sort by

3 publications mentioning ppt-MIR319b

Open access articles that are associated with the species Physcomitrella patens and mention the gene name MIR319b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 30
Other miRNAs from this paper: dme-mir-7, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-124-1, hsa-mir-124-2, mmu-mir-34a, osa-MIR169a, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, cel-mir-354, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, mtr-MIR169a, mtr-MIR319a, ptc-MIR159a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR168a, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, hsa-mir-519b, ppt-MIR319a, ppt-MIR319c, ppt-MIR319d, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR169f, mtr-MIR319b, mtr-MIR168a, mtr-MIR169g, mtr-MIR169h, mtr-MIR169b, ppt-MIR319e, osa-MIR169r, mtr-MIR159a, mtr-MIR169k, mtr-MIR169j, mtr-MIR159b, ptc-MIR169ag, mtr-MIR169i, mtr-MIR319c, mtr-MIR319d, mtr-MIR169l
We also examined the target conservation of the miRNA-like RNAs on miR159a and miR319b precursors across Arabidopsis, a dicotyledonous plant, and rice, a monocotyledonous plant. [score:3]
As shown, several miRNA-like RNAs, particularly those expressed at a relatively abundant level, are more conserved than their flanking sequences except their cognate miRNAs or miRNA*s. For example, the sequences of miR319b. [score:3]
miR159 and miR319 belong to the same MIR family based on their evolutionary origin [30, 44], playing important roles in plant development [47]. [score:2]
2* and miR319.1/miR319b. [score:1]
1*); specifically, miR319a, miR319a*, miR319b. [score:1]
2 AATGAATGATGCGAGAGACAA 491 1,2 miR319b. [score:1]
Figure 6a displays the miR159a precursors in Arabidopsis, rice, Medicago and Populus and Figure 6b shows the miR319b precursors in Arabidopsis, rice, moss and Medicago. [score:1]
2* have a comparable level of conservation to miR319b* (that is, miR319b. [score:1]
2 and miR319b. [score:1]
Importantly, a close inspection showed that many individual miRNA-like RNAs on the miR159 and miR319 precursors are also highly conserved at the sequence level. [score:1]
For example, miR319b. [score:1]
This is consistent with the recent discovery that the DCL cleavage that produces mature miR159 and miR319 starts from the loop ends of their fold-back structures [45, 46]. [score:1]
Note that miRNA-miRNA* duplexes for miRNA-like RNAs, with approximately two-nucleotide 3'-end overhangs, appear on the miR159, miR169m and miR319b precursors. [score:1]
In the five plant species we studied, miRNA-like RNAs appeared in two well-conserved miRNA families, that is, miR159 and miR319 (Table 2). [score:1]
1* GAGCTTTCTTCGGTCCACTC 28 miR319b. [score:1]
2 has 491 reads while miR319b (that is, miR319b. [score:1]
Furthermore, most of these miRNA-like RNAs, including miR319b. [score:1]
miRNA-like RNAs appeared in miR319 precursors in all of these five plants, and miRNA-like RNAs occurred in miR159 precursors in all of five bar moss. [score:1]
Examples include MIR159a, MIR319a and MIR319b in Figures 1a,c,d, respectively. [score:1]
Another interesting observation is that not every slot in the phasing pattern of a precursor was filled by sequencing reads, as shown in MIR319b and MIR839 (Figures 1d and 4a). [score:1]
Some of these miRNA-like RNAs from conserved miRNA families, that is, miR159 and miR319 in plants, are conserved at the sequence level (Figure 7), which adds another layer of evidence that these miRNA-like RNAs are potentially functionally important in plants. [score:1]
1* (that is, miR319/miR319b*) in four plants, Arabidopsis, rice, Medicago and P. trichocarpa (ptc). [score:1]
1 TTGGACTGAAGGGAGCTCCCT 27 miR319b + miR319b. [score:1]
2* and miR319b. [score:1]
2, and miR319b. [score:1]
[1 to 20 of 25 sentences]
2
[+] score: 25
Importantly, miR319 was highly expressed in the current sequencing data and exhibited down-regulation (3.2-fold) in the ABI3 knockout mutant. [score:7]
However, it also displayed a 1.3-fold up-regulation in the WT, suggesting that miR319 responded to ABA-treatment in the mutants without the ABI3 genes expressed. [score:6]
miR319 is known to target three paralogous MYB genes in moss, including the two paralogs, Pp1s143_30V6.1 and Pp1s391_54V6.1 9, and one target we newly identified in our study, Pp1s66_200V6.1. [score:5]
Some of the reads from the degradome profiling were aligned to the miR319 cleavage site on the new miR319 target (MYB, Pp1s66_200V6.1, Fig. 3D). [score:3]
We also observed a low degree of complementarity within the seed region in the binding of miR319 and MYB gene (Fig. 3D), whereas experiments demonstrate that miR319 is able to cleave MYB gene in moss 9. Taken together, our results suggest a broad existence of non-canonical target sites of plant miRNAs that may not have a high degree of complementarity within seed regions. [score:3]
Overall, the 5 most abundant mature miRNAs were miR156, miR319, miR535, miR904, and miR1028 (Table S3). [score:1]
[1 to 20 of 6 sentences]
3
[+] score: 1
These sRNAs (4–67, 2–15, 3–40, 3–54) belong to miRNA families miR536, miR535, miR156 and miR319 previously identified in Physcomitrella [17, 46], whereas the sRNA 4–72 was nearly identical to miR171 present in several other plant species [53]. [score:1]
[1 to 20 of 1 sentences]