sort by

24 publications mentioning hsa-mir-622

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-622. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 262
MiR-622 acts as a tumor suppressor in colorectal cancer occurrence and metastasis by suppressing K-Ras [10], in hepatocellular carcinoma [12], in lung cancer by repressing hypoxia-inducible factor-1α in ERK-responsive [13], in human esophageal squamous cell carcinoma by directly targeting E2F1 [14], in gastric cancer by targeting LAMC2 and CD82 [15]. [score:9]
The expression of miR-622 was examined in RCC cells lines (769-P, A498, 786-O, GRC-1, OS-RC-2, ACHN) and normal kidney cells (HK-2) and miR-622 expression in the RCC cell lines was lower than its expression in HK-2 cells (Fig.   1a). [score:7]
However, in some conditions, miR-622 plays an oncogene, for example, radiation could increase miR-622 expression and then promotes radioresistance of colorectal cancer cells by targeting Rb expression [8]. [score:7]
In this study, we found that low levels of miR-622 in RCC tissues and cells, which suppressed cell proliferation and metastasis by targeting CCL18 expression. [score:7]
Cheng CW Chen PM Hsieh YH Weng CC Chang CW Yao CC Hu LY Wu PE Shen CY Foxo3a -mediated overexpression of microRNA-622 suppresses tumor metastasis by repressing hypoxia-inducible factor-1α in ERK-responsive lung cancerOncotarget. [score:7]
Based on expression analysis of miR-622 in RCC cell lines treated with 5-aza, we strongly suspected that DNA methylation was one of the regulatory mechanisms of miR-622 expression. [score:6]
Its expression is restored by 5-aza-dC treatment, suggesting that abnormal expression of miR-622 is epigenetically regulated due to DNA hypermethylation RCC cells. [score:6]
CCL18 mRNA was significantly up-regulated in OS-RC-2 and ACHN cells with miR-622 inhibitors (Fig.   3c). [score:6]
g Luciferase activity in 293T cells was down-regulated significantly when the cells were co -transfected with miR-622 inhibitors and wide type of CCL18 3′UTR. [score:6]
MiR-622 were effectively down-regulated in OS-RC-2 and ACHN cells with miR-622 mimics or inhibitors transfection. [score:6]
When the cells were treated with CCL18, Erk and JUK was phosphorylated, p38 was not influenced and miR-622 inhibited the activated Erk, however, p38 and JUK was not affected; miR-622 could suppress the protein levels of cdc25, CREB, c-Fos, Mad1 induced by CCL18 in OS-RC-2 and ACHN cells (Fig.   6a). [score:5]
We determined if miR-622 expression was silenced by DNA methylation by examining the reactivation of miR-622 expression in GRC-1, OS-RC-2, ACHN and HK-2 cells following treatment with the demethylating agent 5-aza. [score:5]
Our functional analyses described that miR-622 suppressed cell growth, migration, and invasion, demonstrating that miR-622 acted as a tumor suppressor. [score:5]
MiR-622 mimics (miR-622), its negative control (miR-control), the inhibitor of miR-622 and the inhibitor controls were obtained from RiboBio (Guangzhou, China). [score:5]
Functional analysis suggested that miR-622 suppresses RCC cell growth and metastasis by targeting CCL18. [score:5]
The luciferase assay was used to test whether CCL18 is the target gene of miR-622, and the results showed that luciferase activity in OS-RC-2 and ACHN cells was down-regulated significantly when the cells were co -transfected with miR-622 mimics and wide type of CCL18 3′UTR (Fig.   3f). [score:5]
MiR-622 in RCC cells decreased CCL18 expression and suppressed CCL18 activated MAPK signal pathway. [score:4]
In cancer development and progression, miR-622 plays as a tumor inhibitor or an oncogene. [score:4]
MiR-622 suppresses migration and invasion by targeting DYRK2 in colorectal cancer cells [9]. [score:4]
We want to know whether miR-622 regulates CCL18 expression in OS-RC-2 and ACHN cells. [score:4]
The result from the wound healing assay showed that miR-622 suppressed OS-RC-2 and ACHN cell migration stimulated with CCL18 (Fig.   4c–e) Transwell system was used to observe the cell invasion ability and the result showed that the invaded cells became less in the group of cells with miR-622 than the controls and miR-622 also decrease cell invasion of CCL18 -overexpressed cancer cells (Fig.   4f–h). [score:4]
Furthermore, miR-622 expression was verified in the RCC tissues and exhibited extraordinarily low expression of miR-622 compared to the adjacent tissues (Fig.   1c). [score:4]
In summary, our results indicated that aberrant expression of miR-622 was regulated by DNA hypermethylation in RCC. [score:4]
Xu L Hou Y Tu G Chen Y Du YE Zhang H Wen S Tang X Yin J Lang L Sun K Yang G Tang X Liu M Nuclear Drosha enhances cell invasion via an EGFR-ERK1/2-MMP7 signaling pathway induced by dysregulated miRNA-622/197 and their targets LAMC2 and CD82 in gastric cancerCell Death Dis. [score:4]
MiR-622 suppresses kidney cancer cell survival and metastasis by targeting CCL18. [score:4]
f Luciferase activity in 293T cells was down-regulated significantly when the cells were co -transfected with miR-622 mimics and wide type of CCL18 3′UTR. [score:4]
Fig.  3CCL18 is a potential target gene of miR-622. [score:3]
The results demonstrated that miR-622 acted as a tumor-promoting miRNA by targeting CCL18 in RCC. [score:3]
The study demonstrated that CCL18 was a target gene of miR-622 in kidney cancer cells, which was from the prediction result. [score:3]
Our study showed that the expression of miR-622 in RCC tissues samples of patients with RCC was lower than the normal controls. [score:3]
CCL18 is a the potential target gene of miR-622. [score:3]
We examined the expression of miR-622 in RCC and adjacent normal tissues and then explored the roles of miR-622. [score:3]
It was verified that CCL18 was a target gene of miR-622 in kidney cancer cells, which was from the prediction result. [score:3]
RCC cells were transfected with CCL18 siRNA or miR-622 inhibitors for 24 h, and then seeded in the up-chamber of the transwell system, the invaded cells underside of the membrane were counted. [score:3]
It was also verified that the luciferase activity in OS-RC-2 and ACHN cells increased significantly when the cells were co -transfected with miR-622 inhibitors and wide type of CCL18 3′UTR (Fig.   3g). [score:3]
In order to confirm the DNA methylation associated with abnormal expression of miR-622, bisulfite sequencing analysis was performed to assess the methylation status of CpG islands of miR-622, and we observed that miR-622 was hypermethylated in RCC cell lines. [score:3]
A specific and inverse correlation between miR-622 and CCL18 expression was found in human RCC samples. [score:3]
d miR-622 expression in high metastasis (n = 78) and low metastasis (n = 34) of RCC. [score:3]
We performed a series of tests and found consistently lower expression levels of miR-622 in kidney cancer cells. [score:3]
Kidney cancer cells were seeded in 6-well plates and transfected with miR-622 or miR-622 inhibitors or CCL18 and cultured in the normal condition. [score:3]
The data showed that miR-622 expression was decreased in RCC samples than the controls (Fig.   5b). [score:3]
Kidney cancer cells were transfected with miR-622 inhibitors or CCL18 siRNA or the controls for 48 h and then total RNA was isolated for RT-PCR analysis. [score:3]
MiR-622 plays an inhibiting role in glioma cell proliferation, invasion and migration by down -regulating transcription factor 2 [7]. [score:3]
We found that miR-622 expression in the RCC with high metastasis was lower than it in the RCC with low metastasis or without metastasis (Fig.   1d). [score:3]
We found that OS-RC-2 cell growth was enhanced in cells with miR-622 overexpression and in CCL18 treated cells (Fig.   4a). [score:3]
OS-RC-2 and ACHN cells were transfected with miR-622 inhibitors for 48 h and RNA was extracted for RT-PCR. [score:3]
Whether miR-622 inhibits CCL18 mediated activated MAPK in RCC cells, OS-RC-2 and ACHN cells were transfected with miR-622 mimics or treated with CCL18 and then the molecules associated with MAPK signal pathway were detected. [score:3]
The results of this analysis indicated that miR-622 activity was significantly downregulated in RCC tissues compared with the corresponding normal tissues, so did in RCC cell lines. [score:3]
e CCL18 protein levels in OS-RC-2 and ACHN cells with miR-622 inhibitors transfection were texted by ELISA. [score:3]
RCC cells (1.0 × 10 [4]) were transfected with CCL18 siRNA or miR-622 inhibitors for 24 h, and then seeded in the 12-well plate and observed the wound width. [score:3]
The luciferase activity assay with a reporter containing the miR-622 binding sequence at the 3′ UTR of mRNA suggested that miR-622 directly targets the 3′ UTR of CCL18 mRNA. [score:3]
In our study, we showed that miR-622 reduced the expression level of CCL18 at both mRNA and protein levels in RCC cells. [score:3]
Overall, all of these data suggest that miR-622 might play a role as tumor suppressor in RCC. [score:3]
a miR-622 expression in RCC and HK-2 cells following treatment with the demethylating agent 5-aza. [score:3]
Using Western blot and luciferase reporter assays, it was verified that CCL18 was a direct target of miR-622. [score:3]
The cell invasion was assayed by transwell system, and the data indicated that miR-622 could inhibited RCC cell invasion, but not in HK-2 cells (Fig.   1b). [score:2]
MiR-622 inhibits CCL18 activated MAPK signal pathway in RCC cells. [score:2]
MiR-622 plays an inhibiting role in various cancer like glioma [7], colorectal cancer [8– 10], hepatocellular carcinoma [11, 12], lung cancer [13], esophageal squamous cell carcinoma [14] and gastric cancer [15]. [score:2]
Fig.  1Down-regulation of miR-622 in RCC tissues is correlated with clinicopathological characteristics. [score:2]
MiR-622 could lead to the suppression of cell proliferation and metastasis of kidney cancer. [score:2]
MiR-622 expression levels recovered by 3–5-folds after 5-aza treatment in GRC-1, OS-RC-2 and ACHN cells, but not HK-2 cells (Fig.   2a). [score:2]
But, the regulatory mechanism of miR-622 in RCC is still unknown. [score:2]
Down-regulation of miR-622 in RCC tissues is correlated with clinicopathological characteristics. [score:2]
MiR-622 plays as a tumor inhibitor in some types of cancer, however, its role in kidney cancer is unknown. [score:2]
The further investigation indicated that miR-622 suppressed CCL18 activated MAPK signal pathway in RCC cells. [score:1]
Furthermore, we detected CpG island methylation of miR-622 in RCC cell lines (including 769-P, A498, 786-O, GRC-1, OS-RC-2 and ACHN) by BSP analysis of multiple clones in the cell lines. [score:1]
miR-622 Kidney cancer CCL18 MAPK Renal cell carcinoma (RCC) is the most common type of human kidney cancer, and clear cell RCC (ccRCC) is one of major histologic subtype. [score:1]
The biological functions of miR-622 in the reported cancers include cell proliferation and metastasis [7– 15]. [score:1]
MiR-622 expression in the tissues of 112 RCC patients were assayed by RT-PCR. [score:1]
The clinical results demonstrated that miR-622 was negatively associated with CCL18 in the samples of RCC patients. [score:1]
In RCC, the functional roles of miR-622 were not known. [score:1]
c miR-622 expression was measured in RCC tissues by RT-PCR. [score:1]
Liu H Liu Y Liu W Zhang W Xu J EZH2 -mediated loss of miR-622 determines CXCR4 activation in hepatocellular carcinomaNat Commun. [score:1]
b MiR-622 expression in the tissues of RCC patients were assayed by RT-PCR. [score:1]
c The analysis of relationship between miR-622 and CCL18 mRNA levels in the samples. [score:1]
d CCL18 protein levels in OS-RC-2 and ACHN cells with miR-622 mimics transfection were texted by ELISA. [score:1]
The analysis of relationship between miR-622 and CCL18 levels in the samples showed that both of them had negative association (Fig.   5c). [score:1]
OS-RC-2 and ACHN cells were transfected with miR-622 mimics for 48 h and RNA was extracted for RT-PCR. [score:1]
All the cells were transfected with miR-622 mimics and its control for 24 h and then seeded in the up-chamber with matrigel treatment. [score:1]
a miR-622 expression was measured in kidney cancer cells by RT-PCR. [score:1]
a OS-RC-2 and ACHN cells were transfected with miR-622 mimics or treated with CCL18 and then the molecules associated with MAPK signal pathway were detected by western blotting. [score:1]
The mRNA levels of MAPK associated proteins were measured and the data indicated that the mRNA of the genes involved in cell proliferation, metastasis associated MAPK signal pathway was enhanced in the OS-RC-2 and ACHN cells with CCL18 treatment, and miR-622 suppressed them (Fig.   6b, c). [score:1]
b CpG island methylation of miR-622 in RCC cell lines and normal kidney epithelial cells (HK-2) by BSP analysis of multiple clones in the cell lines. [score:1]
Bisulfite sequencing in all the above RCC cell lines confirmed marked methylation of the promoter region of miR-622, however, there was no methylation in normal cells (HK-2) (Fig.   2b). [score:1]
[1 to 20 of 84 sentences]
2
[+] score: 54
To further define miRNA -mediated target mRNA cleavage and uridylation at specific cleavage sites on the target mRNA, we analysed the SLA–RT-PCR or SLA–qRT-PCR amplicon patterns and intensities of the cleaved and 3′-uridylated fragments of human kRAS mRNA directly targeted by a single miRNA species, hsa-miR-622 20, in H1299 cells by overexpression of the miR-622 gene, using the overexpressed let-7d as a nonspecific control, which was confirmed to have no predicted binding activity in this miR-622 -targeted KRAS mRNA region (Fig. 2a). [score:14]
Overexpression of miR-622 in H1299 cells resulted in increased accumulation of both the cleaved kRAS mRNA fragments at bases G6, U7 and C8, as detected by both SLA–RT-PCR and SLA-qRT-PCR (Fig. 2a, SLA-RT and SLA-qRT-PCR), and the 3′-oligouridylated fragments at bases G6 and C8, as detected by 2U-SLA–RT-PCR and 2U-SLA-qRT-PCR (Fig. 2a, 2U-SLA-RT and 2U-SLA-qRT-PCR), compared to their steady expression backgrounds detected in the control H1299 cells overexpressing let-7d. [score:6]
Total RNAs were isolated from H1299 cells transfected with a miR-622 expression vector or a let-7d expression vector as a nonspecific control. [score:5]
Overexpressed miR-622 and let-7d mRNAs were detected by qRT-PCR in H1299 cells transfected with a miR-622 or a let-7 expression vector, respectively (Fig. 2b). [score:5]
Accumulation of Cleaved Target kRAS mRNA 5′-fragments by miR-622 Overexpression in H1299 Cells. [score:5]
Overexpression of miR-622 resulted in an accumulation of cleaved kRAS mRNA fragments at bases G6, U7 and C8, and of the 3′-oligouridylated fragments at bases G6 and C8 corresponding to the miR-622 seed region but with ignorable cleavage and uridylation activities at bases C12-C20 in central bulge and supplementary base pair regions, as indicated by red boxes. [score:3]
pLJ-T241:miR-622 expression vector. [score:3]
miR-622 and miR-30a were used as nonspecific controls and their expression levels were normalised to those of RNU44. [score:3]
The markedly increased accumulation of the cleaved kRAS fragments at U7 in conjunction with the uridylated fragments at U7 could have been due to either miR-622–mediated direct cleavage activity at U7 or the addition of one uridine to the 3′ ends of cleaved kRAS fragments at C8. [score:2]
of the quantitative real-time RT-PCR (SLA-qRT-PCR) analysis of miR-622 -mediated target kRAS mRNA cleavage and uridylation activities at corresponding sites to the above SLA-RT-PCR reactions were represented as relative fragment abundance (RFA) compared to the highest amplicon abundance in individual qRT-PCR series and shown in lower graph panels. [score:2]
PCR was performed on genomic DNA extracted from normal human bronchial epithelial cells with the following primers flanking the miR-622 precursor: GGACTAGTGAATTCTTTAGAGAAGCTGGACAAGTACT ACTTGTAACTCGAGAAAAGTGTCATCTCAGCAGCTC PCR fragments were digested with SpeI/ EcoRI and cloned into a CMV promoter–driven expression plasmid with BGH poly(A) signal. [score:2]
PCR was performed on genomic DNA extracted from normal human bronchial epithelial cells with the following primers flanking the miR-622 precursor: GGACTAGTGAATTCTTTAGAGAAGCTGGACAAGTACT ACTTGTAACTCGAGAAAAGTGTCATCTCAGCAGCTCPCR fragments were digested with SpeI/ EcoRI and cloned into a CMV promoter–driven expression plasmid with BGH poly(A) signal. [score:2]
Increased accumulation of the 3′-uridylated fragments at C8 was detected by both 2U-SLA–RT-PCR and 2U/8U-SLA-qRT-PCR (Fig. 2a, 2U-SLA-RT, 2U-SLA-qRT-PCR, and 8U-SLA-qRT-PCR), suggesting that the miR-622–mediated cleavage of kRAS mRNA occurred at C8 with one uridine addition to the 3′-end of the cleaved fragment. [score:1]
Let-7 family miRNA, hsa-miR-622, hsa-miR-30a and hsa-RNU44 in H1299 cells were determined by SLA–RT-PCR methods. [score:1]
[1 to 20 of 14 sentences]
3
[+] score: 14
Down-regulation of miR-622 in gastric cancer promotes cellular invasion and tumor metastasis by targeting ING1 gene. [score:6]
In two different approaches researchers have shown an important role for the gene inhibitor of growth (ING4) which is targeted by hsa-miR-650 and hsa-miR-622 and this in turn, seems to be associated with increased invasion/migration of gastric cell lines in vitro and promote metastasis in nude mice (Zhang et al., 2010; Guo et al., 2011). [score:5]
So, there are miRNA profiles that promote tumor growth including hsa-miR-622, hsa-miR-650, hsa-miR-223, hsa-miR-21, and hsa-miR-181a, among others (Zhang et al., 2010, 2012a, b; Guo et al., 2011; Li et al., 2011b); while hsa-miR-107, -145, -495, -551a, let-7f, -218, and -610, among others, inhibit cell invasion and metastasis (Tie et al., 2010; Li et al., 2011a, 2012b; Liang et al., 2011; Feng et al., 2012; Gao et al., 2012; Wang et al., 2012). [score:3]
[1 to 20 of 3 sentences]
4
[+] score: 14
MiR-622 expression was down-regulated in gastric cancer whereas ectopic expression of miR-622 promoted invasion, tumorigenesis and metastasis of GC cells both in vitro and in vivo. [score:8]
A luciferase reporter assay showed the effect of miR-622 on inhibitor of growth family, member 1 (ING1) expression [111]. [score:4]
Deregulation of others miRNAs, such as miR-622, miR-107, miR-221, and miR-222, has been described in GC. [score:2]
[1 to 20 of 3 sentences]
5
[+] score: 9
Other miRNAs from this paper: hsa-mir-488, mmu-mir-488
Zhang R MiR-622 suppresses proliferation, invasion and migration by directly targeting activating transcription factor 2 in glioma cellsJ. [score:5]
We also noticed that several potential PtpA -targeted ncRNA genes (such as miR-488, CASC2, and miR-622) are involved in tumor progression through regulating cell apoptosis, proliferation, and migration 55– 57. [score:4]
[1 to 20 of 2 sentences]
6
[+] score: 8
Xie et al. revealed 14 upregulated miRNAs (including miR-21, miR-26b and miR-30b) and 19 downregulated miRNAs (including let-7i, miR-7 and miR-622) which contributes to gastric cancer development and progression by using miRNA microarray profiling [16]. [score:8]
[1 to 20 of 1 sentences]
7
[+] score: 7
The hsa-mir-622 family seems to be further expanded in the primate lineage. [score:1]
To validate the results obtained by computational prediction, we selected two probes for the two microRNA families (hsa-mir-1233 and hsa-mir-622), and labeled them with TAMRA (red) and FITC (green), respectively (Additional file 11). [score:1]
Two microRNA families (hsa-mir-1233 and hsa-mir-622) appear to be further expanded in the human genome, and were confirmed by fluorescence in situ hybridization. [score:1]
b. hsa-mir-622 family (Green). [score:1]
One of them was identified previously (hsa-mir-1233), and one novel microRNA family (hsa-mir-622) detected in this study. [score:1]
In addition, nine microRNA families were found to be nonspecific to primate genomes, in which four of them were novel (hsa-mir-622, hsa-mir-220, hsa-mir-199b and hsa-mir-1282) (Figure 2b). [score:1]
Fluorescence in situ hybridizationTo validate the results obtained by computational prediction, we selected two probes for the two microRNA families (hsa-mir-1233 and hsa-mir-622), and labeled them with TAMRA (red) and FITC (green), respectively (Additional file 11). [score:1]
[1 to 20 of 7 sentences]
8
[+] score: 7
We found nine miRNAs (miR-622, -512-5p, -504, -497, -34a, -302d, -302b*, -29c, -20b) upregulated in the cells. [score:4]
Only miR-622, -497, and -34a inhibited the proliferation of lung cancer cells, whereas the remaining six miRNAs had no effect on cell proliferation in our preliminary experiments. [score:3]
[1 to 20 of 2 sentences]
9
[+] score: 5
Other miRNAs from this paper: hsa-mir-492, hsa-mir-4788, hsa-mir-7161
For instance, hsa- miR-622, which acts as a suppressor of tumorigenesis in cancers, including hepatocellular carcinoma [145], overlaps with the genomic locus of the KRT18P27 retrocopy. [score:3]
Song W. -H. Feng X. -J. Gong S. -J. Chen J. -M. Wang S. -M. Xing D. -J. Zhu M. -H. Zhang S. -H. Xu A. -M. MicroRNA-622 acts as a tumor suppressor in hepatocellular carcinomaCancer Biol. [score:2]
[1 to 20 of 2 sentences]
10
[+] score: 5
For the efficient target AXIN2, miR-622 repressed it in CIN I stage but not in CIN III stage, and AXIN2 having contribution to the ‘dorsal/ventral axis specification’ process only in CIN III stage. [score:3]
Our finding suggests that due to miR-622’s differential regulation on AXIN2, the Wnt signaling may be stabilized in CIN III stage. [score:2]
[1 to 20 of 2 sentences]
11
[+] score: 5
In glioma cells, miR-622 inhibited tumor invasion and migration by targeting activating transcription factor 2 (ATF2) [74]. [score:5]
[1 to 20 of 1 sentences]
12
[+] score: 5
In a mo del of transformed human bronchial epithelial cell line, Han et al. demonstrated that miR-622 down-regulation was correlated with an activation of the RAS-MAPK pathway due to a direct interaction with KRAS mRNA [73]. [score:5]
[1 to 20 of 1 sentences]
13
[+] score: 4
001 hsa-miR-210 11p15.5 Up (3.23) 0.021 hsa-miR-30b 8q24.2 Down (-2.02) 0.015 hsa-miR-30c 1p34.2 Down (-2.32) 0.039 hsa-miR-494 14q32.3 Up (8.03) 0.021 hsa-miR-497 17p13.1 Down (-2.15) 0.014 hsa-miR-502 Xp11.23 Down (-2.43) 0.014 hsa-miR-532 Xp11.23 Down (-2.11) 0.049 hsa-miR-551b 3q26.2 Down (-7.30) 0.034 hsa-miR-622 13q31.1 Up (2.39) 0.015 Hierarchical clustering of 44 miRNA genes with significantly different expression (p<0.05) in tumor tissues. [score:3]
001 hsa-miR-210 11p15.5 Up (3.23) 0.021 hsa-miR-30b 8q24.2 Down (-2.02) 0.015 hsa-miR-30c 1p34.2 Down (-2.32) 0.039 hsa-miR-494 14q32.3 Up (8.03) 0.021 hsa-miR-497 17p13.1 Down (-2.15) 0.014 hsa-miR-502 Xp11.23 Down (-2.43) 0.014 hsa-miR-532 Xp11.23 Down (-2.11) 0.049 hsa-miR-551b 3q26.2 Down (-7.30) 0.034 hsa-miR-622 13q31.1 Up (2.39) 0.015 Three miRNAs (hsa-miR-494, hsa-miR-551b, and ebv-miR-BART19) were validated in an independent sample set of non-TRU- and TRU-type lung adenocarcinoma and corresponding normal lung tissue (n = 21 and 12, respectively) by qRT-PCR. [score:1]
[1 to 20 of 2 sentences]
14
[+] score: 4
Other miRNAs from this paper: hsa-mir-129-1, hsa-mir-129-2, hsa-mir-423, hsa-mir-18b, hsa-mir-452
Aliquots of sera were pooled from patients with Ross scores <3, 3–5, and >5 for expression analysis of miR129-5p, miR18b, miR423-5p, miR622, and miR452. [score:3]
Following linear pre-amplification of miRNA sequences using the Applied Biosystems Preamplification system, relative expression was determined using singleplex TaqMan Assays (ABI) with primer sets for miR-129 (ABI; 000590), miR-18b (ABI; 002310), miR-423-5p (ABI; 002340), miR-622 (ABI; 001553), and miR-452 (ABI; 002330). [score:1]
[1 to 20 of 2 sentences]
15
[+] score: 3
In addition, transfection with mimetic miRNAs, such as miR-31-5p [40], miR-100 [41], miR-630 [42] and miR-124 [43], or inhibition of miR-622 [44] and miR-221 [45], resulted in an increase of radiosensitivity at high- dose IR (4 Gy) in several CRC cell lines. [score:3]
[1 to 20 of 1 sentences]
16
[+] score: 3
Recent studies also indicate that some miRNAs contribute to gastric carcinoma, including activated miRNAs (such as miR-21, miR-107, miR-222, and miR-106b) and suppressed miRNAs (such as miR-143, miR145, miR-622, and miR-148a) [16]. [score:3]
[1 to 20 of 1 sentences]
17
[+] score: 3
miRNAs selected for validation studies spanned a range of expression from high to single alignments, and included miR-21, miR-30, miR-98/Let7 family members, miR-221, miR-222, miR-622, miR-664, miR-1248 and miR-1291. [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 3
Namely, miR-765, miR-622, and miR-1300 had significantly lower expression levels in female HCC than in male HCC (Table  2). [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 2
Importantly, this signature includes all four members of the hsa-miR-200 family (hsa-miR-200a, hsa-miR-200b, hsa-miR-200c, hsa-miR-141), hsa-miR-155, and hsa-miR-622 miRNAs. [score:1]
Other known significant miRNAs of this signature are hsa-miR-155 and hsa-miR-622, which were also linked to enhanced tumorigenesis in various cancer types besides breast cancer [54, 55]. [score:1]
[1 to 20 of 2 sentences]
20
[+] score: 1
Figures Array data was validated by by qRT-PCR for 10 miRNAs (mir-1, miR-10b, miR-135b, miR-147, miR-31, miR-33, miR-503, miR-552, miR-592, miR-622). [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
Nine miRNAs (miR-888-5p, miR-454-3p, miR-10a-5p, miR-181c-5p, miR-1909-3p, miR-20a-3p, miR-484, miR-501-5p, and miR-622) were detected in at least 50% of cases and not detected in the corresponding matched control. [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
Chen and co-workers identified a panel of 5miRNAin this regard; let-7c, let-7e, miR-30c, miR-622, and miR-1285. [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
Other miRNAs from this paper: mmu-mir-138-2, hsa-mir-138-2, hsa-mir-138-1, mmu-mir-138-1
Liu H Liu Y Liu W Zhang W Xu J EZH2 -mediated loss of miR-622 determines CXCR4 activation in hepatocellular carcinomaNat. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
Among FOXO family, Cheng et al. reported that FOXO3a-miR-622 axis inhibited HIF-1α to interfere mesenchymal characteristics of tumor cells in ERK-responsive lung cancer 38. [score:1]
[1 to 20 of 1 sentences]