sort by

22 publications mentioning rno-mir-503-1

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-503-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 203
Considering that FGF2 functions as an important positive regulator in osteogenesis, the suppression of FGF2 induced by miR-503 might directly inhibit bone formation. [score:7]
Furthermore, we also observed that miR-503 inhibitor significantly abrogated the upregulation of osteogenic markers (Fig.   4C) and sensitized the promoted osteogenic effect (Fig.   4D) induced by Smurf1 knockdown. [score:7]
Overexpression of miR-503 could promote bone formation in vitro and in vivo through targeting Smurf1. [score:5]
Therefore, we confirmed that miR-503 exerted osteogenic functions through suppressing Smurf1 expression, which partially explain the underlying mechanism of DO. [score:5]
The further investigation also showed that miR-503 triggered osteogenesis in vitro and promoted bone formation in vivo through suppressing Smurf1 expression, which serves as an inhibitor of osteoblast. [score:5]
However, our results showed that miR-503 was highly expressed during distraction osteogenesis and overexpression of miR-503 promoted bone formation. [score:5]
In order to validate whether it is a bona fide target for miR-503, we inserted the target sites into the 3′ UTR locus of firefly luciferase (Fig.   3D). [score:5]
To elucidate whether the osteogenic effect of miR-503 was mediated by the suppression of Smurf1 in rBMSCs, a small interfering RNA (siRNA) specifically targeting Smurf1 was designed and its osteogenic effect was monitored. [score:5]
In this study, miR-503 was screened from microRNA array and we also identified that it promoted osteogenic differentiation in rBMSCs and enhanced bone regeneration in DO animal mo del through suppressing Smurf1 expression. [score:5]
As a tumor suppressor, miR-503 was reported to suppress cell proliferation and metastasis in multiple cancers, such as glioma [21], osteosarcoma [22], colorectal cancer [23], breast cancer [24] and prostate cancer [25]. [score:5]
It was showed that miR-503 dramatically suppressed the luciferase activity when compared with control groups and mutations on the binding sites successfully abolished the suppressive effects (Fig.   3E,F). [score:5]
For example, we only investigated the relationship between miR-503 expression and bone formation in DO, however, the direct relationship between miR-503 expression and mechanical stimulation has not been fully revealed. [score:4]
In summary, our results illustrated that miR-503 was upregulated during distraction phase of DO. [score:4]
MicroRNA-503 represses epithelial-mesenchymal transition and inhibits metastasis of osteosarcoma by targeting c-myb. [score:4]
MiR-503 was identified as one of the most differentially expressed miRNAs compared to its expression in normal bone tissue. [score:4]
These data indicated that the elevated expression of miR-503 would play important roles in regulating calcification in DO and osteogenic differentiation of rBMSCs. [score:4]
To verify the results of microarray, we also took advantage of qPCR and the results confirmed that miR-503 was significantly upregulated at the distraction period of DO and early stage of osteogenesis of bone mesenchymal stem cells of rats (rBMSCs) (Fig.   1D). [score:4]
According to the dramatic changes showed in the heat-map results, miR-503 is of great interest due to its one of the most upregulation in all the samples (Fig.   1C). [score:4]
Chen’s study demonstrated that miR-503 could regulate osteoclastogenesis through targeting RANK. [score:4]
MiR-503 could suppress while its inhibitor promote the luciferase activity. [score:4]
By transfecting rBMSCs with miRNA mimics, we demonstrated both miR-503 significantly downregulated the mRNA and protein levels of Smurf1 (Fig.   3A–C). [score:4]
Overexpression of miR-503 in rBMSCs. [score:3]
Figure 5X-ray and microCT analysis confirm miR-503 overexpression therapy promote bone formation. [score:3]
Considering that many miRNAs have been reported to be sensitive to the mechanical stimulation, further analysis should lay emphasis on the miR-503 expression when exposed to mechanical stimulation, especially tensile stimulation. [score:3]
In this study, we performed a comparative microRNA profiling to identify the differently expressed miRNAs and miR-503-5p (miR-503) was found to be the promising candidate in DO animal mo del. [score:3]
Our results also indicated osteogenic markers, such as ALP, BMP2 and Runx2, were increased when Smurf1 was silenced by Smurf1 siRNA, a similar effect to miR-503 overexpression. [score:3]
Local injection of miR-503 overexpressing rBMSCs enhances bone formation in DO animal mo del. [score:3]
To elucidate the biological effect of miR-503 on osteogenesis of rBMSCs, agomir-503 and antagomir-503 were transiently transfected into rBMSCs and the expression of several osteogenic marker genes were examined. [score:3]
Another report indicated miR-503 suppressed proliferation and migration through modulation of FGF2 in osteosarcoma cells [27]. [score:3]
The miR-503 mimics and inhibitor were obtained from Genepharma Company (Genepharma, China). [score:3]
Eight weeks after injection, higher bone volume fraction (BV/TV) was observed in distraction gap in miR-503 overexpression group by microCT examination (Fig.   5A,B). [score:3]
Taken together, our results demonstrated that Smurf1 was a real target of miR-503 in rBMSCs. [score:3]
These results suggest that overexpression of miR-503 could promote osteogenic differentiation in rBMSCs. [score:3]
To test the in vivo function of miR-503 in DO process, miR-503 overexpressing rBMSCs were developed and locally injected into the distraction gap at the end of distraction period. [score:3]
Figure 7Bone tissue regeneration is accelerated by overexpression miR-503 therapy in DO animal mo del. [score:3]
Considering that osteogenesis could be enhanced by miR-503 overexpression, we also investigated the bone formation ability of miR-503 overexpression in animal mo del of DO in vivo. [score:3]
Tibiae of the group with miR-503 overexpressing rBMSCs also showed better mechanical properties than the control group in ultimate load and energy by mechanical testing (Fig.   6). [score:3]
Besides, a rescue effect was observed that miR-503 inhibitor alleviated the enhanced osteogenic effect induced by Smurf1 siRNA. [score:3]
Smurf1 is a bona fide target of miR-503. [score:3]
The result showed the osteogenic capacity of rBMSCs was significantly promoted by miR-503 overexpression. [score:3]
Quantitative Real-Time PCR for miR-503 expression level. [score:3]
Besides, the regenerated bone was much more mature in distraction gap in miR-503 overexpression group than that in control group (Fig.   7B). [score:3]
Therefore, miR-503 overexpression therapy could be used as a novel intervene for promoting bone formation of DO. [score:3]
Result indicated miR-503 overexpression could promote mineralization of newly formed bone. [score:3]
The outcomes demonstrated that bone formation was accelerated in the group with miR-503 overexpression MSCs injection. [score:3]
Among the candidates predicted by the bioinformatics analysis, we found that Smurf1 is of great interest, in which its 3′-untranslated region (UTR) was predicted as a potential binding site of miR-503. [score:3]
Figure 6Bone healing property is enhanced by miR-503 overexpression therapy. [score:3]
Overexpression of miR-503 could prevent bone loss in ovariectomized mice, while silencing of miR-503 could promote bone resorption [26]. [score:3]
In recent studies, miR-503 was also reported to regulate bone metabolism. [score:2]
MiR-503 overexpression promotes osteogenic differentiation of rBMSCs. [score:2]
MiR-503 expression is increased during the distraction period of DO and osteogenic differentiation of rBMSCs. [score:2]
By using online bioinformatics tools, Smurf1 was predicted to be a target gene of miR-503 and we also confirmed this prediction by using biological assays. [score:2]
To analyze the expression level of miR-503-5p, a total reaction volume of 20  μL contained 10  μL SYBR Mix, 5.6  μL RNase-free water, 1  μL miR-503-5p primer, 1  μL universal adaptor PCR primer, 2  μL cDNA template, and 0.4  μL ROX. [score:1]
Fold change of miR-503 expression level at different time points were calculated through compared to the expression level at day 0. (n = 3 each time points, * P < 0.05 compared to Day 0, U6 was used as an internal reference). [score:1]
Figure 4Smurf1 involves in miR-503 induced osteogenic differentiation in rBMSCs. [score:1]
Histological analysis indicated that bone regeneration and remo deling were vigorous in miR-503 group while still lots of fiber tissue remained in the distraction area in control group (Fig.   7A). [score:1]
Although we demonstrated the osteogenic function of miR-503 in vitro and in vivo, there were some limitations in this study. [score:1]
Smurf1 involves in the miR-503 mediated osteogenesis. [score:1]
These findings not only provide potential cues to explain the mechanism of DO in bone formation but also offer preclinical evidences that miR-503 may become a novel therapeutic to promote bone formation in clinic. [score:1]
The mineral apposition rate (MAR) and mineral surface versus bone surface (MS/BS) results also indicated bone regeneration was accelerated due to miR-503 intervention (Fig.   7C,D). [score:1]
Each vector, along with Relina vector and miR-503 mimics or negative control, were transfected into 293 T cells using Lipofectamine 2000 reagent (Invitrogen, USA) following the instructions. [score:1]
The structure of the distracted bone had already repaired as normal at day 44 postoperation in miR-503 intervention group. [score:1]
On the other hand, the miR-503 binding sites were mutated and the mutated luciferase reporters were co -transfected with agomir-503 or antagomir-503. [score:1]
However, ultimate load (B) and energy between (C) were much higher in miR-503 group than that in control group (n = 10 each group, * P < 0.05). [score:1]
To generate pLL3.7-pre-miR-503, the oligonucleotides encoding pre-miR-503 were amplified and cloned into the XhoI site of pLL3.7 under the control of U6 promoter. [score:1]
Wild type (Wt) and mutant (Mu) 3′ UTR of Smurf1 containing the binding site with miR-503 were inserted into pMIR-GLO vector. [score:1]
Fold change of miR-503 expression at different time points were calculated through compared to the expression level at day 0. (n = 3 each time points, * P < 0.05 compared to Day 0). [score:1]
[1 to 20 of 67 sentences]
2
[+] score: 121
Other miRNAs from this paper: rno-mir-191a, rno-mir-191b, rno-mir-503-2
As previously mentioned, CDC25 activates cell cycle progression through CDKs (Donzelli and Draetta, 2003 ▶) and up-regulation of miR-503 inhibits the proliferation of endothelial cells by degradation and inhibition of CDC25 protein (Yamakuchi, 2012 ▶). [score:8]
of this study showed that diabetes decreased heart tissue angiogenesis which was associated with increased miR-503 and reduced CDC25 expression levels (p<0.05) and IMOD™ could reduce the expression of miR-503 and increase the expression of CDC25 (p<0.05). [score:7]
Therefore, it is likely that at least a part of angiogenic effect of IMOD™ is mediated through inhibition of miR-503 expression and enhancement of CDC25 expression. [score:7]
Moreover, in this study, IMOD™ diminished miR-503 expression, while enhanced CDC25 expression in diabetic rats. [score:5]
They notified that miR-503 is involved in angiogenesis impairment during ischemic condition in endothelial cells and also showed that over -expression of miR-503 inhibits proliferation, migration, and network-formation of endothelial cells. [score:5]
Data of this study showed that diabetes increased miR-503 expression while reduced CDC25 gene expression and angiogenesis in rats with type 1diabetes and administration of IMOD™ tended to restore these values to normal levels in diabetic animals. [score:5]
In agreement with these studies, current study showed that hyperglycemia during diabetes increases miR-503 expression, but reduces CDC25 expression. [score:5]
It is concluded that IMOD™ can reduce miR-503 expression while it can increase the expression of CDC25 and augment angiogenesis in diabetic heart tissue. [score:5]
In agreement with our data, Caporali et al. revealed that hyperglycemia leads to increases in miR-503 expression in the ischemic muscles of diabetic rats, so that, inhibition of miR-503 function can effectively improve proliferation and migration of endothelial cells in diabetes. [score:5]
Caporali et al. also reported that over -expression of miR-503 inhibits the migration and proliferation of endothelial cells by affecting CDC25 levels (Caporali et al., 2011 ▶). [score:5]
The angiogenic effect of IMOD™ is associated with reduction of miR-503 expression and increased expression of CDC25. [score:5]
It has been further revealed that miR-503 decreases the expression of CDC25 through proteasome degradation and transcriptional inhibition (Sarkar et al., 2010). [score:5]
Their results also pointed out that the expression level of CDC25 as a target of miR-503, is reduced in ischemic muscles of mice with STZ -induced diabetes (Caporali et al., 2011 ▶). [score:5]
Effects of diabetes and IMOD™ on miR-503 expression in heart tissue In this study, it was shown that diabetes significantly increased miR-503 expression in the heart tissue compared to control group (p<0.01). [score:4]
Therefore, miR-503 might be considered an inhibitor of post-ischemic new vessel formation in hyperglycemia, and it can be a potential therapeutic target for endothelial dysfunction in diabetes mellitus (Caporali et al., 2011 ▶). [score:4]
However, IMOD™ had no significant effect on expressions of miR-503 and CDC25, or angiogenesis in healthy rats. [score:3]
However, IMOD™ had no significant effect on miR-503 expression in non-diabetic rats (Figure 1). [score:3]
Gene name Accession number Target sequence CDC25 NM_133571.1F: AAGGCAAACCTGTTAAGTGTG [a]R: GGGTACACTTCAACATTCCAG rno-miR-503-5p MIMAT0003213UAGCAGCGGGAACAGUACUGCAG [b] a Sequences were derived from NCBI (www. [score:3]
The results of the current experiment showed that IMOD™ decreased miR-503 expression in diabetic animals. [score:3]
To find the mechanism through which IMOD™ promotes angiogenesis, we evaluated the expression levels of miR-503 and its target gene, CDC25, in diabetic heart tissue. [score:3]
Figure1Effect of diabetes and 8-week IMOD™ treatment on miR-503 expression in the heart tissue of experimental groups (n=8). [score:3]
The miR-503 and CDC25 expression levels were quantitatively assessed by real-time PCR. [score:3]
It is thus conceivable that CDC25 gene is a target of miR-503 that plays an essential role in reduction of growth factors in endothelial cells (Caporali et al., 2011 ▶). [score:3]
Since angiogenesis plays a crucial role in vascular homeostasis in ischemic heart diseases, in this study, the effect of IMOD™ on miR-503 and CDC25 expression level which are altered in impaired angiogenesis were investigated in heart tissue of diabetic rats. [score:3]
Caporali et al. have reported that the expression of miR-503 is increased in plasma and ischemic muscles of diabetic patients. [score:3]
It was known that miR-503 is significantly increased in diabetic muscles which is inversely associated with CDC25 expression. [score:3]
Diabetes Angiogenesis MiR-503 CDC25 IMOD Diabetes mellitus is a chronic metabolic disease diagnosed with an inability to produce insulin or presence of high resistance towards its function (Deepthi et al., 2017 ▶). [score:2]
Regarding disrupted angiogenesis in diabetes mellitus and useful effect of IMOD™ observed in some studies, in this study, the effects of IMOD™ on angiogenesis, as well as miR-503 and CDC25 expression levels which are involved in the regulation of angiogenesis, were investigated in a diabetes mo del. [score:2]
After 8 weeks of treatment with IMOD™ (20 mg/kg/day), heart tissue samples were removed and used for measurement of miR-503 and CDC25 expression level as well as histological studies. [score:1]
IMOD™ treatment (20 mg/kg/day for 8 weeks) was able to significantly reduce miR-503 in diabetic animals (p<0.05). [score:1]
This study was carried out to evaluate the effect of IMOD™ on levels of miR-503 and CDC25 expression and angiogenesis in heart tissue of STZ -induced diabetic rats. [score:1]
Furthermore, plasma levels of miR-503 increase in patients with diabetes (Caporali et al., 2011 ▶). [score:1]
[1 to 20 of 32 sentences]
3
[+] score: 102
Based on the evidence of a significant microRNA-503 upregulation in the brain of JD-fed SHRSP as opposed to a significant downregulation in the brain of SHRSR (see section), the modulation of this miRNA was verified in JD-fed SHRSP upon fenofibrate, vehicle, BO, BO plus PPARα inhibitor administration, as well as in the brains of the two SHRSR/SHRSP- STR1/QTL stroke congenic lines (by analyzing the same rats used in the above described experimental groups). [score:9]
Analysis of UCP2 -targeted microRNAs upon JD versus RD in brains of SHRSR and SHRSPOut of the compared UCP2 -targeted microRNAs in the brains of the SHRSR and SHRSP strains upon the two diets, we detected a remarkable differential expression, very consistent with the parallel differential UCP2 expression, for the rno-microRNA-503. [score:8]
Furthermore, we observed a significant downregulation of brain miR-503 level in the JD-fed SHRSP-derived congenic line containing the SHRSR/ STR1 fragment (Figure 7d), whereas the SHRSR-derived congenic line, containing the SHRSP/ STR1 segment, showed a significant upregulation of miR-503 upon JD (Figure 7e). [score:7]
In vitro hsa-microRNA-503 overexpression in HUVECsIn order to verify directly the impact of microRNA-503 on UCP2 expression levels, we performed a dose–response experiment in vitro. [score:6]
Out of the compared UCP2 -targeted microRNAs in the brains of the SHRSR and SHRSP strains upon the two diets, we detected a remarkable differential expression, very consistent with the parallel differential UCP2 expression, for the rno-microRNA-503. [score:6]
Finally, miR-503 overexpression in vitro abolished UCP2 expression and caused a high degree of cell mortality, consistently with what observed upon direct UCP2 silencing. [score:6]
Moreover, treatment with both fenofibrate and BO counteracted the increase of brain microRNA-503 level and the suppression of UCP2 expression in JD-fed SHRSP. [score:5]
Finally, we assessed the impact of miR-503 overexpression at 100 nM concentration (corresponding to 90% reduction of UCP2 expression) on cell apoptosis, necrosis and viability, as assessed by FACS. [score:5]
The in vitro overexpression of hsa-miR-503 in HUVECs showed a marked UCP2 suppression with a linear dose–response (Figures 8a and b). [score:5]
Notably, the microRNA-503 behaves as a key determinant of the dietary -dependent regulation of UCP2 expression in the brain of SHRSP. [score:4]
In order to verify directly the impact of microRNA-503 on UCP2 expression levels, we performed a dose–response experiment in vitro. [score:4]
Importantly, at a miR-503 concentration able to turn off UCP2 expression by 90%, a significant increase of cell mortality and a significant decrease of cell viability were observed (Figure 8c). [score:3]
Impact of microRNA-503 overexpression on viability of HUVECs. [score:3]
We discovered that SHRSP receiving either fenofibrate or BO along with JD showed a significant reduction of brain miR-503 expression level (Figures 7b and c). [score:3]
As a result, we found that the UCP2 expression modulation upon JD in the brains of SHRSP and SHRSR was related to the microRNA-503. [score:3]
In vitro hsa-microRNA-503 overexpression in HUVECs. [score:3]
Thus, the microRNA-503 has a significant potential in unraveling the mechanisms underlying stroke pathogenesis and may reveal a promising therapeutic agent for this disease. [score:3]
Our results strongly suggest that miR-503 is a modulator of brain UCP2 expression in high-salt-fed SHRSP and also in SHRSR. [score:3]
[39] Herein, we report the first evidence that an increase of miR-503 associates with high-salt induced stroke occurrence, through its ability to modulate brain UCP2 expression, in an animal mo del of spontaneous hypertension and stroke and that, in turn, miR-503 can be decreased by both pharmacological and nutraceutical approaches to obtain protection from stroke. [score:3]
Based on the results of the microRNAs screening, we further explored the modulation of the microRNA-503 expression in our experimental groups. [score:3]
Further studies will address the interaction between PPAR α and miR-503 in the UCP2 regulation. [score:2]
A specific gene expression Taqman assay (Lifetech, Waltham, MA, USA) was used to assess miR-503 levels, as reported above. [score:2]
Importantly, both treatments, by their ability to restore regular levels of both microRNA-503 and UCP2, significantly protected from stroke occurrence the JD-fed SHRSP. [score:1]
Of note, miR-503 exerts multiple actions. [score:1]
Twenty-four hours after transfection cells were extracted for total RNA, by the RNazol procedure, [23] and used for the evaluation of both miR-503 and UCP2 expression levels by RT-PCR. [score:1]
Then, serial concentrations of 12.5, 25, 50, 100, 200 and 400 nM of hsa-microRNA-503 mimic (Mission microRNA; Sigma-Aldrich (Milan, Italy)) were incubated in OPTIMEM reduced serum medium with a nucleic acid transferring agent (lipofectamine RNAiMAX reagent (Invitrogen, Milan, Italy)) in a final volume of 2 ml/well each for 20 min. [score:1]
36, 38 On the other hand, a decrease of miRNA-503 upon losartan treatment is associated with an improvement of diabetic nephropathy in an animal mo del of spontaneous type 2 diabetes. [score:1]
It will be also interesting to characterize the potential contribution of miRNA-503 in the prevention and/or amelioration of hypertensive target organ damage with the available therapeutic antihypertensive strategies. [score:1]
[1 to 20 of 28 sentences]
4
[+] score: 75
Other miRNAs from this paper: rno-mir-503-2
The mimic and inhibitor were transfected into myocardial cells with lipofectamine 2000 (Invitrogen, USA) to induce upregulation and downregulation of miR-503 in the myocardial cells according to manufacturer's instructions. [score:9]
According to the prediction analysis of the TargetScan, PicTar, and miRanda data, Nrf2 has a putative binding site in the 3′-UTR of miR-503 and was speculated as the target gene of miR-503 (Figure 4(a)). [score:5]
In addition, the expression of Nrf2 was decreased by miR-503 mimics and increased by inhibitor (Figures 5(b)– 5(d)). [score:5]
Database of miRanda, TargetScan, and PicTar was used to predict the potential targets gene of miR-503. [score:5]
In this study, we found that miR-503 is involved in the progress of DCM, and Phase II enzyme inducer (CPDT) could reverse the impaired structure and function, reduce myocardial apoptosis, relieve the occurrence and development of DCM through miR-503 and Nrf2/ARE signaling pathway, and provide new therapeutic targets for DCM. [score:4]
3.5. miR-503 Regulated the Expression of Nrf2 in Myocardial Cells. [score:4]
The Nrf2 Was the Target Gene of miR-503. [score:3]
In conclusion, miR-503 was involved in the progress of DCM via regulating Nrf2/ARE signaling pathway, and the CPDT reduces the occurrence and development of diabetic cardiomyopathy through miR-503 and Nrf2/ARE signaling pathway. [score:3]
Synthetic miR-503 mimic and inhibitor were generated and purchased from Sangon Biotech Co. [score:3]
After mimic and inhibitor were transfected into myocardial cells, the miR-503, Nrf2, and downstream medium level were detected and analyzed. [score:3]
Therefore, miR-503 is involved in the progress of DCM via regulating Nrf2/ARE signaling pathway, CPDT reduces the development of DCM through miR-503 and Nrf2/ARE signaling pathway. [score:3]
The results showed that miR-503 suppressed luciferase activity through 3′-UTR of wild-type (WT) HMGB1 (Figure 4(b)). [score:3]
Among those target genes, nuclear factor erythroid 2-related factor 2 (Nrf2) had a binding site in the 3′-UTR of miR-503. [score:3]
The Expression of miR-503, Nrf2, and Downstream Medium Level in Streptozotocin- (STZ-) Induced Diabetes and Treatment Rats. [score:3]
In this study, we found that miR-503 was also increased in DCM and closely correlated with occurrence and development of DCM. [score:2]
The results showed that, compared with control, the intracellular miR-503 was increased by miR-503 mimics and decreased by miR-503 inhibitor (Figure 5(a)). [score:2]
For miR-503, some studies have showed that miR-503 was increased in diabetic muscles and oppositely correlated with cdc25 protein expression; in addition, miR-503 was also increased in myocardial microvascular endothelial cells from type 2 diabetic Goto-Kakizaki (GK) rats [12]; finally, compared with normal healthy controls, miR-503 was also increased in type 2 diabetes patients [13]. [score:2]
In development of DCM, miR-503 was increased, Nrf2 was decreased, antioxidative stress ability was weakened, and myocardial apoptosis was increased, damaging the myocardium or affecting the myocardial systolic and diastolic function. [score:2]
For luciferase assay, The human embryonic kidney (HEK293T) 293 cells were seeded into 24-well plates, and NC mimics (empty vector) and miR-503 mimics (stable miR-503 -overexpressing) were cotransfected with constructed reporter plasmids (0.2 ug) into HEK293T cells by Effectene transfection regents (Qiagen). [score:2]
In this study, diabetic cardiomyopathy mo del in rats was duplicated, and Phase II enzyme inducer CPDT, as intervention agent, was used to detect relevant indicators, such as miR-503 and Nrf2/ARE signaling pathway, including Nrf2, HO-1 and MDA, to investigate whether the Phase II enzyme inducer (CPDT) reduces myocardial cell apoptosis, reduces the occurrence and development of diabetic cardiomyopathy through miR-503 and Nrf2/ARE signaling pathway, and provides new therapeutic targets for diabetic cardiomyopathy. [score:2]
Therefore, miR-503 plays important role in diabetes; however, the role and mechanism of miR-503 in DCM remain unclear. [score:1]
The diabetic cardiomyopathy was established, diabetic cardiomyopathy rats were treated with Phase II enzyme inducer (CPDT), and the miR-503, Nrf2, and downstream medium level were detected and analyzed. [score:1]
In treatment of CPDT for DCM, miR-503 was decreased, Nrf2 was increased, antioxidative stress ability was improved, and myocardial cell apoptosis was decreased, protecting the myocardium and improving the myocardial systolic and diastolic function. [score:1]
In addition, the activity change of fluorescence of miR-503 containing the mutated 3′-UTR site or the control group lacking an Nrf2 3′-UTR sequence had no statistically significant difference (Figure 4(c)). [score:1]
Therefore, miR-503 was involved in DCM and CPDT exerted myocardial protection by performing miR-503. [score:1]
The dual-luciferase reporter assay method was used to further investigate whether miR-503 directly targets Nrf2. [score:1]
In addition, exhilaratingly, we also found that miR-503 was shown to be decreased in DCM treated by CPDT. [score:1]
[1 to 20 of 27 sentences]
5
[+] score: 66
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
The expression levels of miR-183, miR-96, and miR-182 were most highly up-regulated, whereas miR-122, miR-503, and miR-139-3p exhibited the greatest down-regulation as a result of 17α-E2 treatment. [score:9]
The expression levels of miR-183 (4.61-fold), miR-96 (4.56-fold), and miR-182 (4.29-fold) were most highly up-regulated, whereas miR-122 (9.79-fold), miR-503 (5.88-fold), and miR-139-3p (1.94-fold) showed the greatest down-regulation as a result of 17α-E2 treatment. [score:9]
ACTH up-regulated the expression of miRNA-212, miRNA-182, miRNA-183, miRNA-132, and miRNA-96 and down-regulated the levels of miRNA-466b, miRNA-214, miRNA-503, and miRNA-27a. [score:9]
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
Real-time quantitative PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats. [score:7]
qRT-PCR measurements confirmed that the expression of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377 and miRNA-96 was up-regulated and that of miRNA-122, miRNA-200b, miRNA-466b, miRNA-138, miRNA-214, miRNA-503 and miRNA-27a down-regulated in adrenals from 17α-E2 treated rats (Fig. 3 ). [score:7]
Real-time PCR (qRT-PCR) measurements demonstrated that ACTH treatment upregulated the expression of miRNA-212, miRNA-183, miRNA-182, miRNA-132 and miRNA-96, while down -regulating the expression of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a. [score:7]
For example, miRNA-503, miRNA-224 and miRNA-383 are expressed almost exclusively in mouse granulosa cells and oocytes [68], [72], whereas a large number of miRNAs are differentially expressed in bovine ovarian cortex, cumulus cells and corpus luteum [60]. [score:5]
Significant ACTH -induced down-regulation of miRNA-466b, miRNA-214, miRNA-503 and miRNA-27a was also observed (Fig. 3 ). [score:4]
Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
0078040.g003 Figure 3Quantitative RT-PCR (qRT-PCR) validation of miRNA-212, miRNA-200b, miRNA-183, miRNA-122, miRNA-19a, miRNA-466b, miRNA-182, miRNA-132, miRNA-138, miRNA-370, miRNA-96, miRNA-503, miRNA-27a and miRNA-214 levels in control, ACTH-, 17α-E2 or DEX -treated adrenals in vivo. [score:1]
[1 to 20 of 11 sentences]
6
[+] score: 34
RT-PCR validation of these 9 miRNAs confirmed the high expression of 7 miRNAs, of which 3 (miR-503, miR-330 and miR-293) were exclusively expressed in dnIKK2-Treg-EV, while the remaining 4 miRNAs (miR-297c, miR-207, miR-9, miR-484) were faintly detected in Tact-EV and Trest-EV too (Fig.   5A). [score:5]
Our findings – that Cyclin E and Cyclin D1 proteins are down-regulated in T cells exposed to dnIKK2-Treg-EV, together with the arrest of T cell cycle progression – confirm that miR-503 has a role in cell cycle regulation in this setting. [score:5]
Target prediction of cell cycle genes targeted by miR-503, miR-330 and miR-9 included CCNE1, CCNE2, CCND1, CDC14A, E2F1-3, CDKN1A, CDC25A, CHEK1, WEE1 and EP300 (Supplementary Fig.   8) 25, 26. [score:5]
Namely, miR-503, miR-330 and miR-9, which affect the transcription of genes encoding proteins crucial to the regulation of cell cycle progression, were exclusively present or were up-regulated in dnIKK2-Treg-EV compared to Tact-EV and Trest-EV. [score:4]
There is evidence that the over -expression of miR-503 induces a G1 cell cycle arrest in several cell lines by down -regulating genes such as CCNE1 (Cyclin E1), CCND1 (Cyclin D1), CDKN1A (Cip1, p21), CDC25A (Cdc25A phosphatase), CHEK1 (Chk1 kinase) and WEE1 (Wee1 kinase) both at mRNA [38] and at the protein level 39, 40. [score:4]
Specificity of miRNA inhibition by PLL/TPF treatment was documented by results of RT-PCR showing that miR503 was undetectable (Ct values > 40) in EV released from PLL/TPF -treated dnIKK2-Treg, at variance with EV from untreated dnIKK2-Treg (Ct values < 35). [score:3]
Hirakawa T miR-503, a microRNA epigenetically repressed in endometriosis, induces apoptosis and cell-cycle arrest and inhibits cell proliferation, angiogenesis, and contractility of human ovarian endometriotic stromal cellsHuman Reproduction. [score:3]
Forrest AR Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulationLeukemia. [score:2]
Caporali A Deregulation of microRNA-503 contributes to diabetes mellitus -induced impairment of endothelial function and reparative angiogenesis after limb ischemiaCirculation. [score:2]
This analysis highlighted 3 miRNAs (miR-503, miR-330 and miR-9) potentially affecting 16 pathways (Supplementary Table  3) among which cell cycle was the most closely related to anti-proliferative effects of dnIKK2-Treg-EV. [score:1]
[1 to 20 of 10 sentences]
7
[+] score: 26
rno-miR-675-5p 4.143757751 Premature senescence of cardiac progenitor cells, G1 arrest, reduced cell proliferation, colony formation, migration and invasion rno-miR-183-3p 3.74730108 Regulates claudin-1 expression rno-miR-299a-5p 3.626723224 Anti-apoptotic role rno-miR-200c-3p 3.593610443 Targets the VEGF-VEGFR2 pathway and angiogenesis rno-miR-665 3.511737089 Negatively targets anti-apoptotic BCL2L1 rno-miR-291a-5p 3.457928187 VSMC migration rno-miR-490-5p 2.373358 Tumour suppressor rno-miR-1 2.505729 Suppresses cell growth rno-miR-133b 2.192279 Inhibits cell proliferation and invasion rno-miR-30c-1-3p 2.70761 Suppresses PXR expression rno-miR-294 2.010496 Promotes proliferation and differentiation rno-miR-127-5p 2.780488 A regulator of MMP-13 and suppresses cell growth rno-miR-503 2.327383 Inhibits cell proliferation and invasion Table 2 Twenty down-regulated miRNAs. [score:26]
[1 to 20 of 1 sentences]
8
[+] score: 20
Several other down-regulated genes such as Hes6 (inhibits cell proliferation), Rbl2 (tumour suppressor and inhibitor of E2F target genes) and Id1 (a bHLH transcription factor that regulates cell proliferation by supressing p21 or Cdkn1a, a CDKs inhibitor) were also observed as the putative targets of rno-miR-503, -214 and -146b and -503. [score:17]
Moreover, Fn1 was predicted to be a putative target of miR-146b (5 programs) and miR-503, -214, -31, -34a, -199a-5p, and -132 (2 programs). [score:3]
[1 to 20 of 2 sentences]
9
[+] score: 16
In contrast, analysis of total RNA from lung specimens of MCT PAH rats overexpressing human prostacyclin synthase (hPGIS) demonstrated reversal of MCT -induced upregulation of miRs 17, 21, and 223 and an increase in levels of miR-424 and miR-503. [score:6]
A group of miRNAs were downregulated in the lung and PA of MCT PAH rats, including miR-126, miR-145, miR-150, miR-424, and miR-503 (Fig 1A and 1B). [score:4]
Among these the miR-17–92 cluster, miR-21, miR-145, miR-204 and miR-210 are dysregulated in PASMCs, miR-124 is primarily dysregulated in fibroblasts in the adventitia, and miR-17, miR-21, miR-424, and miR-503 appear to play important roles in PAECs. [score:3]
Expression levels of miR-17-5p, miR-21-5p, miR-126-3p, miR-145-5p, miR-150-5p, miR-204-5p, miR-223-3p, miR-328-3p, miR-424-5p (mmu-miR-322, the mouse/rat ortholog for hsa-miR-424), and miR-503-5p were evaluated. [score:1]
Notably, levels of miRs 17, 21, and 223 were all significantly reduced and levels of miR-424 (mmu-miR-322, the mouse/rat ortholog for hsa-miR-424) and miR-503 were significantly increased (Fig 5). [score:1]
MiR-424 (miR-322 ortholog) was decreased ~2 fold in the lungs and PA (Fig 1A and 1B) and decreased only slightly in RV, while miR-503 slightly increased in RV with no change in plasma (Fig 1C and 1D). [score:1]
[1 to 20 of 6 sentences]
10
[+] score: 15
We then used a screening system based on the luciferase reporter plasmid carrying the full-length 3′UTR of the FSHb mRNA and found that 18 miRNAs, specifically miR-433-3p, miR-323-3p, miR-328a-3p, miR-3573-3p, miR-204-5p, miR-206-5p, miR-31a-5p, miR-7a-5p, miR-880-3p, miR-186-5p, miR-503-5p, miR-383-5p, miR-324-5p, miR-505-5p, miR-27b-3p, miR-221-5p, miR-320-3p and miR-21-3p, could suppress the expression of the reporter by more than 30% (Figure 1). [score:5]
Interestingly, we identified 12 other miRNAs (miR-323-3p, miR-328a-3p, miR-3573-3p, miR-204-5p, miR-206-5p, miR-31a-5p, miR-7a-5p, miR-880-3p, miR-186-5p, miR-503-5p, miR-383-5p and miR-320-3p) that might also regulate FSHb expression, and then affected FSH secretion, but their specific effects need to be verified through further experiments. [score:4]
35 rno-miR-383-5p 820-826 7mer-1A −0.11 rno-miR-409a-5p 639-645 7mer-1A −0.19 rno-miR-433-3p 1044-1050 7mer-m8 −0.14 rno-miR-449c-3p 674-680 7mer-m8 −0.13 rno-miR-503-5p 763-769 7mer-1A −0.22 rno-miR-505-5p 111-117 7mer-1A −0.14 rno-miR-7a-5p 572-578 7mer-1A −0.01 rno-miR-880-3p 586-592 7mer-1A −0.11 rno-miR-9a-3p 272-278 7mer-1A −0.1 Figure 1Effects of the predicted 45 miRNAs on the reporter gene expression of the pmiR-FSHb-3′UTR-WT vector. [score:3]
35 rno-miR-383-5p 820-826 7mer-1A −0.11 rno-miR-409a-5p 639-645 7mer-1A −0.19 rno-miR-433-3p 1044-1050 7mer-m8 −0.14 rno-miR-449c-3p 674-680 7mer-m8 −0.13 rno-miR-503-5p 763-769 7mer-1A −0.22 rno-miR-505-5p 111-117 7mer-1A −0.14 rno-miR-7a-5p 572-578 7mer-1A −0.01 rno-miR-880-3p 586-592 7mer-1A −0.11 rno-miR-9a-3p 272-278 7mer-1A −0.1 Figure 1Effects of the predicted 45 miRNAs on the reporter gene expression of the pmiR-FSHb-3′UTR-WT vector. [score:3]
[1 to 20 of 4 sentences]
11
[+] score: 9
The unique miRNA expression patterns distinguishing the ASH group from the control group were composed of six downregulated (miR-199a-3p, miR-214, miR-93, miR-146a, miR-191 and let-7b) and six upregulated (miR-129, miR-490, miR-21, miR-503, miR-183 and miR-185) miRNAs. [score:9]
[1 to 20 of 1 sentences]
12
[+] score: 7
This demonstrated 63 microRNAs were significantly upregulated and 3 significantly downregulated (miR-122, miR-296-5p and miR-503) (Fig. 1A & 1B). [score:7]
[1 to 20 of 1 sentences]
13
[+] score: 6
Chen et al showed that overexpression of miR-503 could inhibit bone resorption and prevent bone loss in osteoporosis mice [9]. [score:5]
Till now, few miRNAs have been reported to be involved in DO process except miR-503 which promoted bone formation in distraction osteogenesis [10]. [score:1]
[1 to 20 of 2 sentences]
14
[+] score: 4
For example, mir-503 was found markedly reduced while mir-133a was found significantly upregulated in peripheral blood mononuclear cells of postmenopausal osteoporosis patients, respectively [12, 13]. [score:4]
[1 to 20 of 1 sentences]
15
[+] score: 4
Down regulation of microRNAs, like miR-28, miR-125a, and miR-503, could possibly lead to up regulation of p21 in parous ALDH positive MECs. [score:3]
miR-497, miR-218a, miR-378 and miR-503 were reported to have anti-carcinogenic effect in breast, glioma, liver, endometrial and gastric cancers respectively. [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 4
Other miRNAs from this paper: hsa-mir-503, rno-mir-503-2
Man XF MiR-503 inhibits adipogenesis by targeting bone morphogenetic protein receptor 1aAm. [score:4]
[1 to 20 of 1 sentences]
17
[+] score: 3
GRN expression is also under the post-transcriptional control of miR-107 (a member of a miRNA group also including miR-15, miR-16, miR-103, miR-195, miR-424, miR-497, miR-503, and miR-646), with implications for brain disorders (Wang et al., 2010). [score:3]
[1 to 20 of 1 sentences]
18
[+] score: 2
5 miR-503* −5.7 miR-376c* −4.0 miR-215 −1.4 miR-30b* −1.3 miR-29c* −1.2All groups except the BDL and HFD groups showed necrosis and inflammation. [score:1]
5 miR-503* −5.7 miR-376c* −4.0 miR-215 −1.4 miR-30b* −1.3 miR-29c* −1.2 All groups except the BDL and HFD groups showed necrosis and inflammation. [score:1]
[1 to 20 of 2 sentences]
19
[+] score: 1
In contrast, several E10-enriched miRNAs identified in our study, including rno-miR-181a, rno-miR-449a, and rno-miR-503, were not detected in their results. [score:1]
[1 to 20 of 1 sentences]
20
[+] score: 1
Other miRNAs from this paper: hsa-mir-424, hsa-mir-503, rno-mir-503-2
Kim J Kang Y Kojima Y Lighthouse JK Hu X Aldred MA McLean DL Park H Comhair SA Greif DM Erzurum SC Chun HJ An endothelial apelin-FGF link mediated by miR-424 and miR-503 is disrupted in pulmonary arterial hypertension. [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
Other miRNAs from this paper: hsa-mir-424, hsa-mir-503, mmu-mir-503, rno-mir-503-2
An endothelial apelin-FGF link mediated by miR-424 and miR-503 is disrupted in pulmonary arterial hypertension. [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
Other miRNAs from this paper: hsa-mir-424, hsa-mir-503, rno-mir-503-2
Kim J Kang Y Kojima Y Lighthouse JK Hu X Aldred MA McLean DL Park H Comhair SA Greif DM Erzurum SC Chun HJ An endothelial apelin-FGF link mediated by miR-424 and miR-503 is disrupted in pulmonary arterial hypertension. [score:1]
[1 to 20 of 1 sentences]