sort by

113 publications mentioning hsa-mir-503 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-503. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 380
Functional studies by manipulating miR-503 expression in different ESCC cell lines further showed that overexpression of miR-503 inhibited cell proliferation, migration, and invasion, whereas suppression of miR-503 expression had the opposite effects. [score:11]
As shown in Figure6B, silenced expression of CCND1 using si CCND1 (si CCND1 + vector) could mimic tumor suppressive effect of miR-503 mimic overexpression (mimic + vector) on ESCC cell proliferation, whereas overexpression of CCND1 (mimic +  CCND1) could partially diminish the tumor suppressive effect of miR-503 on ESCC cell lines. [score:11]
Similarly, knocking down expression of CCND1 (si CCND1 + vector) could mimic tumor suppressive effect of miR-503 mimic (mimic + vector) on ESCC cell migration and invasion, whereas overexpression of CCND1 (mimic +  CCND1) could partially reverse the tumor suppressive effect of miR-503 on ESCC cell lines (Figure6C). [score:10]
Figure 5miR-503 regulates the expression of CCND1 by targeting its 3′UTR A. Venn diagram and the list of putative miR-503 target genes commonly predicted by TargetScan and miRDB. [score:10]
In conclusion, our study demonstrates that miR-503 has a tumor suppressor role in ESCC cell lines and tumor samples by negatively regulating the expression of its direct target, CCND1, in ESCC. [score:9]
A significant elevation in miR-503 expression has been reported in the human ESCC cell line EC9706 compared to the normal human esophageal epithelial cell (HEEC), whereas downregulated miR-503 expression suppresses proliferation, migration, and invasion in EC9706 cells [18]. [score:9]
In this study, we demonstrated that the expression of miR-503 was suppressed in ESCC tissue, whereas overexpression of miR-503 inhibited aggressive phenotypes of ESCC cells in vitro. [score:9]
Moreover, silenced expression of CCND1 could recapitulate the tumor suppressive effect of miR-503 mimic on ESCC, whereas overexpression of CCND1 could partially reverse the tumor suppressive effect of miR-503 mimic on ESCC cells. [score:9]
Figure 1 miR-503 expression was down-regulated in ESCC tissues and cell lines A. miR-503 expression in NE2 and 10 ESCC cell lines was evaluated using qPCR and presented as fold change relative to the expression in NE2. [score:8]
Our results showed increased expression of cyclin D1 in the ESCC cell lines (Figure5E), which is opposite to the downregulation of miR-503 expression observed in ESCC cell lines (Figure1C). [score:8]
Examination of miR-503 expression in paired clinical tumor samples of ESCC patients showed that miR-503 expression was downregulated in most ESCC tissue samples relative to adjacent normal tissues. [score:8]
In this study, we found that overexpression of miR-503 reduced the protein levels of cyclin D1 and vimentin, but increased the expression of E-cadherin, which can be partially revised by overexpression of CCND1. [score:7]
YES-2 and KYSE30 cell lines, which possessed low expression level of miR-503, were chosen to transfect the mimic, whereas KYSE450 and KYSE510 cell lines, which displayed high expression level of miR-503, were chosen to transfect the inhibitor. [score:7]
Our observation is different from the observation reported in another ESCC cell line EC9706 with increased miR-503 expression, showing the tumor suppressive effects of the decreased miR-503 expression [18]. [score:7]
Downregulation of miR-503 expression in ESCC cell lines and tissues relative to normal human esophageal epithelial cell and adjacent normal tissues indicates miR-503 might be a negative regulator of tumorigenesis in ESCC. [score:7]
We found that overexpressing miR-503 led to the decreased protein expression of cyclin D1 and vimentin but an increased expression of E-cadherin. [score:7]
Figure 2 Upregulation of miR-503 expression inhibits ESCC malignant phenotypeAfter YES-2 and KYSE30 cells were transfected with miR-503 mimic or miR-NC 24 h, their proliferation ability was detected by RTCA-MP system (A), whereas migration and invasion assays were performed using Transwell (B). [score:7]
Figure 4 Upregulation of miR-503 expression induces cell cycle G1/S arrestESCC cell lines YES-2 A. and KYSE30 B. were transiently transfected with miR-NC or miR-503 mimic. [score:6]
miR-503 expression is downregulated in human ESCC tissue samples and cell lines. [score:6]
However, the expression of miR-503 in other ESCC cell lines and ESCC tissues has not been reported, and whether miR-503 has the tumor suppressive role in ESCC remains to be addressed. [score:5]
miR-503 expression is inversely correlated with CCND1 expression in ESCC tissuesProtein expression of cyclin D1 in NE2 and the ten aforementioned ESCC cell lines was evaluated. [score:5]
Overexpression of CCND1 could partially diminish the tumor suppression of ESCC by miR-503. [score:5]
miR-503 expression is inversely correlated with CCND1 expression in ESCC tissues. [score:5]
Therefore, miR-503 could inhibit ESCC cell migration and invasion by targeting CCND1 through decreasing vimentin level and increasing E-cadherin level. [score:5]
G. Correlation analysis of CCND1 mRNA expression and miR-503 expression in the paired ESCC tumor samples from 57 patients. [score:5]
Therefore, miR-503 could inhibit ESCC cell proliferation by targeting CCND1 and inducing cell cycle G1/S arrest. [score:5]
E. Silencing of miR-503 expression after transfecting the inhibitor in KYSE450 and KYSE510 cell lines was analyzed using qPCR. [score:5]
Our data revealed a significant negative correlation between CCND1 expression and miR-503 expression in ESCC tumor samples (P < 0.001, r = −0.523, Pearson). [score:5]
Figure 6Overexpression of CCND1 could partly diminish the tumor suppressive effect of miR-503 on ESCCYES-2 and KYSE30 cells were cotransfected with miR-503 mimic, CCND1 siRNA or negative control and pcDNA3.1-vector or pcDNA3.1- CCND1 and incubated for 24 h. A. of cyclin D1, vimentin, and E-cadherin using β-actin as a loading control. [score:5]
It has been reported that miR-503 inhibits prostate cancer progression by repressing ZNF217 expression [20]. [score:5]
C. Down-regulation of miR-503 expression was observed in 83% of ESCC tumor samples compared to the corresponding adjacent non-cancerous tissues. [score:5]
Figure 3 Silencing of miR-503 expression promotes ESCC malignant phenotypeCells were transfected with miR-503 inhibitor or miR-NC. [score:5]
miR-503 can repress epithelial-mesenchymal transition (EMT) and inhibit metastasis of osteosarcoma by targeting c-myb [14]. [score:5]
To further explore its molecular mechanisms, we firstly predicted the candidate target genes of miR-503 using TargetScan7.0 (http://www. [score:5]
further indicated that cyclin D1 expression was reduced at protein level with the overexpression of miR-503 mimic (Figure5D). [score:5]
To see whether cyclin D1 could rescue miR-503′s effect on ESCC, we silenced the endogenous CCND1 expression by overexpression of miR-503 mimic and of CCND1 in ESCC simultaneously. [score:5]
We further showed that enhanced expression of miR-503 suppressed cell proliferation, migration, and invasion in two ESCC cell lines examined. [score:5]
To explore the molecular mechanism of miR-503 in ESCC, we overexpressed miR-503 in YES-2 and KYSE30 cell lines in the presence or absence of CCND1 overexpression. [score:5]
We then looked at the effects of overexpression of miR-503 on the expression level of CCND1 using si CCND1 as a positive control. [score:5]
qPCR analysis showed that the expression of miR-503 was significantly increased by mimic transfection (P < 0.001, Figure1D) and significantly decreased by inhibitor transfection (P < 0.001, Figure1E). [score:5]
Previous studies have shown that miR-503 expression is dysregulated in various physiological and pathological processes, including in human cancers. [score:4]
miR-503 negatively regulates cyclin D1 expression. [score:4]
Cyclin D1 is an important protein during the development of ESCC, and CCND1 was demonstrated to be the target of miR-503. [score:4]
To test whether CCND1 is a direct target of miR-503, we generated a pair of plasmids, i. e., pmiR- CCND1-WT plasmid, which contains CCND1 3′UTR sequence spanning the miR-503 binding site in the luciferase plasmid vector, and pmiR- CCND1-MUT plasmid, which contains the corresponding mutant counterpart (Figure5B). [score:4]
We also symmetrically examined miR-503 expression in 10 ESCC cell lines and revealed a general trend of decreased miR-503 expression in ESCC cells compared to the immortalized esophageal epithelial cell line NE2. [score:4]
As expected, silenced miR-503 expression with inhibitor in KYSE450 and KYSE510 increased cell proliferation, migration, and invasion ability, compared to the cells transfected with the control (Figure 3). [score:4]
However, we did not find significant association between miR-503 expression and gender, age, or lymph node metastasis (Table 1). [score:3]
These data support miR-503 as a tumor suppressor. [score:3]
Interestingly, our study shows that overexpression of miR-503 in ESCC cell lines also induced G1/S arrest. [score:3]
Additionally, miR-503 can also suppress hepatocellular carcinoma metastasis through Rho guanine nucleotide exchanger factor 19 [21]. [score:3]
In agreement with this observation, we found that cyclin D1 is the direct target of miR-503 by dual-luciferase reporter assay and western blot. [score:3]
Given the suppressive effect of miR-503 on cell proliferation, we speculate that miR-503 might affect cell cycle. [score:3]
As shown in Figure5B, overexpression of miR-503 significantly reduced the luciferase activity of WT plasmid, whereas luciferase activity from mutant construct was not significantly changed. [score:3]
Expression level of miR-503 was categorized into 'high' and 'low' using the median value as the cutoff point [13]. [score:3]
D. Overexpression of miR-503 mimic in KYSE30 and YES-2 cell lines was analyzed using qPCR. [score:3]
CCND1, which encodes cyclin D1, is the target of miR-503 in breast cancer cells and endometrioid endometrial cancer [16], [17]. [score:3]
Similar experiments were also performed in KYSE450 and KYSE510 cells transfected with the inhibitor of miR-503. [score:3]
Association between miR-503 expression and various clinicopathological parameters was determined using a Pearson’s chi-squared (χ [2]) test [13]. [score:3]
miR-503 mimic, inhibitor, and siRNA for CCND1 were purchased from RiboBi (Guangzhou, China) for transient transfection. [score:3]
qPCR was conducted to determine the expression levels of hsa-miR-503 and CCND1 mRNA using Applied Biosystems 7300 Real-Time PCR System, with the U6 small nuclear RNA and GAPDH as internal controls, respectively. [score:3]
We thus examined the endogenous expression of miR-503 in 10 commonly-used ESCC cell lines, using the immortalized esophageal epithelial cell line NE2 as a control. [score:3]
In the present study, we demonstrated, for the first time, the tumor suppressive role of miR-503 in ESCC. [score:3]
The results above indicated that miR-503 might function as a tumor suppressor in ESCC. [score:3]
U6 was used as the internal control for miR-503 expression. [score:3]
Currently, there is no report on the expression of miR-503 in ESCC tissues. [score:3]
C. qPCR analysis of CCND1 expression in YES-2 and KYSE30 cells 48 h after transfected with miR-503 mimic or negative control. [score:3]
B. Predicted miR-503 target sequence in 3′UTR of CCND1 and the positions of mutated nucleotides (red). [score:3]
Based on our data in the present study, the function of miR-503 target genes in ESCC might be associated with proliferation and metastasis. [score:3]
Moreover, we plotted the relative expression of miR-503 against that of CCND1 in the patients (Figure5G). [score:3]
qPCR analysis showed that compared to the NE2 cell line, miR-503 expression was markedly decreased in most of the ESCC cell lines examined (Figure1A). [score:2]
The deregulation of miR-503 has been reported in various human cancers [14], [15], [16], [17], [18]. [score:2]
As shown in Figure5C, compared to the cells transfected with the negative control, expression of CCND1 was significantly decreased in the YES-2 and KYSE30 cells transfected with miR-503 mimic or si CCND1. [score:2]
These data demonstrate a direct interaction of CCND1 3′UTR with miR-503. [score:2]
Our data showed that compared to the adjacent non-tumorous tissues from the same patient, there is a significant decrease in miR503 expression in the tumor samples from 83% of the ESCC patients (P  = 0.0021, Figure1B and C). [score:2]
miR-503 negatively regulates proliferation, migration, and invasion and could induce G1/S arrest of ESCC cells. [score:2]
The complementary binding sites of miR-503 and CCND1 3′UTR (nt 1960–1966) are shown in Figure5B. [score:1]
D. of cyclin D1 in YES-2 and KYSE30 cells 48 h after transfected with miR-503 mimic or negative control. [score:1]
Esophageal squamous cell carcinoma miR-503 Cyclin D1 Proliferation Migration and invasion Esophageal cancer (EC) is the fourth leading cause of cancer-related death in China, and esophageal squamous cell carcinoma (ESCC) accounts for 90% of EC [1], [2]. [score:1]
Relative luciferase activity of luciferase reporter plasmids containing the wild-type or mutant CCND1 3′UTR was determined in YES-2 and KYSE30 cells that were co -transfected with the miR-503 mimic or miR-NC. [score:1]
These results indicate that miR-503 could induce cell cycle G1/S arrest. [score:1]
Correlation Pearson analysis was performed to evaluate the association between miR-503 expression and CCND1 expression and calculate coefficient (r) and P values. [score:1]
Cells were cotransfected with WT or MUT plasmid and miRNA negative control or miR-503 mimic using Lipofectamine 3000 (Invitrogen). [score:1]
As a result, 6 candidate genes that contain miR-503 binding sequence in their 3′UTRs were commonly found using these two bioinformatics methods (Figure5A). [score:1]
We next used qPCR to evaluate miR-503 expression in 71 pairs of tumor samples and the adjacent non-tumorous tissue samples from ESCC patients. [score:1]
Our findings provide a mechanism by which miR-503 mediates ESCC malignant phenotype formation. [score:1]
B. Relative expression of miR-503 was evaluated using qPCR in 71 pairs of ESCC samples and the corresponding adjacent non-cancerous samples. [score:1]
The luciferase construct, Renilla plasmid, and miR-503 mimic or negative control were cotransfected into YES-2 or KYSE30 cells. [score:1]
miR-503 plays a crucial role in tumorigenesis and cancer progression. [score:1]
To evaluate the possible association between miR-503 expression and clinicopathological characteristics of ESCC patients, we then analyzed the miR-503 expression levels regarding the clinicopathological information of ESCC patients using Pearson’s χ [2] test. [score:1]
[1 to 20 of 89 sentences]
2
[+] score: 337
Furthermore, over -expression of miR-503 and knockdown of PI3K p85 can down-regulate the expression of Snail, which confirms that miR-503 regulates EMT via the regulation of the transcription factor Snail. [score:11]
The aforementioned studies have shown that the expression of miR-503 is down-regulated in the silica -treated HBE cells and A549 cells (Fig.   4e,f and Supplementary Fig.   1d,e), thus we wonder whether the expression of miR-503 is regulated by lncRNA. [score:9]
In addition, we confirmed that ectopic expression of miR-503 via mimic transfection could partly reverse the morphological changes of HBE cells (Supplementary Fig.   1j) and suppressed the expression of p-PI3K p85, PI3K p85, vimentin and α-SMA, and correspondingly enhanced the expression of E-cadherin at the protein level (Fig.   4g and Supplementary Fig.   1k). [score:9]
Furthermore, knockdown of MALAT1 released miR-503 and inhibited the expression of its target gene PI3K p85 thus alleviating the process of EMT. [score:8]
Having verified the expression of miR-503 was down-regulated in the mouse lung tissues of silica -induced pulmonary fibrosis, then we explored whether raising the expression of miR-503 in vivo alleviates the process of EMT and influences the pathological process of silicosis. [score:8]
Increased miR-503 attenuates the EMT in vivoHaving verified the expression of miR-503 was down-regulated in the mouse lung tissues of silica -induced pulmonary fibrosis, then we explored whether raising the expression of miR-503 in vivo alleviates the process of EMT and influences the pathological process of silicosis. [score:8]
In addition, the over expression of miR-503 could also suppress p-Akt expression both in vivo and in vitro, which all suggest that miR-503 limits the development of EMT via PI3K/Akt signaling pathway. [score:8]
Consistently, the up-regulation of miR-503 increased the protein expression level of E-cadherin and decreased the expression levels of vimentin and α-SMA, thus alleviating the process of EMT (Fig.   2d). [score:8]
The results showed that the expression of lncRNA MALAT1 was significantly up-regulated in the silica -treated group compared to the control one (Fig.   6b), which is negatively correlated with miR-503 expression. [score:7]
Li et al. [42] suggested that the expression of miR-503 is up-regulated in the adenocarcinoma. [score:6]
Although we have demonstrated that the expression of miR-503 is down-regulated in silica -induced pulmonary fibrotic tissues and HBE cells, the mechanisms for the alterations of miR-503 are still obscure. [score:6]
The expression of miR-503 is down-regulated in the lung tissues of mice with silica -induced pulmonary fibrosis. [score:6]
In silica -treated HBE and A549 cell lines, the protein expression levels of p-PI3K p85 and PI3K p85 increased (Fig.   4c and d and Supplementary Fig.   1d and e), and the miR-503 levels were decreased significantly (Fig.   4e and f and Supplementary Fig.   1h and i), which showed the inverse correlation with PI3K p85 expressions. [score:5]
Furthermore, miR-503 overexpression can inhibit EMT, slowing down the progression of pulmonary fibrosis. [score:5]
So we predicted the target genes by the bioinformatics tools and found that PI3K p85 is a target of miR-503. [score:5]
Based on these findings, we concluded that miR-503 suppresses EMT by targeting PI3K/Akt/mTOR/Snail pathway in silica -induced pulmonary fibrosis. [score:5]
Silica treatment resulted in the enhanced expression of lncRNA MALAT1, which competitively binding to miR-503 and depressed its expression. [score:5]
On the contrary, overexpression of miR-503 repressed the protein expression of p-Akt, p-mTOR and Snail in vivo (Fig.   5d) and in vitro (Fig.   5e and Supplementary Fig.   2a). [score:5]
These data showed that the expression of miR-503 appears to be disease-specific or cell-type specific. [score:5]
The results revealed that inhibition of lncRNA MALAT1 could significantly increase the expression of miR-503 in these two cell lines (Fig.   6f and Supplementary Fig.   3c). [score:5]
In this study, we have identified that PI3K p85 is highly expressed in silica -induced lung fibrotic tissues, HBE cells, A549 cells, which is consistent with the negative expression of miR-503. [score:5]
Therefore, we use TargetScan bioinformatics software to predict the target genes of miR-503. [score:5]
It concentrated on the EMT-suppressive effects of miR-503 on the silica -induced pulmonary fibrosis via the classical PI3K/Akt/Snail signaling pathway, and the lncRNA MALAT1 serves as a molecular sponge to competitively decrease the expression of miR-503. [score:5]
Interestingly, overexpression of PI3K p85 largely counteracted the inhibitory effects of miR-503 mimic (Fig.   4i and Supplementary Fig.   1m). [score:5]
Conversely, the cells treated with silica result in the enhanced expression of lncRNA MALAT1, which competitively binds to miR-503 and depresses its expression. [score:5]
Our rescue experiment also showed that co-transfection with pcDNA3.1-PI3K p85 and miR-503 mimic restored the protein expression levels of p-Akt, p-mTOR and Snail which were inhibited by miR-503 mimic (Fig.   5g and Supplementary Fig.   2c). [score:5]
While accumulated evidence indicated that the expression of miR-503 varies in different organs and diseases. [score:5]
Zhou et al. [23] identified a potential epigenetic mechanism for the explanation of the down-regulation of miR-503 in HepG2 and LO2 cells. [score:4]
And up-regulated miR-503 in a mouse mo del also reduced the protein levels of p-PI3K p85 and PI3K p85 (Fig.   3c). [score:4]
Moreover, Yang et al. [27] reported that PI3K p85 is a direct target of miR-503 in non-small cell lung cancer. [score:4]
For the wild type with PI3K p85 reporter, over -expression of miR-503 significantly reduced its relative luciferase activity compared to group transfected with non-target miRNA mimic control, whereas this effect was abolished in the case of the mutant reporter in which the miR-503 binding site was mutated (Fig.   3d and Supplementary Fig.   1b). [score:4]
Our previous microarray analysis showed miR-503 is down-regulated in the lung fibrotic tissue which suggested miR-503 may play an important role in the process of pulmonary fibrosis. [score:4]
It means the expression of miR-503 could be possibly regulated by the modulation of methylation of the CpG islands. [score:4]
All these results strongly suggest that PI3K p85 can be targeted by miR-503 directly. [score:4]
Taken together, our results indicated that miR-503 alleviates the process of EMT by down -regulating the expression of PI3K p85. [score:4]
In present study, we have identified PI3K p85 is a target gene of miR-503, and a number of studies have demonstrated that PI3K p85 can be regulated by some other miRNAs. [score:4]
Taken together, these results indicated that miR-503 is able to alleviate the development and pathological process of mouse pulmonary fibrosis in vivo via the EMT-suppressive effects. [score:4]
MiR-503 binds to the 3′-UTR region of PI3K p85 and represses its levels, thus inhibiting the expression of the downstream molecules, p-Akt, p-mTOR and Snail, and ultimately leading to alleviation of EMT. [score:4]
It was also proved that miR-503 overexpression increased E-cadherin expression and reduced vimentin in fibrotic lung tissues by using immunohistochemistry assays (Fig.   2e). [score:4]
To validate the expression level of miR-503 in this re-established mo del, qRT-PCR analysis was performed and displayed markedly decreased expression of miR-503, about five-fold changes, in the day 28 group as compared with the control group (Fig.   1c). [score:4]
The miR-503 overexpression mouse lung fibrosis mo del was conducted by intratracheal instillation of 200 nmol/kg miR-503 agomir (RiboBio Co, Ltd, Guangzhou, China) after silica instillation. [score:3]
All these results indicated that miR-503 is significantly down-regulated in the fibrotic mice lung tissues, but whether miR-503 influences the pathological process and development of the pulmonary fibrosis needs further investigation. [score:3]
Two CpG enriched islands were found near the translational start site of miR-503. [score:3]
Figure 1The expression of miR-503 is decreased in mouse lung tissues of silica -induced pulmonary fibrosis. [score:3]
It was found that PI3K p85 might be the functional potential target of miR-503 (Fig.   3a). [score:3]
The results showed down-regulation of miR-503 was found in the silica group compared with the control group, but elevated when treated with miR-503 agomir (Fig.   2b). [score:3]
The results obtained here have preliminarily illustrated the target gene of miR-503, while the downstream molecular signaling mechanisms need further research. [score:3]
Some studies revealed that the expression of miR-503 is increased in several kinds of cancers 41– 44. [score:3]
For example, Long et al. reported that miR-503 inhibits cell proliferation in human breast cancer [22]. [score:3]
Therefore, we examined whether miR-503 could inhibit EMT through PI3K/Akt/mTOR/Snail signaling pathway. [score:3]
However, on the contrary, some other studies reported the declined expression of miR-503 in cervical cancer [19], non-small cell lung cancer (NSCLC) [45] and hepatocellular carcinoma(HCC) [46]. [score:3]
To further investigate whether MALAT1 is a functional target of miR-503, the relative expression of lncRNA MALAT1 in silica -treated HBE cells was detected by qRT-PCR. [score:3]
Peng et al. identified that miR-503 inhibits cell growth and EMT in gastric cancer [24]. [score:3]
We overexpressed PI3K p85 by the co-transfection of pcDNA3.1-PI3K p85 plasmid with miR-503 mimic. [score:3]
The miR-503 expression levels were normalized to U6 (interval reference) and the lncRNA MALAT1 expression levels were normalized to GAPDH (interval reference) and calculated via 2 [−ΔΔCt] method. [score:3]
With the help of several bioinformatics software, we found that lncRNA MALAT1 might be the potential target of miR-503. [score:3]
The predict software (Starbase v2.0 and RegRNA 2.0) was used to identify the potential target lncRNA of miR-503 and found a putative complementary sequence for miR-503 in lncRNA MALAT1 at position 6623–6650 (Fig.   6a). [score:3]
Figure 7 The signaling pathway for miR-503 playing its EMT-suppressive role in silica -induced pulmonary fibrosis. [score:3]
The miR-503 expression was performed using SYBR Green methods (TaKaRa Bio Inc, Japan) by qRT-PCR (ABI7900 real-time PCR instrument). [score:3]
But the molecular mechanisms underlying the EMT-suppressive effects of miR-503 are still unclear. [score:3]
And on day 7, 14, 21 after the molding, 120nmol/kg miR-503 agomir were given to the miR-503 over expression group via tail vein injection. [score:3]
Having identified PI3K p85 is the target gene of miR-503, we were also wondering which signaling pathway is the key point in alleviating EMT in pulmonary fibrosis. [score:3]
After we have confirmed lncRNA MALAT1 could act as a sponge of miR-503, and miR-503 could influence EMT through PI3K/Akt/mTOR/Snail signaling pathway, it is need to test whether lncRNA MALAT1 regulates the process of EMT via the miR-503-PI3K/Akt/mTOR/Snail signaling pathway. [score:2]
Our previous miRNA microarray data have shown that the expression of miR-503 is decreased in mouse lung tissues of the silica group compared to the control group. [score:2]
We have identified that the expression levels of miR-503 are significantly decreased in the tissues of silica -induced pulmonary fibrosis and two cell lines (HBE and A549) treated with silica compared with their control groups. [score:2]
MiR-503 blocks the process of EMT via targeting PI3K p85. [score:2]
Our previous data revealed that the relative expression of miR-503 is reduced in the lung tissues of the silica group compared to the control group by microarray analysis. [score:2]
Figure 6LncRNA MALAT1 promotes EMT via binding to miR-503 directly. [score:2]
Based on our findings, a functional mo del was proposed to integrate miR-503 with downstream PI3K/Akt/mTOR/Snail signaling and upstream endogenous ‘sponge’ lncRNA MALAT1 regulation network (Fig.   7). [score:2]
However, fewer studies have concentrated on the regulation of miR-503 in the pathological process of lung fibrosis, particularly silicosis. [score:2]
LncRNA MALAT1 promotes EMT via binding to miR-503 directly. [score:2]
Taken together, it appears that lncRNA MALAT1 is able to bind to miR-503 directly. [score:2]
To verify whether miR-503 is capable of regulating PI3K p85 via the binding sites in its 3′-UTR, we constructed the 3′-UTR containing the predicted miR-503 binding site downstream of the firefly luciferase coding region in the psi-CHECK2-REPORT luciferase vector. [score:2]
Previous microarray study of mouse lung fibrosis showed that the expression of miR-503 on day 28 after silica treatment was decreased about three-fold changes compared with the control group (Supplementary Fig.   1a). [score:2]
, Ltd, Shanghai, China) and was co -transfected with miR-503 mimic into HBE and A549 cells for the rescue experiment. [score:1]
To our knowledge, this is the first report showed miR-503 could be sponged by lncRNA MALAT1. [score:1]
Furthermore, was applied to validate whether miR-503 could bind to lncRNA MALAT1. [score:1]
Moreover, Zhao et al. [43] revealed that the increase of miR-503 is associated with tumorigenesis of retinoblastoma. [score:1]
And then we confirmed that MALAT1 could bind to miR-503 directly by performing and dual-luciferase reporter gene assay. [score:1]
In addition, miR-503 has been reported to exert diverse biological functions in several kinds of cancer, such as hepatocellular carcinoma (HCC), cervical cancer, prostate cancer, etc. [score:1]
HBE or A549 cells were cultured in 24-well plates and transfected with 400 ng of either firefly luciferase reporter plasmids (pGL3-MALAT1-wt-3′-UTR; pGL3-MALAT1-mut-3′-UTR) together with 25 ng renilla luciferase construct (pRL-SV40), or 300ng of psiCHECK2-PIK3R1-wt-3′-UTR or psiCHECK2-PIK3R1- mut-3′-UTR combined with 50 nM miR-503 or miR-NC mimic using Reagent (RiboBio Co, Ltd, Guangzhou, China) according to the manufacturer’s protocol. [score:1]
The C57BL/6 mice were co -transfected 200 nmol/kg either miR-503 or miR-NC agomir with 50 mg/kg silica suspension via intratracheal instillation, and the mice were injected with 120 nmol/kg miR-503 or miR-NC agomir via the tail vein on day 7, 14 and 21. [score:1]
Transfection of 50 nM miR-503 mimic (RiboBio Co, Ltd, Guangzhou, China) and PI3K p85 siRNA (RiboBio Co, Ltd, Guangzhou, China) were performed the day before the treatment of silica suspension following the manufacturer’s protocol. [score:1]
Zhou et al. discussed the role of miR-503 in tumor angiogenesis and growth [23]. [score:1]
To confirm the therapeutic importance of miRNAs in silica -induced pulmonary fibrosis, our previous work have revealed that miR-486-5p and miR-489 play important anti-fibrotic roles in silica -induced pulmonary fibrosis 15, 16. miR-503, located on the chromosome Xq26.3, is an intragenic miRNA, and belongs to the miR-16 family [17]. [score:1]
When miR-503 was silenced, PI3K p85 binding to miR-503 was released and thereby activated the downstream molecules, thus causing intensified process of EMT. [score:1]
Therefore, a critical issue for better understanding is that whether there are some lncRNAs that could sponge miR-503. [score:1]
Biotinylated miR-503 (bio-miR-503) and miR-NC were incubated with the extracted RNA of HBE cells (10 μl of the RNA samples were reserved for input) to pull down lncRNA MALAT1. [score:1]
We cloned sequences containing the binding region of miR-503 in PI3K p85 mRNA and lncRNA MALAT1 and their mutated version were cloned into the psiCHECK2 vector or pGL3-control vector (Generay Biotech Co. [score:1]
To confirm our assumption, the mo del was conducted by dripping miR-503 agomir or miR-NC intratracheally following the instillation of silica at day 0, and then miR-503 agomir or miR-NC was injected via the tail vein on day 7, 14, and 21 after silica treatment. [score:1]
A significant decrease in relative luciferase activity was observed when the pGL3-MALAT1-wt-3′-UTR vector was co -transfected with the miR-503 mimic but not with the miRNA mimic control (Fig.   6d and Supplementary Fig.   3a). [score:1]
When miR-503 is silenced, PI3K p85 bounding to miR-503 is released and thereby activates the downstream molecules, thus leading intensified process of EMT. [score:1]
These data suggest that lncRNA MALAT1 could affect the process of EMT in silica -induced pulmonary fibrosis via miR-503-PI3K/Akt/mTOR/Snail signaling pathway. [score:1]
The correlation between miR-503 and PI3K p85 was further determined by the rescue experiment in both cell lines. [score:1]
Increased miR-503 attenuates the EMT in vivo. [score:1]
Figure 2Increased miR-503 attenuates EMT in vivo. [score:1]
From the study above, we can easily come to the conclusion that miR-503 plays a pivotal role in the process of EMT, thus limiting mouse lung fibrosis. [score:1]
The abundance of MALAT1 also provides great possibility to be a well-sponge platform for many kinds of miRNAs, not only miR-503. [score:1]
The results indicated that miR-503 might be a potentially vital miRNA for the therapy of silicosis. [score:1]
The luciferase reporter vectors together with the miR-503 mimic or miRNA mimic control were transfected into the HBE and A549 cells. [score:1]
[1 to 20 of 100 sentences]
3
[+] score: 313
qRT-PCR showed that miR-503 expression was suppressed by SB-431542 inhibitor, but not by K02288 inhibitor under TGF-â1 treatment. [score:9]
To examine the expression level of miR-503 in human glioblastoma, we analyzed the miRNA’s expression profile from a previously published dataset (Gene expression omnibus accession GSE25631). [score:7]
To translate our findings, we found that inhibition of endogenous microRNA-503 augments the growth inhibitory effect of temozolomide. [score:7]
To translate the above findings, we next examined the effect of combined miR-503 inhibitor and the first-line glioblastoma multiforme treatment, temozolomide [16], on glioblastoma cells over 72 h. The miR-503 inhibitor and temozolomide were used alone at 0.31 uM, 0.62 uM, 1.25 uM, 2.5 uM, 5 uM, 10 uM, 20 uM, 40 uM, and in combination at equipotent concentrations at the same ratios. [score:7]
The data showed a lower percentage of annexin V positive cells in the miR-503 overexpression group than in the scramble cells (Fig.   5E), suggesting miR-503 overexpression suppresses glioblastoma cell apoptosis. [score:7]
However, little was known about how microRNA-503 was upregulated in cancer cells, although there were several reports of its aberrant expression. [score:6]
To examine the biological role of miR-503 in glioblastoma cells, we transfected glioblastoma cells with miR-503 inhibitor or mimic to knockdown or overexpress the endogenous miR-503, respectively. [score:6]
Taken together, these data suggest that miR-503 downregulates the expression of PDCD4. [score:6]
For example, downregulation of microRNA-503 expression level predicates advanced cytological features and poor prognosis in patients with non-small cell lung cancer [7]. [score:6]
The result showed that overexpression of miR-503 enhanced anchorage-independent growth, as expected, and knockdown of miR-503 suppressed anchorage-independent growth (Fig.   5D), indicating an essential role of miR-503 in cell growth. [score:6]
We found that microRNA-503 increases proliferation of glioblastoma cells and inhibits apoptosis by directly targeting PDCD4. [score:6]
The results showed that overexpression of miR-503 enhanced cell proliferation, and in contrast, knockdown of miR-503 suppressed glioblastoma cell growth (Fig.   5B). [score:6]
Cells were seeded in duplicate in 96-well plates 24 hours before exposure to various concentrations of miR-503 inhibitor (The miR-503 inhibitor and temozolomide were used alone at 0.31 uM, 0.62 uM, 1.25 uM, 2.5 uM, 5 uM, 10 uM, 20 uM, 40 uM, and in combination at equipotent concentrations at the same ratios) and temozolomide in constant molar ratios. [score:5]
Furthermore, miR-503 inhibitor augments the growth -inhibitory effect of temozolomide in glioblastoma cells. [score:5]
Finally, miR-503 inhibitor augments the growth inhibitory effect of temozolomide in glioblastoma cells. [score:5]
In prostate cancer, microRNA-503 can directly regulate RNF31 and thus suppress tumor cell proliferation and metastasis [8]. [score:5]
In vitro drug treatment and synergism analysis Cells were seeded in duplicate in 96-well plates 24 hours before exposure to various concentrations of miR-503 inhibitor (The miR-503 inhibitor and temozolomide were used alone at 0.31 uM, 0.62 uM, 1.25 uM, 2.5 uM, 5 uM, 10 uM, 20 uM, 40 uM, and in combination at equipotent concentrations at the same ratios) and temozolomide in constant molar ratios. [score:5]
Figure 6Growth inhibition induced by miR-503 inhibitor and temozolomide, alone and in combination. [score:5]
miR-503 suppresses PDCD4 expression. [score:5]
Furthermore, overexpression of microRNA-503 significantly inhibited cell apoptosis. [score:5]
These data showed that miR-503 inhibitor augmented the growth inhibitory effect of temozolomide (Fig.   6B,D). [score:5]
miR-503 inhibitor and temozolomide inhibit glioblastoma cell growth alone and in combination. [score:5]
This suggests that microRNA-503 functions as an oncogene and is upregulated in glioblastoma. [score:4]
miR-503 is up-regulated in glioblastoma. [score:4]
In this report, we found that miR-503 is overexpressed in human glioblastoma tissues compared with normal brain tissues, and that TGF-â1 can induce miR-503 expression at the transcriptional level by binding the promoter. [score:4]
Taken together, these data indicate that TGF-â1 regulates the expression of miR-503 in glioblastoma via the smad2/3 pathway. [score:4]
Feinmesser et al. reported that upregulation of miR-503 was the best single discriminator of malignancy [11]. [score:4]
Analysis of microRNA expression profiling shows that microRNA-503 regulates metastatic function in hepatocellular cancer cells [9]. [score:4]
Our biological function assay showed that miR-503 enhances cell proliferation and inhibits apoptosis by targeting PDCD4. [score:4]
We detected the level of PDCD4 protein using western blot in cells overexpressing miR-503. [score:3]
To further confirm the expression level of miR-503 in glioblastoma, we performed qRT-PCR to detect the level of miR-503 in glioblastoma cell lines. [score:3]
Moreover, we analyzed the level of PDCD4 mRNA using qRT-PCR in glioblastoma cells transfected with miR-503 inhibitor or mimics. [score:3]
qRT-PCR showed that TGF-â1 administration strongly induced pri-miR-503 expression (Fig.   3A). [score:3]
The median effect analysis showed that microRNA-503 inhibitor and temozolomide at high concentration have a synergistic effect. [score:3]
Building on these published data, we found that TGF-â1 induces microRNA-503 expression in glioblastoma cells. [score:3]
TGF-â1 induces the expression of miR-503 in glioblastoma cells. [score:3]
The result showed that expression of mature miR-503 increased with the TGF-â1 dose increase (Fig.   2B). [score:3]
To further identify how TGF-â1 regulates miR-503 expression, we analyzed the 2500 bp region upstream of pri-miR-503 using five pairs of primers to create a library of five 500 bp regions spanning the miR-503 promoter (Fig.   3C). [score:3]
To explore whether TGF-â1 induces miR-503 expression, we treated glioblastoma cells with different TGF- â1 doses, ranging from 2ng/ml to 16ng/ml, and then performed qRT-PCR to determine miR-503 levels. [score:3]
We next tested the effect of miR-503 inhibitor on colony formation in vitro. [score:3]
In conclusion, miR-503 is overexpressed in glioblastoma. [score:3]
In our study of glioblastoma cells, ectopic expression of microRNA-503 with mimics significantly increased cell growth, colony formation and anchorage-independent growth in soft agar. [score:3]
The western blot showed that miR-503 inhibitor augmented the level of PARP cleavage, an indicator of apoptosis, when combined with temozolomide. [score:3]
We seeded the miR-503 knockdown or overexpression cells in 96 well plates and cultured them to different time points for the Alarma Blue cell growth assay. [score:3]
However, microRNA-503 was found to be upregulated in esophageal cancer tissues compared to adjacent normal tissues and to promote tumor progression [10]. [score:3]
The data showed that all combinations of miR-503 inhibitor and temozolomide were synergistic at the combined concentrations of 5 uM, 10 uM, 20 uM, and 40 uM. [score:3]
In NSCLC and prostate cancer, microRNA-503 acts as tumor suppressor, however, in esophageal cancer and hepatocellular cancer, microRNA-503 act as an oncogene. [score:3]
In summary, our study shows that microRNA-503 is overexpressed in glioblastoma tissues. [score:3]
The data showed that overexpression of miR-503 dramatically decreased the level of PDCD4 protein (Fig.   4B). [score:3]
These results provide a potential preclinical rationale for examining miR-503 inhibitor in combination with chemotherapy for glioblastoma treatment. [score:3]
Taken together, these results provide a potential preclinical rationale for examining miR-503 inhibitor in combination with chemotherapy for treatment of glioblastoma. [score:3]
The result showed that miR-503 is significantly upregulated in glioblastoma tissue compared with normal brain tissue (p < 0.001) (Fig.   1A). [score:3]
Aberrant expression of miR-503 has been shown in several types of cancers and appears to be significantly associated with clinical outcome in patients. [score:3]
The data showed that miR-503 inhibitor increased the level of PDCD4 mRNA. [score:3]
Moreover, our data showed that PDCD4 is a downstream target of microRNA-503. [score:3]
Previous studies have shown that miR-503 is dysregulated in several types of cancer, however, the mechanism underlying the regulation of miR-503 in cancer remains unknown. [score:3]
To explore whether there is a relationship between the levels of miR-503 level and miR-424, we analyzed the global microRNA expression of the published NCI-60 cancer cell panel. [score:3]
Figure 2TGF-â1 induces the expression of miR-503 in glioblastoma cells. [score:3]
We found that miR-503 inhibitor strongly repressed colony formation in a dose dependent manner (Fig.   5C). [score:3]
For detection of miR-503 expression, stem-loop RT-PCR was performed. [score:3]
We found that microRNA-503 is highly upregulated in glioblastoma tissue compared with normal brain tissue, which is consistent with the report from Stefan Wuchty et al. [24]. [score:3]
miR-503 increases glioblastoma cell proliferation and inhibits cell apoptosis. [score:3]
We stained cells overexpressing miR-503 with annexin V and PI for flow cytometry analysis. [score:3]
To explore whether TGF-â1 stimulation could induce miR-503 expression at the transcriptional level, we detected the pri-miR-503 level in glioblastoma cells under TGF-â1 treatment. [score:3]
On the basis of these findings, we hypothesized that PDCD4 is a potential target of miR-503. [score:3]
To further confirm the effect of TGF-â1 on miR-503 expression, TGF-â1 was administered to glioblastoma cells at final concentration of 8 ng/ml and qRT-PCR was performed at different time points (0, 48, 72, and 96 hours). [score:3]
Cells were transfected with 20 nM miR-503 mimics, miR-503 inhibitor or negative controls (Shanghai GenePharma) using RNAiMAX transfection reagent (Life Technologies) according to the manufacturer’s instructions. [score:3]
TGF-â1 induces the expression of miR-503 at the level of transcription. [score:3]
These results establish miR-503 as a promising molecular target for glioblastoma therapy. [score:3]
qRT-PCR showed that miR-503 expression was enhanced under TGF-â1 treatment, and was highest at 72 hours in three glioblastoma cell lines and at 96 hours in T98G cells (Fig.   2C). [score:3]
Figure 3TGF-â1 induces the expression of miR-503 at the transcriptional level. [score:3]
In conclusion, Smad2/3 binds to the SBE3 in the set 4 region of the pri-miR-503 promoter and directly activates its transcription. [score:2]
U251 and A172 cells were treated with various combinations of miR-503 inhibitor and temozolomide for 72 h. The growth -inhibitory effect was measured by the Alarma Blue assay. [score:2]
MicroRNA-503 and microRNA-424 were shown to be regulated by apelin in pulmonary arterial hypertension. [score:2]
To further detect the mechanism by which miR-503 increases glioblastoma cell growth and suppresses apoptosis, we compared the seed region sequences of miR-503 and miR-424. [score:2]
In contrast, knockdown of microRNA-503 sup pressed cell proliferation and anchorage-independent growth. [score:2]
Furthermore, to confirm whether PDCD4 is indeed the target of miR-503, we cloned the 3′ UTR of PDCD4 into the dual-luciferase UTR vector and performed the luciferase reporter assay (Fig.   4C). [score:2]
For the 3′ UTR luciferase reporter assay, the miR-503 mimics or inhibitor and pmirGLO, pmirGLO-PDCD4 3′ UTR-wt, pmirGLO-PDCD4–3′ UTR-mut were cotransfected into HEK293T. [score:2]
As smad2/3 is the key mediator of the canonical TGF-â1 pathway, we explored whether endogenous need of TGF-â1 pathway for the miR-503 regulation in glioblastoma cells. [score:2]
Thus, our data indicates that TGF-â1-microRNA-503 may play a key role in glioblastoma progression. [score:1]
In glioblastoma, the role of miR-503 remains largely unknown. [score:1]
The role of microRNA-503 varies in different cancer tissues. [score:1]
The data showed that luciferase activity was significantly decreased in cells cotransfected with miR-503 mimics and 3′ UTR-wild-type, but not in cells cotransfected with miR-503 mimics and 3′ UTR-mutant. [score:1]
The precipitated DNA was analyzed using PCR to amplify five 500 bp regions (set 1, set 2, set 3, set 4, set 5) of the miR-503 promoter. [score:1]
U251 cells were transfected with pGL-miR-503-wt-set4, pGL-miR-503-mut-SBE1, pGL-miR-503-mut-SBE2, pGL-miR-503-mut-SBE3, or pGL-miR-503-mut-SBE4 and Renilla. [score:1]
We found that miR-503 and miR-424 levels have a strong correlation (R2 = 0.7421) (Fig.   2A), which indicates that miR-503 and miR-424 may be governed by the same mechanism. [score:1]
We used qRT-PCR to demonstrate that miR-503 was indeed dramatically decreased or enhanced as expected (Fig.   5A). [score:1]
The result showed that the miR-503 level is higher in the six glioblastoma cell lines (U251, A172, LN-229, T98G, U87MG and U-138MG) than in normal human astrocytes (NHAs) (Fig.   1B). [score:1]
In contrast, miR-503 mimics reduced the PDCD4 mRNA level (Fig.   4D). [score:1]
Furthermore, TGF-â1 induces microRNA-503 at the transcriptional level by binding a core promoter element. [score:1]
The blue nucleotides are the seed region of miR-424 and miR-503. [score:1]
Jongmin Kim et al. reported that miR-503 and miR-424, which are separated by 250 bp on the X chromosome, are transcribed as a single transcript. [score:1]
We next sought to explore the role of miR-503 in apoptosis. [score:1]
[1 to 20 of 93 sentences]
4
[+] score: 301
miR-503 targeting of DDHD2 may represent an isolated case, but analysis of our experimentally identified genome wide target set suggests miR-503 uses 3′ target pairing to mediate gene expression throughout its targetome. [score:11]
Transient overexpression of miR-503 did not repress the transcript levels of DDHD2 in proliferating primary human fibroblasts (data not shown) but did decrease protein levels in both fibroblasts and HeLa cells, indicating miR-503 more strongly represses DDHD2 expression through inhibition of translation than mRNA destabilization (Figure  5B). [score:9]
Analysis of the genome wide target profiles revealed evidence of extensive regulation of gene expression through non-canonical target pairing by miR-503. [score:8]
Our results provide an extensive genome wide set of targets for miR-503, miR-103, and miR-494, and suggest that miR-503 may act as a tumor suppressor in breast cancer by its direct non-canonical targeting of DDHD2. [score:8]
In this study, we experimentally determined the targetomes of multiple miRNAs that repress cell proliferation, and showed that miR-503 regulates the expression of the proto-oncogene DDHD2 by a unique non-canonical targeting mode. [score:8]
miRNA miRNA targeting Proliferation Ago2 immunoprecipitation RIP-seq miRNA targets miRNA target pairing miR-503 miRNA non-canonical pairing The ability of human cells to transition from a quiescent to proliferative state is essential for tissue homeostasis. [score:7]
In our experiments, we found evidence of extensive non-canonical targeting by miR-503 mediating both RISC-target association and gene expression. [score:7]
We further explored the targeting mechanisms of miR-503 experimentally, and confirmed that miR-503 targets the proto-oncogene DDHD2 through a novel form of non-canonical target pairing. [score:7]
To confirm their effect on cell growth, we overexpressed miR-503, −103, −494, and miR-34a, a well known tumor suppressor [37], in proliferating fibroblasts and counted cells expressing Ki67 protein using flow cytometry. [score:7]
Moderate repression of multiple key regulatory genes can have large phenotypic effects in concert, and miR-503 may conceivably inhibit breast cancer tumorigenesis by repressing multiple previously known targets in addition to DDHD2. [score:6]
In summary, we demonstrated that miR-503 represses cell proliferation, and may function as a tumor suppressor in ER+ cancer by utilizing non-canonical 3′ pairing to target and repress the proto-oncogene DDHD2. [score:5]
There was enrichment for proliferation related genes in the targets identified for miR-503 and miR-494, but there were not enough target genes identified for miR-103 to produce meaningful results (Additional file 2) [38- 40]. [score:5]
There were no differences between compensatory target pairing sites and the intact 5′ seed alone for both miR-503 and miR-103, making it difficult to draw conclusions as to utilization of compensatory target pairing. [score:5]
We then constructed genome wide target sets for miR-503, −103, and −494 using RIP and global gene expression profiling methodologies. [score:5]
We identified a genome wide set of the targets of miR-503, −103, and −494 by conducting extensive profiling of RISC associated transcripts and gene expression profiling. [score:5]
miR-503 has been shown to act as a tumor suppressor in several cancers, and decreases in miR-503 expression have been reported in multiple cancer types [26, 30, 32, 44]. [score:5]
Patients with high miR-503 expression had a significantly higher survival probability than patients with low miR-503 expression (Figure  6A). [score:5]
Bars are the mean percentage of cells expressing Ki67 relative to Control RNA 2, and error bars denote ± SD, n = 3. (C) miR-503 and −103 transfection significantly inhibits progression through the cell cycle. [score:5]
We identified the proto-oncogene DDHD2 as a target of miR-503 that requires pairing outside of the canonical 5′ seed region of miR-503, representing a novel mode of miRNA-target pairing. [score:5]
To further confirm functional targeting of DDHD2 by miR-503, we transiently overexpressed miR-503 in proliferating fibroblasts and HeLa cells. [score:5]
miR-503 repressed expression of the reporter with the intact 3′UTR of DDHD2, and deleting the sequences pairing to the 5′ and 3′ portion of miR-503 relieved repression, indicating that miR-503 functionally targets DDHD2 for repression through these sites. [score:5]
Taken together, these data suggest that miR-503 may function as a previously unknown tumor suppressor in ER+ breast cancer, and that a critical component of its tumor suppressor role could be the repression of DDHD2 via a non-canonical mechanism. [score:5]
In addition, we showed that miR-503 acts like a tumor suppressor by non-canonically targeting the putative oncogene DDHD2. [score:5]
To determine the sub-sequences of miR-503, −103, and −494 that are used for target pairing, we examined enrichment of 6-mer sequences that pair different areas of the mature miRNAs in the 3′UTRs of the experimentally identified targets (Figure  4A). [score:5]
In addition, miR-503 has been shown to target multiple oncogenes and regulators of proliferation [30, 33, 44, 45]. [score:4]
Yang Y, Liu L, Zhang Y, Guan H, Wu J, Zhu X, Yuan J, Li M. MiR-503 targets PI3K p85 and IKK-β and suppresses progression of non-small cell lung cancer. [score:4]
To rule out indirect effects from flooding the cells and the RNA silencing machinery with large quantities of the mature miRNA duplexes, we transiently inhibited miR-503, −103, and −494 in fibroblasts induced into quiescence by serum removal. [score:4]
Taken together, these data indicated that all 3 of these miRNAs inhibit cell growth, with miR-503 most clearly regulating proliferation and cell cycle progression. [score:4]
Considered as a whole, these studies suggest that miR-503 operates as a potent tumor suppressor that regulates multiple pathways that are frequently deregulated in tumorigenesis. [score:4]
Figure 5 Pairing of the 3′ and 5′ end of miR-503 is necessary for direct targeting by miR-503 of the proto-oncogene DDHD2. [score:4]
Pairing of the 3′ and 5′ end of miR-503 is necessary for direct targeting by miR-503 of the cell growth promoting gene DDHD2. [score:4]
Surprisingly, cells with transiently overexpressed miR-503, −103, or −494 showed significant reductions in the rate of cell growth (Figure  1A). [score:3]
Error bars denote ± SD, n = 3. (D) Inhibition of miR-503, −103, and −494 increases cell growth in quiescent fibroblasts. [score:3]
In addition, mRNAs that were most repressed following miRNA transient overexpression showed the greatest enrichment for miR-103, and −494 seed matches, although not for miR-503 (Figure  3C). [score:3]
miR-503, miR-103, and miR-494 have previously been shown to act as either oncogenes or tumor suppressors in different cellular contexts [22- 29]. [score:3]
miR-503 inhibits hepatocellular carcinoma, glioblastoma multiforme, and non small cell lung cancer (NSCLC) tumorigenesis by repressing proliferation, inducing cell cycle arrest, and reducing metastasis [26, 30, 32, 46]. [score:3]
We used the MIRUMIR tool to query the prognostic value of miR-503 expression levels in a published data set of patients with high-risk ER+ breast cancers [43]. [score:3]
Based on the enrichment for sequences pairing the miRNA 5′ seed and the miRNA 3′ end for miR-503 and miR-103, we hypothesized that miR-503 and −103 were using supplementary or compensatory pairing to target mRNAs (Figure  4B). [score:3]
Figure 1 miR-503, −103, and −494 inhibit proliferation. [score:3]
This data suggests miR-503 plays a role in breast cancer tumorigenesis at least in part by targeting DDHD2. [score:3]
For all mRNAs profiled, the level of RISC association correlated well with repression of gene expression (Pearson correlation between RIP-seq enrichment and was 0.65, 0.63, and 0.58 for miR-503, −103, and −494 respectively). [score:3]
Our analysis showed that decreased miR-503 expression correlated with low patient survivability, and that DDHD2 copy number amplifications were most frequent in invasive breast carcinoma and correlate significantly with low patient survivability. [score:3]
Average cell number relative to 0 hr following transfection of an LNA targeting miR-503, −103, or −494 or a LNA negative control is shown for each time point indicated. [score:3]
Additionally, miR-503 also represses hepatocellular carcinoma tumor angiogenesis by targeting the potent angiogenic factors FGF2 and VEGFA [32]. [score:3]
miR-503 acts as a tumor suppressor in non-small cell lung cancer, glioblastoma, and hepatocellular carcinoma [26, 30- 33], and as an oncomiR in colon cancer [29]. [score:3]
A slightly offset seed sequence (position 1–6) was used for miR-503 because it was slightly more enriched in the experimentally identified targets (Figure  4A). [score:3]
In addition, transient overexpression of miR-503 and −103 in proliferating fibroblasts significantly decreased the rate of progression through the cell cycle (Figure  1C). [score:3]
To experimentally determine the target pairing mechanisms used by miR-503, we cloned the 3′UTR of DDHD2 into luciferase reporter constructs, and constructed additional reporter constructs of the 3′UTR of DDHD2 with deletions of either the sequence pairing the 5′ end of miR-503, the sequence pairing the 3′ end of miR-503, or both (Figure  5A). [score:3]
Genome wide profiling of miR-503, −103, and −494 targets. [score:3]
Following transient miR-503, −103, and −494 overexpression, mRNAs with the greatest RISC association had a high frequency of the corresponding miRNA seed matches (Figure  3B). [score:3]
In addition, we provided experimentally determined genome wide target profiles of the proliferation related miRNAs miR-503, −103, and −494. [score:3]
We went on to experimentally confirm that 3′ target pairing was necessary for miR-503 to repress DDHD2. [score:3]
Using previously published data we identified numerous miRNAs induced in fibroblasts transitioning from quiescence to proliferation, and selected three, miR-503, miR-103, and miR-494, for further study that were consistently induced by serum stimulation and predicted to target proliferation and or cell cycle related genes [34]. [score:3]
Taken together, this data strongly suggests miR-503 may utilize supplementary target pairing for repression. [score:3]
Additional file 2: GO term enrichment for experimentally determined miRNA targetomes for miR-503 and miR-494. [score:3]
The frequency of compensatory pairing sites in the target gene set for either miR-503 or miR-103 was not higher than the frequency of 5′ seed matches (Figure  4C & Additional file 3). [score:3]
To experimentally identify the targets of miR-503, −103, and −494 we used two approaches. [score:3]
To investigate the type of target pairing used by miR-503 and −103, we began by further analyzing our RIP and gene expression data. [score:3]
Right: There were no significant differences in miR-503 RIP enrichment or gene expression in RIP enriched mRNAs with different types of miRNA pairing. [score:3]
Inhibition of miR-503, −103, and −494 in quiescent fibroblasts significantly increased the rate of cell growth (Figure  1D). [score:3]
We went on to show that miR-503 targets the oncogene DDHD2 non-canonically, requiring 3′ pairing of miR-503 in addition to the normal 5′ pairing. [score:3]
To further investigate the utilization of supplementary target pairing by miR-503 in targeting genes that affected cell proliferation, we searched for candidate genes to test experimentally based on three criteria: (1) sequences in the 3′ UTR that paired the 5′ and 3′ end of miR-503 (Figure  5), (2) involvement in promoting cell proliferation, and (3) combined RIP-seq and rank. [score:3]
Unexpectedly, deleting only the sequence pairing the 3′ end of miR-503 also significantly relieved repression by miR-503 even though the 5′ seed remained intact, indicating that miR-503 requires pairing of its 3′ end in order to target DDHD2 in addition to the 5′ perfect seed pairing (Figure  5A). [score:3]
Forrest ARR, Kanamori-Katayama M, Tomaru Y, Lassmann T, Ninomiya N, Takahashi Y, et al. Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. [score:2]
Here we identified miR-503, miR-103, and miR-494 as negative regulators of proliferation in primary human cells. [score:2]
We began by screening for miRNA involvement in primary cell proliferation, and identified miR-503, −103, and −494 as regulators of primary cell proliferation. [score:2]
miR-503 and −494 transient overexpression significantly decreased the percentage of Ki67 positive cells compared to multiple controls, indicating that these miRNAs repress proliferation, although not to the extent of miR-34a (Figure  1B) [37]. [score:2]
There were no significant differences in repression for miR-103 or in RISC association for either miR-503 or miR-103 that was dependent on pairing type (Figure  4E & Additional file 3). [score:1]
The subsequences of miR-503 and miR-103 examined for pairing were selected based off the subsequence enrichment plots shown in Figure  4A. [score:1]
We cloned 0.9 kb of the 3′UTR of DDHD2 centered around the putative miR-503 binding site into the psi-CHECK2 plasmid (Promega) downstream from the Renilla luciferase gene using XhoI and NotI restriction sites. [score:1]
Deleting the sequence pairing to the 5′ seed of miR-503 also significantly relieved repression, although there was no significant difference in reporter activity between the 3′ and 5′ deletion constructs (Figure  5A). [score:1]
mRNAs showing high miR-503 dependent RISC association and containing supplementary pairing sites were significantly more repressed than mRNAs showing only miR-503 dependent RISC association (Figure  4D). [score:1]
The involvement of miR-503 in ER+ breast cancer. [score:1]
Kaplan-Meier survival curves for patients with ER+ breast cancer expressing different levels of miR-503 were calculated using the MIRUMIR tool. [score:1]
Figure 6 miR-503 involvement in breast cancer. [score:1]
24 hours after plating, miR-503 or Control siRNA duplexes were transfected at a 100 nM concentration (Lipofectamine, Invitrogen). [score:1]
Additional bioinformatic analysis revealed a link between miR-503, DDHD2, and breast cancer. [score:1]
Further bioinformatics analysis implicated miR-503 and DDHD2 in breast cancer tumorigenesis. [score:1]
We identified one candidate gene, DDHD2, that contained a perfect miR-503 5′ seed match with additional 3′ pairing, had been previously shown to promote proliferation of breast cancer cells [42], and was the highest ranked gene in the combined genome-wide experiments that satisfied the first two criteria. [score:1]
However, supplementary pairing sites were much more frequent than the 5′ seed matches and compensatory pairing sites for both miR-503 and miR-103 (Figure  4C & Additional file 3). [score:1]
Despite the broad involvement of miR-503 in repressing tumorigenesis in various cancers, its activity has not been explored in either primary cells or breast cancer. [score:1]
For miR-503, the criteria used to search for compensatory sites (5′ mismatch + additional 3′ pairing) were: (1) a 6-mer pairing position 1–6 with 1 mismatch, (2) an 8-mer pairing position 11–18 with 0 – 3 mismatches, and (3) a 1 base pair wobble allowed in the length of the sequence separating the 6-mer and 8-mer. [score:1]
Our analysis further linked miR-503 to ER+ breast cancer through DDHD2. [score:1]
miR-503, miR-103, and miR-494 repress proliferation. [score:1]
Since the most enriched 5′ 6-mer for miR-503 was from position 1–6 (Figure  4A), for miR-503 we used both a canonical 5′ position 2–7 seed match, as well as a 5′ position 1–6 seed match. [score:1]
In the whole-site deletion variant, the entire 22 bp sequencing corresponding to the length of miR-503 at its binding site was deleted (QuikChange Lightning Mutagenesis Kit, Agilent). [score:1]
miR-503 has also been shown to play a role in repressing endometrial cancer [44]. [score:1]
The Y-axis denotes relative luciferase units from miR-503 transfected HEK293 cells normalized to control RNA transfected cells. [score:1]
[1 to 20 of 88 sentences]
5
[+] score: 276
Ultimately, to explore whether there is direct inhibition of miR-503 on SMAD7, the SMAD7 3′-UTR segment was cloned into an miRNA target reporter clone with firefly luciferase gene located upstream of the SMAD7 3′-UTR, and the target sites at SMAD7 3′-UTR predicted with TargetScan were then mutated with the QuickChange Lightning site-directed mutagenesis kit (Agilent Technologies) (Fig. 4 G). [score:11]
A possible explanation is that miR-503 could be up-regulated by the same machinery that up-regulates SMAD7 and could serve as a limiting factor to fine-tune its up-regulation. [score:10]
After obtaining the list of predicted targets, further screening was performed to select targets related to TGFβ1-signaling pathway, given the importance of TGFβ1 in SMC differentiation and its role in regulating miR-503 expression. [score:8]
In MSC to SMC differentiation, upon stimulation of TGFβ1, miR-503 is up-regulated in a SMAD4 -dependent pathway and directly targets SMAD7, which is a negative regulator of the TGFβ1 SMAD -dependent signaling pathway, to promote SMC differentiation. [score:8]
Thus far, we established that the up-regulation of miR-503 and the down-regulation of miR-222-5p both regulate MSC to SMC differentiation. [score:8]
Consistent with the microRNA array results, the up-regulation of miR-503-5p and the down-regulation of miR-222-5p were time -dependent (Fig. 3 A). [score:7]
Taken together, we showed that miR-503 is transcriptionally up-regulated upon TGFβ1 treatment through a SMAD4 -dependent pathway and subsequently targets SMAD7, which is a negative regulator of SMAD -dependent signaling. [score:7]
During SMC differentiation, miR-222-5p down-regulation might work together with miR-503 up-regulation. [score:7]
It was established in our study that miR-503 targets SMAD7 to promote MSC to SMC differentiation, and miR-222-5p targets ROCK2 to inhibit the differentiation process. [score:7]
SMAD7 is a direct target of miR-503 and miR-503 is transcriptionally up-regulated through SMAD4 -dependent pathway. [score:7]
It was revealed that miR-503 co-transfection in HEK293 cells could inhibit the relative luciferase activity in plasmid reporter with SMAD7 3′-UTR compared with miRNA control in plasmid reporter with SMAD7 3′-UTR, and the inhibition was abolished if the miR-503 target site on the 3′-UTR segment was mutated (Fig. 4 H). [score:6]
The postulation that downstream targets of miR-222-5p may also regulate miR-503 expression would merit further examination. [score:6]
); miRNA inhibitor negative control (199006-001, Exiqon); miR-503 inhibitor (4100899-001, Exiqon); siRNA negative control (AM4611, Life Technologies, Inc. [score:5]
Furthermore, the expression of miR-503 could be inhibited by miR-222-5p. [score:5]
H, protein expression and quantification after miR-503 inhibitor treatment for 3 days in αMEM with 1% FBS and 5 ng/ml TGFβ1 were analyzed. [score:5]
F, TaqMan microRNA assay showed significant down-regulation of miR-503 after inhibitor treatment for 1 day. [score:5]
The expression level of miR-503-3p fluctuated, which compromised the stability of the expression. [score:5]
Furthermore, the mechanistic study implied that miR-503 mimics or miR-222-5p inhibitors carry the potential to improve the performance of these vascular grafts through enhancing SMC differentiation from MSCs while avoiding possible off-target effects from the use of TGFβ1. [score:5]
Figure 4. miR-503 directly targets SMAD7 in regulating SMC differentiation. [score:5]
Although they target different pathways regulating SMC differentiation, whether miR-503 and miR-222-5p directly interact with each other merited further examination. [score:5]
This suggested that miR-222-5p could affect the expression of miR-503, but miR-503 does not interfere with the expression of miR-222-5p. [score:5]
To explore the potential targets of miR-503, algorithm -based bioinformatic prediction, literature review, and in vitro examination of gene expression were conducted. [score:5]
Zhou R., Gong A. Y., Chen D., Miller R. E., Eischeid A. N., and Chen X. M. (2013) Histone deacetylases and NF-κB signaling coordinate expression of CX3CL1 in epithelial cells in response to microbial challenge by suppressing miR-424 and miR-503. [score:5]
*, p < 0.05; **, p < 0.01, and ***, p < 0.001. mim ctrl, miRNA mimic negative control; mim 503, miR-503 mimic; inhi ctrl, miRNA inhibitor negative control; inhi 503, miR-503 inhibitor. [score:5]
More importantly, the level of SMAD7 upon miR-503 mimic treatment showed significant down-regulation by Q-PCR (Fig. 4 C). [score:4]
As demonstrated earlier, SMAD7 and miR-503 are both transcriptionally up-regulated by TGFβ1. [score:4]
In our study, miR-503 directly targets SMAD7 by binding to its 3′-UTR segment. [score:4]
Among the up-regulated miRNAs, we identified the miR-15 family, including the stem-loop forms of miR-503 and miR-424, miR-503 mature strand miR-503-5p, and the miR-503 star strand miR-503-3p (Table 1). [score:4]
Figure 5. miR-503 is transcriptionally up-regulated through SMAD4 -dependent pathway. [score:4]
These results implied that SMAD4 plays a key role in TGFβ1 -mediated up-regulation of miR-503. [score:4]
Interestingly, SMAD7 is also up-regulated in a SMAD4 -dependent pathway suggesting that miR-503 might serve as a self-limiting factor for the SMAD4 -dependent induction of SMAD7 (Fig. S3). [score:4]
Interestingly, miR-503 was significantly down-regulated when SMAD4 was depleted in cells with TGFβ1, although its level was not affected if the medium did not contain TGFβ1 (Fig. 5 C). [score:4]
G, alignment of miR-503 and the 3′-UTR of SMAD7 gene showed the postulated target -binding sites (red) and induced mutations (blue). [score:4]
miR-222-5p mimic transfection resulted in miR-503 down-regulation. [score:4]
D, Q-PCR showed the mRNA level up-regulation of SMC-specific markers after miR-503 mimic treatment for 3 days in αMEM with 1% FBS. [score:4]
D, representative picture of and analysis from three independent experiments showed the down-regulation of SMAD7 at the protein level after treatment with miR-503 mimics in αMEM with 1% FBS for 3 days. [score:4]
Previous studies related to the upstream regulation of miR-503 transcription have described peroxisome proliferator-activated receptor γ and nuclear factor κ–light-chain enhancer of activated B cells (NF-κB) as direct regulators (38 – 40). [score:4]
By establishing SMAD7 as a direct target of miR-503, we present miR-503 as a new component of the TGFβ1-signaling pathway. [score:4]
H, co-transfection of miR-503 mimics and reporter with WT SMAD7 3′-UTR segment showed reduced relative luciferase activity as compared with vector with empty plasmid, whereas mutation of target -binding sites recovered the reduction. [score:3]
Genome browsing in the UCSC genome sequence database (21) implied that the 3′-UTR of SMAD7 contain a “GCTGCTA” sequence that may be a target site for miR-503. [score:3]
E, protein expression and quantification after miR-503 mimic treatment for 3 days in αMEM with 1% FBS were analyzed. [score:3]
However, 24 h after transfection of the miR-222-5p mimic in MSCs, the level of miR-503 was significantly down-regulated as shown by TaqMan microRNA assay (Fig. 8 E). [score:3]
The inhibition of SMAD7 by miR-503 provides a further level of complexity in the already complex TGFβ1-related signaling pathway. [score:3]
Transfection of miR-503 mimics in MSCs in medium with 1% FBS promoted SMC differentiation with increased expression of SMC markers, including calponin, SM22, αSMA, and SMMHC at the mRNA level after 3 days as shown by Q-PCR (Fig. 3 D). [score:3]
This is the first time that miR-503 has been shown to target SMAD7, thereby influencing the SMC differentiation process. [score:3]
G, level of SMC-specific markers was detected with Q-PCR after miR-503 inhibitor treatment for 3 days in αMEM with 1% FBS and 5 ng/ml TGFβ1. [score:3]
To explore the role of miR-503 in MSC differentiation toward SMCs, miRNA mimics and inhibitors were used to perform the gain-of-function and loss-of-function analysis of miR-503. [score:3]
The transfection efficiency was confirmed 24 h after transfection as shown by a more than 100-fold increase of miR-503 expression in MSCs transfected with the miR-503 mimics (Fig. 3 C). [score:3]
C, TaqMan microRNA assay showed significant up-regulation of miR-503 after mimic treatment for 1 day in αMEM with 1% FBS. [score:3]
The implication from our in vitro study is that miR-503 mimics and miR-222-5p inhibitors may have the potential to augment the performance of vascular grafts by promoting the differentiation of stem cells toward SMCs. [score:3]
Loss-of-function effects of miR-503 were demonstrated by the transfection of miR-503 inhibitors in the cells. [score:3]
Finally, miRNA-centered mechanisms involved in the differentiation process into SMCs were elucidated with the identification of novel regulatory miRNAs (miR-503-5p and miR-222-5p). [score:2]
E, level of miR-503 was inhibited by miR-222-5p mimic treatment after 1 day as shown with TaqMan microRNA assay. [score:2]
Caporali A., Meloni M., Nailor A., Mitić T., Shantikumar S., Riu F., Sala-Newby G. B., Rose L., Besnier M., Katare R., Voellenkle C., Verkade P., Martelli F., Madeddu P., and Emanueli C. (2015) p75(NTR) -dependent activation of NF-κB regulates microRNA-503 transcription and pericyte-endothelial crosstalk in diabetes after limb ischaemia. [score:2]
The lack of complementary sequence between miR-503 and miR-222-5p suggests that they are unlikely to directly bind to each other (data not shown). [score:2]
We then performed chromatin immunoprecipitation (ChIP) experiments to detect SMAD4 binding, and three sets of primers were used to target the promoter region of miR-503. [score:2]
Next, the level of miR-503 was examined after SMAD4 knockdown. [score:2]
We also showed that miR-503 was regulated by miR-222-5p. [score:2]
For this reason, miR-503-3p was not included in further experiments, and miR-503 was used to refer to miR-503-5p in the rest of the paper. [score:1]
); miR-503 mimic (4464066 MC10378, Life Technologies, Inc. [score:1]
One day after transfection, the level of miR-503 was significantly decreased (Fig. 3 F). [score:1]
In this study, SMAD4 enriches at the promoter region of miR-503 after TGFβ1 treatment. [score:1]
In addition, promotion of SMC differentiation was also observed in human adipose tissue-derived MSCs (Fig. S2, A and B) and mouse adipose tissue-derived MSCs (Fig. S2, C–E), which is demonstrated by the induction of SMC markers with miR-503 mimic treatment at the mRNA and protein level. [score:1]
*, p < 0.05, and ***, p < 0.001. mim ctrl, miRNA mimic negative control; mim 503, miR-503 mimic; ctrl, plasmid without SMAD7 3′-UTR; wt, plasmid bearing WT SMAD7 3′-UTR. [score:1]
*, p < 0.05; **, p < 0.01; and ***, p < 0.001. mim ctrl, miRNA mimic negative control; mim 503, miR-503 mimic; si ctrl, siRNA negative control; si SMAD7, siRNA SMAD7; ctrl, plasmid negative control; wt, plasmid bearing WT SMAD7 3′-UTR. [score:1]
Importantly, miR-503 could also promote SMC differentiation in other types of MSCs, suggesting its universal effect among MSCs. [score:1]
Q-PCR was performed for the enrichment of SMAD4 at the promoter region of miR-503. [score:1]
Enrichment of SMAD4 at the promoter region of miR-503 was confirmed, and at the same time SMAD4 was not enriched at the promoter region of GAPDH, which served as a negative control (Fig. 5 D). [score:1]
On the contrary, 24 h after transfection of miR-503 mimic in MSCs, the level of miR-222-5p was not affected (Fig. 8 F). [score:1]
Interaction of miR-503 and miR-222-5p. [score:1]
Moreover, we showed that SMAD4 is enriched at the promoter region of miR-503 upon TGFβ1 treatment. [score:1]
miR-503 promotes MSC to SMC differentiation. [score:1]
The miR-503 family participates in a number of pathophysiological pathways (35). [score:1]
[1 to 20 of 73 sentences]
6
[+] score: 174
Surveying the online algorithms miRanda and TargetScan, we found that IGF-1R, a central receptor protein to facilitate tumor development mainly by AKT and MAPK pathways, bears miR-503 target site in its 3′UTR region, thus may serve as a potential target gene of miR-503 (Fig. 6A). [score:8]
Taken together, our results demonstrated that miR-503 is a tumor suppressor in GBM with multiple aspects of antitumor effects partially mediated by post-transcriptional downregulation of insulin-like growth factor-1 (IGF-1R) expression, thereby interfering with the PI3K/AKT pathway. [score:8]
Target genes of miR-503 were first predicted using multiple target prediction algorithms: TargetScan (http://www. [score:7]
This is similar to the suppressed expression level of miR-503 in human GBM cell lines (U251 and U87MG) (p<0.001; Fig. 1), suggesting a potential tumor-suppressive function of miR-503 in GBM. [score:7]
To the best of our knowledge, this is the first description of the tumor-suppressive role of miR-503 in GBMs and its functions through regulating IGF-1R and its AKT activation, leading to potent suppression in cancer cell proliferation, survival, migration and invasion. [score:6]
Our results showed that the level of IGF-1R protein was markedly decreased but there was no apparent change in the IGF-1R mRNA levels when miR-503 was overexpressed (Fig. 6C and D), suggesting miR-503 was involved in the regulation of IGF-1R expression. [score:6]
Moreover, Jiang et al demonstrated that miR-503 may reduce S phase cell populations by targeting CCND1 3′UTR and resulted in human head and neck carcinoma cell growth inhibition (28). [score:5]
To investigate the responding molecular components in miR-503 tumor-suppressive regulation, we sought to identify the direct target gene in the context of glioblastoma. [score:5]
Overexpression of miR-503 inhibits the propagation of GBM cell lines in vitro. [score:5]
Luciferase assays demonstrated that miR-503 suppressed activity of luciferase in constructs carrying the wild-type target sites but not the site with point mutations (Fig. 6B). [score:5]
Consistent with this hypothesis, we found that elevated miR-503 level not only suppressed cellular proliferation, inhibited cell migration and invasion, but also enhanced apoptosis in U251 and U87MG cells. [score:5]
Collectively, these results suggest that miR-503 may suppress GBM progression probably by inhibiting the IGF-1R/PI3K/AKT pathway. [score:5]
IGF-1R is a direct functional target of miR-503 that partially mediates the effect of miR-503 through AKT activation in glioblastoma cells. [score:4]
miR-503 may also be a potent cell cycle regulator by targeting multiple cell cycle-related proteins. [score:4]
This inhibitory effect of ectopic expression of miR-503 was further confirmed using a [[3]H]thymidine incorporation assay (p<0.05; Fig. 2C). [score:4]
Further, we identified IGF-1R as a direct functional target of miR-503 which exerts important effects on glioblastoma cells. [score:4]
In the present study, we found that IGF-1R was a direct target of miR-503 and indicated the IGF-1R/PI3K/AKT pathway may contribute to the biological effects of miR-503. [score:4]
Caporali et al (26) and Sarkar et al (27) identified CCNE1 and CDC25A as direct targets of miR-503 in endothelial cells and osteosarcoma cells respectively, leading to the block in G0/G1 and G2/M phase transitions. [score:4]
In the present study, we found that miR-503 was downregulated in GBM tissues and cell lines related to normal brain tissues. [score:4]
These results suggested that overexpression of miR-503 induced G0/G1 arrest, thereby delaying the progression of cell cycle. [score:3]
However, the relative expression of miR-503 between GBM and normal brain as well as the function of miR-503 on GBM is unclear. [score:3]
A putative reason for such tumor-specific expression patterns of miR-503 may be due to the feedback adjustment, tumor progression stages and diversity of internal environment between different types of tumor. [score:3]
On the contrary, Zhou et al reported that miR-503 was markedly downregulated in primary HCC tissues compared to their adjacent non-cancerous liver tissues (17) and a similar observation was reported in endometrioid endometrial cancer and cisplatin-resistant non-small cell lung cancer cells (18– 20). [score:3]
Given that miR-16-1 and miR-195 played tumor-suppressor roles in human glioblastoma cells, we hypothesized that miR-503 may have a similar antitumor effect as other members of the miR-15/16 family in human glioblastoma cells (7, 8). [score:3]
Our results further confirmed that miR-503 may suppress the endogenous CCND1 protein level and induce G0/G1 phase arrest in GBM cell lines. [score:3]
miR-503 was overexpressed in human retinoblastoma tissues as detected by miRNA microarray analysis. [score:3]
miR-503 inhibits cell migration and invasion of glioblastoma cells. [score:3]
miR-503 is downregulated in human GBM tissue samples and cell lines compared to normal brain tissues. [score:3]
In our study, we found that miR-503 was significantly downregulated in GBM tissues and two glioma cell lines compared to three normal brain tissues. [score:3]
Western blot results demonstrated that treatment with miR-503 mimics reduced the expression of phosphorylated AKT, whereas the effect of miR-503 on total AKT protein level was not statistically significant (Fig. 6D). [score:3]
Moreover, introduction of exogenous miR-503 inhibited cell growth, migration and invasive ability, induced G0/G1 phase arrest and enhanced apoptosis of U251 and U87MG human glioblastoma cells. [score:3]
The 2 [−ΔCt] or 2 [−ΔΔCt] methods were used to calculate the relative expression level of miR-503 human tissues or the expression levels of miR-503 and IGF-1R in cell lines (n=3, means ± SEM). [score:3]
U251 and U87MG cells transfected with miR-503 mimics displayed a substantially suppressed migratory and invasive capacity compared to their respective control groups (Fig. 5B). [score:2]
As expected, the inhibitory effect of miR-503 on cancer cell invasion was further confirmed using the wound healing assays (Fig. 5A). [score:2]
These results suggested that miR-503 may play a key role in cell cycle regulation. [score:2]
In summary, we conceived a specific mechanism of miR-503 regulatory impacts on a variety of tumors, including the current discovery in glioblastoma (Fig. 7). [score:2]
To determine direct regulatory binding of miR-503 on IGF-1R, we constructed a luciferase reporter assay using pMIR-REPORT constructs containing a segment of the 3′UTR with wild-type or mutated seed region. [score:2]
Furthermore, we observed a decrease in the MMP-9 protein level, a cell migration regulator in gliomagenesis (12), in cells with elevated miR-503 compared to control samples as shown by western blot assays, suggesting a potential mechanism of miR-503 inhibiting tumor invasion (Fig. 5C). [score:2]
As expected, transfection of both cell lines with miR-503 mimics oligonucleotides resulted in a marked suppression of cell growth activity compared to cells transfected with NC oligos after 24 h (p<0.05; Fig. 2B and D), 48 h (p<0.01 in U251 and p<0.05 in U87MG; Fig. 2B and D) and 72 h (p<0.05; Fig. 2B and D). [score:2]
In combination with previous and current studies, we highlighted a potential regulatory mechanism of miR-503 on cell cycle and apoptosis-related protein in GBM cells (26, 28, 42). [score:2]
To analyze miR-503 expression levels, the Bulge-Loop™ miRNA qRT-PCR primer kits (RiboBio) were utilized according to the manufacturer’s instructions. [score:2]
Based on our results of MTT and flow cytometry (Figs. 2 and 4), we hypothesized that loss of miR-503 in GBM cells may contribute to the invasion of GBM tumor. [score:1]
U251 and U87MG cells were transfected with miR-503 mimics or NC for 48 h. Cells were harvested in cold phosphate-buffered saline (PBS), stained with Annexin V-FITC and propidium iodide (PI) for 10 min and analyzed by flow cytometry (EPICS Altra II; Beckman) and date SPSS version 17.0. [score:1]
Twenty-four hours before transfection, U251 cells were seeded in a 24-well plate, the pMIR-REPORT vector bearing miR-503 binding site (IGF-1R-3′UTR-wt) or mutated binding site (IGF-1R-3′UTR-mut) constructs and pRL-TK vector were transfected using Lipofectamine 2000 reagent. [score:1]
To further define the antiproliferative ability of miR-503 in glioblastoma cells, we analyzed cell cycle distribution in GBM cells transfected with miR-503 mimics or NC control oligos using flow cytometry analysis. [score:1]
These results support an antineoplastic role for miR-503 in GBMs. [score:1]
microRNA-503 (miR-503) is a member of the miR-15/16 family and it was first reported as a highly elevated miRNA in human retinoblastoma tissues using miRNA microarray analysis (10, 11). [score:1]
Cells at 50–70% confluence were transfected with miR-503 mimics or non-specific mimics as negative control (NC) (RiboBio, Guangzhou, China) using Lipofectamine [®] 2000 reagent (Invitrogen, Carlsbad, CA, USA), respectively. [score:1]
miR-503 induces G0/G1 phase arrest in cell cycle distribution. [score:1]
Forty-eight hours after transfection of miR-503 mimics or NC, cells were collected and analyzed for the binding of Annexin V and PI penetration using flow cytometry. [score:1]
In the present study, we first analyzed the expression pattern of miR-503 in human GBM samples and cell lines followed by functional investigation of miR-503 in human GBM cell lines. [score:1]
miR-503 enhances apoptosis of glioblastoma. [score:1]
As shown in Fig. 3A, the G0/G1 phase fraction of cells with NC control was 60.97±1.16% (n=3, in U251 cells) and 56.43±1.04% (n=3, in U87MG cells), whereas cells transfected with miR-503 mimics increased the percentage of cells in G0/G1 phase 79.07±1.91% (n=3, in U251 cells) and 66.77±0.88% (n=3, in U251 cells). [score:1]
To understand the function of miR-503 in GBM, we utilized both gain of loss of function strategies in the cultured cells. [score:1]
Collectively, our study provided a possible therapeutic application against glioma by a gene therapy approach with introduction of exogenous miR-503. [score:1]
To evaluate the expression pattern of miR-503, we performed quantitative RT-PCR analysis. [score:1]
It is of note that the expression patterns of miR-503 vary in different tumor tissues and cell lines and its specific impact on the tumor biology needs to be further investigated. [score:1]
Taken together, these results demonstrated an antiproliferative effect of miR-503 on GBM cell lines. [score:1]
[1 to 20 of 58 sentences]
7
[+] score: 135
A search for potential miR-503 targets using in silico prediction algorithms showed that miR-503 could target SMAD7 [28], which was downregulated in T/E VI, but upregulated in T/E III cells. [score:11]
Upregulation of miR-503 in T/E VI cells promotes EMT by targeting SMAD7We further aimed to identify determinants of the stronger activation of EMT regulating pathways genes in T/E VI expressing cells. [score:9]
Furthermore, TGFB1 knockdown in T/E VI cells showed reduced expression of miR-503 (Figure 7E), suggesting that the expression of miR-503 is regulated by TGF-β, thereby contributing to enhanced TGF-β signaling by inhibition of SMAD7 [29]. [score:9]
These results suggested that T/E VI -mediated overexpression of miR-503 plays an important role in increasing EMT effectors and that miR-503 can induce invasion of T/E VI expressing cells due to its ability to downregulate CDH1. [score:8]
Figure 7 MiR-503 overexpression in T/E VI cells inhibits SMAD7 and CDH1 (A) qPCR analysis of miR-503 expression relative to RNU6B. [score:7]
To test whether miR-503 could augment EMT, we transiently overexpressed and inhibited miR-503 in T/E III and T/E VI cells using miR-503 mimics and inhibitors, respectively. [score:7]
Key EMT markers like VIM and MMP1 were upregulated in T/E -induced cells and were further increased after miR-503 overexpression (Figure 7B). [score:6]
Upregulation of miR-503 in T/E VI cells promotes EMT by targeting SMAD7. [score:6]
Although miR-503 expression was shown to be lower in metastatic compared to non-metastatic PCa xenografts [56], and several studies reported tumor suppressor properties of miR-503 [57, 58], in the context of T/E -induced TGF-β signaling miR-503 overexpression has tumor-promoting effects. [score:6]
Only induced T/E VI cells displayed significant upregulation of miR-503, which was further increased by simultaneous miR-503 overexpression (Figure 7A). [score:6]
Recently, Li et al. could show that miR-503 downregulates SMAD7 expression and thereby enhances TGF-β signaling and the metastatic capability of breast cancer cells [28]. [score:6]
Strikingly, we observed upregulation of miR-503 exclusively in T/E VI overexpressing cells. [score:6]
Overexpression of miR-503 was able to repress expression of SMAD7, a known negative regulator of TGF-β and WNT/β-catenin signaling [52]. [score:6]
The impacts of miR-503 overexpression and inhibition on SMAD7, and CDH1 quantities as surrogate for a mesenchymal phenotype were examined by Western blot analysis. [score:5]
Inhibition of miR-503 upon induction of T/E VI expression led to a reduction of VIM (Figure 7B). [score:5]
We focused on miR-503, which was strongly upregulated in the T/E VI only (∼7-fold), but not in the T/E III only microarray dataset (Supplementary Table 1). [score:4]
MiR-503 overexpression led to decreased SMAD7 and CDH1 expression in T/E VI cells (Figure 7C and 7D). [score:4]
MiR-503 overexpression in T/E VI cells inhibits SMAD7 and CDH1. [score:4]
In agreement with previous reports in MCF-10A breast cancer cells [55], TGFB1 knockdown also decreased miR-503 expression. [score:4]
Thus, the miR-503 -mediated downregulation of SMAD7 in T/E VI, but not in T/E III cells, explains T/E VI variant-specific transcription. [score:4]
For transfection, cells were treated with Dox and transfected with hsa-miR-503-5p inhibitor (Exiqon, Vedbaek, Denmark) or hsa-miR-503-5p mimic (GE Healthcare, Rosersberg, Sweden) using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific). [score:3]
Mimic - hsa- miR-503-5p mimic (used at 10 nM), inh - hsa- miR-503-5p inhibitor (used at 100 nM). [score:3]
MiR-503 -mediated repression of SMAD7 therefore appears to be a way to escape the inhibitory effect of SMAD7 on TGF-β and WNT/β-catenin signaling. [score:2]
We therefore hypothesized that miR-503 might be a candidate modulating the biological activity of the T/E VI fusion variants. [score:1]
We confirm that WNT/β-catenin signaling in T/E cells is mediated by FZD4 and propose that miR-503 plays a crucial role in augmenting this process. [score:1]
Figure 8T/E VI variant-specific transcriptional modulation of miR-503 and SMAD7 leads to stronger activation of EMT -regulating genes compared to T/E variant III. [score:1]
T/E VI variant-specific transcriptional modulation of miR-503 and SMAD7 leads to stronger activation of EMT -regulating genes compared to T/E variant III. [score:1]
[1 to 20 of 27 sentences]
8
[+] score: 114
Although the expression of Nanog can be regulated by miR-503-3p, our results indicate that Nanog is not a direct target of miR-503-3p, assuming that miR-503-3p indirectly regulates the expression of Nanog in its downstream pathways. [score:11]
Tumorigenesis was inhibited at significant expression of miR-503-3p (P < 0.01); however, other tumor-suppressive miRNAs were also expressed. [score:9]
Among the RNA cargoes identified by a miRNA microarray analysis, we found that miR-503-3P inhibited stemness via downregulation of Nanog, a pluripotent marker, and upregulation of CK-18, a differentiation marker, resulting in significantly reduced tumor growth in vivo. [score:9]
However, aberrant expression of miR503-3p has been observed in various tumors and upregulation of miR-503-3p inhibits cancer viability, especially in 786-0 renal cancer; this indicates that miR-503-3p may function as an antioncogenic factor [46]. [score:8]
Among the miRNAs, identified within the exosomes, miR-503-3p can regulate cell proliferation and apoptosis via direct targeting to p21, resulting in inhibition of cancer growth. [score:7]
Moreover, RNA-Seq data demonstrated that some genes, such as p21 and CDK4, which are involved in CSC signaling pathways, are downregulated after treatment with miR-503-3p [46]. [score:4]
The level of the pluripotency genes was significantly downregulated in miR-503-3p -transfected CSCs. [score:4]
miRNA sequences, used for transfection, are as follows: miR-503-3p mutant sense: 5′-GCCCAUAAGUUUCCGCUGCCAGG -3′ miR-503-3p mutant antisense: 5′-CCUGGCAGCGGAAACUUAUGGGC-3′ The 3′-untranslated region (UTR) fragment of Nanog (NM_024865.3) was amplified from the genomic DNA of MCF7 cells and cloned between the Renilla luciferase coding sequence and the poly(A) site of the psiCHECK-2 plasmid (Promega, Madison, WI, USA), using XhoI/NotI sites to produce psiC-Nanog. [score:3]
In addition, 86.8% of cell viability was inhibited in miR-503-3p -treated CSCs (Figure 3(c)). [score:3]
We found that miR-503-3p was highly enriched in exosomes derived from human ASCs, which inhibited the initiation and progression of CD44 [+] CSCs. [score:3]
miR-503-3p significantly inhibited the level of Nanog at 30.5%. [score:3]
3.2. miR-503-3p Inhibits Colony-Forming Activity in Cancer. [score:3]
The cytotoxic effects, mediated by ASC-derived exosomes, may be influenced by the inhibitory roles of miR-503-3p. [score:3]
miRNA sequences, used for transfection, are as follows: miR-503-3p mutant sense: 5′-GCCCAUAAGUUUCCGCUGCCAGG -3′ miR-503-3p mutant antisense: 5′-CCUGGCAGCGGAAACUUAUGGGC-3′ The 3′-untranslated region (UTR) fragment of Nanog (NM_024865.3) was amplified from the genomic DNA of MCF7 cells and cloned between the Renilla luciferase coding sequence and the poly(A) site of the psiCHECK-2 plasmid (Promega, Madison, WI, USA), using XhoI/NotI sites to produce psiC-Nanog. [score:3]
A luciferase reporter assay was conducted to test whether miR-503-3p directly targeted the 3′-UTR of Nanog. [score:3]
We used a luciferase reporter assay to test whether Nanog is a direct target of miR-503-3p (Figure 3(d)). [score:3]
miR-503-3p appears to regulate CSC-like phenotypes by controlling pluripotent transcription factors. [score:2]
Our colony formation assay (Figure 2) indicated that miR-503-3p and miR-328-3p had opposing effects on colony formation; the final biological effect of ASC-derived exosomes was inhibition of cancer growth (Figure 1(c)). [score:2]
We used a colony formation assay to examine whether both miR-328-3p and miR-503-3p can suppress cancer stem cell- (CSC-) like phenotypes (Figure 2). [score:2]
We investigated whether miR-503-3p is a direct target of Nanog. [score:2]
Thus, miR-503-3p may play an important role as a paracrine factor in the regulation of CSCs. [score:2]
3.3. miR-503-3p Regulates Cancer Stemness. [score:2]
Conversely, cytokeratin 18 (CK18) mRNA, used as a differential stem cell marker, was highly increased in miR-503-3p -transfected NC -treated CSCs [38]. [score:1]
miRNA sequences, used for transfection, are as follows: miRNA-NC sense: 5′- CCUCGUGCCGUUCCAUCAGGUAGUU -3′ miRNA-NC antisense: 5′-CUACCUGAUGGAACGGCACGAGGUU-3′ miR-328-3p sense: 5′-CUGGCCCUCUCUGCCCUUCCGU-3′ miR-328-3p antisense: 5′-ACGGAAGGGCAGAGAGGGCCAG-3′ miR-503-3p sense: 5′-GGGGUAUUGUUUCCGCUGCCAGG-3′ miR-503-3p antisense: 5′-CCUGGCAGCGGAAACAAUACCCC-3′ Cells, transfected as described above, were harvested by Accutase (Thermo Scientific, USA), and total RNA was purified with an RNeasy Mini kit (QIAGEN, GmBH, Germany) following the manufacturer's instructions. [score:1]
Expectedly, the administration of miR-503-3p triggered apoptosis, suggesting that miR-503-3p has antitumor activity. [score:1]
miR-503-3p was discovered in exosomes isolated from ASCs, suggesting that miR-503-3p may function as a paracrine factor in cell-to-cell communications. [score:1]
3.4. miR-503-3p Functions as an Anticancer Factor In Vivo. [score:1]
The control (mock and miR-NC) treatment and miR-503-3p were intratumorally administered into MCF7 xenografts (Figure 4(a)). [score:1]
The number of spheroids, formed by CSCs treated with mutant miR-503-3p, did not differ from that formed by the controls. [score:1]
At day 28, the dissected tumors, from the xenografts that received miR-503-3p, showed dramatic reduction (by 66%) in tumor growth (Figures 4(a) and 4(b)). [score:1]
Next, we investigated the possibility of whether miR-503-3p plays inhibitory roles in self-renewal and survival of CSCs. [score:1]
Based on the results of our in vitro functional assay, we speculated that miR-503-3p is involved in the regulation of CSC stemness. [score:1]
Treatment with miR-503-3p inhibited 69.7% of spheroid formation, which is a characteristic property of CSCs; spheroid formation was significantly lower than that of CSCs treated with mutant miR-503-3p (Figure 3(b)). [score:1]
When the four different cancer cell lines, including MCF7, BT-474, HCT-15, and COLO 205, were treated with miR-503-3p, the number of colonies was greatly reduced (Figure 2(b)). [score:1]
miRNA sequences, used for transfection, are as follows: miRNA-NC sense: 5′- CCUCGUGCCGUUCCAUCAGGUAGUU -3′ miRNA-NC antisense: 5′-CUACCUGAUGGAACGGCACGAGGUU-3′ miR-328-3p sense: 5′-CUGGCCCUCUCUGCCCUUCCGU-3′ miR-328-3p antisense: 5′-ACGGAAGGGCAGAGAGGGCCAG-3′ miR-503-3p sense: 5′-GGGGUAUUGUUUCCGCUGCCAGG-3′ miR-503-3p antisense: 5′-CCUGGCAGCGGAAACAAUACCCC-3′ Cells, transfected as described above, were harvested by Accutase (Thermo Scientific, USA), and total RNA was purified with an RNeasy Mini kit (QIAGEN, GmBH, Germany) following the manufacturer's instructions. [score:1]
Cells were transfected, with 20 nM miR-NC or miR-503-3p, using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer's instructions. [score:1]
As a paracrine factor, miR-503-3p may be a key factor in the initiation and progression of CSCs. [score:1]
However, the activity of luciferase was not reduced even in the miR-503-3p -treated cells. [score:1]
After 24 h, 20 nM of scrambled miRNA (miR-NC), miR-328-3p, and miR-503-3p was transfected as described above, and the cells were grown up to 3 weeks by replacing the media with fresh media every 3 days. [score:1]
Thus, miR-503-3p may function as a stemness-attenuating factor via cell-to-cell communications. [score:1]
Thus, we investigated whether miR-503-3p can inhibit tumor growth in ER/PR -positive MCF7-bearing xenografts (Figure 4). [score:1]
Furthermore, xenografts, which received miR-503-3p, exhibited remarkably reduced tumor growth in vivo. [score:1]
Next, the expression of Nanog, a pluripotency transcription factor, was evaluated in miRNA -negative control (miRNA-NC) or miR-503-3p -treated CSCs for 48 h and analyzed by qRT-PCR (Figure 3(a)). [score:1]
These results indicate that miR-503-3p may be a key factor within ASC-derived exosomes and may show anticancer activity by controlling stem cell-like properties. [score:1]
When the tumors reached ~0.1 cm [3], 2 mg/mL of miR-503-3p and miRNA-NC was administered intratumorally into the xenografts six times every 3 days. [score:1]
[1 to 20 of 45 sentences]
9
[+] score: 101
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-424, hsa-mir-630
Since we also demonstrate that CXCL10/IP-10 is a validated miR-503 target, down-regulation of this miRNA may explain, at least in part, the observed CXCL10/IP-10 up-regulation. [score:9]
The miR-503/CXCL10/IP-10 represents the best match showing the highest miRNA down-regulation (namely, -6.39 fold decrease) and the highest mRNA transcript up-regulation (+9 fold increase). [score:7]
In the recent few years miR-503 has been found to exert opposite effects in different cancer settings; namely it shows a protective role by inhibiting proliferation and inducing apoptosis in glioma [62] and in prostate cancer [63], while on the contrary its down-regulation has shown a protective role in esophagus carcinoma [64] and osteosarcoma [65]. [score:6]
According to TargetScan software, CXCL10/IP-10 is one of the predicted miR-503 targets, given the computed high score of complementarity of CXCL10/IP-10 3′UTR and miR-503 seed sequence (Figure 5A). [score:5]
For miR-503, putative mRNA targets prediction was carried out using TargetScan software [83– 86]. [score:5]
mir-503 target prediction and target validation. [score:5]
Namely, CXCL10/IP-10, miRNA-503, CEBPB and CEBPD, two known onco-suppressor genes [50, 51, 53, 54, 52] were found strongly modified in cells over -expressing PDGFR-alpha, along with other molecules such as CXCL8, IL6, SOCS3, all known to have functional connections with CXCL10/IP-10. [score:5]
These data indicate that miR-503 is strongly down-regulated in both HUVEC and SKMEL-28 cells overexpressing PDGFR-alpha, as compared to Ad. [score:5]
Such effect was significantly reverted when a deleted form of the 3′-UTR CXCL10/IP-10 was used as specificity control (Figure 5B), demonstrating that the 3′-UTR CXCL10/IP-10 is a functional target of miR-503, as predicted by TargetScan. [score:5]
Overexpressing PDGFR-alpha has been found in the present study to significantly reduce miR-503 expression. [score:5]
Figure 5 A. CXCL10/IP-10 was predicted to be one of the miR-503 targets according to TargetScan software, given the complementarity of CXCL10/IP-10 3′UTR and miR-503 seed sequence. [score:5]
A. CXCL10/IP-10 was predicted to be one of the miR-503 targets according to TargetScan software, given the complementarity of CXCL10/IP-10 3′UTR and miR-503 seed sequence. [score:5]
miR-503 was confirmed to be strongly and significantly down-regulated both in HUVEC and in SKMel-28 (fold-change -2 with p = 0.0008 and = 0.004, respectively). [score:4]
On the other hand, 39 miRNAs were found to be significantly reduced; the most down-regulated is miR-503 (6.4 fold reduction, p = 0.016 vs control). [score:4]
Interestingly enough, miR-424, another member of the miR-503 cluster, was also found down-regulated about 2 fold. [score:4]
The current study is the first indicating that the anti-melanoma role of PDGFR-alpha may be linked to the known anti-melanoma role of CXCL10/IP-10, and suggests PDGFR-alpha and CXCL10/IP-10 as related targets in melanoma therapy, likely via miR-503. [score:3]
Figure 4A and 4B show the strong reduction miR-503 expression in the same experimental set up. [score:3]
Target prediction of miR-503 and validation. [score:3]
Figures 2 to 5 represent strong evidences allowing us to hypothesize that CXCL10/IP-10 and miR-503 are involved in the PDGFR-alpha anti-proliferation activity shown in Figure 1. Cells overexpressing PDGFR-alpha were then exposed to the specific neutralization of CXCL10/IP-10. [score:3]
CXCL10/IP-10 3′UTR Luciferase Stable 293 Cell Line (purchased from abm) containing target site sequences complementary to the seed sequence of miR-503 cloned downstream of the luciferase gene was used. [score:3]
It shows the reduced levels of miR-503 and miR-424, the increased level of CXCL10/IP-10, and the observed up- and down- regulation of other factors. [score:2]
A transient transfection of 3′-UTR CXCL10/IP-10 Luciferase stable 293 Cell Line with miR-503 led to a significant decrease (about 50%, p < 0.0001) in Luciferase reporter expression as compared to the control vector (Figure 5B). [score:2]
Therefore we hypothesized a functional interplay between CXCL10/IP-10 and miR-503, downstream the PDGFR-alpha. [score:1]
Additional data indicate contrasting effect of miR-503 in colon carcinoma [66, 67]. [score:1]
B. 3′-UTR-Luc assay shows a significant decrease (about 50%, p value < 0.0001) in Luciferase reporter expression in transiently transfected 3′-UTR CXCL10/IP10 Luciferase stable 293 cell line with miR-503, as compared to the control vector, and a significant reversion is observed when a deleted form of the 3′-UTR CXCL10/IP-10 was used as specificity control. [score:1]
[1 to 20 of 25 sentences]
10
[+] score: 94
Other miRNAs from this paper: hsa-let-7i, hsa-mir-424
Induction of CX3CL1 may be associated with downregulation of miR-424 and miR-503, both of which target the CX3CL1 3’UTR, suppress its translation and induce RNA degradation. [score:10]
Because induction of CX3CL1 and downregulation of miR-424 and miR-503 were also detected in epithelial cells in response to LPS stimulation, we speculated that HDACs and NF-kB signaling coordinate expression of CX3CL1 through suppressing the mir-424-503 gene in epithelial cells upon microbial challenge in general. [score:8]
Release of miRNA -mediated post-transcriptional suppression through downregulation of miR-424 and miR-503 contributes to induction of CX3CL1, as evident by a modest increase in CX3CL1 mRNA but a robust induction of CX3CL1 protein in infected cells. [score:6]
Downregulation of miR-424 and -503 in epithelial cells following C. parvum infection, and targeting of CX3CL1 3UTR by miR-424 and miR-503. [score:6]
Expression of miR-424 and miR-503 is downregulated, and is involved in the induction of CX3CL1 in epithelial cells following infection. [score:6]
0065153.g002 Figure 2Downregulation of miR-424 and -503 in epithelial cells following C. parvum infection, and targeting of CX3CL1 3UTR by miR-424 and miR-503. [score:6]
Coupled with the downregulation of miR-424 and miR-503 in cells following C. parvum infection, the above data suggested that the relief of miR-424- and miR-503 -mediated post-transcriptional repression was required for C. parvum -induced suppression of CX3CL1 in host epithelial cells. [score:6]
Overexpression of miR-424 and miR-503 by transfection of their precursors further decreased the luciferase activity (Fig. 2 E ), suggesting targeting of CX3CL1 3′UTR by miR-424 and miR-503. [score:5]
Complementary 35 bp DNA oligonucleotides containing the putative miR-424 and miR-503 target site within the 3′ untranslated region (3′UTR) of human CX3CL1 were synthesized with flanking SpeI and HindIII restriction enzyme digestion sites (Sense, 5′-CTAGTGGCCTCTGCACTCCCCTGCTGGGT GTGGCGCAGC-3′; antisense, 5′-AGCTGCTGCGCCACACCCAGCAGGGGAGTGCAGA GGCCA-3′) and cloned into the multiple cloning site of the pMIR-REPORT Luciferase vector (Ambion). [score:5]
Among miRNAs suppressed in host epithelial cells following C. parvum infection, we identified that miR-424 and miR-503 target 3′UTR of CX3CL1 mRNA, contributing to induction of CX3CL1 in infected epithelial cells. [score:5]
The data show that induction of CX3CL1 expression in biliary epithelial cells upon microbial challenge involves donwregulation of the miR-424 and miR-503. [score:4]
Downregulation of miR-424 and miR-503 was also detected in H69 cells following LPS stimulation (Fig. S3). [score:4]
Figure S3 Downregulation of miR-424 and miR-503 in epithelial cells in response to LPS stimulation. [score:4]
Downregulation of miR-424 and miR-503 in infected cells was further confirmed by Northern blot (Fig. 2 B ) and qRT-PCR (Fig. 2 C ). [score:4]
To test the potential targeting of CX3CL1 3′UTR by miR-424 and -503, we inserted the CX3CL1 3'UTR sequence covering the potential binding site for miR-424 and miR-503 into the pMIR-REPORT luciferase plasmid. [score:3]
Targeting of CX3CL1 by both miR-424 and miR-503 may reflect functional redundancy because they are transcribed from the same mir-424-503 gene. [score:3]
C. parvum infection suppresses transcription of the pri-mir-424-503 in biliary epithelial cells in a NF-κB- and HDAC -dependent mannerThe mir-424-503 gene locus at chromosome X codes the mature form of both miR-424 and miR-503 [32]. [score:3]
Expression levels of miR-424 and miR-503 by microarray are presented as the log [2] (Hy5/Hy3) ratios. [score:3]
The mir-424-503 gene locus at chromosome X codes the mature form of both miR-424 and miR-503 [32]. [score:1]
H69 cells were exposed to C. parvum for up to 12 h and microarray analysis revealed a significant decrease in miR-424 and miR-503 levels in their mature forms (Fig. 2 A ). [score:1]
LNA DIG-probes for miR-424 and miR-503 (Exiqon, Vedbaek, Denmark) were hybridized using UltraHyb reagents (Ambion) according to the manufacturer’s instructions, with snRNA RNU6B blotted as a control [21]– [23]. [score:1]
[1 to 20 of 21 sentences]
11
[+] score: 67
Upregulation of ALDH1 (p = 0.019) and miR-503 (p = 0.033) correlated with high clinical stage, and upregulation of miR-27a was related with distant metastasis (p = 0.046) in patients with ovarian cancer. [score:7]
Upregulation of ALDH1 and miR-503 correlated with high clinical stage, and upregulation of miR-27a was correlated with distant metastasis. [score:7]
Upregulation of miR-503 correlated with high clinical stage, and upregulation of miR-27a was related with distant metastasis in patients with ovarian cancer. [score:7]
High expression of miR-503 (Figure  5C) was significantly associated (p = 0.033) with advanced clinical stage (stage III and IV), and upregulation of miR-27a (Figure  5D) was related to distant metastasis (p = 0.046). [score:6]
CDCA4, a putative miR-503 target gene with a high target score, participates in the regulation of cell proliferation mainly through the E2F/pRB pathway [35]. [score:6]
We identified six miRNAs, including miR-23b, miR-27a, miR-27b, miR-346, miR-424, and miR-503, overexpressed in ALDH1 (+) cells, and they were significantly upregulated in chemoresistant ovarian cancer cells (1.4 ~ 3.5-fold) and tumor samples (2.8 ~ 5.5-fold) compared with chemosensitive group. [score:5]
As a result, miR-424 (1.62-fold), miR-346 (3.25-fold), miR-503 (1.66-fold), miR-27a (2.08-fold), miR-23b (1.98-fold), and miR-27b (3.09-fold) were upregulated in ALDH1 (+) cells relative to ALDH1 (−) cells (Figure  4B). [score:4]
Further studies are necessary to determine whether miR-503 induces cancer cell growth or migration/invasion, and whether CDCA4 is a direct target gene of miR-503, as well as to define the oncogenic function of miR-503 in this subset of ovarian cancers. [score:4]
C. High expression of miR-503 significantly correlated (p = 0.033) with advanced clinical stage (stage III and IV). [score:3]
Our findings indicate that ALDH1 is a useful marker for enriching ovarian CSCs, and high expression of ALDH1 and its related miRNAs, particularly miR-23b, miR-27b, miR-424, and miR-503, are significantly implicated in chemoresistance and tumor progression in ovarian cancer. [score:3]
Among the miRNAs examined, the expression levels of miR-23b (2.8-fold, p = 0.039), miR-27b (3.5-fold, p = 0.007), miR-346 (2.7-fold, p = 0.02), and miR-503 (2.2-fold, p = 0.049) were significantly higher than those in S KOV3 cells (Figure  5A). [score:3]
We found that six miRNAs, including miR-23b, miR-27a, miR-27b, miR-346, miR-424, and miR-503, were significantly overexpressed in CSC-enriched ALDH1(+) cells using and qRT-PCR. [score:3]
The function of miR-503 in tumor development and progression remains unresolved except for a report demonstrating its regulation of metastatic function in hepatocellular cancer cells [34]. [score:3]
Six miRNAs, including miR-23b, miR-27a, miR-27b, miR-346, miR-424, and miR-503 were overexpressed in ALDH1(+) cells, and significantly implicated in chemoresistance in ovarian cancers. [score:3]
As a result, six miRNAs were differentially overexpressed more than 1.5-fold in ALDH1 (+) cells compared with that in ALDH1 (−) cells (Table  4, Figure  4A) (miR-424 [1.98-fold], miR-346 [1.95-fold], miR-503 [1.86-fold], miR-27a [1.66-fold], miR-23b [1.53-fold], and miR-27b [1.50-fold]). [score:2]
de) to predict the role of miR-503 implicated in chemoresistance and tumor progression. [score:1]
[1 to 20 of 16 sentences]
12
[+] score: 63
Interestingly, two genes typically expressed in placenta and involved in signal transduction and development (EPS8 and ZNF644) were deregulated by the non-human miR-503-3p in the transcriptome experiments and predicted as candidate targets for the same variant (S7 Table). [score:7]
Conversely, miR-503-3p and miR-508-3p regulate a low number of genes, have a restrictive pattern of expression and, although they seem to be involved in development, their functional role is still very vague. [score:5]
miR-541-3p was mostly expressed in human and non-human primate brain, while miR-503-3p was not amplified in brain and its expression was specifically found in human placenta and macaque testis. [score:5]
Moreover, genes deregulated by miR-299-3p and miR-541-3p were involved in reproductive and infectious diseases and non-human miR-503-3p, human miR-508-3p and both variants of miR-541-3p were associated with neurological disorders. [score:4]
We next centered our interest in the analysis of the expression of four miRNAs with human-specific substitutions located either in the mature (miR-299-3p, miR-508-3p and miR-541-3p) or in the seed regions (miR-503-3p). [score:3]
The human and non-human versions of miR-299-3p and miR-541-3p deregulated more than one thousand genes, while both versions of miR-503-3p and miR-508-3p deregulated less than 300 genes. [score:3]
Although specific expression patterns of mir-503 have been poorly investigated it has been shown to be lowly expressed in human brain cortex [53], in accordance with our analyses. [score:3]
As expected, the proportion of predicted target genes in common between the human and non-human variants was larger for the three miRNAs with nucleotide substitutions in the mature out of the seed region than for miR-503-3p with the nucleotide substitution in the seed (Fig 7B). [score:3]
In fact, miR-503-3p seems to have a restricted pattern, considering that we only detected its expression in human placenta and macaque testis. [score:3]
In contrast, only 30% of the target genes predicted for the human miR-503-3p were also predicted for the non-human miR-503-3p. [score:3]
Finally, miR-503-3p, which was the only miRNA with one nucleotide substitution in the seed region, had similar expression levels for both versions. [score:3]
As expected, we found strong differences in the exclusive set of target genes between miR-503-3p variants as they differ in the seed region. [score:3]
Consistent with the earlier results, miR-503-3p was lowly expressed in all brain regions studied (Fig 4C). [score:3]
Human miR-299-3p and miR-541-3p deregulated about the 10% of the genes in an exclusive manner, but these proportions reached about 50% for human miR-503-3p and miR-508-3p. [score:2]
Conversely, we found that miR-503-3p and miR-508-3p were absent or lowly expressed in the brain compared to other tissues such as testis and placenta. [score:2]
As anticipated, miR-503-3p showed the highest variation between variants with human miR-503-3p being particularly involved in the regulation of cancer related signaling pathways and miR-503-3p in metabolic functions. [score:2]
In the case of non-human miRNAs, the set of exclusively deregulated genes varied for all four miRNAs, from 17% (miR-541-3p) up to 90% (miR-503-3p). [score:2]
For expression level analyses, pre-miRNA genomic sequences of the selected miRNAs (mir-299, mir-503, mir-508 and mir-541) and ~100 bp flanking regions at each side were PCR amplified (primers in S2 Table). [score:2]
After discarding polymorphism changes (1000 Genomes database) [34], four miRNA candidates were studied: miR-503-3p, with a single human-specific nucleotide substitution in the seed region, and miR-299-3p, miR-508-3p and miR-541-3p with human-specific nucleotide substitutions in the mature out of the seed region (Table 1). [score:1]
miR-503 is located together with mir-424 [52], in a cluster that is conserved across mammals [53]. [score:1]
Except for miR-503-3p, both the human and non-human versions of each miRNA were involved in similar biological functions, mainly related with cell cycle processes such as proliferation, cell growth or apoptosis (S6 Table). [score:1]
These differences are also reflected in the gene networks predicted for each variant as the human miR-503 is involved in cancer signaling pathways while the non-human miR-503 is involved in metabolic functions. [score:1]
For transcriptome analyses SH-SY5Y cells were transfected with 100 μM of miRNA mimic variants (miR-299-3p, miR-503-3p, miR-508-3p, miR-541-3p or the related negative control) as previously described [38]. [score:1]
[1 to 20 of 23 sentences]
13
[+] score: 36
Moreover, miR-503 functioned as a tumor suppressor in HCC by directly targeting cyclin D3 and E2F3 through Rb-E2F signaling pathway, suggesting that miR-503/E2F3 may act as helpful therapeutic targets for HCC therapy [48]. [score:8]
Also, overexpression of miR-503 also remarkably inhibited CRC cell proliferation by targeting E2F3 [49]. [score:7]
On chromosomal location Xq26.3, miR-503 was an intragenic miRNA clustered with miR-424, which was significantly decreased in HCC and colorectal cancer (CRC) and functioned as a tumor suppressor by directly targeting E2F3 [48, 49]. [score:6]
Another study showed that miR-503 induced G1 phase arrest of cell cycle via downregulation of cyclin D3 and E2F3 in HCC cells [48]. [score:4]
Meanwhile, miR-503 performed similar performance in CRC cells by directly targeting E2F3 [49]. [score:4]
Practical reports showed that miR-503 suppressed proliferation of HCC cells through Rb-E2F signaling pathways [48]. [score:3]
Likewise, miR-503 was found to induce apoptosis by targeting E2F3 [49]. [score:3]
Reduced miR-503 was observed to be correlated with worse overall survival of HCC patients and enhanced malignant potential, including portal vein tumor thrombi, histologic grade, TNM stage and AFP level [48]. [score:1]
[1 to 20 of 8 sentences]
14
[+] score: 35
By the expression of miR-503 or miR-424, Rictor protein was downregulated as well as the activity of AKT, a critical downstream effector of mTORC2, whereas phosphorylation of the mTORC1 target S6K was not affected in c-Src–transformed cells (Figure 2C, left panels); this indicates that miR-424/503 -mediated Rictor specifically controls the mTORC2 pathway. [score:8]
qRT-PCR analyses revealed that transfection with miR-503 or miR-424 reduced the level of RICTOR mRNA in parallel with Rictor protein level, suggesting that Rictor expression is downregulated by miRNA -mediated mRNA degradation (Figure 2C and 2D). [score:6]
Overexpression of miR-503 and 424 significantly suppressed anchorage-independent growth of c-Src–transformed cells in an additive manner, because the two miRNAs independently recognize different sites in the 3’-UTR of RICTOR mRNA (Figure 3A). [score:5]
Inversely, functional knockdown using anti-miR-503 or anti-miR-424 increased Rictor expression and the activity of AKT (Figure 2C, right panels). [score:4]
0080300.g005 Figure 5(A) The relative expression levels of miR-503 (black) and miR-424 (grey) in colon tumors in comparison with adjacent non-cancerous tissues (white) were assessed by qRT-PCR. [score:3]
As shown in Figure 2A, the 3’-untranslated region (3’-UTR) of human RICTOR mRNA contains two potential miR-424 binding sequences (3’-UTR-1; 1681–1687 and 3’-UTR-2; 4074–4081), the latter of which (3’-UTR-2) partly overlaps with a potential miR-503 binding sequence. [score:3]
However, a luciferase reporter assay in c-Src–transformed cells revealed that miR-424 and miR-503 selectively target 3’-UTR-1 and 3’-UTR-2, respectively (Figure 2B). [score:2]
Csk [-/-] cells were transfected with 30 nM of control, anti-miR-503, or anti-miR-424 (right panels). [score:1]
Two sets of complementary oligonucleotides from the human Rictor 3’UTR containing the putative miR-503 or miR-424 binding sites were designed. [score:1]
miR-503 precursor (PM10378), miR-424 (PM10306), antisense miR-503 (AM10378), and anti-miR-424 (AM10306) were purchased from Applied Biosystems. [score:1]
miR-424 and miR-503 are co-transcribed as a polycistronic primary transcript (pri-miRNA) and thus comprise the miR-424/503 gene cluster [35]. [score:1]
[1 to 20 of 11 sentences]
15
[+] score: 32
The transfection of miR-503 into ECSCs induces apoptosis by B-cell lymphoma-2 (Bcl-2) suppression, inhibition of vascular endothelial growth factor A (VEGF-A) production and cell proliferation, and induction of cell cycle arrest at the G0/G1 phase by cyclin D1 suppression [5]. [score:7]
miR-503 has been demonstrated to downregulate cyclin D1 expression and induce G0/G1 phase cell cycle arrest in several cell types [5, 7, 14]. [score:6]
Transfection of ECSCs with miR-503 inhibited cell proliferation and VEGF-A production and induced apoptosis and G0/G1 cell cycle arrest in these cells [5]. [score:3]
We previously showed that microRNA-503 (miR-503) transfection into endometriotic cyst stromal cells (ECSCs) induced cell cycle arrest at the G0/G1 phase by suppressing cyclin D1. [score:3]
Similar to the effects of miR-503, arcyriaflavin A inhibited cell proliferation and VEGF-A production, and induced apoptosis and G0/G1 cell cycle arrest in these cells mainly at 1 and 10 μM. [score:3]
In a previous study, we observed the anti-proliferative, pro-apoptotic, angiostatic, and anti-fibrogenic functions of miR-503 and identified its possible downstream targets using miR-503 -transfected endometriotic cyst stromal cells (ECSCs) [5]. [score:3]
We evaluated the effects of miR-503 on the cellular functions of ECSCs and the mechanisms underlying the suppression of miR-503 expression in ECSCs. [score:3]
We demonstrated that the cyclin D1-CDK4 inhibitor, arcyriaflavin A, exerted therapeutic effects on ECSCs that are similar to those of miR-503, which is considered a promising candidate for the treatment of endometriosis. [score:2]
In our previous study, we investigated the expression of miR-503 in ECSCs and normal endometrial stromal cells isolated from eutopic endometrial tissues. [score:1]
Arcyriaflavin A exhibited a variety of therapeutic effects on ECSCs that are similar to those induced by miR-503 transfection. [score:1]
[1 to 20 of 10 sentences]
16
[+] score: 31
Of those 70 miRNAs up- or down-regulated during adipocyte differentiation, 2 of the most significantly over-expressed (miR-30c and miR-378) and 4 of the most down-regulated (miR-210, miR-221, miR-424 and miR-503) were selected for validation by semi-quantitative Real Time-PCR. [score:9]
MiR-503, the most down-regulated miRNA during differentiation, has been previously found over-expressed in retinoblastoma tumor tissue as compared to normal human retina [31] and involved in mouse pancreas development [32]. [score:6]
Thus, FAS, ACC, FABP4, PPARg, ADIPOQ and RBP4 gene expression levels were significantly and directly correlated with miR-30c and miR-378 but significantly and inversely related with miR-210, miR-221, miR-503 and miR-424 expression levels in RNA samples from cell lines [Figure S2]. [score:6]
The most remarkable were miR-503 (−6.7-fold), miR-221 (−4.9-fold), miR-424 (−4.6-fold), miR-210 (−4.3-fold) and miR-31* (−2.6-fold), that were down-regulated in mature adipocytes. [score:4]
The miRNA expression levels were assessed by RT-PCR for miR-210 (MIMAT 0000267), miR-221 (MIMAT 0000278), miR-503 (MIMAT 0002874), miR-424 (MIMA 0001341), miR-378 (MIMAT 0000732), and miR-30c (MIMAT 0000244). [score:3]
Several miRNAs, namely miR-221, miR-125b, miR-100, miR-130b, miR-210, miR-30a*, miR-34a, miR-503 and miR-185, were outstanding when integrating results from cells and subcutaneous fat tissue together. [score:1]
It should be noted that, while 3 of these miRNAs (miR-30c, miR-210 and miR-221) have been previously described as obesity and/or adipogenesis-related [11], [26], the 3 others (miR-503, miR-378 and miR-424) were not. [score:1]
IntegratedSeveral miRNAs, namely miR-221, miR-125b, miR-100, miR-130b, miR-210, miR-30a*, miR-34a, miR-503 and miR-185, were outstanding when integrating results from cells and subcutaneous fat tissue together. [score:1]
[1 to 20 of 8 sentences]
17
[+] score: 24
In gonadotropin-secreting pituitary adenomas, a study demonstrated that miR-10b was upregulated and miR-503 was downregulated [59]. [score:7]
miR-503 has been validated to directly target cyclin D1 and is thought to be a tumor suppressor [70]. [score:6]
Six miRNAs of them (miR-450b-5p, miR-424, miR-503, miR-542-3p, miR-629, and miR-214) were significantly underexpressed, while one miRNA (miR-592) was significantly overexpressed in NFA compared to normal pituitary tissues. [score:4]
Furthermore, an important potential target of miR-503 is the cell cycle regulator CDC25. [score:4]
miR-503 was highly expressed in NFA and had a negative correlation with tumor size [22]. [score:3]
[1 to 20 of 5 sentences]
18
[+] score: 20
Several other down-regulated genes such as Hes6 (inhibits cell proliferation), Rbl2 (tumour suppressor and inhibitor of E2F target genes) and Id1 (a bHLH transcription factor that regulates cell proliferation by supressing p21 or Cdkn1a, a CDKs inhibitor) were also observed as the putative targets of rno-miR-503, -214 and -146b and -503. [score:17]
Moreover, Fn1 was predicted to be a putative target of miR-146b (5 programs) and miR-503, -214, -31, -34a, -199a-5p, and -132 (2 programs). [score:3]
[1 to 20 of 2 sentences]
19
[+] score: 20
These miRNAs have all been previously shown to contribute to CRC disease progression; for example, miR-182 and miR-503 were found to cooperatively target FBXW7 and contribute to CRC malignant transformation and progression and were also predictive of patient survival (28). [score:5]
Li L, Sarver AL, Khatri R, Hajeri PB, Kamenev I, French AJ, Thibodeau SN, Steer CJ, Subramanian S 2014 Sequential expression of miR-182 and miR-503 cooperatively targets FBXW7, contributing to the malignant transformation of colon adenoma to adenocarcinoma. [score:5]
In CRC, several miRNAs, such as miR-182, miR-503, and mir-17~92 cluster, can regulate multiple genes and pathways and have been found to promote malignant transformation and disease progression (28 – 30). [score:4]
We identified 76 miRNAs as differentially expressed (DE) in tissue from CRC tumors and normal tissue, including the known oncogenic miRNAs miR-182, miR-503, and mir-17~92 cluster. [score:3]
DE miRNAs with higher expression levels in tumor tissues include miR-182, miR-183, miR-503, and the miR-17~92 cluster miRNAs (Fig.  2; Table S1), all consistent with our previous reports (28, 33). [score:3]
[1 to 20 of 5 sentences]
20
[+] score: 19
Takada et al. [13] showed in mice that the expression of miR-503 was restricted to placenta and ovary, supporting the suggestion that Xq26 region is involved in human reproduction and development. [score:4]
Expression levels of MIR503HG, LINC00269,and their neighbouring miRNAs—miR-424 and miR-503, were determined in RNA samples from breast and colon adenocarcinoma cell lines treated with 5-aza-2-deoxycytidine (5-Aza-dC) by RT-qPCR normalized to the geometric mean from GAPDH and HPRT genes (for MIR503HG and LINC0026 genes) or snoRNAs RNU24 and RNU48 (for miRNAs). [score:3]
Likewise, the miRNAs miR-424 and miR-503, which are mapped in the MIR503HG gene, also presented increased expression after (Fig 4). [score:3]
The same expression pattern was observed for miRNAs located near the studied loci (miR-424, miR-450a, miR-450b-5p, miR-503 and miR-542-3p). [score:3]
MIR503HG, LINC00629, miR-424 and miR-503 were negatively regulated by DNA methylation after treatment with the demethylating agent 5-aza-2-deoxycytidine. [score:2]
A previous study had already demonstrated that methylation regulates miR-503 in non-small lung cancer cell lines [16]. [score:2]
Furthermore, using the normal tissue panel, we observed a significant positive correlation between MIR503HG and LINC00629 lincRNAs (Fig 3K), and also between both lincRNAs and the neighboring miRNAs: miR-424, miR450a, miR-450b-5p, miR-542-3p and miR-503 (Fig 3A–3J). [score:1]
001284) and miR-503 (Catalog No. [score:1]
[1 to 20 of 8 sentences]
21
[+] score: 17
Under inflammatory conditions, endothelial cells downregulate the expression of miR-424 and miR-503, which are both related with the upregulation of CD40. [score:9]
However, treatment of these cells with pioglitazone, a PPARg agonist, activates the transcription of miR-424 and miR-503 and leads to suppression of CD40 expression, suggesting that miRNAs may act as key modulators of the endothelial inflammatory response (97). [score:5]
The expression levels of hsa-miR-155, hsa-miR-503, hsa-miR-193b, hsa-miR-99a, and hsa-miR-221 were normalized with SNORD8, SNORA70, and SNORD46 used as endogenous controls. [score:3]
[1 to 20 of 3 sentences]
22
[+] score: 17
Other miRNAs from this paper: hsa-mir-424
Induction of CX3CL1 expression involved downregulation of microRNAs (miR-424 and miR-503) both known to target the CX3CL1 3′ UTR, suppressing its translation and inducing RNA degradation (Zhou et al., 2013). [score:12]
Histone deacetylases and NF-kB signaling coordinate expression of CX3CL1 in epithelial cells in response to microbial challenge by suppressing miR-424 and miR-503. [score:5]
[1 to 20 of 2 sentences]
23
[+] score: 17
TRAF6 and TAOK3 are inhibited by mir-373, GYK and APPBP2 are inhibited by mir-200a, TRAF6, TAOK3 and ZNF302 are inhibited by mir-141, CBX2 is inhibited by mir-1, APBB1 is inhibited by mir-148b, POLR3D is inhibited by mir-374b, NAE1 is inhibited by mir-503, and GTF2I is inhibited by mir-98. [score:17]
[1 to 20 of 1 sentences]
24
[+] score: 16
Li L Sarver AL Khatri R Sequential expression of miR-182 and miR-503 cooperatively targets FBXW7, contributing to the malignant transformation of colon adenoma to adenocarcinoma. [score:5]
In a study from Li et al, [64] they showed that a sequential expression of miR-503 and miR-182 in benign adenoma cooperatively regulated Fbxw7, contributing to the malignant transformation of colon adenoma to adenocarcinoma. [score:4]
What is more, several proteins such as, RITA, EBP2, Numb4, SGK1,,, Pin1, FAM83D, C/EBPδ, Hes-5, presenilin, miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a are found to regulate the expression of Fbxw7. [score:4]
Besides those, recently, accumulating evidence has shown that several molecules such as, miRNAs including miR-223, miR-25, miR-27a, miR-182, miR-503, and miR-129-5p, RITA, and FAM83D, as well as Pin1, CCAAT/enhancer -binding protein-δ, presenilin,,, EBP2, Numb4 and serum-and glucocorticoid-inducible protein kinase1 could regulate Fbxw7 (Figure 3). [score:2]
MicroRNAs (miRNAs) Including miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a. [score:1]
[1 to 20 of 5 sentences]
25
[+] score: 16
In contrast, analysis of total RNA from lung specimens of MCT PAH rats overexpressing human prostacyclin synthase (hPGIS) demonstrated reversal of MCT -induced upregulation of miRs 17, 21, and 223 and an increase in levels of miR-424 and miR-503. [score:6]
A group of miRNAs were downregulated in the lung and PA of MCT PAH rats, including miR-126, miR-145, miR-150, miR-424, and miR-503 (Fig 1A and 1B). [score:4]
Among these the miR-17–92 cluster, miR-21, miR-145, miR-204 and miR-210 are dysregulated in PASMCs, miR-124 is primarily dysregulated in fibroblasts in the adventitia, and miR-17, miR-21, miR-424, and miR-503 appear to play important roles in PAECs. [score:3]
Expression levels of miR-17-5p, miR-21-5p, miR-126-3p, miR-145-5p, miR-150-5p, miR-204-5p, miR-223-3p, miR-328-3p, miR-424-5p (mmu-miR-322, the mouse/rat ortholog for hsa-miR-424), and miR-503-5p were evaluated. [score:1]
Notably, levels of miRs 17, 21, and 223 were all significantly reduced and levels of miR-424 (mmu-miR-322, the mouse/rat ortholog for hsa-miR-424) and miR-503 were significantly increased (Fig 5). [score:1]
MiR-424 (miR-322 ortholog) was decreased ~2 fold in the lungs and PA (Fig 1A and 1B) and decreased only slightly in RV, while miR-503 slightly increased in RV with no change in plasma (Fig 1C and 1D). [score:1]
[1 to 20 of 6 sentences]
26
[+] score: 15
Among the 1,205 sets of human miRNAs covered by the array, five (miR-503, miR-542-3p, miR-155, miR-145* and miR-424) were significantly down-regulated upon decidualization (<0.5-fold) (Table 1A), whereas a single miRNA (miR-483-3p) increased in expression (>2-fold) (Table 1B) in all three decidualizing primary HESC cultures (Fig. 1A and Table 1A and B). [score:6]
Although the current study focused on miR-542-3p, other differentially expressed miRNAs, including miR-424, miR-503 and miR-155, may equally functionally regulate decidualization. [score:4]
This analysis identified six major induced decidual genes that were also putative targets of miR-542-3p, miR-424 or miR-503 (Table 2). [score:3]
It is possible that miR-424 in cooperation with miR-503 coordinates endometrial differentiation. [score:1]
Interestingly, it has been reported that miR-424 and miR-503 are derived from a polycistronic precursor miR-424-503. [score:1]
[1 to 20 of 5 sentences]
27
[+] score: 14
For example, these studies reported up to seven fold differences in miRNA expression levels between receptive (LH day 7) and non-receptive (cycle day 12 or LH day 2) endometrium, where miR-30d, miR-30b, miR-31, miR-193a-5p, miR-203 showed up-regulation and miR-503 down-regulation in receptive endometrium [17, 18, 20]. [score:9]
McBride et al. (2012) observed nine miRNAs (miR-125a, miR-199a-3p, miR-125b, miR-99a, let-7c, miR-145, miR-31, miR-202 and miR-27b) with decreased expression and eight miRNAs (miR-503, miR-21, miR-29b, miR-142-3p, miR-34a, miR-152, miR-25 and miR-130a) with increased expression between the follicular and luteal stages in ovine ovarian tissues [21]. [score:5]
[1 to 20 of 2 sentences]
28
[+] score: 13
FGFR1 is a direct target of miR-16 (Chamorro-Jorganes et al., 2011), miR-133b (Wen et al., 2013), miR-198 (Yang et al., 2014), (Wang et al., 2013b), miR-382 (Mor et al., 2013), miR-424 (Chamorro-Jorganes et al., 2011), and miR-503 (Kim et al., 2013b). [score:4]
FGFR1 is a direct target of miR-16, miR-133b, miR-198,, miR-382, miR-424, and miR-503. [score:4]
By contrast, downregulation of miR-133b and in human cancers (Wen et al., 2013; Wang et al., 2013b) and that of miR-424 and miR-503 in pulmonary artery epithelial cells of patients with pulmonary arterial hypertension (Kim et al., 2013b) de-repress FGFR1 and promote proliferation of tumor cells and endothelial cells, respectively, through FGF signaling activation. [score:4]
An endothelial apelin-FGF link mediated by miR-424 and miR-503 is disrupted in pulmonary arterial hypertension. [score:1]
[1 to 20 of 4 sentences]
29
[+] score: 13
Along these lines, our results show a significant downregulation of miR-195 and miR-503 expression in MKN45 radioresistant cells. [score:6]
This family has been recently described as radiosensitivity enhancer on breast cancer by targeting CHK1 43 and miR-503 has been previously shown to target CHK1 44 45. [score:5]
From the predicted miRNAs that target CHK1, we investigated the potential role of miR-195 and miR-503 in the regulation of the stability of CHK1 mRNA. [score:2]
[1 to 20 of 3 sentences]
30
[+] score: 13
Predicted targets for the top 5 annotated miRNA in exosomes (miR-663, miR-503, miR-492, miR-498 and miR-671–5p) were searched using TargetScan and subsequently the target mRNAs were analysed by IPA software to determine predicted canonical pathways, networks and biofunctions regulated by the exosomal miRNAs (Fig. 5 and Additional Information, Table S6. [score:8]
TargetScanHuman 5.1 was applied to predict mRNA targets for the top 5 annotated microRNAs detected in exosomes (miR-663, miR-503, miR-492, miR-498 and miR-671–5p), which generated a list of 500 mRNA. [score:5]
[1 to 20 of 2 sentences]
31
[+] score: 12
However, some miRs such as miR-503 downregulated by HIF-1α inhibit tumor angiogenesis by targeting FGF2 and VEGF (29). [score:8]
Zhou B. Ma R. Si W. Li S. Xu Y. Tu X. Wang Q. MicroRNA-503 targets FGF2 and VEGFA and inhibits tumor angiogenesis and growthCancer Lett. [score:4]
[1 to 20 of 2 sentences]
32
[+] score: 12
Up-regulation of miR-34a [16], miR-19b [17], miR-503 [18] or miR-125b [19] can induce cardiac fibrosis, whereas overexpression of miR-101a [20], miR-17-3p or miR-29a [21] inhibits the fibrosis of CFs. [score:8]
Up-regulation of miR-503 promotes cardiac fibrosis through miR-503-Apelin-13-TGF-β-CTGF-collagen production pathway [18]. [score:4]
[1 to 20 of 2 sentences]
33
[+] score: 12
Experimental validation was done using quantitative RT-PCR for seven randomly chosen miRNAs (five upregulated and two downregulated) and we noticed significant induction in the levels of miR-503, -638, -663 and -744 while slight downregulation in miR-3175 and miR-671-5p (Figure 1b ). [score:10]
We confirmed time dependent induction of specific miRNAs (miR-663, miR-638, miR-503 and miR-744) in response to CHIKV infection thus validating the microarray data. [score:1]
The experiments were also conducted on primary human dermal fibroblasts and similar results were obtained with miR-503 and miR-638 showing maximal induction over the course of the CHIKV infection (Figure 1c ). [score:1]
[1 to 20 of 3 sentences]
34
[+] score: 11
Specifically, miR-195 regulated glioblastoma cell invasion by modulating the CCND3/p27Kip1 pathway [35] and miR-503 inhibited the G1/S transition by targeting CCND3 and E2F3 in hepatocellular carcinomas [36]. [score:6]
Xiao F MicroRNA-503 inhibits the G1/S transition by downregulating cyclin D3 and E2F3 in hepatocellular carcinomaJ. [score:5]
[1 to 20 of 2 sentences]
35
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-18a, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-124-3, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-200b, mmu-mir-203, mmu-mir-204, mmu-mir-205, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-203a, hsa-mir-204, hsa-mir-205, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-100, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-375, mmu-mir-375, hsa-mir-335, mmu-mir-335, mmu-mir-133a-2, hsa-mir-424, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-515-1, hsa-mir-515-2, hsa-mir-518f, hsa-mir-518b, hsa-mir-517a, hsa-mir-519d, hsa-mir-516b-2, hsa-mir-516b-1, hsa-mir-517c, hsa-mir-519a-1, hsa-mir-516a-1, hsa-mir-516a-2, hsa-mir-519a-2, mmu-mir-503, hsa-mir-642a, mmu-mir-190b, mmu-mir-193b, hsa-mir-190b, mmu-mir-1b, hsa-mir-203b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The top negatively correlated (conserved) mouse miRNAs include miR-30a/d (targets Runx2) [57], miR-148a (targets Met/Snail) [58], miR-503 (targets Bcl-2 and Igf1r, implicated in involution) [59], miR-203 (targets the transcription factor p63) [60] and miR-34a (targets Dll1 and CD44, important for stem cell activity) [61, 62]. [score:11]
[1 to 20 of 1 sentences]
36
[+] score: 11
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676 Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
severe (p<0.05) cfa-let-7a, cfa-let-7b, cfa-let-7c, cfa-let-7f, cfa-miR-127, cfa-miR-1271, cfa-miR-130a, cfa-miR-139, cfa-miR-17, cfa-miR-1836, cfa-miR-1837, cfa-miR-20a, cfa-miR-23a, cfa-miR-25, cfa-miR-26a, cfa-miR-29b, cfa-miR-378, cfa-miR-421, cfa-miR-502, cfa-miR-503, cfa-miR-542, cfa- miR-652, cfa-miR-653, cfa-miR-872 Normal and mild vs. [score:1]
[1 to 20 of 3 sentences]
37
[+] score: 10
Only the expression levels of the nonmodified form (not the modified form or the nonmodified plus modified form) of miR-503 were confirmed to be significantly different between HCC and ANL (P = 0.025). [score:3]
Third, 74% and 78% of miR-503 expressed U→ A at the +17 position in the modified forms in HCC and ANL, respectively. [score:3]
Although opposite miRNAs are inferred to exist for all miRNAs, some miRNAs (e. g., hsa-miR-503) with many clone reads have no opposite sequence. [score:1]
Here is a clustering analysis when one does not consider modified miR-503. [score:1]
For miR-376c, miR-376a, miR-34a, miR-503, miR-21, and miR-122, the RNA modifications were detected using both methods, and the possibility of a single nucleotide polymorphism at any of the RNA editing sites was excluded by comparison with the public database OncoDb HCC. [score:1]
Modified miR-376c, miR-376a, miR-34b*, and miR-503 are detected by RT-PCR and conventional cloning. [score:1]
[1 to 20 of 6 sentences]
38
[+] score: 10
We built regression mo dels for these two miRNAs and found that these two loci accounted for 44 % and 37 % of variation in miR-322 and miR-503 expression, respectively. [score:3]
The trans-eQTL locus shared by miR-322 and miR-503 was also weakly associated with the expression of miR-351 and miR-497 (p [adjusted] < 0.1). [score:3]
The predicted structure of pre-miR-342 with the addition of the in del (rs261236356) is shown at right Seven other miRNAs had local eQTL: miR-146b, miR-181d, miR-187, miR-203, miR-221, miR-322, and miR-503. [score:1]
The predicted structure of pre-miR-342 with the addition of the in del (rs261236356) is shown at rightSeven other miRNAs had local eQTL: miR-146b, miR-181d, miR-187, miR-203, miR-221, miR-322, and miR-503. [score:1]
For example, miR-322 and miR-503 each had one local eQTL (on Chr X) and one trans-eQTL on Chr 11. [score:1]
Pairwise Pearson Correlation Values Among miR-322, miR-252, miR-497, and miR-503. [score:1]
[1 to 20 of 6 sentences]
39
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, hsa-mir-381, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Ortega et al., however, show miR-503 as the most down-regulated miRNA during differentiation of human adipocytes [14], while in our murine data set miR-503 was upregulated during both primary brown and white adipocyte differentiation. [score:7]
The discrepancy with respect to mir-503 regulation may relate to differential regulation between man and mouse, or differences in the differentiation protocols applied. [score:3]
[1 to 20 of 2 sentences]
40
[+] score: 10
In agreement with the deep-sequencing findings, Q-PCR results confirmed the down-regulation of miR-133a, miR-378a-3p and miR-378a-5p, as well as the over -expression of miR-483-3p and miR-503-5p in the RMS tumour tissues (see Additional file 2: Figure S1A) and cells (see Additional file 2: Figure S1B). [score:6]
MiR-133a, miR-378a-3p, miR-378a-5p, miR-483-3p and miR-503-5p were selected as candidates to validate miRNA expression levels in Q-PCR using the eight deep-sequencing-analysed RMSs, seven additional tumour samples (3 ARMSs and 4 ERMSs) along with four different RMS cell lines (RH4 and RH30 ARMS cell lines; and RD and RD18 ERMS cell lines). [score:3]
Histograms indicate the mean value ± SD of independent samples (ARMS1-2-3-4-7-36-37 and ERMS1-2-3-4-12-21-23-27); (B) Relative fold change of miR-378a-3p, miR-378a-5p, miR-483-3p and miR-503-5p in RMS cell lines in comparison to NSM. [score:1]
[1 to 20 of 3 sentences]
41
[+] score: 10
The choice of miRNAs for validation with real-time RT-PCR was based on their differential expression among the groups as well as their putative biological significance: miR-542-5p is predicted to target estrogen receptor alpha mRNA; miR-200a and miR-429 are both members of the miR-200 family; and miR-503 is the most down-regulated miRNA in both types of carcinoma and the precursor lesion. [score:8]
Specific kits used were as follows: miR-542-5p: ABI#002240; miR-200a: ABI#000502; miR-429: ABI#001024; miR-503: ABI#001048. [score:1]
1 −2.0 −4.2 miR-410 −2.4 −1.7 −4.2 miR-424 −4.1 −2.6 −10.7 miR-424* −1.2 −4.0 −4.9 miR-431 2.2 −4.3 −1.9 miR-432 −1.9 −2.4 −4.6 miR-503 −8.6 −3.2 −27.3 miR-542-3p −3.2 −2.1 −6.9 miR-542-5p −2.0 −3.1 −6.1 miR-596 2.2 −4.4 −2.0 miR-610 1.9 −5.1 −2. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 9
Expression of miR-424 is low in NFPAs, miR-503 is low in GH adenomas and NFPAs, and CDC25 is a potential target gene of miR-424 and miR-503 [31]. [score:5]
Let-7 [9], miR-26a [10], miR-34a [11], miR-15a/ 16 [12], and miR-503 [11] are differentially expressed in PAs compared with normal tissues, and CCND1 has been predicted to be a potential target [13, 14]. [score:4]
[1 to 20 of 2 sentences]
43
[+] score: 9
Radiation up-regulated miRNA expression levels included let-7g, miR-16, miR-20a, miR-21 and miR-29c, while miR-18a, miR-125a, miR-127, miR-148b, miR-189 and miR-503 were down-regulated. [score:9]
[1 to 20 of 1 sentences]
44
[+] score: 9
The expression difference of miR-503 and miR-660 was not statistically significant in the qPCR analysis (Fig. 4B). [score:3]
Real-time of the selected miRNA confirmed the trends observed in the microarray analysis; however, the expression differences of miR-503 and miR-660 were not statistically significant (Fig. 4). [score:3]
A few high-throughput studies have confirmed some of the identified miRNAs (miR-1, miR-128, miR-133a, miR-133b, miR-206, miR-222, and miR-503) as common for skeletal muscle development in mouse, human, pig, common carp [11], and cattle [25]. [score:2]
Besides the abovementioned miRNAs promoting myoblast differentiation, a few identified molecules such as miR-29b [49], miR-31 [50], miR-9 [51], miR-145 [52], miR-194 [53], miR-378 [54], miR-449 [55], miR-503 [11, 27], miR-542, [56], and miR-660 [11] were described in the literature as skeletal muscle-related. [score:1]
[1 to 20 of 4 sentences]
45
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-28, hsa-mir-29a, hsa-mir-93, hsa-mir-100, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-34a, hsa-mir-181c, hsa-mir-182, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-217, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-134, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-106b, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-372, hsa-mir-382, hsa-mir-148b, hsa-mir-196b, hsa-mir-424, hsa-mir-448, hsa-mir-449a, hsa-mir-483, hsa-mir-491, hsa-mir-501, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320c-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320c-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Zhou R Gong A-Y Chen D Miller RE Eischeid AN Chen X-M Histone deacetylases and NF-kB signaling coordinate expression of CX3CL1 in epithelial cells in response to microbial challenge by suppressing miR-424 and miR-503. [score:5]
On the other hand, Cryptosporidium parvum, a protozoal parasite, hijacks the histone deacetylase and NF-κB signaling pathway to suppress two host miRNA namely miR-424 and miR-503 in the epithelial cells [111]. [score:3]
[1 to 20 of 2 sentences]
46
[+] score: 8
However, mir-503, part of the same cluster and thus subject to the same regulations, is not displayed in Figure 4. This is a consequence of the expression data obtained for miR-503 causing the PCCs for the TF→miRNA associations to decrease and thus not being part of the top quartile of associations (see above). [score:4]
A/ Depicted are the predicted regulations of/miR-542/miR-503 and their involvement in the monocytic differentiation. [score:2]
Furthermore, the pre-mir-424 is transcribed together with pre-mir-503 and pre-mir-542 as one transcript. [score:1]
These pre-miRNAs form the mature miRNAs, miR-503, miR-542-5p, and miR-542-3p. [score:1]
[1 to 20 of 4 sentences]
47
[+] score: 8
Selected miRNAs have a role in tumor progression, as e. g., miR-503 directly targets L1 adhesion molecule (L1CAM) [45] and E2F transcription factor 3 (E2F3) [46] mRNAs involved in tumor progression. [score:4]
MiR-503 and five other miRNAs (miR-4417, miR-18a, miR-431, miR-1246, and miR-18b) were the only short RNAs, which showed significant upregulation through the normal to  adenoma (dysplasia) transition in our analysis. [score:4]
[1 to 20 of 2 sentences]
48
[+] score: 8
Among them, 12 miRNAs (let-7e-5p, miR-151a-3p, miR-21-5p/-3p, miR-221-5p/-3p, miR-222-3p, miR-424-3p, miR-450a-5p, miR-450b-5p, miR-503-5p, and miR-99b-5p) were up-regulated by IL-27 and two miRNAs (miR-99a-5p and miR-125b-5p) were down-regulated. [score:7]
These included let-7e-5p, miR-21-5p/-3p, miR-221-5p/-3p, miR-424-5p/-3p, miR-450a-5p, miR-450b-5p, miR-503-5p, etc. [score:1]
[1 to 20 of 2 sentences]
49
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
Similar findings about miR-503were reported by Qui T. et al., indeed they showed that the expression of miR-503 was decreased in cisplatin-resistant NSCLC cells (A549/CDDP), compared with the parental A549 cells, and that the overexpression of miR-503 could sensitize the A549/CDDP cells to cisplatin targeting the anti-apoptotic protein Bcl-2, whereas the inhibition of miR-503 was able to increase A549 cell resistance to cisplatin [214]. [score:8]
[1 to 20 of 1 sentences]
50
[+] score: 7
They identified 13 miRNAs that were differentially expressed in OSCC when compared to healthy controls and, among them, 11 miRNAs were down-regulated (miRNA-136, miRNA-147, miRNA-1250, miRNA-148a, miRNA-632, miRNA-646, miRNA-668, miRNA-877, miRNA-503, miRNA-220a, miRNA-323-5p), and two miRNAs were over-expressed (miRNA-24, miRNA-27b). [score:7]
[1 to 20 of 1 sentences]
51
[+] score: 7
Functional screening by in vitro transfection of miRNA mimics and inhibitorsMiRNA mimics for miR-1237, miR-365b-5p, miR-550a-5p and miR-135a-3p and miRNA inhibitors for miR-301b, miR-503, miR-542-5p and miR-210 were chosen for further functional investigation. [score:3]
We performed GO analysis and KEGG pathway analysis on the differentially expressed miRNAs, and the results are shown in Supplementary Figure 1. Ultimately, fifteen potential miRNAs associated with the proliferation of osteosarcoma were selected for microarray validation by quantitative real-time RT-PCR analysis, including miR-1237, miR-550a-5p, miR-365b-5p, miR-135a-3p, miR-933, miR-762, miR-629-3p, miR-542-5p, miR-503, miR-301b, miR-210, miR-374a-5p, miR-199a-5p, miR-199a-3p and miR-195-5p. [score:3]
MiRNA mimics for miR-1237, miR-365b-5p, miR-550a-5p and miR-135a-3p and miRNA inhibitors for miR-301b, miR-503, miR-542-5p and miR-210 were chosen for further functional investigation. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 6
We observe large increases in expression over time for miR-375 [24], [25], miR-7 [26] and miR-503 [15], though for the insulin secretion regulating miRNA miR-9 [27] expression rises and then falls (data not shown). [score:6]
[1 to 20 of 1 sentences]
53
[+] score: 6
31 miR-411 –3.3 1.30E-07 14q32.31miR-494 [†] –2.0 1.90E-12 14q32.31 miR-503 –4.0 1.50E-15 Xq26.3 miR-532-5p –4.1 4.80E-19 Xp11.23miR-598 [†] –1.9 5.80E-10 8p23.1 miR-660 –2.4 1.60E-07 Xp11.23 Of the UV-regulated miRNAs 10 were found to be regulated by both UVA and UVB. [score:3]
31 miR-411 –3.3 1.30E-07 14q32.31miR-494 [†] –2.0 1.90E-12 14q32.31 miR-503 –4.0 1.50E-15 Xq26.3 miR-532-5p –4.1 4.80E-19 Xp11.23miR-598 [†] –1.9 5.80E-10 8p23.1 miR-660 –2.4 1.60E-07 Xp11.23Of the UV-regulated miRNAs 10 were found to be regulated by both UVA and UVB. [score:3]
[1 to 20 of 2 sentences]
54
[+] score: 6
In mice with AFL, miR-199-3p, miR-214, miR-93, miR-146a, miR-191, and let-7b are downregulated and miR-129, miR-490, miR-21, miR-503, miR-183, and miR-185 are upregulated compared with healthy mice [103]. [score:6]
[1 to 20 of 1 sentences]
55
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
In the vascular wall, miR-424 miR-155, miR-503, and miR-222 can contribute to the differentiation of monocytes into macrophages, unlike the miR-20a, miR-106a, and miR-17, which prevent this mechanism by suppressing the transcriptor factor acute myeloid leukemia-1 (AML-1) and downregulating macrophage-colony-stimulating factor receptor [51]. [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
Long J Ou C Xia H Zhu Y Liu D MiR-503 inhibited cell proliferation of human breast cancer cells by suppressing CCND1 expressionTumour Biol. [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 5
It has been suggested that the non-structural protein 5A (NS5A), encoded by HCV RNA genome, can decrease miR-503, which is abnormally expressed in various cancers and may play complicated and tissue-specific roles in cancer, and increase bcl-2 by inhibiting NF-κB activation [48]. [score:5]
[1 to 20 of 1 sentences]
58
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-520c, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Another study showed that miR-322/424 and miR-503 are upregulated during myogenesis and these miRNAs promote cell cycle arrest at G1 phase by down -regulating Cdc25A [144]. [score:5]
[1 to 20 of 1 sentences]
59
[+] score: 5
In addition, several other miRNAs (miR-195/497, miR-322/424, and miR-503) have been recently identified as capable of regulating myoblast proliferation by targeting Cdc25a/b and CCNDs, all well-known cell cycle regulators [43, 44]. [score:5]
[1 to 20 of 1 sentences]
60
[+] score: 5
The miR-15/107 family includes miR-15a-5p, miR-15b-5p, miR-16-5p, miR-103-3p, miR-107 (which are expressed in all vertebrates), miR-195-5p, miR-424-5p, miR-497-5p, miR-503-5p (which are expressed in mammals), and miR-646 (human specific) (Finnerty et al., 2010[53]). [score:5]
[1 to 20 of 1 sentences]
61
[+] score: 5
Comparing miRNA editing (Table  1) and expression (Additional file 2 and Additional file 3), we observed that relatively few miRNAs were both edited and significantly modulated by ADAR2 (shown in bold in Table  1): miR-22, miR-503 (Additional file 2), miR-138-1* and miR-455 (Additional file 3). [score:3]
Of note, 9 out of 19 of the editing sites identified in the ADAR2 transfected cells (Table  1) are located within the miRNA seed region (including the new miR-503). [score:1]
Most of these edited miRNAs had already been identified in our previous study [23]; however, here we detected new potential editing sites in miR-210, miR-503 and miR-3157* (shown in italics in Table  1). [score:1]
[1 to 20 of 3 sentences]
62
[+] score: 5
Prediction of functions of the best matched targets of each known miRNAs revealed that targets of some miRNAs were related to energy metabolism, including NADH dehydrogenase (miR-4144-3p, miR-1837, miR-125b*, and miR-36a*) and ATPase (miR-3666, miR-4115-5p, miR-4038-3p, miR-3668, miR-3559-3p, and miR-503); some of them were related to transcription initiation factor (miR-369-3p, miR-139, miR-4082-3p and miR-4148-5p), and splicing factor (miR-23a*, miR-767-3p, miR-463, miR-598 and miR-2881). [score:5]
[1 to 20 of 1 sentences]
63
[+] score: 5
In primary mouse hepatocyte, TCCD modulated the expression of miR-503-5p that targeting cyclin D2 which was involved in the discriminative process of p53 signaling and metabolism (Rieswijk et al., 2015). [score:5]
[1 to 20 of 1 sentences]
64
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-20b, hsa-mir-410, hsa-mir-202, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
This study demonstrated that eight miRNAs (miR-503, miR-21, miR-29b, miR-142-3p, miR-34a, miR-152, miR-25 and miR-130a) were highly expressed, while nine miRNAs (miR-125a, miR-199a-3p, miR-125b, miR-99a, let-7c, miR-145, miR-31, miR-202 and miR-27b) were expressed at lower level between the follicular and luteal stages in ovine ovarian tissues. [score:5]
[1 to 20 of 1 sentences]
65
[+] score: 5
Other miRNAs from this paper: hsa-mir-424
Histone deacetylases and NF-kB signaling coordinate expression of CX3CL1 in epithelial cells in response to microbial challenge by suppressing miR-424 and miR-503. [score:5]
[1 to 20 of 1 sentences]
66
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
With Dicer1 deletion, miR-503, that is more abundant in a mouse ovary than in other tissues, was significantly downregulated. [score:4]
[1 to 20 of 1 sentences]
67
[+] score: 4
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-106b
Moreover, we have demonstrated that such Pitx2c effect on SCs proliferation is due to Pitx2c -mediated downregulation of the miRNAs miR-15b, miR-106b, miR-23b, and miR-503 (Figure 3B). [score:4]
[1 to 20 of 1 sentences]
68
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
After repeated osteo-induction (2w+), miR-30d and miR-30c were induced, and the expression levels of miR-503, miR-322 and miR-125b-3p were the most powerfully repressed (Fig. 4B, E). [score:3]
miR-30d and miR150 as well as other miRNAs were induced by long-term culture for 2 weeks in the absence of differentiation stimulus, while miR-503 and miR-744 were reduced by the long-term culture (Fig. 4C, F). [score:1]
[1 to 20 of 2 sentences]
69
[+] score: 4
We found that compared to medium, moDCs stimulated with B0213 showed significantly increased expression of hsa-miR-132-3p, hsa-miR-144-3p, hsa-miR-147a, hsa-miR-155-5p, hsa-miR-503-3p, and hsa-miR-99b-5p and a decreased expression hsa-miR-222-3p (Fig.   3c). [score:4]
[1 to 20 of 1 sentences]
70
[+] score: 4
Zhang Y MicroRNA-503 acts as a tumor suppressor in glioblastoma for multiple antitumor effects by targeting IGF-1ROncol. [score:4]
[1 to 20 of 1 sentences]
71
[+] score: 4
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Of the down-regulated miRNAs, 24 miRNAs showed a >5-fold decrease, including four miRNAs, i. e. miR-205, miR-503, miR-708 and miR-2115*, which were undetectable in the metastatic line. [score:4]
[1 to 20 of 1 sentences]
72
[+] score: 4
Other miRNAs from this paper: rno-mir-503-1, rno-mir-503-2
Man XF MiR-503 inhibits adipogenesis by targeting bone morphogenetic protein receptor 1aAm. [score:4]
[1 to 20 of 1 sentences]
73
[+] score: 4
Zhou B MicroRNA-503 targets FGF2 and VEGFA and inhibits tumor angiogenesis and growthCancer Lett. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 3
Another study showed that miR-503, a miRNA that is repressed in endometriosis, induces apoptosis and inhibits cell proliferation, angiogenesis, and contractility of human ovarian endometriotic stromal cells [38]. [score:3]
[1 to 20 of 1 sentences]
75
[+] score: 3
MiR-503 regulates osteoclastogenesis via targeting RANK. [score:3]
[1 to 20 of 1 sentences]
76
[+] score: 3
FGF2 is also a target of miR-503 in hepatocellular carcinomas [35]. [score:3]
[1 to 20 of 1 sentences]
77
[+] score: 3
Thirteen miRNAs were overexpressed in exosomes from bulk cells: hsa-miR-218-5p, hsa-miR-7-5p, hsa-miR-1290, hsa-miR-17-5p, hsa-miR-20a-5p, hsa-miR-503-5p, hsa-miR-30c-5p, hsa-miR-125b-1, hsa-miR-21-5p, hsa-miR-93-5p, hsa-miR-378c, hsa-miR-378d and hsa-miR-25-3p (Table 2). [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
[27]↓quail myoblasts diff, ↓ C2C12 diff [29] ↓ C2C12 diff [28] ↓ muscle development [32]40miR-320↓(this study)↑ pMyo diff [33]  41 miR-324-3p (n)↑↑(this study)   42 miR-324-5p (n)↑(this study)   43 miR-331 (n)↑(this study)-  44miR-339↓(this study)↑ C2C12 diff [33] ↑ pMyo diff [33]  45miR-361↑(this study)↑ pMyo diff [33]  46 miR-362↑↑(this study)↑ C2C12 diff [28]  47 miR-374 (n)↑(this study)   48 miR-432 (n)↑(this study)   49 miR-451 (n)↓↓↓(this study)   50 miR-452 (n)↓↓(this study)   51 miR-500↑↑(this study)↑ C2C12 diff [28, 33] ↑ pMyo diff [33]  52 miR-501↑↑↑(this study)↑ C2C12 diff [28, 33]  53 miR-502 (n)↑↑(this study)-  54 miR-503↑(this study)↑ C2C12 diff [19, 28, 33] ↑ pMyo diff [33]  55 miR-532↑↑(this study)↑ C2C12 diff [28, 33] ↑ pMyo diff [33]  56↓↓ pMyo diff. [score:2]
These include [11], [12], miR-27b [13], miR-29b/c [14], miR-143 [15], miR-181 [16], miR-208b/499 [17],4 [18], miR-322/424 and miR-503 [19], miR-486 [20], miR-682 [21]. [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 3
One miRNA (miR-503-5p) was significantly changed in responders and nonresponders in both placebo- and duloxetine -treated patients, suggesting that the alterations in the expression of this miRNA may associate with metabolic processes that are independent of clinical outcome. [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
Furthermore, the overexpressed miRNAs included miR-7, miR-9/miR-9*, miR-21*, miR-31/miR-31*, miR-181, miR-196a/miR-196b, miR-503 and members of the miR-29 and miR-130/301 families (Table 1). [score:3]
[1 to 20 of 1 sentences]
81
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Wang T. Ge G. Ding Y. Zhou X. Huang Z. Zhu W. Shu Y. Liu P. MiR-503 regulates cisplatin resistance of human gastric cancer cell lines by targeting IGF1R and BCL2 Chin. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
Of these, nine miRNAs (hsa-miR-326 [21], hsa-miR-211 [22], [23], hsa-miR-10b [32], hsa-miR-365 [32], hsa-miR-10a [32], hsa-miR-503 [32], hsa-miR-335* [30], hsa-miR-331-3p [30] and has-miR-199a-5p [30]) were expressed at higher levels in abdominal, rather than gluteal, adipose tissue (Table S1). [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
MiR-503 has been shown to target RANK in osteoclastogenesis (Chen et al. 2014). [score:2]
TNFRSF11A (i. e. RANK) was associated with 15s in our data, although not associated with miR-503. [score:1]
[1 to 20 of 2 sentences]
84
[+] score: 3
Of 262 miRNAs in the network significantly correlated with at least one pathway, 8020 miRNA pairs (out of >20,000 possible pairs) were candidates for pathway cotargeting, including hsa-miR-497 and hsa-miR-503 (ER, Ras, and TGF-β), hsa-miR-20a and hsa-miR-372 (EGFR and p53), and hsa-miR-192 and hsa-miR-215 (BRCA1 and HER2). [score:3]
[1 to 20 of 1 sentences]
85
[+] score: 3
Other miRNAs from this paper: hsa-mir-215, hsa-mir-200b, hsa-mir-200c, hsa-mir-200a
Xie Z. Xiao Z. Wang F. Hepatitis C Virus Nonstructural 5A Protein (HCV-NS5A) Inhibits Hepatocyte Apoptosis through the NF-κb/miR-503/bcl-2 PathwayMol. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
The analysis showed miRNAs that were related to ER stress pathway (let-7f, miR-351, miR-127, miR-133a, miR-195, miR-214 and miR-503), suggesting CASP3, CASP7, XBP1, ATF6 and ATF4 as possible target genes for these miRNAs (Table 4). [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
The analysis of miRNA expression in cardiomyocyte progenitor cells (CMPCs) showed that 188 miRNAs were detectable in proliferating CMPCs and 195 in differentiated CMPCs such as miR1, miR1-2, miR499, miR322, miR503, miR208, miR133, and miR26b [30, 31, 32, 33, 34]. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
Therefore, we analyzed expression changes of the hsa-miR-16 family members: hsa-miR-16, hsa-miR-15a and hsa-miR-503 in our high-throughput data (Fig.   4, Panel a-d and Additional file 2: Figure S5, Panel a) and performed qRT-PCR analysis as well (Fig.   4, Panel e-g). [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
Abnormal suppression of miR-503 leads to the increase in the Cyclin D1 level, which may promote carcinogenesis in endometrioid endometrial cancer [28]. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 2
Previous studies demonstrated that the acquired drug resistance of cancer cells is related to deregulation of miRNAs such as miR21, miR-503, miR-181a and miR-620 [23- 25]. [score:2]
[1 to 20 of 1 sentences]
91
[+] score: 2
MiR-503 deters neoplasm angiogenesis via targeting FGF2 and VAGFA [67]. [score:2]
[1 to 20 of 1 sentences]
92
[+] score: 2
Nine distinct binding sites of six human miRNAs, hsa-miR-25, hsa-miR-92a, hsa-miR-93, hsa-miR-99b, hsa-miR-191, and hsa-miR-503 were top ranked by the prioritization with binding energy lower than -37 KCal/Mol and having at most two amino acid substitutions without effects on physical properties (see Additional file 3). [score:1]
Human miRNAs hsa-miR-99b and hsa-miR-503 has an MRE with only single amino acid substitution on segment 6 (NA) and segment 4 (HA), respectively. [score:1]
[1 to 20 of 2 sentences]
93
[+] score: 2
Pre-clinical studies in healthy mice and in vitro studies using estrogen have identified miRNAs either regulated by estrogen (miR-203, miR-126, miR-23a, miR-21, miR-24, miR-27a and b, and miR-106a and b) or encoded by X-chromosome (miR-98, miR-652, miR-221, miR-222, miR-223, miR-361, miR-421, miR-325, miR-188, miR-92a, miR-424, miR-503, miR-505). [score:2]
[1 to 20 of 1 sentences]
94
[+] score: 2
The transcription factor p53 has been also co-localized in the mitochondria during p53-dependant apoptosis and is a putative regulator of let-7 familly and other miRNA (mir-107, mir-145, mir-134, mir-503, mir-21) detected in the mitochondria [48], [49]. [score:2]
[1 to 20 of 1 sentences]
95
[+] score: 2
However, many of the miRNA species detected regulate cell proliferation and are associated with a variety of cancers, including miR-92a, miR-125b, miR-125a-5p, miR-503 and miR-99a-star. [score:2]
[1 to 20 of 1 sentences]
96
[+] score: 2
Another study showed that miR-424 promotes monocytic differentiation through combinatorial regulation with miR-155, miR-222, and miR-503 [33]. [score:2]
[1 to 20 of 1 sentences]
97
[+] score: 2
However, miRNAs, including hsa-miR-503-5p (MIMAT0002874) and hsa-miR-423-3p (MIMAT0001340) which were predictors at mid-pregnancy as well as in late pregnancy, constituted 7 out of the top 10 predictors of class membership. [score:1]
MiRNAs like miR-503-5p (MIMAT0002874) and miR-423-3p (MIMAT0001340) were stable contributors to prediction accuracy in both mid- and late pregnancy, whereas miR-337-3p (MIMAT0000754) contributed to prediction accuracy in late pregnancy. [score:1]
[1 to 20 of 2 sentences]
98
[+] score: 2
Recent investigations indicate that several miRNAs, such as miR-152 [29], miR-218 [30], miR-424 and miR-503 [31], were involved in the dysregulation of Rictor expression. [score:2]
[1 to 20 of 1 sentences]
99
[+] score: 2
Recently, noncoding microRNAs (miRNAs) such as miRNA-222, miRNA-30, miRNA-29b, miRNA-503, miRNA-195, and miRNA-320a have been demonstrated to play a role in the regulation of epithelial regeneration, protection, and epithelial barrier function (194). [score:2]
[1 to 20 of 1 sentences]
100
[+] score: 1
These results are consistent with previous reports showing that miR-424 and miR-503 are capable of inducing G1 arrest in multiple cell types [8], [25]. [score:1]
[1 to 20 of 1 sentences]