apoe [−/−] mice, and this could enhance inflammation in atherosclerotic plaque. [score:1]
To clarify the role of miR-33 in the progression of atherosclerosis, miR-33 [−/−] mice [22] were mated with Apoe [−/-] mice. [score:1]
C, Representative HPLC analysis of serum cholesterol from female miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Figure 3. miR-33 deficiency reduced CD3 -positive cell accumulation and apoptosis in atherosclerotic plaque. [score:1]
Lipid accumulation area in atherosclerotic lesions was reduced in miR-33 [+/+] Apoe [−/−] mice transplanted with miR-33 [−/−] Apoe [−/−] BM. [score:1]
The ICAM-1 -positive area in miR-33 [−/−] Apoe [−/−] mice tended to be less than that in miR-33 [+/+] Apoe [−/−] mice (P=0.127), shown in Figure 8C and 8D. [score:1]
To further elucidate the effect of miR-33 deletion on the monocyte/macrophage phenotype, we performed a flow-cytometric analysis of circulating monocytes and a quantitative PCR analysis of RNA from PEMs of miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
A, Leukocyte count in peripheral blood in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
A, Experimental protocol for bone marrow transplantation from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice to miR-33 [−/−] Apoe [−/−] mice. [score:1]
We found that the loss of miR-33 significantly increased the capacity to promote cholesterol efflux, and this may have contributed to the reduction in atherosclerotic plaque volume. [score:1]
These results showed that loss of miR-33 in blood cells reduced the lipid content of atherosclerotic plaque. [score:1]
We also characterized miR-33 [−/−] Apoe [−/−] macrophages by analyzing the expression of classically activated or proinflammatory (M1) and alternatively activated or anti-inflammatory (M2) macrophage markers using mouse PEMs. [score:1]
The αSMA -positive area was also significantly reduced in miR-33 [−/−] Apoe [−/−] mice (P=0.025 Figure 3C and 3D). [score:1]
[44] Because leukocytosis enhances the progression of atherosclerosis, the reduction in leukocytes observed in miR-33 [−/−] Apoe [−/−] mice may have had a beneficial effects on atherosclerosis. [score:1]
E, HE staining of livers of miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice at age 20 weeks fed NC. [score:1]
D, Proportion of the Ly-6C [high] monocyte subset to total monocytes in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
C, Scheme for gating of monocytes using an anti-CD115 antibody, and representative dot plots showing the quantification of Ly-6C [high] and Ly-6C [low] monocyte subsets in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Male mice with genotypes of miR-33 [+/+] Apoe [−/−] and miR33 [−/−] Apoe [−/−] (8 weeks old) were used as bone marrow (BM) donors. [score:1]
We then examined whether miR-33 deficiency influenced the monocyte count or subset frequency in peripheral blood. [score:1]
Free Cholesterol–Induced Apoptosis Was Reduced in PEMs From MiR-33 [−/−] Apoe [−/−] Mice Compared With MiR-33 [+/+] Apoe [−/−] MiceBecause mice transplanted with miR-33 [−/−] Apoe [−/−] BM showed reduced lipid accumulation in atherosclerotic plaque compared with mice transplanted with miR-33 [+/+] Apoe [−/−] BM, we analyzed free cholesterol (FC)–induced apoptosis in PEMs by treating macrophages with acLDL and acyl-CoA:cholesterol acyl-transferase (ACAT) inhibitor. [score:1]
Representative results of the HPLC elution profile of serum of both sexes are shown in Figure 4B and 4C, and lipid profiles are summarized in Table 1. These results show that only the HDL-C level differed between the serum of miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
A, Experimental protocol for bone marrow transplantation from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice to miR-33 [+/+] Apoe [−/−] mice. [score:1]
Previous experiments indicated that loss of miR-33 in blood cells reduced lipid accumulation in atherosclerotic plaque. [score:1]
A, Quantitative real-time PCR analysis of Abca1 and Abcg1 in macrophages from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Values from miR-33 [+/+] Apoe [−/−] mice were set at 100%. [score:1]
D, Total cholesterol, free cholesterol, cholesterol ester, and triglyceride levels in livers of miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
These results indicated that a deficiency of miR-33 decreased atherosclerotic plaque size and lipid content and reduced the accumulation of macrophages and T cells in atherosclerotic plaques. [score:1]
F, Representative microscopic images of immunohistochemical staining for the macrophage marker CD68 in mice transplanted with miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] BM. [score:1]
B, Numbers of monocyte in peripheral blood in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
In any case, the effect of miR-33 deletion in macrophages is not as simple as a shift from the M1 to the M2 phenotype, as described in a previous report. [score:1]
The miR-33 [−/−] Apoe [−/−] mice were born at the expected Men delian ratio, and miR-33 [+/+] Apoe [−/−] littermates were used as controls. [score:1]
Furthermore, loss of leukocyte miR-33 significantly reduced the lipid content in atherosclerotic plaque. [score:1]
Our findings thus far indicate that miR-33 deficiency reduced the accumulation of inflammatory cells in atherosclerotic plaque. [score:1]
)miR-33 [+/+] Apoe [−/−]miR-33 [−/−] Apoe [−/−]miR-33 [+/+] Apoe [−/−]miR-33 [−/−] Apoe [−/−] TC, mg/dL 705.3±72.1 768.4±45.2 598.9±88.8 574.2±70.0 CM (1 to 2), >80 nm 129.2±21.6 157.9±19.8 124.6±20.9 138.6±28.11 VLDL (3 to 7), 30 to 80 nm 419.5±44.1 450.9±30.0 353.6±51.7 322.1±36.4 Large VLDL (3 to 5) 279.3±32.2 316.4±24.9 245.1±35.1 230.2±29. [score:1]
We assessed the impact of the genetic loss of miR-33 in a mouse mo del of atherosclerosis. [score:1]
Male mice with miR-33 [+/+] Apoe [−/−] or miR33 [−/−] Apoe [−/−] genotypes (8 weeks old) were used as bone marrow (BM) donors. [score:1]
Therefore, it was impossible to observe an effect of HDL-C elevation caused by the loss of miR-33 on atherosclerosis in recipients that had the same type of blood cells (Figures 10 and 12). [score:1]
Figure 4. miR-33 deficiency increased HDL-C. A, Serum HDL-C levels determined by standard methods in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] male and female mice. [score:1]
We first determined that the total leukocyte count in miR-33 [−/−] Apoe [−/−] mice was less than that in miR-33 [+/+] Apoe [−/−]mice. [score:1]
D, Representative microscopic images of the lipid accumulation area in atherosclerotic lesions in mice transplanted with miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] BM. [score:1]
B, Representative microscopic images of cross-sections of proximal aorta in mice transplanted with miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] BM. [score:1]
BM recipients were female miR-33 [+/+] Apoe [−/−] mice and miR-33 [−/−] Apoe [−/−] mice (8 weeks old). [score:1]
Our results showed that loss of miR-33 in blood cells reduced the lipid content of atherosclerotic plaque, which may be because of improved cholesterol efflux from macrophages. [score:1]
Experimental conditions such as radiation to the liver and intestine may have reduced the effect of miR-33 deficiency on the increase in HDL-C levels in recipient mice after BMT. [score:1]
B, Western blotting analysis of ABCA1 and ABCG1 in thioglycollate-elicited peritoneal macrophages from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Next, to determine the contribution of miR-33 deficiency to atherosclerosis in BM recipients, we transferred BM of miR-33 [+/+] Apoe [−/−] or miR-33 [−/−] Apoe [−/−] mice to miR-33 [−/−] Apoe [−/−] mice in the same way as in the previous BMT experiments (Figure 12A). [score:1]
The mean values of serum HDL-C used in this experiment were 17.8±1.4 versus 19.5±1.8 mg/dL in males and 10.2±0.5 versus 17.3±1.7 mg/dL in females (miR-33 [+/+] Apoe [−/−] versus miR-33 [−/−] Apoe [−/−] mice, n=6 for each group). [score:1]
MiR-33 was barely detectable in BM cells from miR-33 [−/−] Apoe [−/−] BM recipients by quantitative PCR analysis for miR-33 (data not shown). [score:1]
A, Quantitative real-time PCR analysis of Abca1, Crot, Cpt1a, and Prkaa1in livers from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
We previously reported that miR-33 [−/−] mice showed 22% to 39% higher serum HDL-C levels than wild-type mice. [score:1]
MiR-33 [−/−] Apoe [−/−] Mice Transplanted With MiR-33 [−/−] Apoe [−/−] BM Had Reduced Lipid Accumulation in Atherosclerotic PlaqueWe also observed the effect of loss of miR-33 in BMT experiments in miR-33 [−/−] Apoe [−/−] recipients. [score:1]
E, Cholesterol efflux via apoB -depleted serum from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice using [3]H-cholesterol-labeled J774 mouse macrophages. [score:1]
[37] Protein level of RIP140 in miR-33 [−/−] Apoe [−/−] macrophages was significantly increased compared with that in miR-33 [+/+] Apoe [−/−] macrophages (Figure 9F through 9H), which may be one of the reasons why the expression of inflammatory cytokine such as IL-6 in PEMs of miR-33 [−/−] Apoe [−/−] mice was increased compared with that in miR-33 [+/+] Apoe [−/−] mice. [score:1]
F, Quantitative real-time PCR analysis of Nrip1 (RIP140) in peritoneal macrophages from miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
[36] The frequency of proinflammatory Ly6C [high] monocytes in miR-33 [−/−] Apoe [−/−] mice was significantly higher than that in miR-33 [+/+] Apoe [−/−] mice (Figure 6B through 6E). [score:1]
MiR-33 and apoE double -knockout mice (miR-33 [−/−] Apoe [−/−]) showed an increase in circulating HDL-C levels with enhanced cholesterol efflux capacity compared with miR-33 [+/+] Apoe [−/−] mice. [score:1]
To elucidate the roles of miR-33 in blood cells, bone marrow transplantation was performed in these mice. [score:1]
Consistent with these results, miR-33 [−/−] Apoe [−/−] mice showed reductions in plaque size and lipid content. [score:1]
We also tried to determine the contribution of the loss of miR-33 in recipient mice to atherosclerosis. [score:1]
A, Experimental protocol for the analysis of atherosclerosis in miR-33 [+/+] Apoe [−/−] and miR-33 [−/−] Apoe [−/−] mice. [score:1]
Figure 1. miR-33 deficiency reduced atherosclerosis. [score:1]
Overall, these results demonstrate that a loss of miR-33 may have affected multiple pathways in both pro- and anti-inflammatory processes. [score:1]
Although a previous study demonstrated that the short-term administration of anti-miR-33 oligonucleotides raised HDL-C levels and promoted the regression of atherosclerosis, this current study indicates that miR-33 deficiency contributes to the reduction of plaque size in the progression of advanced atherosclerosis. [score:1]
ApoB -depleted serum from miR-33 [−/−] Apoe [−/−] mice significantly promoted cholesterol efflux in J774 macrophages (Figure 4E). [score:1]
In accordance with this in vitro experiment, apoptotic cells in the lesion area were also reduced in miR-33 [−/−] Apoe [−/−] mice. [score:1]
These data demonstrate that miR-33 deficiency serves to raise HDL-C, increase cholesterol efflux from macrophages via ABCA1 and ABCG1, and prevent the progression of atherosclerosis. [score:1]
[1 to 20 of 139 sentences]
8
[+] score: 181
Other miRNAs from this paper: hsa-mir-33a, mmu-mir-33
miR-33b is upregulated after inducing Srebf1 expressionWe next sought to confirm whether miR-33b expression was affected by endogenous changes in Srebf1 expression by the LXR agonist T0901317 13. [score:10]
Because Srebf1 level is higher in the liver than that in macrophages 22, it is possible that miR-33b and miR-33a compete for the same target gene binding sites in the liver, and that the degradation of miR-33a is inhibited by miR-33b expression. [score:7]
Second, miR-33b differs from miR-33a by 2-nucleotides and may have a different target profile, including stronger effects on targets in the SREBP-1 -dependent regulation of fatty acid/TG homeostasis and insulin signaling. [score:6]
miR-33b is upregulated after inducing Srebf1 expression. [score:6]
However, it is known that one miR can have hundreds of target genes and unexpected side effects may occur due to long-term therapeutic modulation of miR-33 to cure metabolic diseases. [score:5]
miR-33b is co-expressed with SREBF1 in the human cell line HepG2It is assumed that a miR located within an intron of a gene is expressed along with its host gene and exerts its specific function 12. [score:5]
As shown in Fig. 1a and b, miR-33b expression seemed to tag along behind SREBF1 expression. [score:5]
We next sought to confirm whether miR-33b expression was affected by endogenous changes in Srebf1 expression by the LXR agonist T0901317 13. [score:5]
We found increased miR-33b expression after treatment with LXR agonist in our mice, which indicated that miR-33b was co-expressed with its Srebf1 host gene and enabled us to study the impact of Srebf1-derived miR-33b on cholesterol/lipid homeostasis. [score:5]
Because miR-33b is located in a SREBF1 intron in humans (Supplementary Fig. S1a), we stimulated human cell line HepG2 with the LXR agonist T0901317 and determined miR-33b and miR-33a expression along with the expression of the host genes SREBF1 and SREBF2. [score:5]
miR-33b may be utilized for a feedback mechanism to regulate its host gene SREBF1 because insulin induces hepatic SREBP-1c expression and promotes lipogenesis and hepatic TG synthesis (Supplementary Fig. S6). [score:4]
More recently, Rottiers et al. reported that miR-33a and miR-33b acted in a redundant manner and that inhibiting both isoforms by an 8-mer LNA -modified anti-miR enhanced HDL-C levels 24. [score:3]
The LXR agonist T0901317, which is a well-established Srebf1 expression inducer, enhanced miR-33b production. [score:3]
Moreover, our mice will aid in analyzing the roles of miR-33a/b in different genetic disease mo dels and in screening drug candidates that can modulate miR-33a and miR-33b levels and activities. [score:3]
Relative miR-33b expression levels in primary hepatocytes from miR-33b KI [+/+] mice treated with T0901317 (10 μM) for the indicated time. [score:3]
In contrast, we found a significant inhibitory effect of miR-33b on SREBP-1. A feedback system of SREBP-2 by cholesterol levels is well known, which maintains appropriate levels of cellular cholesterol. [score:3]
Careful observations of miR-33b KI and miR-33a -deficient mice and intercrossing of these mice will enable us to detect miR-33a- and miR-33b-specific target genes and to elucidate the overall functions of miR-33a and miR-33b in vivo. [score:3]
The expression levels of miR-33b in miR-33b KI [+/−] mice were almost half of those in miR-33b KI [+/+] mice (Fig. 2f). [score:3]
Srebf1 and miR-33b expression levels in the liver were also significantly increased in parallel (Fig. 3c and d). [score:3]
Relative tissue expression pattern of miR-33b was similar to that of Srebf1 (Supplementary Fig. S2e and S2f). [score:3]
Thus, it may be necessary to assess those conditions when Srebf1 expression is strongly affected to establish the importance of the functions of miR-33b. [score:3]
miR-33b is co-expressed with SREBF1 in the human cell line HepG2. [score:3]
Our data demonstrated that miR-33b indeed functions to control HDL-C levels, which highlights the importance of targeting both miR-33 family members simultaneously. [score:3]
Relative miR-33b expression levels in the livers of 8-week-old male miR-33b KI [+/+] mice treated with T0901317 (25 mg/kg) for 3 days. [score:3]
We assume that inhibiting both miR-33a and miR-33b will have a significant effect on HDL-C levels in clinical settings. [score:3]
Relative Srebf1 expression levels in the livers of 8-week-old male miR-33b KI [+/+] mice treated with T0901317 (25 mg/kg) for 3 days. [score:3]
miR-33b is co-expressed with SREBF1 in HepG2 cells. [score:3]
Rayner et al. recently showed that inhibiting miR-33a and miR-33b in healthy male non-human primates increased circulating HDL-C levels 21. [score:3]
These results indicate that miR-33b was co-expressed with Srebf1 in the livers of the T0901317 -treated miR-33b KI mice. [score:3]
The relative expressions of SREBF1 (a), miR-33b (b), SREBF2 (c), and miR-33a (d) are shown (n = 6–9). [score:3]
Relative Srebf1 expression levels in primary hepatocytes from miR-33b KI [+/+] mice treated with T0901317 (10 μM) for the indicated time. [score:3]
Although there were no differences in the levels of miR-33a in macrophages, it is interesting that the levels of miR-33a were increased in proportion to the expression levels of miR-33b in the liver. [score:3]
This explains one of the reasons why human HDL-C levels are lower than those of mice and indicates that it is important to considerably reduce miR-33b levels if pharmacological targeting of miR-33s is used to increase HDL-C levels. [score:3]
miR-33b KI results in alterations in miR-33a target proteins ABCA1 and SREBP-1. miR-33b KI reduces cholesterol efflux in macrophages. [score:3]
Relative expression of miR-33b in the livers of 8-week-old mice (n = 6). [score:3]
We have not yet succeeded in identifying miR-33b-specific target genes. [score:3]
miR-33b is co-expressed with Srebf1 in miR-33b KI mice. [score:3]
Although there was no difference in miR-33a levels in macrophages (Supplementary Figure S3b), miR-33a levels were increased in proportion of the expression levels of miR-33b in the liver (Supplementary Figure S2b). [score:3]
Even previously reported miR-33b target genes were not reduced in the liver of miR-33b KI mice compared with that of control mice. [score:2]
Descendant miR-33b knock-in heterozygous mice without the Ayu-1 Cre allele were crossed with each other to generate the miR-33b KI [+/+] mice. [score:2]
This indicates that both isoforms of miR-33 participate in regulating the primary risk factors of metabolic syndrome, which accelerate atherosclerosis. [score:2]
miR-33b regulates ABCA1 and SREBP-1.. [score:2]
Generation of miR-33b knock-in (KI) mice. [score:2]
Generation of miR-33b KI mice. [score:1]
In the present study, we successfully established humanized mice, in which a miR-33b transgene was inserted within the same intron as that in human SREBF1. [score:1]
When primary hepatocytes from the miR-33b KI [+/+] mice were stimulated with T0901317, Srebf1 and miR-33b mRNA levels were significantly increased in parallel, although this increase was faster for Serbf1 than for miR-33b (Fig. 3a and b). [score:1]
Thus, miR-33b-specific functions should be determined in future experiments. [score:1]
miR-33b reduces cellular cholesterol efflux and serum HDL-C levels. [score:1]
Because miR-33b is located in SREBF1 intron 16 in humans and there are high homologies in exons 16 and 17 between human and mouse (82.6% of nucleotides and 79.7% of amino acids, Supplementary Fig. S1b), we introduced the human miR-33b sequence into intron 16 of mouse Srebf1. [score:1]
In the present study, we demonstrated the effect of miR-33b on HDL-C levels in vivo. [score:1]
A single miR-33b copy reduces serum HDL levels. [score:1]
To check this effect in vivo, T0901317 was suspended in 0.5% carboxymethylcellulose and administrated to 8-week-old male miR-33b KI [+/+] mice at a dose of 25 mg/kg for 3 days. [score:1]
The miR-33b KI [+/+] mice were born with the expected Men delian ratios, were viable, fertile, and did not exhibit any obvious abnormalities in size, shape, or structure up to 8 weeks of age. [score:1]
One of the reasons of such result may be that the previous study was conducted in human cell line and potential binding sites of miR-33b are not conserved at least in PCK1 3′UTR of mice. [score:1]
ABCA1 and ABCG1 protein levels were lower in macrophages from the miR-33b KI [+/+] mice than from the WT mice (Fig. 5a and Supplementary Figure S3e and S3f), which was compatible with the findings for our miR-33a -deficient mice. [score:1]
In addition to the effects on HDL-C, a study by Rayner et al. showed that miR-33 antagonism reduced very low-density lipoprotein -associated TGs in their cohort of normal male African green monkeys 21. [score:1]
We determined apoA-I- and HDL-C -mediated cholesterol efflux from peritoneal macrophages and found that macrophages from the miR-33b KI [+/+] mice had lower apoA-I- and HDL-C -mediated cholesterol efflux than those from the WT mice (Fig. 5b). [score:1]
We isolated and amplified the region that encoded for the complete pre-miR sequence of human miR-33b and adjacent sequence, which enabled the introduction of miR-33b into intron 16 of mouse Srebf1 (Fig. 2a). [score:1]
As a selection marker, a neomycin resistance cassette flanked by loxP sites (loxP-PGK-gb2-neo-loxP cassette; Gene Bridges, Germany) was inserted at the adjacent site of the human pre-miR-33b site. [score:1]
These results show that only one copy of miR-33b was sufficient to substantially reduce HDL-C and total cholesterol to the same levels as those in the miR-33b KI [+/+] mice. [score:1]
This miR-33b KI strategy did not alter Srebf1 intron 16 splicing, as confirmed by PCR (Fig. 2d) and sequencing (Fig. 2e). [score:1]
In any event, the numbers of miR-33b transcripts were greater than those of miR-33a transcripts, and this underscores the importance of miR-33b 21. [score:1]
Moreover, we previously reported that the miR-33a [−/−] mice had 22%–39% higher serum HDL-C levels than the WT mice 8. Thus, we determined the serum HDL-C levels of the WT, miR-33b KI [+/−], and miR-33b KI [+/+] mice at the age of 8 weeks. [score:1]
In this context, the current LNA -modified anti-miR technique is quite potent for reducing the levels of both miR-33 isoforms and may be useful for anti-atherosclerosis therapy. [score:1]
It is also possible that some compensated mechanisms may have occurred in miR-33b KI mice. [score:1]
It is noteworthy that only one copy of miR-33b (miR-33b KI [+/−] mice) significantly reduced HDL-C levels to the same levels as those in the miR-33b KI [+/+] mice. [score:1]
Mouse primary hepatocytes were obtained from miR-33b KI [+/+] mice using a two-step collagenase perfusion method 28. [score:1]
In contrast to humans and other mammals, rodents lack miR-33b and only have miR-33a in Srebf2. [score:1]
Strategy used to generate miR-33b KI mice. [score:1]
As shown in Fig. 4a, Supplementary Figure S5a, and S5b, ABCA1 and SREBP-1 protein levels were lower in the livers of the miR-33b KI mice. [score:1]
[1 to 20 of 70 sentences]
9
[+] score: 126
In the present study, we predicted the potential miRNAs which might target at the 3′UTR of CCL2, and further identified miR-33 as a suppressor of CCL2 expression. [score:7]
miR-33 is a regulator of CCL2 expressionTo observe the regulatory role of miR-33 in CCL2 expression, we performed gain- or loss-of-function studies on miR-33 in primary chondrocytes. [score:7]
Figure 3miR-33 suppresses CCL2 expression via targeting at the 3′UTR(A) The schematic diagram of potential binding sites (79–98) for miR-33 in the 3′UTR of mouse CCL2 gene. [score:7]
miR-33 suppresses CCL2 expression via targeting at the 3′UTR. [score:7]
In the present study, we are the first to report the expression of miR-33 in mouse chondrocytes and identify CCL2 as its direct target. [score:6]
miR-33 suppresses CCL2 expression via targeting at the 3′UTRTo investigate the precise regulatory mechanism between miR-33 and CCL2, we subcloned the 3′UTR of mouse CCL2 gene into a miRNA reporter gene vector (Figure 3A). [score:6]
Those results indicated that miR-33 suppressed mouse CCL2 expression via a binding element locating at 79/98 in the 3′UTR. [score:5]
Those findings confirmed the suppressive role of miR-33 in CCL2 expression. [score:5]
Figure 1Prediction of potential miRNAs targeting at the 3′UTR of CCL2 gene(A and B) The potential target sites of miR-124 (A) or miR-33 (B) in the 3′UTR of CCL2 gene were conserved in human, mouse and rat species. [score:5]
Here in chondrocytes, we identified miR-33 as a regulator of CCL2 expression and monocyte chemotaxis. [score:4]
Figure 2 miR-33 is a regulator of CCL2 expression(A) The relative mRNA levels of CCL2 in the primary mouse chondrocytes transfected with a scramble miRNA (100 nM) or an anti-miRNA of miR-33 (100 nM) (n=4, ** P<0.01). [score:4]
To observe the regulatory role of miR-33 in CCL2 expression, we performed gain- or loss-of-function studies on miR-33 in primary chondrocytes. [score:4]
miR-33 is a regulator of CCL2 expression. [score:4]
Inhibition of miR-33 was conducted by transfecting the chondrocytes with an anti-miRNA of miR-33 (AM12410, Thermo Fisher Scientific). [score:3]
We demonstrated that the treatment with an anti-miRNA of miR-33 could strikingly induce the expression of CCL2 in the mRNA (Figure 2A) and protein (Figure 2B) levels as well as the secretion of CCL2 in the supernatant of cultured chondrocytes (Figure 2C). [score:3]
However, the role of miR-33 in CCL2 expression was still not clear. [score:3]
Further, we overexpressed miR-33 in chondrocytes by treating the cells with a miR-33 mimic (Figure 2D). [score:3]
As shown in Figure 4, we found that the CM from miR-33 mimic -treated chondrocytes significantly inhibited the migration rate of the monocytes, whereas the CM from anti- miR-33 -treated chondrocytes notably stimulated the monocyte chemotaxis. [score:3]
We found that the potential binding sites for miR-124 (Figure 1A) and miR-33 (Figure 1B) were conserved in multiple species, indicating that those two miRNAs might be functional in CCL2 suppression. [score:3]
Overexpression of miR-33 was carried out by transfecting the chondrocytes with a miR-33 mimic (MC12410, Thermo Fisher Scientific). [score:3]
As expected, we found that anti- miR-33 treatment largely potentiated the reporter gene activity (Figure 3B), whereas miR-33 mimic could significantly suppress the luciferase activity (Figure 3C). [score:3]
The miR-33/CCL2 axis in chondrocytes regulates the monocyte chemotaxisCCL2 is a potent attractor of monocytes [12]. [score:2]
Those findings indicated that miR-33/CCL2 axis in chondrocytes was functional in regulating monocyte chemotaxis. [score:2]
The miR-33/CCL2 axis plays an important role in regulating monocyte chemotaxis. [score:2]
Noteworthily, the anti- miR-33-stimulated reporter gene activity was abolished with the mutation of the potential miR-33 binding sites (Figure 3E). [score:2]
To further confirm the regulatory effect of miR-33 on CCL2 via the 3′UTR, the potential binding sites AAUGCA were mutated as ACCGAA (Figure 3D). [score:2]
The miR-33/CCL2 axis in chondrocytes regulates the monocyte chemotaxis. [score:2]
The miR-33/CCL2 axis might regulate monocyte chemotaxis in OA. [score:2]
To observe the regulatory role of miR-33/CCL2 axis in monocyte chemotaxis, transwell migration assays were carried out. [score:1]
To further correlate our in vitro findings to the physiopathological condition, we determined the levels of miR-33, CCL2, CD-68 and IL-1β in the cartilage of the patients with OA. [score:1]
These findings implied that the miR-33/CCL2 axis might not exist in macrophages or that the function of miR-33/CCL2 axis might be antagonized by other miR-33-initiated factors. [score:1]
In a previous study, miR-33 was reported to potentiate the pro-inflammatory activation of macrophages and aggravate the progression of atherosclerosis [31]. [score:1]
We presumed that the deficiency of miR-33 in the chondrocytes of OA patients would potentiate the production of CCL2, which then attracted the monocytes from peripheric blood to the articular tissues. [score:1]
Therefore, further studies on the role of miR-33/CCL2 axis in other cell types might be very interesting. [score:1]
Decreased miR-33 levels and elevated CCL2 levels in the cartilage of OA patientsTo further correlate our in vitro findings to the physiopathological condition, we determined the levels of miR-33, CCL2, CD-68 and IL-1β in the cartilage of the patients with OA. [score:1]
Therefore, our findings indicated a potential role of miR-33 in OA. [score:1]
miRNA-33 expression level was detected with the TaqMan microRNA assay real-time fluorescent quantitative PCR technology (TaqMan®MicroRNA Assays, Life Technologies). [score:1]
Then, the luciferase reporters (wt or mut) and miRNAs (miR-33 mimic, anti- miR-33 or scramble miRNA) were transfected using Lipofectamine 2000 according to the manufacturer's instructions (Invitrogen). [score:1]
The miR-33/CCL2 axis was identified in the primary mouse chondrocytes in the present study. [score:1]
Identical results were obtained in response to the treatment of miR-33 mimic (Figure 3F). [score:1]
Decreased miR-33 levels and elevated CCL2 levels in the cartilage of OA patients. [score:1]
Meanwhile, we demonstrated that the anti- miR-33 treatment -induced monocyte chemotaxis was prevented by supplementary CCL2 antibody. [score:1]
Figure 4The miR-33/CCL2 axis in chondrocytes regulates the monocyte chemotaxisThe primary chondrocytes were transfected with a scramble miRNA (100 nM), miR-33 mimic (100 nM) or anti- miR-33 (100 nM) for 36 h. Then, the supernatant was collected as CM for the chemotaxis test of monocytes in the transwell migration assays. [score:1]
We found that treatment of miR-33 mimic largely attenuated the mRNA (Figure 2E), protein (Figure 2F) and secretion (Figure 2G) levels of CCL2 in the chondrocytes. [score:1]
The previous and recent studies mainly focused the functions of miR-33 on the cholesterol homoeostasis [28, 29] and energy metabolism [30]. [score:1]
[1 to 20 of 45 sentences]
10
[+] score: 115
Among the 77 miRNAs, 7 miRNAs, hsa-miR-33b-3p, hsa-miR-4284, hsa-miR-663a, hsa-miR-150-5p, hsa-miR-1233-3p, hsa-miR-671-3p, and hsa-miR-140-3p, were selected for further validation based on the fact that they were in the top 20 up- or downregulated miRNAs as found in microarray microRNA expression profiling presented in Fig.   1a, b. More specifically, miR-33b-3p and miR-4284 were among the top upregulated, and miR-663a, miR150-5p, miR-1233-3p, miR-671-3p, and miR-140-3p were downregulated. [score:12]
The expression levels of hsa-miR-33b-3p and hsa-miR-4284 coincided between the two methodologies, while hsa-miR-1233-3p, hsa-miR-140-3p, hsa-miR-150-5p, hsa-miR-663a, and hsa-miR-671-3p were marginally overexpressed in microarray analysis and appeared to be down-regulated with qRT-PCR Moreover, we found that hsa-miR-33b-3p and hsa-miR-4284 expression levels coincided between microarray analysis and qRT-PCR, exhibiting decreased expression in serum of OA samples compared to controls. [score:11]
The expression levels of hsa-miR-33b-3p and hsa-miR-4284 coincided between the two methodologies, while hsa-miR-1233-3p, hsa-miR-140-3p, hsa-miR-150-5p, hsa-miR-663a, and hsa-miR-671-3p were marginally overexpressed in microarray analysis and appeared to be down-regulated with qRT-PCR Moreover, we found that hsa-miR-33b-3p and hsa-miR-4284 expression levels coincided between microarray analysis and qRT-PCR, exhibiting decreased expression in serum of OA samples compared to controls. [score:11]
Among these, INSR and IGF1R were targeted by all three miRNAs, while ADCY7, VANGL1, WNT5A, PPP3R2, TGFBR1, FZD4, BRAF, and CREB5 were co -targeted by hsa-miR-140-3p, and hsa-miR-671-3p, RPTOR, CDKN1A, PRKCB, ADCYA1, PDPK1, MAPK1, ADCY2, TCS1, Kras, CBL, CHRM3, SGL1, CREB1, KCNN3, PRKC1, PPP2R5E, and KCNJ11 were co -targeted by hsa-miR-33b-3p, and hsa-miR-140-3p and KCNN1 were co -targeted by hsa-miR-671-3p and hsa-miR-33b-3p. [score:9]
Fig. 4 Venn diagram of common target genes between miR-140-3p, miR-33b-3p and miR-671-3p Pathway enrichment analysis (Additional file  2: Table S2) revealed that the target genes of hsa-miR-140-3p, hsa-miR-33b-3p,and hsa-miR-671-3p are potentially involved in 48 common signaling pathways, including thyroid hormone synthesis, FoxO signaling pathway, insulin secretion, chemokine signaling pathway, MAPK signaling pathway, PI3K-Akt signaling pathway, estrogen signaling pathway, regulation of lipolysis in adipocytes, glucagon signaling pathway, and calcium signaling pathway, whereas 40 common pathways were predicted common between miR-140-3p and miR-33b-3p, such as mTOR signaling pathway, osteoclast differentiation, Ras signaling pathway, type II diabetes mellitus, adipocytokine signaling pathway, thyroid hormone signaling pathway, insulin signaling pathway, insulin resistance, sphingolipid signaling pathway, sphingolipid metabolism, and ErbB signaling pathway. [score:6]
We, next, validated with qRT-PCR, which offers high accuracy, sensitivity, and dynamic range [46] the expression levels of 7 selected out of the 77 DE miRNAs, which were among the top 20 up- or downregulated in the microarray screening, namely, hsa-miR-33b-3p, hsa-miR-4284, hsa-miR-663a, hsa-miR-150-5p, hsa-miR-1233-3p, hsa-miR-140-3p, and hsa-miR-671-3p, in serum and in OA and healthy articular cartilage samples. [score:6]
Fig. 4 Venn diagram of common target genes between miR-140-3p, miR-33b-3p and miR-671-3p Pathway enrichment analysis (Additional file  2: Table S2) revealed that the target genes of hsa-miR-140-3p, hsa-miR-33b-3p,and hsa-miR-671-3p are potentially involved in 48 common signaling pathways, including thyroid hormone synthesis, FoxO signaling pathway, insulin secretion, chemokine signaling pathway, MAPK signaling pathway, PI3K-Akt signaling pathway, estrogen signaling pathway, regulation of lipolysis in adipocytes, glucagon signaling pathway, and calcium signaling pathway, whereas 40 common pathways were predicted common between miR-140-3p and miR-33b-3p, such as mTOR signaling pathway, osteoclast differentiation, Ras signaling pathway, type II diabetes mellitus, adipocytokine signaling pathway, thyroid hormone signaling pathway, insulin signaling pathway, insulin resistance, sphingolipid signaling pathway, sphingolipid metabolism, and ErbB signaling pathway. [score:6]
Target-gene analysis of hsa-miR-140-3p, hsa-miR-33b-3p, and hsa-miR-671-3p revealed that InsR and IGFR1 were common targets of all three miRNAs, highlighting their involvement in regulation of metabolic processes that contribute to OA pathology. [score:6]
We found that three miRNAs, hsa-miR-140-3p, hsa-miR-671-3p, and hsa-miR-33b-3p, were significantly downregulated in the serum of OA patients compared to controls, and in addition, hsa-miR-140-3p and hsa-miR-671-3p were also significantly downregulated in OA compared to healthy articular cartilage (Figs.   3a, b and 6 ). [score:5]
Target gene analysis of hsa-miR-140-3p, hsa-miR-33b-3p, and hsa-miR-671-3p revealed that 28 genes were co -targeted by at least two miRNAs. [score:5]
qRT-PCR validation in seven selected out of the 77 miRNAs revealed 3 significantly downregulated miRNAs (hsa-miR-33b-3p, hsa-miR-671-3p, and hsa-miR-140-3p) in the serum of OA patients, which were in silico predicted to be enriched in pathways involved in metabolic processes. [score:4]
We identified a three-miRNA signature, including hsa-miR-140-3p, hsa-miR-671-3p, and hsa-miR-33b-3p, which was downregulated in the serum of OA patients compared to controls and in silico predicted to be involved in regulating metabolic factors. [score:4]
Human miR-33 has two isoforms, has-miR-33a and has-miR-33b, which share the same seed sequence, have the same predicted targets, and are both regulating lipid and cholesterol metabolism [19, 52]. [score:4]
Hsa-miR-1233-3p (a), hsa-miR-140-3p (b), hsa-miR-150-5p (c), hsa-miR-33-3p (d), hsa-miR-4284 (e), hsa-miR-663a (f), and hsa-miR-671-3p (g) manifested an area under the curve (AUC) value > 0.8 (AUC > 0.8) and p < 0.01 We verified by qRT-PCR the expression levels of the seven selected miRNAs (hsa-miR-33b-3p, hsa-miR-4284, hsa-miR-663a, hsa-miR-150-5p, hsa-miR-1233-3p, hsa-miR-140-3p, and hsa-miR-671-3p) in all serum samples. [score:3]
No significant differences were observed for hsa-miR-33-3p, hsa-miR-4284, hsa-miR-663a, and hsa-miR-1233-3p expression levels between OA and healthy articular cartilage. [score:3]
Among these seven miRNAs, 3 miRNAs, hsa-miR-33b-3p, hsa-miR-671-3p, and hsa-miR-140-3p, were found significantly downregulated in OA serum samples compared to controls (p < 0.05) (Fig.   3a ). [score:3]
Hsa-miR-140-3p, hsa-miR-671-3p, and hsa-miR-33b-3p were significantly downregulated in serum samples of OA patients compared to healthy individuals. [score:3]
An interesting finding in the in silico prediction analysis was that InsR and IGFR1 were common targets of all three hsa-miR-140-3p, hsa-miR-33b-3p, and hsa-miR-671. [score:3]
Recently, miR-33b was shown to regulate adipocyte differentiation [54] and miR-33a different functions of macrophages having a role in development and progress of atherosclerosis [55]. [score:3]
Biomarker Circulating miRNAs Hsa-miR-140-3p Hsa-miR-33b-3p Hsa-miR- 671-3p Metabolic miR-array Osteoarthritis Osteoarthritis (OA) is the most common chronic degenerative joint disease and a leading cause of pain and disability. [score:3]
All above suggest that the in silico predictions in the present study are highlighting the possible implication of circulating hsa-miR-140-3p, hsa-miR-33b-3p, and hsa-miR-671-3p as novel serum -based biomarkers for osteoarthritis prognosis and underlining their involvement in the regulation of metabolic processes that contribute to OA pathology. [score:2]
Regarding hsa-miR-671-3p and hsa-miR-33b, there are no reports on their involvement in OA pathogenesis. [score:1]
The expression levels of 7 selected miRNAs screened with miRNA microarrays, as mature hsa-miR-33b-3p, hsa-miR-4284, hsa-miR-663a, hsa-miR-150-5p, hsa-miR-1233-3p, hsa-miR-140-3p, and hsa-miR-671-3p, were evaluated in serum samples from 12 OA patients and 12 healthy controls. [score:1]
Fig. 5 Venn diagram of common signaling pathways between miR-140-3p, miR-33b-3p and miR-671-3p Based on the previous list of the revealed miRNAs, we further investigated their association with known diseases. [score:1]
[1 to 20 of 24 sentences]
11
[+] score: 82
Conversely, antagonism miR-33 upregulates ABCA1 expression in vitro and in vivo and promotes cholesterol efflux to ApoA-I. Importantly, in vivo inhibition of miR-33 expression leads to a significant increase in plasma HDL levels and the regression of atherosclerosis, thus confirming the physiological effects of miR-33 in regulating lipid metabolism [12, 25, 68, 69]. [score:11]
Altogether, these data suggest that the inhibition of miR-33 expression may be a promising strategy to treat atherosclerotic vascular disease, metabolic syndrome, and liver regeneration in chronic liver disease. [score:9]
To assess whether anti-miRNA-33 therapy increases liver ABCA1 expression and plasma HDL levels, several groups silenced miR-33 expression using a variety of strategies including modified oligonucleotides and antisense oligonucleotides expressed in lentiviral or adenoviral constructs. [score:7]
miR-33 overexpression strongly represses ABCA1 expression at the RNA and protein level and decreases cellular cholesterol efflux to apolipor protein A-I (ApoA-I), a key step in regulating reverse cholesterol transport (RCT). [score:6]
Interestingly, miR-33 is highly expressed in the brain, and many predicted targets for miR-33 are involved in neurogenesis, such as Sema-3a and netrin-1, and synaptic regulation, including glutamate receptor ionotropic Kainate 2 (GRIK2) and glutamate receptor ionotropic AMPA 3 (AMPA 3). [score:6]
Another interesting difference between humans and rodents is that the 3′UTR of Npc1 in humans contains two miR-33 binding sites resulting in a significant repression of NPC1 protein expression, whereas mice only contain one site, which is modestly suppressed by miR-33 [12]. [score:5]
Although the preclinical studies of miR-33 inhibition in mice are encouraging, extrapolation of these findings to human is complicated by the fact that mice lack miR-33b. [score:3]
C. Fernández-Hernando has patents on the use of miRNA-33 inhibitors. [score:3]
In addition to ABCA1, two important genes involved in cholesterol metabolism were described as targets of miR-33: ABCG1 which mobilizes cellular free cholesterol to more lipidated HDL particles, and Niemann Pick C1 (NPC1), which transports cholesterol from lysosomes to other cellular compartments. [score:3]
Moreover, miR-33a and miR-33b also target the insulin receptor substrate 2 (IRS2), an essential component of the insulin-signaling pathway in the liver [72]. [score:3]
miR-33a and miR-33b also target genes involved in the β-oxidation of fatty acids, including carnitine palmitoyltransferase 1A (CPT1A), carnitine O-octanoyltransferase (CROT), hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (HADHB), 5′ adenosine monophosphate-activated protein kinase (AMPK), and sirtuin 6 (SIRT6). [score:3]
As expected, mice treated with anti-miR-33 oligonucleotides have a significant increase in liver ABCA1 expression and plasma HDL levels. [score:3]
In addition to the role of miR-33 in regulating cholesterol and fatty acid metabolism, we have also recently shown that miR-33 regulates cell cycle progression and cellular proliferation [73]. [score:3]
Furthermore, this study also shows that in vivo inhibition of miR-33 using antisense oligonucleotides improves liver regeneration after partial hepatectomy [73]. [score:3]
mir-33a and mir-33b are co-transcribed with their host genes and regulate cholesterol and fatty acid metabolism. [score:2]
Several miRNAs have been described to regulate lipid metabolism, including miR-122, miR-33, miR-758, and miR-106b [11– 14] (Table 1). [score:2]
miR-33 negatively regulates cyclin -dependent kinase 6 (CDK6) and cyclin D1 (CCND1), which results in cell cycle arrest in G1 phase. [score:2]
Interestingly, Abcg1 has two miR-33 binding sites in its 3′UTR that are only present in rodents, suggesting that cellular efflux to mature HDL is differently regulated between species [12, 24]. [score:2]
These results were later confirmed genetically in the miR-33 knockout mice. [score:2]
We and others have recently identified miR-33a and miR-33b, intronic miRNAs located within the Serbp2 and Srebp1 genes, respectively [12, 24, 25]. [score:1]
The data summarized in this paper pointed out that anti-miR-33, miR-758 therapy, and miR-106 may be useful for treating dyslipidemia and cardiovascular disorders. [score:1]
Nevertheless, anti-miR-33 therapy in nonhuman primates has demonstrated to be very effective in increasing the levels of HDL and reducing VLDL [71]. [score:1]
MiR-33: A Key Regulator of Lipid Metabolism. [score:1]
[1 to 20 of 23 sentences]
12
[+] score: 76
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-130a, hsa-mir-155, hsa-mir-130b
In contrast, MafB is directly targetable and down-regulated by pro-inflammatory and pro-atherogenic microRNAs, miR-155 and miR-33, which have been shown to be significantly up-regulated in atherosclerotic plaque [7]. [score:10]
miR-33, an intronic microRNA located within the SREBF2 gene, has been shown to target and suppress Abca1 expression in human and mouse macrophages, and thereby attenuate reverse cholesterol transport and promote atherosclerotic development [33]. [score:8]
However, a non-targetable mutation of the candidate miR-33 target sequence blocked the inhibitory effect of miR-33. [score:8]
These findings suggest that the increase in MafB expression may be attributed largely to reduced extent of miR-33 -mediated inhibition, further supporting the notion that MafB may also be a direct target of miR-33 in these animals. [score:8]
In contrast, MafB is directly targeted and down-regulated by pro-inflammatory and pro-atherogenic microRNAs, miR-155 and miR-33. [score:7]
Further, ectopic expression of miR-33 in THP-1 cells significantly reduced the endogenous MafB mRNA (Fig.   6c), indicating that human MafB mRNA is a direct target of miR-33. [score:6]
However, the same treatments did not enhance expression of c-Maf and aforementioned potential positive regulators of MafB that do not contain candidate miR-33 target sequence in their 3′ UTRs. [score:6]
Notably, we found that this pro-atherogenic miR-33 could directly target the 3′ UTR of MafB mRNA in human (Fig.   6e), although candidate miR-33 target sequence was not fully conserved in mouse. [score:6]
Notably, analyses of publically available high-throughput datasets revealed that in two separate studies of african green monkeys 34, 35, in vivo administration of anti-miR-33 significantly increased hepatic expression of MafB (Supplementary Figs.   S6 and S7), as well as a known miR-33 target, Abca1, despite A to G substitution in the miR-33 seed region of MafB 3′ UTR in these animals (Fig.   6e). [score:5]
Notably, MafB, but not c-Maf, is directly targetable and negatively regulated by pro-atherogenic miR-33 (Fig.   6f). [score:5]
Accordingly, ectopic miR-33 expression in 293ETN cells significantly reduced the activity of the MafB 3′ UTR reporter, to an extent equivalent to an ABCA1 3′ UTR reporter (Fig.   6f). [score:3]
Figure 6Atherogenic miR-155 and miR-33 negatively regulate MafB. [score:2]
Atherogenic miR-155 and miR-33 negatively regulate MafB. [score:2]
[1 to 20 of 13 sentences]
13
[+] score: 65
Mao et al. [21] recently demonstrated that miR-33 expression can be upregulated in human THP-1 monocytes by inflammation, leading to a decrease in ABCA1 expression and cholesterol efflux. [score:8]
Pitavastatin has also been shown to regulate VCAM-1 through miR-126 in endothelial cells [10]; and, others have demonstrated that several statins increase miR33 expression, and decrease ABCA1 expression and cholesterol efflux in macrophage cell lines [10, 11]. [score:6]
Because expression levels of miR-33a and miR-33b were altered significantly after 16 hours treatment of oxLDL, we questioned whether miR-33 expression also is changed at other time points. [score:5]
Moreover, we searched potential targets for miR-33 and miR-758 using the Targetscan (http://www. [score:5]
In a pattern similar to miR-33, miR-758 expression was suppressed by oxLDL. [score:5]
Based on our findings and the existing literature, it is unlikely that miR-33 is solely responsible for regulating of ABCA1 and other RCT proteins, as the slight increase in miR-33 cannot rationally explain the robust suppressive effect on ABCA1 by pitavastatin (Fig 3). [score:4]
Predicted targets for miR-33 and miR-758. [score:3]
Importantly, pitavastatin prevented the suppression of miR-33a, miR33b, and miR-758 by oxLDL (Fig 1). [score:3]
Moreover, we detected seven miRNAs that displayed the most significantly differential expression among samples which had the highest signals in the microarray, including miR-33b-3p in this study (Table 1). [score:3]
Expression of miR-33a, miR-33b and miR-758 displayed significant reduction from 8 to 16 hours (S1 Fig). [score:3]
Having shown that miRNAs with an established link to cholesterol homeostasis (miR-33 and miR-758) are differentially targeted by pitavastatin in the presence and absence of oxLDL, we set out to define if a broader network of miRNAs is similarly modulated. [score:3]
miR-33 and -758 have been specifically shown to negatively regulate ABCA1 in macrophages [2, 4]. [score:2]
The impact of statins in regulating miR-33 and -758 under basal conditions appear to be modest, however this pathway becomes amplified in a pro-atherogenic milieu when oxLDL is present. [score:2]
Regulation of miR-33 and -758 by pitavastatin in the presence and absence of oxLDL. [score:2]
Sterol regulatory element binding protein (SREBP) is a lipogenic transcription factor; and, miR-33a and miR-33b are intronic miRNAs within SREBP. [score:2]
However, pitavastatin prevented the decreases in miR-33a and in miRNA33b seen in the oxLDL-alone group. [score:1]
Furthermore, the genetic deletion of miR-33 in mice increases plasma HDL-C levels and reduces the progression of atherosclerosis [4]. [score:1]
The increase in miR-33 has been linked to induction of SREBP-2 [18]. [score:1]
While the present study focused on the effect of pitavastatin, the effects of other statins on miR-33 and ABCA1 have been shown consistent enough to postulate a similar response profile across the class [3, 17]. [score:1]
Although we observed a clear induction of SREBP mRNA and protein by pitavastatin (Fig 2), they were not accompanied by an equally notable increase in miR-33. [score:1]
miR-33a and miR-33b were the first reported miRNAs to be linked to ABCA1 [2]. [score:1]
Therefore, the elevated levels of miR-33 may not be necessarily attributed to SREBP-2. At this time, the mechanism of these findings remains unclear. [score:1]
Under baseline conditions, we observed that oxLDL decreased miR-33a, miR33b, and miR-758. [score:1]
Pitavastatin alone led to a modest increase in miR-33a and a modest decrease in miR-33b in the control group, neither of which reached statistical significance. [score:1]
[1 to 20 of 24 sentences]
14
[+] score: 65
Other miRNAs from this paper: hsa-mir-33a
In contrast, it was shown that c-myc was negatively regulated by miR-33 at the post-transcriptional level, via a specific target site within the 3’UTR and over -expression of c-myc impaired miR-33b -induced inhibition of proliferation and invasion in osteosarcoma cells [16]. [score:8]
Although various reports indicated that miR-33 inhibits tumoral cell migration and invasion by targeting the c-myc gene, acting as a tumor suppressor. [score:7]
It seems that factors secreted by adipose stem cells in the feeder layer targeted mir-33 -mediated down-regulation of p53 in expansion of HSCs. [score:6]
Improvement in self-renewal of HSCs directly cultured on ADSCs was associated with increased expression of miR-33 and c-myc and decreased expression of p53. [score:6]
On the other hand, it was reported that there is a negative relationship between miR-33 and c-myc so that over -expression of c-myc impaired miR-33b -induced inhibition of proliferation and invasion in osteosarcoma cells [16, 17]. [score:5]
Xu, et al, found that miR-33 Inhibits tumoral cell migration and invasion by targeting the c-myc gene, suppreses tumors. [score:5]
It has been shown that miR-33 family members modulate the expression of genes involved in cell cycle regulation and cell proliferation [13]. [score:4]
It seems that miR-33 mediated down-regulation of p53. [score:4]
On the other hand, another research showed that miR-33 reduces cell proliferation and cell cycle progression and impairing the p53 tumor suppressor gene function [23]. [score:3]
Perhaps, it explains that the expression level of miR-33 depends on the cell type. [score:3]
Various functions have been defined for miR-33 such as reduction of cell proliferation and cell cycle progression and impairing the p53 tumor suppressor gene function. [score:3]
Expression of genes p53, c-myc and miR-33 were analyzed by real-time PCR. [score:3]
Previously, it has been reported that miR-33 targets p53 [13]; p53 activates the transcription of genes that induce cell cycle arrest, apoptosis and senescence in response to several stress conditions including DNA damage [13]. [score:3]
The function of miR-33 is associated with genes such as p53 and c-myc. [score:1]
Defining the role of ADSCs in controlling the HSC self-renewal through miR-33, p53 and c-myc may lead to the treatment and prevention of hematopoietic disorders. [score:1]
Some studies have shown that miR-33, p53 and c-myc have critical roles in control of self-renewal cells. [score:1]
Defining the role of ADSCs in controlling the HSCs self-renewal through increased miR-33 and reduced p53 may lead to the treatment and prevention of hematopoietic disorders. [score:1]
In conclusion, it seems that miR-33 increases proliferation of HSCs cultured on ADSCs by impairing the p53 function. [score:1]
[1 to 20 of 18 sentences]
15
[+] score: 63
Farnesoid X receptor (FXR) suppresses ABCA1 by upregulating miR-33b [62]. [score:6]
Statins are known to increase SREBP2 and miR-33-5p expression [68], therefore, individuals taking statins will likely have consistently low levels of miR-33-5p target genes, including those involved in bile acid export, which may lead to increased hepatic cholesterol accumulation, a known side effect of statins. [score:5]
Indeed, multiple groups have shown that miR-33-5p and miR-144-5p have an additive effect on suppression of ABCA1 [54, 60, 62], while cotransfection of miR-33-5p and miR-758 further reduced ABCA1 expression in vitro [48]. [score:5]
Gerin I. Clerbaux L. A. Haumont O. Lanthier N. Das A. K. Burant C. F. Leclercq I. A. MacDougald O. A. Bommer G. T. Expression of miR-33 from an SREBP2 intron inhibits cholesterol export and fatty acid oxidation J. Biol. [score:5]
In vitro work suggests that miR-33b-3p regulates ABCA1 indirectly, via Sp1 [6], while miR-33a-3p also regulates ABCA1 indirectly via the transcription factor steroid receptor coactivator 1 (SRC1). [score:5]
Inhibition of miR-33 increased hepatic ABCA1 expression, plasma ApoA1 and HDL, and RCT, and decreased aortic plaque size, lesion macrophage and lipid content, and macrophage cholesterol efflux [55, 56, 57]. [score:5]
FXR also increases miR-144-5p expression to mediate ABCA1 suppression and cholesterol efflux [54]; perhaps miR-33b and miR-144-5p work together to mediate FXR -induced ABCA1 repression. [score:5]
Horie T. Nishino T. Baba O. Kuwabara Y. Nakao T. Nishiga M. Usami S. Izuhara M. Sowa N. Yahagi N. MicroRNA-33 regulates sterol regulatory element -binding protein 1 expression in mice Nat. [score:4]
It is possible that this could have clinical implications in which a combination of statin therapy and miR-33-5p inhibition would alleviate the hepatotoxic side effects of the drug. [score:3]
These results highlight the potential of miR-33 or miR-302a suppression as a strategy to promote RCT and the regression of atherosclerosis [51, 55]. [score:3]
Interestingly, ABCG1 is a target of miR-33-5p in mice but not humans [65]. [score:3]
MiR-33-5p and its passenger strand, miR-33-3p, also have an additive effect on expression of ABCA1 [6]. [score:3]
However, co-treatment of cells with miR-33-5p and miR-145 did not have an additive effect on ABCA1 expression [50]. [score:3]
Along with miR-33-5p, miR-223 is involved in the regulation of numerous genes that maintain cholesterol homeostasis. [score:2]
Niesor E. J. Schwartz G. G. Perez A. Stauffer A. Durrwell A. Bucklar-Suchankova G. Benghozi R. Abt M. Kallend D. Statin-Induced decrease in ATP -binding cassette transporter A1 expression via microRNA33 induction may counteract cholesterol efflux to high-density lipoprotein Cardiovasc. [score:2]
Allen R. M. Marquart T. J. Albert C. J. Suchy F. J. Wang D. Q. H. Ananthanarayanan M. Ford D. A. Baldán Á. MiR-33 controls the expression of biliary transporters, and mediates statin- and diet -induced hepatotoxicity EMBO Mol. [score:2]
Tarling E. J. Ahn H. de Aguiar Vallim T. Q. The nuclear receptor FXR uncouples the actions of miR-33 from SREBP-2 Arterioscler. [score:1]
Rayner K. J. Sheedy F. J. Esau C. C. Hussain F. N. Temel R. E. Parathath S. van Gils J. M. Rayner A. J. Chang A. N. Suarez Y. Antagonism of miR-33 in mice promotes reverse cholesterol transport and regression of atherosclerosis J. Clin. [score:1]
[1 to 20 of 18 sentences]
16
[+] score: 62
These findings demonstrate for the first time the utility of seed -targetings in pharmacological inhibition of an entire miRNA family in non-human primates and imply that even under conditions of obesity, hyperglycemia and low insulin responsiveness in a severe metabolic disease animal mo del, inhibition of the miR-33 family is a feasible approach to increase circulating HDL cholesterol (Rottiers et al, 2013). [score:9]
Recently, Rottiers et al (2013) reported on pharmacological inhibition of the miR-33 family using a subcutaneously injected, seed -targeting 8-mer LNA -modified in a non-human primate metabolic disease mo del. [score:7]
Nevertheless, the different outcomes described above raise concerns with regard to translating pharmacology data from miR-33 inhibition studies in mouse mo dels to human therapy and highlight the need of additional long-term studies in larger animals, which in contrast to mice, harbor both miR-33 isoforms. [score:5]
Horie et al (2012) showed that genetic loss of miR-33 in apolipoprotein E -deficient (Apoe [−/−]) knockout mice enhanced cholesterol efflux and significantly reduced atherosclerotic plaque size and lipid content, whereas Rotllan et al (2013) reported that long-term inhibition of miR-33 in Ldlr [−/−] knockout mice fed a Western diet significantly reduced the progression of atherosclerosis. [score:5]
In addition, pharmacological inhibition of miR-33a/b led to derepression of several miR-33 targets implicated in fatty acid oxidation and a decrease in very-low-density lipoprotein (VLDL) triglycerides, without any evidence for adverse effects in the treated monkeys (Rayner et al, 2011b). [score:5]
The miR-33a and miR-33b sequences share the same seed region and are thus predicted to regulate an overlapping set of target mRNAs, indicating that they may have redundant biological functions. [score:4]
In this study, treatment of obese and insulin-resistant female African green monkeys with the 8-mer over 108 days resulted in derepression of direct miR-33 targets, including ABCA1, increased circulating HDL cholesterol and was well tolerated without any adverse effects. [score:4]
Notably, inhibition of miR-33 by a subcutaneously delivered 2′F/MOE -modified for 4 weeks in hyperlipidemic low-density lipoprotein receptor (Ldlr [−/−]) knockout mice fed a standard chow diet enhanced reverse cholesterol transport and showed atherosclerotic plaque regression, consistent with accumulation of the-33 in plaque macrophages (Rayner et al, 2011a). [score:4]
Rayner et al (2011b) showed that treatment of normal male African green monkeys by a subcutaneously delivered 2′F/MOE -modified targeting both miR-33a and miR-33b resulted in derepression of hepatic ABCA1 levels and sustained increase in plasma HDL cholesterol over 12 weeks (Rayner et al, 2011b). [score:3]
Indeed, two studies have reported on pharmacological inhibition of miR-33 in non-human primates. [score:3]
Targeting of miR-33 for the treatment of atherosclerosis. [score:3]
A number of recent reports have shown that the human sterol-regulatory-element -binding-protein genes SREBF1 and SREBF2 harbor two intronic miRNAs, miR-33b and miR-33a, respectively, which regulate cholesterol, fatty acid and triglyceride homeostasis in concert with their host gene products, SREBP1 and SREBP2 (Gerin et al, 2010; Horie et al, 2010; Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010, 2011a). [score:3]
By comparison, a third study by Marquart et al (2013) reported that long-term inhibition of miR-33 in high-fat-/high-cholesterol-fed Ldlr [−/−] mice failed to sustain elevated HDL cholesterol levels in the serum and did not alter progression of atherosclerosis, despite initial increase in HDL cholesterol after 2 weeks of treatment (Marquart et al, 2013). [score:3]
Several studies have shown that genetic deletion or -mediated inhibition of miR-33 in mice leads to derepression of hepatic ABCA1 and increase in circulating HDL cholesterol levels by up to 40%, suggesting that silencing of miR-33 could be a useful therapeutic strategy for atherosclerosis (Horie et al, 2010; Marquart et al, 2010; Najafi-Shoushtari et al, 2010; Rayner et al, 2010, 2011a). [score:3]
Interestingly, mice and other rodents have only one miR-33 isoform in intron 16 of SREBF2, corresponding to miR-33a in humans and non-human primates (Rottiers & Näär, 2012). [score:1]
[1 to 20 of 15 sentences]
17
[+] score: 46
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-30d, hsa-mir-125b-1, hsa-mir-125b-2
In our study, we found that AR-42 upregulated miR-30d, miR-33, and miR-125b in both BxPC-3 (Fig 4C) and PANC-1 (Fig 4D) cells, which suggested that AR-42 suppresses p53 expression by inducing the expression of several p53 -targeting miRNAs. [score:12]
Meanwhile, according to our results, AR-42 upregulated expression levels of three miRNA, miR-30d, miR-33, and miR-125b (Fig 4C and 4D), which have been previously shown to inhibit p53 gene expression. [score:10]
MiR-33 inhibited expression of Cdk6 and cyclin D1 in liver cells [55], and we demonstrated that AR-42 decreased mRNA expression of cyclin B2 and cdc25B, suggesting that miR-33 might be involved in AR-42 -mediated cell cycle regulation. [score:8]
In addition, AR-42 increased expression levels of negative regulators of p53 (miR-125b, miR-30d, and miR33), which could contribute to lower expression level of mutant p53 in pancreatic cancer cells. [score:6]
Expression levels of miR-30d, miR-33, and miR-125b were determined by real-time PCR of AR-42 treated BxPC-3 (C) and PANC-1 (D) cells for 24, 48 and 72 h. Expression levels of miRNAs were normalized by that of the reference gene U6. [score:5]
MicroRNA-30d (miR-30d), miR-33, and miR-125b have been shown to inhibit p53 mRNA expression [27]. [score:5]
[1 to 20 of 6 sentences]
18
[+] score: 39
However, CPT-1 mRNA and miR-33b expression were downregulated in the cancer tissues, suggesting that the downregulation of CPT-1 mRNA may be part of the mechanism responsible for SREBP upregulation and concords with the increased lipogenesis and lipogenic enzyme expression exhibited by a wide variety of cancers. [score:14]
Consistent with this hypothesis, SREBP expression was markedly stimulated by the inhibition of miR-33b expression, which may also result in increased fatty acid oxidation and reduced accumulation of fat in the liver stores. [score:7]
Although the reason for miR-33b downregulation in cancerous tissues is uncertain, the elucidation of its association with lipogenic genes may provide insight into gastric carcinogenesis and lead to the development of novel strategies for the genetic diagnosis of gastric cancer. [score:5]
miR-33b is embedded in SREBP-1 introns and targets several key regulators of cholesterol trafficking and of fatty acid/triglyceride homeostasis for post-transcriptional repression (10– 12). [score:4]
miR-33b mediates the transcription of its target genes, several of which are critical to lipogenesis and cholesterol metabolism (17, 18), including SREBP-1c, ACLY and FASN, which increase fatty acid and triglyceride production (17, 18). [score:3]
Considering the promising results of the use of anti-miRs in preclinical studies, miR-33b may become a viable therapeutic target in the future. [score:3]
Our results provide a basis for more detailed studies on the regulation of SREBP activity and may assist in further investigations of miR-33b as a target of gastric cancer treatment. [score:2]
The levels of miR-33b in cancerous tissues were determined as 10 [2.7]±10 [1.4] copies/μg total RNA and were significantly higher in non-cancerous tissues at 10 [3.3]±10 [2.1] copies/μg total RNA (Student’s t-test; P<0.01). [score:1]
[1 to 20 of 8 sentences]
19
[+] score: 36
Using a stringent cutoff of a match score between each miRNA and its mRNA targets followed by analysis for unique mRNAs per target list, we identified a total of 67 targets of miR-33, 217 targets of miR-330, 334 targets of miR-181a, and 25 targets of miR-10b (see Supplemental Material, Table 2). [score:13]
We focused a detailed analysis on the four most significantly down-regulated miRNAs, as determined through microarray analysis and qRT-PCR: miR-33, miR-330, miR-181a, and miR-10b. [score:4]
For this analysis, we used a stringent computational matching approach to identify predicted mRNA targets for miR-33, miR-330, miR-181a, and miR-10b. [score:3]
The five most significantly differentially expressed miRNAs, as determined through microarray analysis, were miR-33 (FC = −5.5), miR-450 (FC = −3.6), miR-330 (FC = −2.4), miR-181a (FC = −2.1), and miR-10b (FC = −2.1). [score:3]
For example, miR-33 shows decreased expression levels in tissues from patients with lung carcinomas (Yanaihara et al. 2006). [score:3]
These findings suggest that miR-33, miR-330, and miR-10b may influence cellular disease state specifically related to cancer. [score:3]
qRT-PCR validated the findings of the decreased miRNA expression induced by formaldehyde exposure: FC = −1.3 for miR-330; FC = −7.4 for miR-181a; FC = −1.2 for miR-33; and FC = −1.5 for miR-10b [see Supplemental Material, Figure 1 (doi:10.1289/ehp. [score:3]
The predicted targets of miR-33, miR-330, miR-181a, and miR-10b generated a total of 40 networks [see Supplemental Material, Table 3 (doi:10.1289/ehp. [score:3]
Here, we further investigated the four miRNAs with the most significant formaldehyde -induced changes in expression:miR-33, miR-330, miR-181a, and miR-10b. [score:1]
[1 to 20 of 9 sentences]
20
[+] score: 34
In order to further understand the role of aberrant miRNAs in physiological functions and biologic processes in arsenite -induced neoplastic transformation cells, 11 downregulated miRNAs (miR-197-3p, miR-192-5p, miR-127-3p, miR-139-5p, miR-490-3p, miR-196b-5p, miR-125a-3p, miR-298, miR-542-3p, miR-15b-5p, and miR-33b-5p) and six upregulated miRNAs (miR-200b-3p, miR-106b-5p, miR-574-5p, miR-320d, miR-200c-3p, and miR-141-3p) (Table S2) were selected, and their target genes were predicted with the TargetMiner, miRDB, and TarBase databases. [score:11]
Among the 191 dysregulated miRNAs, seventeen miRNAs (downregulation miRNAs: miR-197-3p, miR-192-5p, miR-127-3p, miR-139-5p, miR-490-3p, miR-196b-5p, miR-125a-3p, miR-298, miR-542-3p, miR-15b-5p, miR-33b-5p; upregulation miRNAs: miR-200b-3p, miR-106b-5p, miR-574-5p, miR-320d, miR-200c-3p, miR-141-3p, Table S2) were selected for bioinformatics analysis. [score:8]
Three of downregulated miRNAs (miR-192b-5p, miR-15b-5p, and miR-33b-5p) and three upregulated miRNAs (miR-141-3p, miR-106b-5p, and miR-200b-3p) (Table S2) were selected for validating the reliability of analysis results from miRNA Array. [score:7]
Qu J. Li M. An J. Zhao B. Zhong W. Gu Q. Cao L. Yang H. Hu C. MicroRNA-33b inhibits lung adenocarcinoma cell growth, invasion, and epithelial-mesenchymal transition by suppressing Wnt/â-catenin/ZEB1 signalingInt. [score:4]
As shown in Figure 2, the expression levels of miR-33b-5p, miR-15b-5p and miR-192b-5p in HBE-T cells were 0.36 (−2.82), 0.12 (−8.90), and 0.06 (−15.61) times of that in HBE cells. [score:3]
We determined the level of six miRNAs (miR-33b-5p, miR-15b-5p, miR-192-5p, miR-141-3p, miR-200b-3p, and miR-106b-5p) to validate the reliability of the miRNA Array detection. [score:1]
[1 to 20 of 6 sentences]
21
[+] score: 27
Other miRNAs from this paper: hsa-mir-33a, rno-mir-33
Regarding mitochondrial β-oxidation, the expression of CPT1A was changed following BDL and CP-MSC transplantation via miR-33, which is known as a posttranscriptional regulator of CPT1A, independent of PPAR α. Decreased cellular ATP production after BDL, which reflects mitochondrial dysfunction, was increased by CP-MSC transplantation via regulation of HO-1 and HO-2. Stem cell therapy with MSCs has been tried for the treatment of various liver diseases, including cirrhosis and hepatic failure, as an alternative to liver transplantation. [score:7]
The expression of miR-33 was normalized to U6 snRNA expression. [score:5]
Therefore, we explored the possibility of posttranscriptional regulation of CPT1A and verified that CPT1A is changed via alternative expression of miR-33 [23]. [score:4]
As expected, we determined that miR-33 expression was reduced in BDL rats and was restored by transplantation of CP-MSCs (Figure 3(e)). [score:3]
Taken together, these results suggest that CPT1A may be regulated posttranscriptionally by miR-33 in a PPAR α-independent manner. [score:2]
MiR-33 represses its target genes, which are involved in free fatty acid oxidation, such as CPT1A [23]. [score:2]
To evaluate whether miR-33 is a posttranscriptional regulator of CPT1A in BDL rat liver, we analyzed the expression levels of miR-33. [score:2]
CPT1A Expression Is Changed via MiR-33 in BDL Rats. [score:2]
[1 to 20 of 8 sentences]
22
[+] score: 27
Gerin I. Clerbaux L. A. Haumont O. Lanthier N. Das A. K. Burant C. F. Leclercq I. A. MacDougald O. A. Bommer G. T. Expression of mir-33 from an srebp2 intron inhibits cholesterol export and fatty acid oxidation J. Biol. [score:5]
In addition, the inhibition of the endogenous levels of miR33 in human liver cells induces fatty acid degradation, through the lack of modulation in the expression of genes involved in the oxidation of fatty acid [56, 57]. [score:5]
The inhibition of ABCA1 by miR-33 induced an efflux of cholesterol from peripheral tissues to the liver and a consequent reduction of circulating high-density lipoprotein-cholesterol (HDL-C) [53]. [score:3]
Similar to the miR-122 family of microRNAs, miR-33 is implicated as a potential target for metabolic disorders treatment. [score:3]
miR-33 -targeting antisense oligonucletotides appears to be a novel therapy approach for cardio metabolic disorders, such as atherosclerosis. [score:3]
miR-33a and miR-33b are intronic microRNAs which are encoded together with their host genes, the sterol-regulatory element -binding proetein 1 (Srebp1) and 2 (Srebp2). [score:2]
While, Srebp1 and miR-33b regulate the lipid homeostasis and the insulin signaling by modulating the activity of key genes involved in these process. [score:2]
Moreover, miR-33 have been involved in the post-transcriptional modulation of other mRNAs involved in the regulation of lipid and glucose metabolism, such as the α1 subunit of AMP-activated protein kinase (AMPKα1) [56, 58, 59]. [score:2]
However, there is not a specific separation of function between miR-33a and miR-33b. [score:1]
Several studies confirmed this evidence; thus, there is an extensive collaboration between miR-33a and miR-33b and their host genes (Figure 1). [score:1]
[1 to 20 of 10 sentences]
23
[+] score: 24
miR-125a-3p inhibits autophagy through targeting UV radiation resistance -associated gene (UVRAG), miR-33 targets ATG5/LAMP1, miR-144-3p targets autophagy-related gene 4a (ATG4a), miR-23a-5p inhibits the TLR2/MyD88/NF-κB leading to reduced autophagy and miR-33 also plays an inhibitory role via targeting some unknown factors. [score:15]
Ouimet et al. (2016) reported that miR-33 induction in THP-1 and HEK293 cells inhibits the integrated pathways involved in autophagy and also reprograms the host lipid metabolism for intracellular survival and persistence of Mtb. [score:3]
miR-125a-3p, miR-33, miR-144-3p, miR-23a-5p, and miR-142-3p are potential inhibitors of autophagy in Mycobacterium tuberculosis (Mtb) infection. [score:3]
Mycobacterium tuberculosis induces the miR-33 locus to reprogram autophagy and host lipid metabolism. [score:1]
1 and primary human macrophages Bettencourt et al., 2013 miR-33 ATG5, LAMP1 Human THP-1 and HEK293 cells Ouimet et al., 2016 miR-125a-3p UVRAG Mouse RAW264.7 and J774A. [score:1]
Ouimet et al. (2016) revealed that silencing of miR-33 and miR-33 [∗] by genetic or pharmacological means promotes autophagy flux through depression of key autophagy effectors and AMPK -dependent activation of the transcription factors FOXO3 and TFEB. [score:1]
[1 to 20 of 6 sentences]
24
[+] score: 23
It was been reported that miR-33 could inhibit cell apoptosis and control hematopoietic stem cells (HSC) self-renewal by targeting p53 [47, 48], and that this function of miR-33 could be applied to the prevention and treatment of hematopoietic disease. [score:7]
Recently, miR-33 was shown to regulate cell proliferation and cell cycle by inhibiting the expression of the cyclin -dependent kinase 6 (CDK6) and cyclin D1 (CCND1). [score:6]
In fact, miR-340 was also observed to be involved in the down-regulation of β-catenin in our research, so we believe that miR-33 and miR-340 may play their functions in a synergistic manner on the pathogenicity and carcinogenicity related to AFB [1]. [score:4]
Cell proliferation rates of Chang liver and HepG2 transfected with the miR-33 over -expression construct were significantly decreased in 96 h (Figure 5A and 5B), in comparison to cells transfected with empty vector. [score:3]
miR-33a, belonging to the miR-33 family, regulates receptor-interacting protein 140 (RIP140) in inflammatory cytokine production, by reducing RIP140 coactivator activity for NF-κB, and hence decreasing NF-κB reporter activity and thus the inflammatory potential in macrophages [49]. [score:2]
Two putative miR-33 binding sites in the 3’-UTR of β-catenin were predicted by PicTar (Figure 6A). [score:1]
[1 to 20 of 6 sentences]
25
[+] score: 20
Marquart et al. [129] delivered antimiRs intravenously (5 mg/kg/dose on three consecutive days) and showed increased ABCA1 expression and HDL-cholesterol levels in serum 12 days after administration, whereas Najafi-Shoushtari et al. [11] injected a LNA -modified antimiR-33 i. v. at a dose of 20 mg/kg for three consecutive days, which resulted in efficient inhibition of miR-33 and concomitant increase of HDL-C by 25% in the mouse serum. [score:5]
Together, these studies demonstrate that pharmacological inhibition of miR-33 in vivo by antimiR-33 oligonucleotides raises circulating HDL-C levels, enhances reverse cholesterol transport and regresses atherosclerosis, implying that therapeutic silencing of miR-33 could be a useful strategy for the treatment of cardiovascular disease. [score:5]
More recently, a third in vivo study targeting miR-33 was reported, in which low-density lipoprotein (LDL) receptor knockout mice with established atherosclerotic plaques were treated with s. c. delivered 2'F/MOE antimiR for four weeks (two s. c. injections of 10 mg/kg the first week followed by weekly injections of 10 mg/kg) [108]. [score:4]
The mature sequences of miR-33a and miR-33b differ by only two nucleotides and share the same seed region, implying that the two miR-33 family members have overlapping targets, and, thus, redundant biological functions, including regulation of cholesterol efflux in cells. [score:4]
Interestingly, another member of the miR-33 family, miR-33b, is found within an intron of the SREBP-1c gene in human and primates, whereas mice only have one miR-33 isoform corresponding to miR-33a [11]. [score:1]
Three in vivo studies have used antimiR oligonucleotides to probe the functions of miR-33 in cholesterol homeostasis in the mouse. [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 19
Other miRNAs from this paper: hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-30a, hsa-mir-32, hsa-mir-33a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-147a, hsa-mir-34a, hsa-mir-187, hsa-mir-204, hsa-mir-205, hsa-mir-200b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-138-2, hsa-mir-142, hsa-mir-144, hsa-mir-125b-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-190a, hsa-mir-200c, hsa-mir-155, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-365b, hsa-mir-328, gga-mir-33-1, gga-mir-125b-2, gga-mir-155, gga-mir-17, gga-mir-148a, gga-mir-138-1, gga-mir-187, gga-mir-32, gga-mir-30d, gga-mir-30b, gga-mir-30a, gga-mir-30c-2, gga-mir-190a, gga-mir-204-2, gga-mir-138-2, gga-let-7d, gga-let-7f, gga-mir-146a, gga-mir-205b, gga-mir-200a, gga-mir-200b, gga-mir-34a, gga-mir-30e, gga-mir-30c-1, gga-mir-205a, gga-mir-204-1, gga-mir-23b, gga-mir-142, hsa-mir-449a, hsa-mir-489, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-449b, gga-mir-146b, gga-mir-147, gga-mir-489, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-144, gga-mir-460a, hsa-mir-147b, hsa-mir-190b, gga-mir-22, gga-mir-460b, gga-mir-1662, gga-mir-1684a, gga-mir-449c, gga-mir-146c, gga-mir-449b, gga-mir-2954, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, gga-mir-365b, gga-mir-33-2, gga-mir-125b-1, gga-mir-190b, gga-mir-449d, gga-mir-205c
We noticed the miR-33-5p, miR-460a-5p, miR-365b-5p, miR-125b-5p and miR-2954 correlated with inflammatory genes including MEOX2, IL-1BETA, TRAF2, TNFRSF1B and MAP3K8, and except for the up-regulated miR-33-5 correlated with under expression of MEOX2, other down-regulated miRNAs all correlated with overexpression targets. [score:13]
Likewise, from the miRNA-mRNA association, the under expressed genes LZTFL1, JAZF1, THBS2 and RPS14 were associated with microRNAs (miR-146b-5p, miR-1684a-3p, miR-460b-3p, miR-30e-5p, miR-33-5p, miR-148a-5p, miR-32-5p, miR-155 and miR-144-3p) that were down-regulated in pulmonary arteries (Figure 4). [score:6]
[1 to 20 of 2 sentences]
27
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-204, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-365a, hsa-mir-365b, hsa-mir-369, hsa-mir-370, hsa-mir-371a, hsa-mir-375, hsa-mir-378a, hsa-mir-133b, hsa-mir-423, hsa-mir-448, hsa-mir-429, hsa-mir-486-1, hsa-mir-146b, hsa-mir-181d, hsa-mir-520c, hsa-mir-499a, hsa-mir-509-1, hsa-mir-532, hsa-mir-637, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-509-2, hsa-mir-208b, hsa-mir-509-3, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-371b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
[192] miR-33b Decrease lipogenesis via early B cell factor 1 (EBF1) targeting C/EBPα and PPARγ signaling[193] miR-93 Sirt7 and Tbx3[194] miR-125a ERRα[195] miR-130 Inhibition of adipogenesis by inhibiting PPARγ[66] miR-138 Inhibition of adipocyte differentiation via EID-1. Lipid droplet reduction[196] miR-145 Preadipocyte differentiation by targeting IRS1[197] miR-155 C/EBPβ pathway[198] mirR-193a/b Adiponectin production in the adipose tissue. [score:11]
Inhibition of miR-33 in non-human primates resulted in elevated plasma HDL and protective effects against atherosclerosis. [score:3]
However, recent studies suggest that miR-33 inhibition may have adverse effects on lipid and insulin metabolism in mice [132]. [score:3]
Other miRNAs, such as miR-27b, miR-33, miR-34, miR-103, miR-104, 223, and miR-370, also control the fatty acid metabolism and cholesterol biosynthesis in the liver. [score:1]
MiR-33-3p regulates cholesterol and lipid metabolism as well as fatty acid oxidation [131]. [score:1]
[1 to 20 of 5 sentences]
28
[+] score: 17
Furthermore, analysis of the miR-33b putative targets disclosed this miRNA as a potential regulator of both myogenesis and osteogenesis by targeting multiple genes involved in the related pathways, such as TPM3 and BMP3 34, 35. [score:6]
The region underlying this signal (Fig.   2) extends along an LD-block harbouring several genes including MYO15A, LRRC48, MIR33B, C17orf39 [GID4], DRG2, RAI1, SREBF1, TOM1L2, ATPAF2, the latter seven all shown to be expressed in skeletal muscle [30]. [score:3]
Wang H miR-33-5p, a novel mechano-sensitive microRNA promotes osteoblast differentiation by targeting Hmga2Sci. [score:3]
In addition, miR-33b may function in concert with the SREBP-1 host gene product to regulate myogenesis or/and osteogenic differentiation, as it does in controlling lipid homeostasis [45]. [score:2]
Of these, miR-33b is located in an intronic region of the SREBF1 gene and is co-transcribed with its host gene. [score:1]
The 17p11.2 is a novel locus, not previously associated with lean mass or BMD, marked by a long stretch of LD harbouring multiple genes in the region including RAI1, LRRC48, MIR33B, C17orf39, DRG2, MYO15A, SREBF1, TOM1L2, and ATPAF2. [score:1]
We identified two miRNAs, miR-6777 and miR-33b, in the associated region. [score:1]
[1 to 20 of 7 sentences]
29
[+] score: 17
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-18a, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
Several independent studies in chicken have similarly indicated that gga-mir-33 and its host gene SREBF2 are highly expressed in the liver, suggesting involvement in expression upregulation of genes related to cholesterol biosynthesis [80], [81]. [score:8]
Out of the 26 miRNA/host gene pairs with coordinated expression, 11 have been found to be coordinately expressed in both, human and mouse [19], [27], [59], [61]– [64], [67]– [69], [71], [73]– [79]: mir-103/ PANK3, mir-107/ PANK1, mir-126/ EGFL7, mir-128-1/ R3HDM1, mir-140/ WWP2, mir-211/ TRPM1, mir-218-1/ SLIT2, mir-218-2/ SLIT3, mir-27b/ C9orf3, mir-33/ SREBF2, and mir-499/ MYH7B. [score:5]
Moreover, two miRNA/host gene pairs have been found to have expression patterns associated with the same phenotype in both species: mir-499/ MYH7B with heart development [79] and mir-33/ SREBF2 with cholesterol homeostasis [74], [75], [77]. [score:4]
[1 to 20 of 3 sentences]
30
[+] score: 17
Although a trend toward the overexpression of miR-33, miR-34 and miR-92a was observed, no evidence for a statistically significant difference in miRNA expression at this early stage of the disease was found. [score:7]
A trend to an increase in miR-33-5p and -92a-5p levels and a decrease in miR-375-3p - Illumina Hi-Seq 2000, small RNAs from fly heads Drosophila mo dels: UAS-Atxn7-102Q and UAS-Atxn7-10Q[56] A study on SCA1 was the first to reveal that some miRNAs can regulate the expression of target transcript mRNA containing a CAG repeat expansion. [score:6]
The study conducted at the beginning of the pathological process revealed a trend toward a decrease in miR-1 and an increase in miR-33, miR-92a and miR-100 levels, however, the observed changes in miRNA expression were not statistically significant. [score:3]
In the case of SCA7 the level of miR-33 and miR-92 tended to be higher and the level of miR-375 was found to be lower but these differences were not statistically significant. [score:1]
[1 to 20 of 4 sentences]
31
[+] score: 15
Other miRNAs from this paper: hsa-mir-33a, mmu-mir-33
Moreover, our data clearly show a reduction in the activity of promoter constructs derived from the 5′ untranslated region of ABCA1 (Fig. 5), whereas miR-33 targets the 3′ untranslated region of ABCA1 (49). [score:7]
Accordingly, we analyzed miR-33 expression after ER stress induction. [score:3]
miR-33 expression was unaltered by thapsigargin treatment in HepG2 cells (data not shown). [score:3]
Rayner K. J. Suarez Y. Davalos A. Parathath S. Fitzgerald M. L. Tamehiro N. Fisher E. A. Moore K. J. Fernandez-Hernando C. 2010 MiR-33 contributes to the regulation of cholesterol homeostasis. [score:1]
This finding further suggests that miR-33 does not play a major role in the repression of ABCA1 under ER stress. [score:1]
[1 to 20 of 5 sentences]
32
[+] score: 14
Other miRNAs from this paper: hsa-let-7c, hsa-mir-33a, gga-mir-33-1, gga-let-7c, gga-mir-33-2
Moreover, miR-33 [*] targets the key transcriptional regulators of lipid metabolism, including SRC1, SRC3, NFYC, and RIP140 [10]. [score:4]
Together, these data support a regulatory role for miR-33a-3p and suggest that miR-33 inhibits tumor cell proliferation and metastasis by both arms of the miR-33a /miR-33a-3p duplex. [score:4]
Members of miR-33 family are intronic miRNAs that are located within the sterol regulatory element -binding protein (SREBP) genes and function as regulators of glucose and lipid metabolism [10, 11]. [score:3]
Research from Goedeke et al. showed that miR-33 [*] and miR-33 share the same targets involved in cholesterol efflux (ABCA1 and NPC1), fatty acid metabolism (CROT and CPT1a), and insulin signaling (IRS2) [10]. [score:3]
[1 to 20 of 4 sentences]
33
[+] score: 13
For the latent stage, 18 consistently differentially expressed mature miRNA sequences were identified: 8 were up-regulated (miR-212-3p, miR-21-5p, miR-132-3p, miR-20a-5p, miR-17-5p, miR-27a-3p, miR-23a-3p, miR-146a-5p) and 10 were down-regulated (miR-139-5p, miR-551b-3p, miR-33-5p, miR-708-5p, miR-7a-5p, miR-935, miR-138-5p, miR-187-3p, miR-30e-3p, miR-222-3p) (Table  2). [score:9]
The most common down-regulated miRNAs were miR-30a-5p (6 profiles), followed by miR-139-5p, miR-187-3p, miR-551b-3p, miR-140-3p, miR-324-5p, miR-33-5p, miR-218-5p, miR-378a-3p and miR-29c-5p (Supplementary Table  S4). [score:4]
[1 to 20 of 2 sentences]
34
[+] score: 13
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-29a, hsa-mir-33a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-134, mmu-mir-138-2, mmu-mir-145a, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, hsa-mir-192, mmu-mir-204, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-134, hsa-mir-138-1, hsa-mir-206, mmu-mir-148a, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-330, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-212, mmu-mir-181a-1, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-106b, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-330, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-181d, hsa-mir-505, hsa-mir-590, hsa-mir-454, mmu-mir-505, mmu-mir-181d, mmu-mir-590, mmu-mir-1b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
A detailed analysis was made on the four most significantly down-regulated miRNAs, namely miR-33, miR-330, miR-181a, and miR-10b, as determined through microarray analysis and qRT-PCR. [score:4]
A stringent computational matching approach was used to identify predicted mRNA targets for miR-33, miR-330, miR-181a, and miR-10b. [score:3]
These findings suggest that miR-33, miR-330, and miR-10b may influence cellular disease state, specifically related to cancer. [score:3]
For example, the expression level of miR-33 is decreased in tissues from patients with lung carcinoma (Yanaihara et al., 2006). [score:3]
[1 to 20 of 4 sentences]
35
[+] score: 12
Other miRNAs from this paper: hsa-mir-33a
Knocking down miR-33 in primary chicken hepatocytes increased the expression of FTO [56]. [score:4]
Furthermore, miR-33 was shown to regulate FTO expression. [score:4]
miR-33 is expressed in many tissues in the chicken, including adipose tissue. [score:3]
miR-33 is transcribed from an intronic region within SREBF2. [score:1]
[1 to 20 of 4 sentences]
36
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-204, hsa-mir-205, hsa-mir-181a-1, hsa-mir-216a, hsa-mir-217, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-370, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-335, hsa-mir-133b, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-574, hsa-mir-605, hsa-mir-378d-2, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-451b, hsa-mir-378j
One of the most significant predicted gene targets of miR-33 is ABCA1, which produces cholesterol efflux regulatory protein (CERP). [score:4]
miR-33 also targets ABCG1, which reduces the efflux of cholesterol to high-density lipoprotein (HDL) and serum in macrophages [156, 161]. [score:3]
For example, miR-33 has been shown to regulate cholesterol homeostasis at the cellular level [158, 159]. [score:2]
The known lipid regulatory microRNAs are few and include amongst others miR-335, miR-33, miR-122, miR-370, miR-378-3p, and miR-125a-5p [157]. [score:2]
[1 to 20 of 4 sentences]
37
[+] score: 11
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676 Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
severe (p<0.05) cfa-let-7c, cfa-miR-10a, cfa-miR-1307, cfa-miR-132, cfa-miR-136, cfa-miR-181a, cfa-miR-181b, cfa-miR-196b, cfa-miR-20a, cfa-miR-30d, cfa-miR-33b, cfa-miR-34c, cfa-miR-497, cfa-miR-499, cfa-miR-676 Mild vs. [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 11
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-145, rno-mir-33, rno-mir-145
As shown in Fig. 2c, miR-33-3p expression was increased (x1.4-fold, p < 0.05), whereas the expression of miR-145-3p and 7-1-5p was reduced (x0.65-0.68-fold, p < 0.0001). [score:5]
Besides observing that same increment in mTOR activity within this study, we show an increase in miR-33-3p as a new mechanism contributing to fructose reduction of hepatic IRS2 expression 40. [score:3]
To our knowledge, this is the first report on the modulation of miRNA-33 by fructose ingestion, although dietary glycaemic load, and specifically diet supplementation with liquid fructose, can alter the miRNA liver expression profile 41 42. [score:3]
[1 to 20 of 3 sentences]
39
[+] score: 10
However, another study described the down-regulation of tumor suppressor p53 by miR-33 [26], suggesting a complex and possible context -dependent response to miR-33 manipulations. [score:6]
In addition, a group of nine miRNAs (miR-33b, miR-32, miR-92a, miR-92b, miR-92c, miR-367, miR-137, miR-137a, and miR-137b) predicted by TargetScan but not differentially expressed in our microarray analysis were also assayed (Figure  2). [score:4]
[1 to 20 of 2 sentences]
40
[+] score: 10
MiR-205 over -expression leads to an expansion of the progenitor-cell population and increased cellular proliferation [26], while miR-27 reduces lipid accumulation by targeting peroxisome proliferator-activated receptor γ (PPARγ) in human adipocyte cells [27], and miR-33 represses sterol transporters in human liver cells [28]. [score:5]
For example, miR-33, which is a sense oriented intronic miRNA in the sterol regulatory element -binding protein (SREBP), is co-regulated with SREBP and is capable of targeting ATP -binding cassette sub -family G (ABCG1) [52] which is downstream of SREBP [53]. [score:5]
[1 to 20 of 2 sentences]
41
[+] score: 9
MiRNA target site/Species Human Mouse Cow Dog Chicken FrogTargeting Twist2 miR-15b-3p + − + + − − − miR-33-5p + + + + − + − miR-137-3p + + + + − + − miR-145a-5p + + + + − − + miR-151-5p + + + + − + − miR-214-5p + + + + − − − miR-326-3p + + + + − − − miR-337-3p + + + + − + − miR-361-5p + + + + − − − miR-378a-5p + + + + − − − miR-381-3p + + + + − + − miR-409-3p + + + + − − − miR-450b-5p + + + + − + − miR-508-3p + + + + − − − miR-543-3p + + + + − − − miR-576-5p + + + + − − − miR-580 + + + + − − − miR-591 + + + + − − − MicroRNAs underlined were tested in this study. [score:5]
The following miRNAs were tested for their potential to repress Twist1 translation in the human lung carcinoma cell line H1299: miR-33, miR-145a, miR-151, miR-326, miR-337, miR-361, miR-378a, miR-381, miR-409 and miR-543 (Fig. 1). [score:3]
The miRBase accession numbers for miRNAs are: mmu-miR-33 (MI0000707), mmu-miR-145a (MI0000169), mmu-miR-151 (MI0000173), mmu-miR-326 (MI0000598), mmu-miR-337 (MI0000615), mmu-miR-361 (MI0000761), mmu-miR-378a (MI0000795), mmu-miR-381 (MI0000798), mmu-miR-409 (MI0001160) and mmu-miR-543 (MI0003519). [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Chronic alcohol feeding of mice showed upregulation of miR-33, miR-34a, and miR-217 in the liver and these microRNAs were also elevated in ethanol-exposed mouse AML-12 hepatocytes. [score:4]
Importantly, ethanol feeding increased miR-33 expression and decreased VLDL secretion [4, 79]. [score:3]
Allen R. M. Marquart T. J. Jesse J. J. Baldan A. Control of very low-density lipoprotein secretion by N-ethylmaleimide-sensitive factor and miR-33 Circ. [score:1]
In ethanol fed mice, miR-33 and miR-34a were also increased, though not in cultured cells [74]. [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 9
hsa-miR-197-5p (MIMAT0022691) CGGGUAGAGAGGGCAGUGGGAGG 2102555 hsa-miR-33b-3p (MIMAT0004811) CAGUGCCUCGGCAGUGCAGCCC 204462 hsa-miR-3960 (MIMAT0019337) GGCGGCGGCGGAGGCGGGGG 2100264 hsa-miR-4443 (MIMAT0018961) UUGGAGGCGUGGGUUUU 2104824 hsa-miR-4455 (MIMAT0018977) AGGGUGUGUGUGUUUUU 2105370 hsa-miR-4515 (MIMAT0019052) AGGACUGGACUCCCGGCAGCCC 2118009 hsa-miR-762 (MIMAT0010313) GGGGCUGGGGCCGGGGCCGAGC 2114944 hsa-miR-940 (MIMAT0004983) AAGGCAGGGCCCCCGCUCCCC 204094 hsa-miR-4530 (MIMAT0019069) CCCAGCAGGACGGGAGCG 2105012 hsa-miR-486-5p (MIMAT0002177) UCCUGUACUGAGCUGCCCCGAG 204001 hsa-miR-630 (MIMAT0003299) AGUAUUCUGUACCAGGGAAGGU 204392 cel-miR-39 (MIMAT0000010) UCACCGGGUGUAAAUCAGCUUG 203952 Using an miRWalk 1.0 online tool, target genes of differentially expressed miRNAs were further co-predicted with miRWalk, Targetscan, miRanda, PICTAR2, and DIANAmT software programs. [score:7]
Figure 2Comparison of the serum levels of miR-33b-3p (A), miR-940 (B), miR-486-5p (C), miR-4443 (D), miR-3960 (E), miR-4530 (F), and miR-4739 (G) in subclinical hypothyroidism (SCH) + spontaneous abortion (SA), SCH, SA, and healthy control (HC) groups. [score:1]
Only 7 of 11 miRNAs, including miR-33b-3p, miR-940, miR-4443, miR-4530, miR-4739, miR-486-5p, and miR-3960, were stably detected in all 4 groups (Figure 1). [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 9
miR-33b inhibits the stemness, migration and invasion of metastatic breast cancer cells is by targeting HMGA2, SALL4 and Twist1 [182]. [score:5]
Lin Y. Liu A. Y. Fan C. Zheng H. Li Y. Zhang C. Wu S. Yu D. Huang Z. Liu F. MicroRNA-33b inhibits breast cancer metastasis by targeting HMGA2, SALL4 and Twist1 Sci. [score:4]
[1 to 20 of 2 sentences]
45
[+] score: 9
Phylogenetic analysis, target gene prediction and pathway analysis showed that, among the 13 conserved miRNAs (miR-1, miR-100, miR-10a, miR-124, miR-125, miR-184, miR-33, miR-34, miR-7, miR-9, miR-92a, miR-92b and miR-let7), several highly conserved miRNAs (miR-1, miR-7 and miR-34) targeted the same or similar genes leading to the same pathways in shrimp, fruit fly and human (Figure 3b). [score:5]
Six miRNAs (miR-279, miR-33, miR-79, miR-9, miR-S5 and miR-S12) were significantly down-regulated by more than twofold. [score:4]
[1 to 20 of 2 sentences]
46
[+] score: 9
Decreased expression of TTF-1 in lung carcinomas allows the overexpression of HMGA2 protein directly, by releasing the transcriptional block on its promoter, and indirectly, by removing the translational block due to miR-33b. [score:9]
[1 to 20 of 1 sentences]
47
[+] score: 9
In particular, it has been shown to be an important negative regulator of SOX4, and TENASCIN-C b) Amplifications of miR-33 produce effects that appear as dyseregulation of PTEN pathway mir-320 is found to be located in regions with CN loss in BC. [score:3]
Also miR-33 expression was found to be strongly associated with the genomic alteration [128]. [score:3]
In particular, it has been shown to be an important negative regulator of SOX4, and TENASCIN-C b) Amplifications of miR-33 produce effects that appear as dyseregulation of PTEN pathway mir-320 is found to be located in regions with CN loss in BC. [score:3]
[1 to 20 of 3 sentences]
48
[+] score: 8
Several miRs, miR-33b-3p, -542-3p, and -335-3p, are upregulated in HFKs expressing both HPV16 E6 and E7, as well as in HFKs expressing HPV16 E6 or E7 alone. [score:8]
[1 to 20 of 1 sentences]
49
[+] score: 7
Other miRNAs from this paper: hsa-mir-33a
This mechanism involves microRNA-33 (Mir-33), resulting in increased expression of srebf2 and downregulation of ABCA1 59, 60. [score:6]
However, species related differences, between mouse and human, in the role of Mir-33 in the regulation of cholesterol homeostasis have been documented [60], and could account for the differential findings. [score:1]
[1 to 20 of 2 sentences]
50
[+] score: 7
As mentioned above, SIRT -targeting miRNAs were found to be crucial for the regulation of adipogenesis and determination of MSCs differentiation towards preadipocytes (e. g., miR-34a, miR-22, miR-93, miR-146b, miR-181a) as well as lipid metabolism (miR-33, miR-34a), insulin secretion (miR-15b) and sensitivity (miR-125a), and their expression profile differs between tissues obtained from obese and normal-weight individuals [26, 41, 44, 53, 85, 86, 87, 88]. [score:6]
Hepatic-specific disruption of SIRT6 by miR-33 in mice results in enhanced glycolysis and triglyceride synthesis causing liver steatosis and correlates with increased triglyceride content observed in human hepatic cell lines, transfected with miR-33 [44]. [score:1]
[1 to 20 of 2 sentences]
51
[+] score: 7
miR-33 family members have been associated with modulation of the expression of various genes involved in cell cycle regulation and proliferation (45, 46). [score:4]
miR-33 decreases cellular proliferation and cell cycle progression via inhibition of cyclin -dependent kinase 6 and cyclin D1 (45, 46). [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 6
Other miRNAs from this paper: hsa-mir-33a
Together with its paralogue miR33a (embedded in the paralogue of SREBF1, SREBF2), miR33b targets the adenosine triphosphate -binding cassette transporter (ABCA1), decreases plasma HDL and boosts intracellular cholesterol levels in cooperation with SREBP proteins [50], [51], [52]. [score:3]
However, mouse Srebf1 does not contain mir33b [50], [51]; it is thus not a candidate accounting for the metabolic phenotype observed in Dp(11)17/+ and Df(11)17/+ mice. [score:1]
Recently, a microRNA miR33b was found to be embedded in an intron of human SREBF1 [50], [51]. [score:1]
The potential role of miR33b in human PTLS/SMS metabolic manifestation will have to be studied with different mo dels, such as those that introduce a human miR33b into the mouse genome. [score:1]
[1 to 20 of 4 sentences]
53
[+] score: 6
Shown in this figure, miR-125a-5p exhibited the highest degree, followed by miR-33a-5p,miR-33b-5p,miR-580-3p,miR-499a-5p and miR-34b-3p In the present study, we employed high-throughput circRNA microarrays to construct profiles of differentially expressed circRNAs in CD28 -associated CD8(+)T cells in the elderly and adult subjects (C1,C2,C3 and C4). [score:3]
Shown in this figure, miR-125a-5p exhibited the highest degree, followed by miR-33a-5p,miR-33b-5p,miR-580-3p,miR-499a-5p and miR-34b-3p In the present study, we employed high-throughput circRNA microarrays to construct profiles of differentially expressed circRNAs in CD28 -associated CD8(+)T cells in the elderly and adult subjects (C1,C2,C3 and C4). [score:3]
[1 to 20 of 2 sentences]
54
[+] score: 6
Figure 7(B) shows a heatmap of the expression of the enzymes involved in cholesterol biosynthesis and Figure 7(C) shows the expression of miR-33, a miRNA linked to cholesterol homeostasis [55], [56]. [score:5]
In the latter case, the evidence for a role comes from apparently highly coordinated changes in the levels of cholesterol producing enzymes as well as other genes involved in cholesterol homeostasis, such as the miRNA mir-33. [score:1]
[1 to 20 of 2 sentences]
55
[+] score: 6
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-221, hsa-mir-184, hsa-mir-361
Both SREBF2 and SREBF1 encode microRNAs, miR-33a and miR-33b respectively, and the coordinate expression of the corresponding SREBP/miRNA represents a mechanism to regulate the expression of the genes responsible of cholesterol homeostasis maintenance [56]. [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
In nonhuman primates, inhibition of miR-33a and miR-33b by an anti-miRNA oligonucleotide increased hepatic expression of ABCA1, a key regulator of high density lipoprotein (HDL) biogenesis, and induced a sustained increase in plasma HDL levels over 12 weeks, with reduction of very low density lipoprotein (VLDL) levels [56]. [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
In the case of Drosophila mo dels particular attention should be brought to the two members of conserved mir family, mir-33, and mir-92a, that show trend toward overexpression in some mo dels, albeit not statistically significant at this early time point. [score:3]
However, when we looked more closely to the miRNAs from Table 1 corresponding to conserved miRNA families, we noticed a trend to overexpression of mir-33 and mir-92a in all ataxia mo dels (Table 2), although the statistical significance is below threshold in independent analysis. [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 6
No miRNA has yet been identified in AD that appears “ de novo” with the initiation or onset of the disease, in contrast to certain cancer -associated miRNAs such as miRNA-10b or miRNA-33 that appear to be previously silent or quiescent and subsequently are “ super-activated,” i. e., up-regulated from zero-abundance, such as is seen in malignant glioblastoma brain tumors and the onset of gliomagenesis [(Gabriely et al., 2011; Teplyuk et al., 2012; unpublished data); AM Krichevsky, personal communication]. [score:6]
[1 to 20 of 1 sentences]
59
[+] score: 6
These findings are consistent with previous studies that indicate miR-33a is highly expressed in low sterol condition whereas miR-33b is more abundant in cholesterol-filled cells [50]. [score:3]
miR-33 family is transcribed from the introns of sterol-regulatory element -binding factor (SREBF) isoforms and is linked to cholesterol homeostasis [51]. [score:2]
miR-33a was more abundant in low LDL-C while miR-33b was more abundant in high LDL-C livers. [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 6
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-155
In particular, Mtb can block autophagosome maturation to create a replication niche; Mtb upregulates miR-155 in an ESAT6 -dependent manner to avoid elimination and to promote infection in macrophages (43), and Mtb also induces miR-33 to inhibit autophagy and to reprogram the host lipid metabolism to enable its intracellular survival (44). [score:6]
[1 to 20 of 1 sentences]
61
[+] score: 6
miRNA-33b and miR-93 could both regulate the MYC gene and promote apoptosis in tumors, whereas circCCDDC66 could inhibit this process by inhibiting both miRNAs [62] (Fig.   3 ). [score:6]
[1 to 20 of 1 sentences]
62
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
In a review, Gramantieri et al. (2008) show miRNAs aberrantly expressed in HCC compared to non-tumorous liver tissue (up -expression of miR-33, miR-130, miR-135a, miR-210, miR-213, miR-222, miR-331, miR-373, miR-376a, and down -expression of miR-130a, miR-132, miR-136, miR-139, miR-143, miR-145, miR-150, miR-200a, miR-200b, miR-214). [score:6]
[1 to 20 of 1 sentences]
63
[+] score: 6
Other miRNAs from this paper: hsa-mir-33a
A possible link between cholesterol and the cell cycle was suggested by Cirera-Salinas et al. [46], who showed that the microRNA miR-33, which regulates the expression of genes involved in fatty acid and cholesterol metabolism [47], also modulates expression of the genes encoding cdk6 and cyclin D1. [score:6]
[1 to 20 of 1 sentences]
64
[+] score: 6
miR-92 and miR-33 were reported to be down-regulated in the plasma of patients with bladder cancer and the expression of these two miRNAs was inversely correlated with the clinical stage of the cancer [22]. [score:6]
[1 to 20 of 1 sentences]
65
[+] score: 5
For miR-33 and miR-320, we found strong associations between miRNA expression and genomic alterations (p < 0.001), suggesting chromosomal change is a possible mechanism for mis -expression of these genes in primary human breast cancers. [score:5]
[1 to 20 of 1 sentences]
66
[+] score: 5
Other miRNAs from this paper: hsa-let-7c, hsa-mir-33a, hsa-mir-223
Protein/gene Genetic manipulation Effect on macrophage polarization ReferenceIRF5/ Irf5 KO and conditional LysM-Cre KO ↓↓ M1(14, 15)JUNB/ JunB Conditional LysM-Cre KO(16)KLF4/ Klf4 Conditional LysM-Cre KO ↑ M1/↓ M2(17)TSC1/ Tsc1 Conditional LysM-Cre KO(18)DAB2/ Dab2 Conditional LysM-Cre KO(19) let-7c (mIR) Knockdown and overexpression(20)mIR-223/ mir223 KO(21)Rictor/ Rictor Conditional LysM-Cre KO ↑↑ M1(22)AKT1/ Akt1 KO(23)IL4RA/ Il4ra KO and conditional LysM-Cre KO ↓↓ M2(24, 25)HCK/ Hck KO and knockdown(26, 27)STAT6/ Stat6 KO(28)IRF4/ Irf4 KO(29)PPARy/ Pparg KO(30)JMJD3/ Jmjd3 KO(29)P50/P105/ NfKb KO(31)PI3Kγ/ Pi3kγ KO(32)KLF6/ Klf6 Conditional LysM-Cre KO ↑ M2/↓M1(33)mIR-33/ Mir33 KO(34)MyD88/ myD88 KO(35)AKT2/ Akt2 KO ↑↑ M2(23)SHIP/ Inpp5d KO(36)SHP-2/ Ptpm6 KO(37)p16 INK4a/ Cdkn2a KO(38)TNFR1/ Tnfrsf1a KO(35)TNF/ Tnf KO(35, 39) The current classification of CAM or M1 macrophages is in part based on their response to stimulation with bacterial LPS, TNFα, and/or IFNγ (Table 1). [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 5
Silencing of miR-33 in vivo increases hepatic expression of ABCA1 and SREBP-2 [26, 27], leading to dysregulation of cholesterol homeostasis. [score:4]
Thus, miR-33 is critical to maintain normal cholesterol metabolism. [score:1]
[1 to 20 of 2 sentences]
68
[+] score: 5
The strongest signal of overlap we identified was for a variant (rs3802177) within the 3′ UTR of the SLC30A8 gene, which maps to miRanda predicted target sites for six islet-expressed miRNAs (miR-363-3p, miR-25-3p, miR-32-5p, miR-92a-3p, miR-33a-5p, and miR-33b-5p) and reaches genome wide significance in T2D-association studies [11]. [score:5]
[1 to 20 of 1 sentences]
69
[+] score: 5
EF24 can induce miR-33b which binds and inhibits high-mobility group AT-hook 2 (HMGA2) expression in Lu1205 and A375 melanoma cells. [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 4
To date, upstream regulators of SALL4 expression in leukemia remain poorly understood, although OCT4, GATA4, GATA6, STAT3, TBX5, the WNT/β-catenin signaling factors, and micorRNAs such as miR-98, miR-33b and miR-294 are reported in other cell systems [8– 10, 76, 90, 91]. [score:4]
[1 to 20 of 1 sentences]
71
[+] score: 4
MiR-342-5p, miR-3058-3p, let-7f-5p, miR-1961, miR-301b-3p, miR-98-5p, miR-1251-5p, miR-215-5p, miR-881-5p, miR-135a-2-3p, and miR-33-3p may regulate the expression of insulin-like growth factor 1 (IGF1) or insulin-like growth factor 2 (IGF2), two molecules that could rescue behavior and memory deficits via lowering A β levels [28, 29]. [score:4]
[1 to 20 of 1 sentences]
72
[+] score: 4
When considering both types of the correlated genes separately, however, we found the cell cycle-related GO term enrichments only in the miR-98 negatively correlated (153 genes from 159 probes) and in the miR-33b positively correlated gene sets (84 genes from 85 probes) (Table 4 ). [score:1]
The most striking findings were from gene sets that were correlated with miR-331, miR-98 and miR-33b. [score:1]
For the gene sets that were correlated with miR-98 (239 genes from 348 probes) and miR-33b (124 genes from 126 probes), we observed similar GO term enrichments as the miR-331 correlated genes. [score:1]
ΔΔΔthe gene list has excluded the genes that are correlated with miR-331, miR-98 and miR-33b. [score:1]
[1 to 20 of 4 sentences]
73
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
In contrast, deregulation of the expression of miR-9, miR-33, miR-92a, miR-142-3p, miR-146a, miR-181a/c, miR-210, miR-215, miR-369-5p, miR-335, miR-454, miR-496, miR-518d, and miR-599 was associated with an unfavorable long-term clinical outcome in ALL patients [65, 67– 73]. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
Also, miR-33, which is encoded by an intron within sterol regulatory element -binding protein 2 (SREBP2), the dominant sterol regulatory element binding protein supporting cholesterol synthesis and uptake, acts in concert with its host gene (SREBP2) to control cholesterol homeostasis by regulating cholesterol efflux [33]. [score:4]
[1 to 20 of 1 sentences]
75
[+] score: 4
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, dme-mir-1, dme-mir-8, dme-mir-11, hsa-mir-34a, hsa-mir-210, dme-mir-184, dme-mir-275, dme-mir-92a, dme-mir-276a, dme-mir-277, dme-mir-33, dme-mir-281-1, dme-mir-281-2, dme-mir-34, dme-mir-276b, dme-mir-210, dme-mir-92b, dme-bantam, dme-mir-309, dme-mir-317, hsa-mir-1-2, hsa-mir-184, hsa-mir-190a, hsa-mir-1-1, hsa-mir-34b, hsa-mir-34c, aga-bantam, aga-mir-1, aga-mir-184, aga-mir-210, aga-mir-275, aga-mir-276, aga-mir-277, aga-mir-281, aga-mir-317, aga-mir-8, aga-mir-92a, aga-mir-92b, hsa-mir-92b, hsa-mir-190b, dme-mir-190, dme-mir-957, dme-mir-970, dme-mir-980, dme-mir-981, dme-mir-927, dme-mir-989, dme-mir-252, dme-mir-1000, aga-mir-1174, aga-mir-1175, aga-mir-34, aga-mir-989, aga-mir-11, aga-mir-981, aga-mir-1889, aga-mir-1890, aga-mir-1891, aga-mir-190, aga-mir-927, aga-mir-970, aga-mir-957, aga-mir-1000, aga-mir-309, cqu-mir-1174, cqu-mir-281-1, cqu-mir-1, cqu-mir-275, cqu-mir-957, cqu-mir-277, cqu-mir-252-1, cqu-mir-970, cqu-mir-317-1, cqu-mir-981, cqu-mir-989, cqu-mir-1175, cqu-mir-276-1, cqu-mir-276-2, cqu-mir-276-3, cqu-mir-210, cqu-mir-92, cqu-mir-190-2, cqu-mir-190-1, cqu-mir-1000, cqu-mir-11, cqu-mir-8, cqu-bantam, cqu-mir-1891, cqu-mir-184, cqu-mir-1890, cqu-mir-980, cqu-mir-33, cqu-mir-2951, cqu-mir-2941-1, cqu-mir-2941-2, cqu-mir-2952, cqu-mir-1889, cqu-mir-309, cqu-mir-252-2, cqu-mir-281-2, cqu-mir-317-2, aga-mir-2944a-1, aga-mir-2944a-2, aga-mir-2944b, aga-mir-2945, aga-mir-33, aga-mir-980
We also observed changes in miR-957, miR-970, miR-980, and miR-33, among others (Additional file 2, Table S1). [score:1]
miR-33 was cross-referenced with the Cx. [score:1]
With the exception of miR-33, all Ae. [score:1]
Top group: miRNAs and miRNA* strands identified by deep sequencingMiddle group: predicted miR-33 was identified in C7/10 cells but absent from Cx. [score:1]
[1 to 20 of 4 sentences]
76
[+] score: 4
Moreover, it was also demonstrated that in addition to miR-155, Mtb engages other miRNAs, such as miR-33 and its star filament miR-33*, to limit the autophagic pathway, whose up-regulation in infected macrophages leads to repression of multiple autophagy effector molecules [54]. [score:4]
[1 to 20 of 1 sentences]
77
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
Dopaminergic neurons are enriched with Pixt3, which is a crucial transcription factor and miRNA-33b directly increases the expression of Pixt3 (Goodall et al., 2013). [score:4]
[1 to 20 of 1 sentences]
78
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Fasting and re-feeding experiment in rainbow trout showed significant upregulation of miR-122 and miR-33 together with cpt1a and cpt1b in liver, suggesting lipogenic role of miRNAs at multiple levels of the hepatic intermediary metabolism (Mennigen et al. 2012). [score:4]
[1 to 20 of 1 sentences]
79
[+] score: 4
Other miRNAs from this paper: hsa-mir-33a
In another group of bacteria, M.  tuberculosis through miR33 is able to persist inside host by the repression of TFEB and expression of autophagic genes (39), and therefore low lysosome formation. [score:3]
Ouimet M, Koster S, Sakowski E, Ramkhelawon B, van Solingen C, Oldebeken S, Karunakaran D, Portal-Celhay C, Sheedy FJ, Ray TD, Cecchini K, Zamore PD, Rayner KJ, Marcel YL, Philips JA, Moore KJ 2016 Mycobacterium tuberculosis induces the miR-33 locus to reprogram autophagy and host lipid metabolism. [score:1]
[1 to 20 of 2 sentences]
80
[+] score: 4
Some diagnostically relevant miRNAs, such as miR-200b, were up-regulated in the BC patients, whereas others, such as miR-92 and miR-33, were inversely correlated with the clinical stage of the cancer. [score:4]
[1 to 20 of 1 sentences]
81
[+] score: 3
Other miRNAs from this paper: hsa-mir-33a, mmu-mir-33
In contrast, a recent study reported that Mtb induces the microRNAs miR-33 and miR-33* in macrophages, which suppressed autophagy, lysosomal function, and FAO (89). [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
On the contrary, miR-33 could inhibit cyclin D1 and CDK6 at mRNA level, thus causing reduced cell proliferation and cell cycle progression during liver regeneration [21]. [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
Furthermore, ectopic expression of miR-504, miR-33, and miR-1285 has been shown to induce phenotypic changes associated with the loss of p53, including reduced apoptosis and increased stemness [49]. [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 3
Other miRNAs from this paper: hsa-mir-33a
Additionally, miR-33 controls the hepatic expression of Abcb11 and Abcg5/Abcg8 in mice and increases the relative amount of cholesterol in bile [46]. [score:3]
[1 to 20 of 1 sentences]
85
[+] score: 3
There has previously reported that low levels of miR-33a expression were found in NSCLC patients in clinical and suggested that the miR-33 family might play a significant role in NSCLC prognosis and patient survival [9]. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
The expression pattern of miR-23a and miR-33 exhibited an antagonistic relationship. [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
Six of the miRNAs identified as highly significant to tumors (HS-29, miR-135b, miR-32, miR-33, miR-542-5p and miR-96) displayed higher expression in pMMR stage IV as compared to stage II tumors (p < 0.05 and fold change > 1.5) (Figure 3C). [score:2]
Figures Array data was validated by by qRT-PCR for 10 miRNAs (mir-1, miR-10b, miR-135b, miR-147, miR-31, miR-33, miR-503, miR-552, miR-592, miR-622). [score:1]
[1 to 20 of 2 sentences]
88
[+] score: 3
Further knockdown studies of circCCDC66 confirmed that it does function as miR sponge of miR-33b and miR-93 in CRC [81]. [score:2]
Three miRs (miR-33b, miR-93, and miR-185) were predicted to be sponged by circCCDC66. [score:1]
[1 to 20 of 2 sentences]
89
[+] score: 2
Namely, pregnant rats fed SO and FO diets during the first 12 days of pregnancy showed significant lower expression of miR-449c-5p, miR-134–5p, miR-188, miR-32, miR130a, miR-144–3p, miR-431, miR-142–5p, miR-33, miR-340–5p, miR-301a, miR-30a, miR-106b, and miR-136–5p, as compared with OO, LO, and PO diets. [score:2]
[1 to 20 of 1 sentences]
90
[+] score: 2
Other miRNAs from this paper: hsa-mir-33a
Zhang QHThe miR-33 gene is identified in a marine teleost: a potential role in regulation of LC-PUFA biosynthesis in Siganus canaliculatusSci. [score:2]
[1 to 20 of 1 sentences]
91
[+] score: 2
Other microRNAs that regulate the insulin signaling pathway are miR-33, miR-103, miR-107 and miR-29 [99, 104, 105]. [score:2]
[1 to 20 of 1 sentences]
92
[+] score: 2
Other miRNAs from this paper: hsa-mir-33a, rno-mir-33
Macrophage mitochondrial energy status regulates cholesterol efflux and is enhanced by anti‐miR33 in atherosclerosis. [score:2]
[1 to 20 of 1 sentences]
93
[+] score: 2
A somatic point mutation in the precursor of human miR-33b not affecting the mature miRNA was observed in one of the 48 medulloblastoma cases, a highly aggressive brain tumor [15]. [score:2]
[1 to 20 of 1 sentences]
94
[+] score: 2
Horie T, Ono K, Horiguchi M, Nishi H, Nakamura T, Nagao K, Kinoshita M, Kuwabara Y, Marusawa H, Iwanaga Y, Hasegawa K, Yokode M, Kimura T, Kita T 2010 MicroRNA-33 encoded by an intron of sterol regulatory element -binding protein 2 (Srebp2) regulates HDL in vivo. [score:2]
[1 to 20 of 1 sentences]
95
[+] score: 2
miR-122 and miR-33, among others, play major roles in regulating cholesterol and fatty acid homeostasis in the liver [36]; however, neither of these miRNAs was modulated by the proanthocyanidins used in these experiments. [score:2]
[1 to 20 of 1 sentences]
96
[+] score: 2
Interestingly, components of cholesterol efflux and fatty acid metabolism are regulated by miR-33a and miR-33b. [score:2]
[1 to 20 of 1 sentences]
97
[+] score: 2
Other miRNAs from this paper: hsa-mir-33a, hsa-mir-122, hsa-mir-126
Baselga-Escudero L. Blade C. Ribas-Latre A. Casanova E. Salvado M. J. Arola L. Arola-Arnal A. Grape seed proanthocyanidins repress the hepatic lipid regulators miR-33 and miR-122 in rats Mol. [score:2]
[1 to 20 of 1 sentences]
98
[+] score: 2
In addition, we have confirmed miR-33b as a bona fide regulator [30]. [score:2]
[1 to 20 of 1 sentences]
99
[+] score: 2
In ESCC, HMGA2 was regulated by ZNF382, let-7 and miR-33b, and played important roles in the proliferation and EMT processes of cancer cells [19– 21]. [score:2]
[1 to 20 of 1 sentences]
100
[+] score: 1
miR-9 and miR-33 are the most possible candidate miRNAs due to their conservation and their location in flanking regions of low secondary structure stability [160]. [score:1]
[1 to 20 of 1 sentences]