sort by

117 publications mentioning hsa-mir-497 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-497. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 339
As demonstrated in Figure 6C, the mRNA levels of IGF1R and mTOR were significantly decreased in miR-497 or miR-99a over-expressed cells, and the expressions were further down-regulated in the cells co -expressing both two miRNAs. [score:10]
By ectopical expression of miR mimics and/or inhibitors as well as corresponding non -targeting control miRNAs in HCC cell lines, the expression of miR-497 or miR-99a in tumor cells were efficiently manipulated (Supplementary Figure 2). [score:9]
Our study showed that miR-497 and miR-99a, the direct targets of IGF1R and mTOR, were significantly down-regulated in HCC tissues and cell lines, and they repressed certain aspects of tumorigenesis by targeting IGF1R and mTOR. [score:9]
As these two miRNAs were both down-regulated in HCC and inversely correlated with same targets, we speculated that miR-497 and miR-99a might be co-operative on the growth of HCC cells by co -targeting these two genes. [score:8]
Taken together, our results suggest that miR-497 and/or miR-99a can work as tumor suppressor in combination synergistically inhibit tumor growth via co -targeting IGF1R and mTOR. [score:7]
Figure 5 (A) Up -expression of miR-99a and miR-497 could significantly inhibit HepG2 and Hep3B cells migration and invasion whereas these effects were reversed when co-transfection with miRNAs inhibitors (presented here was in HepG2 cells). [score:7]
Up -regulating miR-497 in HepG2 and Hep3B cell lines and xenograft mo dels resulted in the down-regulation of IGF1R and mTOR and inhibition of tumor growth and cell invasion. [score:7]
Up-regulation of miR-99a and miR-497 inhibited liver cancer cell proliferation, delayed cell cycle progression, and promoted apoptosis in liver cancer cell, which were reversed by up -regulating IGF1R and mTOR. [score:7]
Apparently the synergistic inhibition of miR-497 and miR-99a on tumor growth could be interpreted by their synergistical inhibition on expression of IGF1R and mTOR. [score:7]
Up-regulation of miR-99a and miR-497 inhibited liver cancer cell migration and invasion. [score:6]
In this study, luciferase reporter assay indicated that miR497 directly bind to the 3’ UTR of IGF1R/mTOR, and down-regulated mRNA expression of IGF1R/mTOR. [score:6]
These and our results, together with the high possibility that more miR-497 or miR-99a common targets will be discovered soon, suggest that these two miRNAs share overlapping functions, regulate important signaling pathway-related mRNAs (including IGF1R and mTOR), and thus function as tumor suppressors. [score:6]
These data indicates that up-regulated IGF1R and mTOR were inversely correlated with the decreased expression of miR-497 and miR-99a in HCC. [score:6]
TSC1 (putative target of miR-497 identified by TargetScan) can regulate the activity of mTOR. [score:6]
Such inhibition on the tumor growth was synergistically strengthened in miR-497 and miR-99a co -expressing group via synergistically suppressing IGF1R and mTOR, which is consistent with the observation in the in vitro assay. [score:6]
MiR-497 and miR-99a inhibited HCC cell growth in vitro, which were reversed by up -regulating IGF1R and mTORConcerning the significant down-regulation of miR-497 and miR-99a in HCC tissues and cell lines (Figure 2), their functional role in HCC carcinogenesis was investigated. [score:5]
Therefore, miR-497 and miR-99a may play important suppressive effects on tumor growth controlled by IGF1R/mTOR signaling pathway and would be both biological and clinical targets for future HCC research. [score:5]
Collectively, our results suggested that miR-497 or miR-99a inhibited HCC cell growth and invasion capacities and functioned as tumor suppressors. [score:5]
Figure 4 (A) Ectopic expression of miR-99a and miR-497 suppressed HegG2 and Hep3B cell lines proliferation at 48h and 72h. [score:5]
IGF1R and mTOR were highly expressed and inversely correlated with the expression of miR-497 and miR-99a. [score:5]
Synergistic effects of miR-497 and miR-99a on inhibiting HCC cell proliferation by co -targeting IGF1R and mTOR. [score:5]
Figure 2 (A, B) Expression profiling of miRNAs showing that miR-99a and miR-497 were down-regulated in HCC tissues compared with non-cancerous liver tissues. [score:5]
As reported previously, miR-497 retards lung cancer cell growth or invasion by targeting CCNE1 [28], VEGFA [29], whereas miR-497 does so by targeting SSRP1 [30] in HCC. [score:5]
But this inhibitory effect of miR-497 and miR-99a on cell proliferation was entirely abolished by co-transfecting cells with miR inhibitors (Figure 4A-4D) and completely reversed by application of IGF1 (IGF1R ligand) or MHY1485 (mTOR agonist) (Figure 4F). [score:5]
By targeting both IGF1R and mTOR, miR-497 or miR-99a exerted remarkable tumor suppressive function in vivo and in vitro. [score:5]
As shown in Figure 7A-7C, at 25 days, the tumor volume and weight were markedly decreased in miR-99a or miR-497 over-expressed tumors compared to the control as IGF1R and mTOR were down-regulated in the xenograft tumors (Figure 7D). [score:5]
Figure 6 (A) Co -expression of miR-99a and miR-497 exerted stronger suppression on HegG2 and Hep3B cell proliferation than that of miR-497 or miR-99a alone at 48h and/or 72h. [score:5]
We found that exogenous expression of miR-497 or miR-99a in HCC cells resulted in markedly suppressed migration and invasion in HepG2 and Hep3B cells through membrane or matri-gel coated membrane (Figure 5A, 5B). [score:5]
As illustrated in Figure 4A, up-regulation of miR-497 or miR-99a significantly decreased the growth rate of HepG2 and Hep3B cells. [score:4]
Real-time PCR and western blot assay further showed that miR-497 and miR-99a suppressed the expression of IGF1R and mTOR in a synergistic manner. [score:4]
miR-99a and MiR-497 were down-regulated in HCC tissues and cell lines. [score:4]
IGF1R and mTOR are direct targets of both miR-99a and miR-497. [score:4]
Mutation of miR-497 or miR-99a binding site from the target mRNA 3′-UTR largely abolished the effects of miR-497 and miR-99a mimics. [score:4]
From our data, it was indicated that miR-497 and miR-99a were significantly down-regulated in patients with HCC and HCC cell lines. [score:4]
MiR-497 and miR-99a inhibited HCC cell growth in vitro, which were reversed by up -regulating IGF1R and mTOR. [score:4]
MiR-497 and miR-99a were down-regulated in HCC tissue samples and cell lines. [score:4]
These alterations may help us to understand the down-regulation of miR-497 and miR-99a and thereby contribute to the hepatocellular malignant transformation. [score:4]
In addition, DNA methylation was also related to the down-regulation of miRNA-497 in tumors, such as ovarian and breast cancer [25, 26]. [score:4]
miR-497 and/or miR-99a retarded HCC development in vivoTo further confirm the tumor suppressive function of miR-497 and miR-99a, HepG2 cells were engrafted into nude mice. [score:4]
The loss or deletion of chromosome 17p13.1 has been reported in various types of cancer, including HCC, which suggested that the down-regulation of miRNA-497 in HCC probably arises from genomic DNA loss or deletion [24]. [score:4]
Among these miRNAs only miR-99a and miR-497 were found to be significantly down-regulated in HCC according to two published microarray -based high throughput assessment (NCBI/GEO/GSE21362, NCBI/GEO/GSE36915, P value < 0.001, Supplementary Figure 1). [score:4]
The Pearson Correlation was used to determine the statistical significance of miR-497/miR-99a expression and immunohistochemistry(IHC) scores of IGF1R and mTOR. [score:3]
To the best of our knowledge, this is the first study to demonstrate the co-operative effect of miR-497 and miR-99a on inhibiting HCC cell growth. [score:3]
IGF1R and mTOR were the target genes of miR-497/miR-99a. [score:3]
The expression level of miR-99a and miR-497 were performed on an ABI 7900 system (Applied Biosystems). [score:3]
MiR-99a and miR-497 mimics/inhibitors and negative control molecules were purchased from (Ribo, guangzhou, China). [score:3]
Further cotransfection of miR-497 and miR-99a exhibited much stronger inhibition on HCC cell proliferation and xenograft tumor growth. [score:3]
In conclusion, the major finding of our study is that miR-497 and miR-99a synergistically target IGF1R and mTOR, thereby impeding the HCC tumor growth. [score:3]
These results indicated that expression of miR-497 and miR-99a were significantly decreased in HCC tumor tissues and HCC cell lines. [score:3]
And correlation analyses were performed between IHC scores of IGF1R/mTOR and the mRNA levels of miR-99a/miR-497 expression in HCC tissues (n = 30). [score:3]
P70S6K (miR-497) [25], and FGF family (including FGFR1 and FGFR3, targeted by miR-497 and miR-99a, respectively) [47, 32] are involved in the downstream genes of IFG1R/mTOR pathway. [score:3]
In GSE21362 and GSE36915, miR-497 and miR-99a were found to be significantly down-regulated in HCC tissues, compared with non-cancerous liver tissue (n=146 and 89, respectively; P<0.001; Figure 2A, 2B). [score:3]
Synergistic effects of miR-497 and miR-99a on retarding HCC cell proliferation, which related with synergistic co -targeting on IGF1R and mTOR. [score:3]
The interaction between miRNA-497 and IGF1R/mTOR were further collaborated by the inversely correlated expressions of miR-497 and IGF1R/mTOR in HCC tumor tissue and cell lines. [score:3]
To further confirm the tumor suppressive function of miR-497 and miR-99a, HepG2 cells were engrafted into nude mice. [score:3]
In the present study, we found that the expression of miR-497 and miR-99a were significantly decreased in human HCC tissues and cell lines. [score:3]
We also examined the expression of miR-497 and miR-99a in two HCC cell lines (HepG2 and Hep3B) and in one normal liver cell line L-02. [score:3]
Both miR-99a and miR-497 were significantly down-regulated in HCC tissues compared to non-tumor tissues. [score:3]
As showed in Figure 6A, HepG2 and Hep3B cells co -expressing miR-497 and miR-99a exhibited a more significant reduction in cell viability than the cells transfected with miR-497 or miR-99a alone (P<0.05; HepG2 cell at 48h and 72h, Hep3B cell at 72h), which is found to be statistically synergistic. [score:3]
In Figure 1A, 3′-UTR of IGF1R and mTOR contained a conserved putative target site for both miR-497 and miR-99a, respectively. [score:3]
To validate this hypothesis, we co -transfected miR-497 and miR-99a into HepG2 and Hep3B cell lines, and found that these two miRNAs act synergistically on retarding HCC cell proliferation via co -targeting IGF1R and mTOR. [score:3]
Thus, miR-497 and miR-99a can synergistically functions as tumor suppressors in vivo. [score:3]
MiR-497 and miR-99a suppressed HCC tumor invasiveness. [score:3]
Further studies on the suppression of miR-497 and miR-99a should be elucidated in the future. [score:3]
The expression of IGF1R and mTOR in HCC cell lines and tissues were inversely correlated with the levels of miR-99a and miR-497. [score:3]
As both IGF1R and mTOR are targets of miR-497 and miR-99a, we examined whether these two miRNAs exert much stronger effects on HCC cell proliferation and apoptosis than individuals. [score:3]
According to the NCBI, GEO database, we generalized the repressive status of miR-497 and miR-99a in HCC by recapitulating their expressions from the large cohorts of HCC patients (Figure 2A, 2B). [score:3]
MiR-99a and miR-497 repressed the growth of HepG2-engrafted tumors and decreased the expression of IGF1R and mTOR in vivo. [score:3]
Aberrant expression of miR-497 and miR-99a were further validated by qRT-PCR in 30 paired HCC and peri-tumoral tissue samples (Figure 2C). [score:3]
Both miR-497 and miR-99a modulate other oncogenes that may mediate their tumor suppressor function. [score:3]
The expression level of miR-497 and miR-99a in the two HCC cell lines was significantly lower than that in the L-02 cells (Figure 2D). [score:3]
Our study extends the results of others by showing that miR-497 targets both IGF1R and mTOR in HCC. [score:3]
Therefore, we thought the inhibitory effects of miR-497/miR-99a on HCC cell growth is through repressing IGF1R/mTOR signalling. [score:3]
miR-497 and/or miR-99a retarded HCC development in vivo. [score:2]
Concerning the significant down-regulation of miR-497 and miR-99a in HCC tissues and cell lines (Figure 2), their functional role in HCC carcinogenesis was investigated. [score:2]
Obviously miR-497 and miR-99a appeared to be suppressed in HCC compared with non-cancerous surrounding tissues. [score:2]
The 3’-UTR of IGF1R and mTOR containing the putative binding sites of miR-99a or miR-497 and their corresponding mutated sequences were amplified and verified by DNA sequencing. [score:1]
Figure 1 (A) Putative binding sequences of IGF1R and mTOR with complementary sites for the seed regions of miR-99a and miR-497, as shown. [score:1]
To confirm the functional interaction between IGF1R/mTOR and miR-99a/miR-497, we performed luciferase experiment. [score:1]
But the relationship between miR-497 and miR-99a is complex and their co-operative effect on HCC growth requires further research. [score:1]
And these anti-growth effects would be attenuated after co-transfection with antisense miR-99a and miR-497 (miR-99a-in and miR-497-in). [score:1]
In this study, we demonstrated that miR-497 and miR-99a from different miRNA clusters and having different seed sequences, act synergistically on tumor cell proliferation and growth. [score:1]
Two-way ANOVA was used to assess the synergistic effect of miR-497 and miR-99a. [score:1]
Since miR-497 and miR-99a have synergistic effects on HCC cell proliferation, further examination of whether these two miRNAs have synergistic effects on IGF1R and mTOR need to be carried out. [score:1]
In our study, miR-497 and miR-99a are located on chromosomes 17p13.1 and 21q, respectively. [score:1]
Therefore, the combination of miR-497 and miR-99a could be superior to each individual miRNA alone in retarding HCC cell growth. [score:1]
Next we explored the potential relationship between IGF1R/mTOR and miR-497/miR-99a, and found that IGF1R/mTOR and miR-497/miR-99a were significantly negatively correlated (Figure 3C). [score:1]
As shown in Figure 1B, 1C, miR-497 and miR-99a mimics repressed the luciferase activity, respectively. [score:1]
Therefore our study focused on the functional role of miR-99a and miR-497 in HCC. [score:1]
[1 to 20 of 89 sentences]
2
[+] score: 325
Other miRNAs from this paper: hsa-let-7e, hsa-mir-214, hsa-let-7i, hsa-mir-200c
In conclusion, our study demonstrated that 1) miR-497 was downregulated in cisplatin-resistant ovarian cancer cell lines and tumors; 2) DNA hypermethylation contribute to downregulation of miR-497; 3) with biological function that are associated with development of cisplatin-resistance phonotype; and 4) overexpression of miR-497 decreases cisplatin resistance of ovarian cancer cells in vitro and in vivo. [score:10]
Furthermore, forced expression of miR-497 by transient transfection repressed both mTOR and p70S6K1 protein expression in A2780/CP and S KOV3/CP cells; whereas blockade of endogenous miR-497 using antisense inhibitors increased both mTOR and p70S6K1 expression levels in A2780 and S KOV3 (Figure 4D–4E). [score:9]
We also inhibited levels of miR-497 in A2780 and S KOV3 cells by transfection of cells with anti-miR-497 inhibitor or a control inhibitor (anti-miR-NS). [score:7]
The luciferase activities from the mTOR and p70S6K1 wild-type construct were inhibited upon overexpression of miR-497 and were induced by inhibition of miR-497. [score:7]
Taken together, downregulation of miR-497 expression render ovarian cancer cells resistant to cisplatin treatment. [score:6]
No significant differences were found in mTOR and p70S6K1 mRNA levels (data not shown), indicating that mTOR and p70S6K1 expression is regulated at the translational level through miR-497. [score:6]
These results indicated that miR-497 downregulation promotes acquisition of cisplatin-resistant ability in ovarian cancer cell via inducing mTOR and p70S6K1 overexpression. [score:6]
These results demonstrated that miR-497 directly targets mTOR and p70S6K1 to repress their protein expression by binding to their 3′-UTR regions. [score:6]
The above studies showed that miR-497 directly target mTOR and p70S6K1 to repress their protein expression by binding to their 3′-UTR regions. [score:6]
The expression levels of miR-497 were downregulated in cisplatin-resistant ovarian cancer cells. [score:6]
Doxycycline treatment -induced stable -expressing miR-497 constantly decreased both mTOR and p70S6K1 expression in A2780/CP and S KOV3/CP, as well as dramatically reduced cells resistance to cisplatin treatment (Figure 5B–5C). [score:5]
MiR-497 expression was downregulated in cisplatin-resistant ovarian cancer cell lines and ovarian cancer specimens. [score:5]
Interestingly, forced expression of mTOR and p70S6K1 partially or completely restored miR-497 -inhibited cisplatin resistance in ovarian cancer cells (Figure 5E–5F). [score:5]
Our results demonstrated that increased methylation of the miR-497 promoter play a crucial role for silencing expression of miR-497 and demethylation by 5-AZA treatment can reverse miR-497 expression in cisplatin-resistant ovarian cancer cells. [score:5]
We showed that miR-497 could suppress both mTOR and p70S6K1 protein expressions through the binding of these miRNAs to their 3′-UTR regions. [score:5]
D. A2780/CP and S KOV3/CP cells were transfected with miR-497 or miR-Scr; or E. A2780 and S KOV3 cells were transfected with anti-miR-497 or anti-miR-Scr inhibitors for 72 h. The expression levels of mTOR or p70S6K1 were analyzed by Western blotting. [score:5]
In addition, forced expression of miR-497 is able to suppress cancer cell growth both in vitro and in vivo [15– 16]. [score:5]
On the contrary, inhibition of miR-497 expression markedly increased A2780 and S KOV3 cells tolerance to cisplatin (Figure 3B). [score:5]
Demethylation treatment by 5-Aza-dC dramatically restored both pri-miR-497 and matured miR-497 expression levels in A2780/CP and S KOV3/CP cells (Figure 2C–2D), indicating that hypermethylation plays a crucial role in the silencing of miR-497 expression. [score:5]
The advantage of the Tet-On inducible miR-497 system is that the expression of miR-497 is more controllable by addition or depletion of Dox in drinking water than long-term continuous stable -expressing miR-497 cell lines. [score:5]
The expression of miR-497 was regulated by DNA methylation. [score:4]
Our results demonstrated that, highlighting the potential role of miR-497 downregulation for ovarian cancer cells to develop a chemoresistance phenotype. [score:4]
mTOR and p70S6K1 are two direct targets of miR-497. [score:4]
Collectively, these results indicated that DNA hypermethylation may be the main reason for miR-497 downregulation in ovarian cancer cells. [score:4]
Downregulation of miR-497 contributes to high levels of mTOR and p70S6K1, which makes ovarian cancer cells resistant to cisplatin -based chemotherapy. [score:4]
MiR-497 inhibits cisplatin resistance through targeting mTOR and p70S6K1 in ovarian cancer cells. [score:4]
To explore the mechanism of miR-497 downregulation in cisplatin-resistant ovarian cancer cells, we first analyzed the genomic DNA sequence within 3-kilobase promoter regions of miR-497 gene, and found miR-497 gene contains CpG-rich regions (CpG islands) in its promoter regions. [score:4]
Downregulation of miR-497 has been found in breast, cervical, head-and-neck, colorectal, and prostate cancer [11– 14]. [score:4]
Point mutations in putative binding site abrogated the effect of miR-497, demonstrating that miR-497 specifically target the mTOR and p70S6K1 3′ UTR by binding to the identified seed sequence (Figure 4B–4C). [score:4]
Doxycycline (Dox) treatment significantly increased miR-497 expression in A2780/CP-Tet-ON-miR-497 and S KOV3/CP-Tet-ON-miR-497 cells, as compared with miR-NS expressing cells or doxycycline non-treatment groups (Figure 3E). [score:4]
Knockdown of endogenous mTOR and p70S6K1 exerted a similar effect as overexpression of miR-497 on decreasing resistance of ovarian cancer cells (Figure 5D). [score:4]
mTOR and p70S6K1 are direct targets of miR-497. [score:4]
To test whether restoration of miR-497 expression in cisplatin-resistant ovarian cancer cells can enhance the response of cisplatin treatment in vivo, we established an orthotopic ovarian tumor mo del by implantation of A2780/CP-Tet-ON-miR-497 or A2780/CP-Tet-ON-miR-NS cells in nude mouse ovary. [score:3]
MiR-497 is one of the tumor suppressor miRNAs in human cancer. [score:3]
MiR-497 downregulation was due to DNA methylation. [score:3]
We observed that miR-497 over -expression in A2780/CP and S KOV3/CP cells resulted in much stronger cisplatin treatment response than transient miR-497 restoration. [score:3]
On Day 6 after cell implantation, tumor-bearing mice were given drinking water with Dox every day to induce miR-497 or miR-NS expression. [score:3]
B. - C. The reporter constructs containing the wild-type and mutant (Mut) p70S6K1 B. or mTOR C. 3′ -UTR regions were co -transfected into A2780/CP cells with miR-497, or scramble miRNA precursors; or anti-miR-497, or anti-scramble miRNA inhibitors and β-gal plasmid. [score:3]
Furthermore, consistent with the results from, we found that overexpression of miR-497 significantly sensitized A2780/CP and S KOV3/CP cells to cisplatin treatment (Figure 3C–3D). [score:3]
The mice were feed drinking water with Dox to induce miR-497 expression 6 days after the injection. [score:3]
Taken together, these results showed lower expression levels of miR-497 were inversely correlated with mTOR/p70S6K1 levels of ovarian cancer patients. [score:3]
B. miR-497 levels were inversely correlated to mTOR expression levels in human ovarian cancer (R = −0.1811, P < 0.0001). [score:3]
A normalized mRNA expression dataset for ovarian cancer [39] was downloaded from the cBioPortal for cancer genomics and used to evaluate coexpression of mTOR, p70S6K1, and miR-497 transcript levels. [score:3]
Importantly, miR-497 was remarkably downregulated in A2780/CP compared with A2780 (Figure 1B–1E). [score:3]
After a second round of selection, cell lines were established and comfirmed for expressing high levels of hsa-miR-497 or hsa-miR-NS in response to doxycycline (Dox). [score:3]
To further validate this finding, we examined miR-497 expression levels in S KOV3 and S KOV3/CP cell lines. [score:3]
Our data showed that induced -expressing of miR-497 in cisplatin-resistant ovarian cancer cells exert a much better cisplatin treatment effect on ovarian tumor growth than control groups, indicating a possible application for miR-497 as a “supplement” to conventional cisplatin -based chemotherapy. [score:3]
Dox treatment altered miR-497 expression or cisplatin resistance of both A2780/CP and S KOV3/CP cells (Figure 3F). [score:3]
To investigate whether miR-497 overexpression enhanced the cisplatin response sensitivity of ovarian cancer cells via targeting mTOR and p70S6K1, we performed mTOR and p70S6K1 loss- and gain-of-function experiments in ovarian cancer cells. [score:3]
C. - D. Serum starved A2780/CP and S KOV3/CP cells with stable overexpression of miR-497, then exposed to various concentrations of cisplatin for 48 h. IC [50] values were determined. [score:3]
Reduced expression of miR-497 was inversely correlated to mTOR/p70S6K1 levels of ovarian cancer patients. [score:3]
Next, we used lentiviral particles carrying mTOR or p70S6K1 cDNAs lacking their 3′-UTR regions to infect miR-497 stable -expressing ovarian cancer cells. [score:3]
Reduced expression of miR-497 has been associated with malignancy of breast and colorectal cancer [11, 14]. [score:3]
The expression levels of miR-497 were significantly decreased in both cisplatin-resistant cell lines (A2780/CP and S KOV3/CP) as well as in platinum-resistant ovarian cancer tissues. [score:3]
Figure 3 A. - B. A2780/CP and S KOV3/CP cells were transfected with pre-miR-497, or scrambled miRNA precursors A. or with anti-miR-497, or scrambled miRNA inhibitors B.. [score:3]
D. The expression levels of miR-497 in tumor tissues were analyzed by qRT-PCR. [score:3]
To further determine whether DNA methylation is responsible for miR-497 downregulation, we treated A2780/CP and S KOV3/CP cells with or without 5-Aza-dC, a demethylation reagent, and performed MSP assay. [score:3]
Overexpression of miR-497 reduces resistance of ovarian cancer cells to cisplatin treatment. [score:3]
Although miR-497 has been shown to be a tumor suppressor gene in many human cancers, its role in chemotherapeutical resistance has not been fully addressed. [score:3]
The hsa-miR-497 and hsa-miR-NS fragments were PCR amplified from hsa-miR-497 and hsa-miR-NS overexpression plasmids obtained from Open biosystems. [score:3]
Hsa-miR-NS, hsa-miR-497 precursors, or anti-miR-497 and control inhibitors (Ambion, TX, USA) were transfected into cells using Lipofectamine RNAiMAX (Invitrogen, CA, USA) according to the manufacturer's instructions. [score:3]
org, to obtain a list of possible mRNA targets of miR-497. [score:3]
Overexpression of miR-497 by transient transfection or Tet-ON -induced system decreased cisplatin-resistance of A2780/CP and S KOV3/CP cells. [score:3]
To further test the physiological relevance of mTOR/p70S6K1 and miR-497 interaction, we performed in silico analysis for miR-497 and mTOR/p70S6K1 expression from The Cancer Genome Atlas (TCGA) 2011 dataset for Ovarian Cancer, comprising of 489 patient samples with follow-up information (Figure 7A). [score:3]
Next, we generated Tet-On -based stable cell lines for inducible expression of miR-497 in A2780/CP-Tet-ON-miR-497 and S KOV3/CP-Tet-ON-miR-497 cells. [score:3]
Similar effects of miR-497 on targeting mTOR and p70S6K1 have also been observed in multiple human cancer cells (data not shown). [score:3]
A. - B. A2780/CP and S KOV3/CP cells were transfected with pre-miR-497, or scrambled miRNA precursors A. or with anti-miR-497, or scrambled miRNA inhibitors B.. [score:3]
G. Relative expression levels of miR-497 in 20 different platinum-sensitive and 21 different platinum-resistant ovarian tumors. [score:3]
MiR-497 overexpression decreased cisplatin resistance of ovarian cancer cells in vivo. [score:2]
Methylation-specific PCR primers are summarized as follows: MiR-497 MF: 5′-TTGATTTAGGGAGAGGAAGGAC-3′ MiR-497 MR: 5′-TAAACAAACAACTAAAAAACGACGA-3′ MiR-497 UF: 5′-TTTGATTTAGGGAGAGGAAGGAT-3′ MiR-497 UR: 5′-AAACAAACAACTAAAAAACAACAAA-3′ mTOR and p70S6K1 3′-UTR regions containing predicted miR-497 binding sites and corresponding mutant sites were amplified by PCR from genomic DNA, and the PCR fragments were inserted into untranslated region (UTR) downstream of the luciferase gene in the pMIR-reporter luciferase vector (Ambion). [score:2]
MiR-497 decreases cisplatin resistance through targeting mTOR and p70S6K1. [score:2]
Methylation-specific PCR primers are summarized as follows: MiR-497 MF: 5′-TTGATTTAGGGAGAGGAAGGAC-3′ MiR-497 MR: 5′-TAAACAAACAACTAAAAAACGACGA-3′ MiR-497 UF: 5′-TTTGATTTAGGGAGAGGAAGGAT-3′ MiR-497 UR: 5′-AAACAAACAACTAAAAAACAACAAA-3′ mTOR and p70S6K1 3′-UTR regions containing predicted miR-497 binding sites and corresponding mutant sites were amplified by PCR from genomic DNA, and the PCR fragments were inserted into untranslated region (UTR) downstream of the luciferase gene in the pMIR-reporter luciferase vector (Ambion). [score:2]
MiR-497 overexpression dramatically reduced A2780/CP and S KOV3/CP cells resistance to cisplatin (Figure 3A). [score:2]
B. - E. Relative expression levels of Let-7e, Let-7i, miR-214, and miR-497 in A2780 and A2780/CP cells were determined by Taqman qRT-PCR assay, and normalized to the U6 levels. [score:2]
The expression levels of miR-497 were analyzed by Taqman qRT-PCR assay. [score:2]
F. Relative expression levels of miR-497 in S KOV3 and S KOV3/CP cells were determined by Taqman qRT-PCR assay, and normalized to the U6 levels. [score:2]
The expression levels of miRNAs were analyzed using Taqman MicroRNA Assay Kits (Applied Biosystems, Foster City, CA) specific for hsa-Let-7e, hsa-Let-7i, hsa-miR-214, hsa-miR-497 precursors, p70S6K1 and mTOR mRNAs. [score:2]
The MSP results showed that the methylation levels of miR-497 promoter regions in platinum resistant tumors were dramatically higher than those in platinum sensitive tumors (Figure 2E–2F). [score:1]
A. The figure shows the alignment of miR-497 putative binding sites in human mTOR and p70S6K1 3′-UTR regions. [score:1]
Applied cisplatin with miR-497 may help to reduce the rate of cisplatin-resistant ovarian cancer occurrence and improve the overall response rate to chemotherapy. [score:1]
E. - F. MSP analyses of miR-497 gene promoter in 14 different pairs of platinum-sensitive and platinum-resistant ovarian tumors. [score:1]
The molecular mechanism of cisplatin -induced hyper-methylation of miR-497 gene will be the focus of our future study. [score:1]
Figure 5 A. - B. The expression levels of mTOR and p70S6K1 in A2780, A2780/CP, S KOV3 and S KOV3/CP cells A. ; or in A2780/CP-Tet-ON-miR-497 or S KOV3/CP-Tet-ON-miR-497 cells exposed to Dox for 48 h B., were measured by Western blotting. [score:1]
Figure 2 A. MSP analyses of miR-497 gene promoter in A2780, A2780/CP, S KOV3 and S KOV3/CP cells. [score:1]
As shown in Figure 7B–7D, miR-497 and mTOR/p70S6K1 were inversely correlated in ovarian cancer tissues, while mTOR and p70S6K1 were positively correlated. [score:1]
To investigate the molecular mechanisms of how miR-497 decreases cisplatin resistance, we employed several well-developed miRNA algorithms, such as TargetScan, PicTar, and miRNA. [score:1]
To investigate the roles of miR-497 in cisplatin-resistant phonotype of ovarian cancer cells, we forced expression of miR-497 in A2780/CP and S KOV3/CP cells with low endogenous miR-497 levels by transfection of cells with miR-497 precursor or a control precursor (miR-NS). [score:1]
The levels of miR-497 were significantly higher and the levels of mTOR and p70S6K1 were dramatically lower in A2780/CP-Tet-ON-miR-497 formed tumors than those in A2780/CP-Tet-ON-miR-NS formed tumors (Figure 6E–6F). [score:1]
We found that miR-497 levels were significant lower in platinum sensitive tumors compared with platinum resistant tumors (Figure 1G), indicating that miR-497 may play an important role in the development of cisplatin resistance in ovarian cancer. [score:1]
The methylation of miR-497 promoter in the cells was analyzed using MSP. [score:1]
To study the impact of miR-497 in ovarian cancer tumor resistance to cisplatin treatment in vivo, we employed an orthotopic ovarian tumor mo del and a Tet-On inducible miR-497 system. [score:1]
The purified fragments were inserted into pTRE3G plasmid to obtain pTRE3G-miR-497 or pTRE3G-miR-NS plasmid. [score:1]
Based on our previously studies [28, 29], we identified miR-497 as a new miRNA involved in cisplatin sensitivity. [score:1]
A. MSP analyses of miR-497 gene promoter in A2780, A2780/CP, S KOV3 and S KOV3/CP cells. [score:1]
G. - H. Spearman's rank correlation analysis revealed an inverse correlation between miR-497 and mTOR levels (R = −0.526, P = 0.001), and p70S6K1(R = −0.594, P = 0.001) exists in our ovarian cancer tumor samples. [score:1]
Then cells were transfected with pTRE3G-miR-497 or pTRE3G-miR-NS and were selected by puromycin. [score:1]
C. A2780/CP-Tet-ON-miR-497 or S KOV3/CP-Tet-ON-miR-497 cells were exposed to Dox for 48 h and treated with cisplatin for 72 h. The cells viability rate was analyzed by. [score:1]
Furthermore, spearman's rank correlation analysis revealed an inverse correlation between miR-497 and mTOR, and p70S6K1 exists in our ovarian cancer samples (Figure 7G–7H). [score:1]
Luciferase reporter plasmid, β-galactosidase (β-gal) plasmid, and pre-miR-497 and negative control precursors were cotransfected into cells using Lipofectamine 2000 (Invitrogen). [score:1]
Figure 4 A. The figure shows the alignment of miR-497 putative binding sites in human mTOR and p70S6K1 3′-UTR regions. [score:1]
E. - H. A2780/CP-Tet-ON-miR-497 or S KOV3/CP-Tet-ON-miR-497 cells were maintained in the medium with or without Dox and were infected using lentivirus carrying Scr, mTOR or p70S6K1 for 48 h. Then the cells were treated with cisplatin for 72 h before. [score:1]
The objective of this study was to reveal the molecular mechanisms of miR-497 in cisplatin-resistant ovarian cancer. [score:1]
We next analyzed miR-497 promoter methylation status in 28 ovarian cancer samples. [score:1]
A. - B. The expression levels of mTOR and p70S6K1 in A2780, A2780/CP, S KOV3 and S KOV3/CP cells A. ; or in A2780/CP-Tet-ON-miR-497 or S KOV3/CP-Tet-ON-miR-497 cells exposed to Dox for 48 h B., were measured by Western blotting. [score:1]
As shown in Figure 6B–6D, tumor weights and volume in the miR-497 + cisplatin group were smaller than those in the miR-NS + cisplatin group. [score:1]
A2780/CP-Tet-On-miR-NS or A2780/CP-Tet-On-miR-497 cells (1×10 [6]) were injected into the ovarian capsule via sterile microsyringe. [score:1]
Pri-miR-497 and miR-497 expression levels were measured by qRT-PCR. [score:1]
Then cells were transfected with pTRE3G-miR-497 or pTRE3G-miR-NS plasmid. [score:1]
C. miR-497 levels were inversely correlated to p70S6K1 levels in human ovarian cancer (R = −0.09128, P = 0.043). [score:1]
[1 to 20 of 109 sentences]
3
[+] score: 321
Other miRNAs from this paper: hsa-mir-22, hsa-mir-143
Then, we will investigate: (1) what is the role of miR-497 in CRC cell growth, migration and invasion; (2) what is specific direct target of miR-497 that is associated with cancer development; and (3) whether forced miR-497 expression inhibits cell growth, migration and invasion via this direct target; (4) whether miR-497 and its target are responsible for the resistance to 5-fluorouracil treatment in CRC. [score:12]
As we expected, forced expression of KSR1 also restored miR-497 -inhibited cell proliferation, migration and invasion (Figures 4B– 4D), suggesting that miR-497 suppresses human CRC cell proliferation, migration and invasion by inhibiting its target KSR1. [score:11]
As shown in Figure 4A, forced expression of KSR1 rescued miR-497 -suppressed KSR1 expression and ERK activation, confirming the effect of KSR1 cDNA expression. [score:9]
To fully understand mechanism of miR-497 in inhibiting human CRC development, TargetScan search program was used to predict targets of miR-497. [score:8]
In addition, forced expression of miR-497 attenuated KSR1 protein expression and ERK activation, a known downstream molecule (Figure 3C), suggesting that miR-497 directly targets KSR1 by binding its seed region of the 3′-UTR region in human CRC cells. [score:8]
Immunohistochemistry (IHC) staining revealed that expression levels of CD31 and the quantitative microvascular density (MVD) were significantly decreased by miR-497 overexpression in tumor tissues (Figure 6D), demonstrating that miR-497 inhibits angiogenesis in xenografts. [score:7]
D. miR-497 overexpression decreased invasion of SW1116 cells, and overexpression of KSR1 reverses the inhibitory effects of miR-497. [score:7]
MiR-497 overexpression significantly suppressed tumor growth since the tumors trimmed out from miR-497 overexpressing group showed smaller size and lower tumor weight (Figures 6B and 6C). [score:7]
Furthermore, we also show that miR-497 acts as a tumor suppressor to inhibit cell growth, migration, invasion, and to diminish MAPK/ERK signaling pathway via targeting KSR. [score:7]
MiR-497 acts as a tumor suppressor to inhibit cell proliferation, migration, invasion, tumor growth and angiogenesis via targeting KSR1. [score:6]
KSR1 is a direct target of miR-497, and is elevated in CRC tissues, which is inversely correlated with miR-497 expression levels. [score:6]
KSR1 is a direct target of miR-497, and CRC tissues have higher KSR1 levels that are inversely correlated with miR-497 expression levels. [score:6]
MiR-497 overexpression suppresses tumorigenesis and decreases KSR1 expression in tumor tissues. [score:6]
To examine the role of miR-497 during carcinogenesis of human CRC, SW1116 cells with low expression levels of miR-497 were infected with lentivirus expressing miR-497 or negative control. [score:5]
Moreover, we found that compared with miR-497 or 5-fluorouracil treatment alone, the activities of caspase-3, a key executor of cell apoptosis, were significantly upregulated upon combination treatment of miR-497 and 5-fluorouracil, whereas forced expression of KSR1 attenuated the activation of caspase-3 during the treatment (Figure 5D). [score:5]
Taken together, these results suggest that miR-497 inhibits tumor growth and angiogenesis with decreased KSR1 expression in vivo. [score:5]
To test whether KSR1 overexpression reverses miR-497-inhibiting cell proliferation, migration and invasion, SW1116 cells were transfected with KSR1 cDNA without its 3′-UTR region. [score:5]
Loss of miR-497 expression has been reported in many cancer types, whereas restoration of miR-497 expression has been shown to abrogate tumorigenesis [14– 16]. [score:5]
Taqman RT-PCR analysis demonstrated miR-497 was highly expressed in SW1116/miR-497 cells, confirming that stable cell line over -expressing miR-497 was successfully established (Figure 2A). [score:5]
Thus, our results show that miR-497 is responsible for suppressing cell proliferation, migration and invasion, similarly as a tumor suppressor in CRC cells. [score:5]
In this study, we found that miR-497 expression was downregulated in CRC tumor samples compared with adjacent normal tissues. [score:5]
B. Relative expression levels of miR-497 in different stages of cancer tissues, * indicates significant difference at p < 0.05 when compared to miR-497 expression levels in Grades III-IV with those of Grades I; [#] indicates significant difference at p < 0.05 when compared miR-497 expression levels in Grades III-IV with those of Grades II. [score:5]
To compare miR-497 expression levels among different clinical stages, we found that its expression levels in tumor tissues were correlated with the clinical stages of CRC patients. [score:5]
Overexpression of KSR1 reverses miR-497 -mediated suppression of cell proliferation, migration and invasion. [score:5]
Overexpression of miR-497 inhibited cell proliferation, migration, invasion and increased chemosensitivity to 5-fluorouracil treatment. [score:5]
B. SW1116 cells stably expressing miR-NC, miR-497, or miR-497 in combination with KSR1 overexpression were treated with 4 μM of 5-fluorouracil for indicated time points. [score:5]
The expression levels of miR-497 in high grade tumors (WHO Grades III-IV) were significantly downregulated compared with those in low grade tumors (WHO Grade I and II) (Figure 1B and Table 1). [score:5]
In the present study, we demonstrated that miR-497 levels were downregulated in human CRC tumor specimens using 62 pairs of normal and cancer tissues. [score:4]
However, the role and molecular mechanism of downregulated miR-497 in CRC has not been fully determined. [score:4]
In our study, KSR1 oncogene has been experimentally validated as a novel direct target of miR-497 not only in vitro, but also in vivo. [score:4]
These results indicate that miR-497 renders CRC cells more sensitive to 5-fluorouracil treatment for inducing apoptosis through targeting KSR1. [score:3]
The correlations between miR-497 expression levels and clinical pathologic features in human CRC specimens were analyzed by Mann-Whitney test for 2 groups and by Kruskall-Wallis test for 3 groups. [score:3]
MiR-497 suppresses tumorigenesis in vivoIn order to test whether miR-497 inhibits tumor growth and angiogenesis of CRC in vivo, SW1116/miR-497 or SW1116/miR-NC cells were injected into both posterior flanks of immunodeficient mice, and tumor sizes were started to be measured after 2 weeks of injection. [score:3]
A. Relative expression levels of miR-497 in SW1116/miR-497 and SW1116/miR-NC stable cell lines were confirmed by Taqman RT-qPCR. [score:3]
Figure 1 A. Relative miR-497 expression levels were analyzed by Taqman RT-qPCR in 62 pairs of CRC specimens. [score:3]
C. Relative expression levels of miR-497 in different types of lymph node metastasis. [score:3]
E. Spearman's correlation analysis was used to determine the correlations between the expression levels of KSR1 and miR-497 in human CRC specimens. [score:3]
Next, we determine the correlation between KSR1 levels and miR-497 expression levels in the same human CRC specimens using Spearman's rank correlation analysis. [score:3]
Taken together, low expression levels of miR-497 in tumor tissues were closely related with advanced clinical stages and metastases, indicating that miR-497 levels may be a potential new biomarker for the diagnosis of CRC. [score:3]
To date, some genes have been identified as miR-497 target genes, including IGF-IR, eIF4E, SMURF1, Bcl2 and cyclin E1 [14, 17– 20], which are involved in pathogenesis of cancers. [score:3]
In this study, we found that forced expression of miR-497 increased the effect of 5-fluorouracil in inducing cellular apoptosis, indicating that miR-497 restoration may offer a new option to overcome chemoresistance to 5-fluorouracil treatment in CRC. [score:3]
Recent studies have reported that miR-497 functions as a tumor suppressor in several kinds of cancers [14– 20]. [score:3]
# indicates significant difference at p < 0.05 compared to miR-497 and KSR1 overexpression; [##] indicates significant difference at p < 0.01 compared to miR-497 and KSR1 overexpression. [score:3]
In addition, overexpression of miR-497 renders CRC cells more sensitive to 5-fluorouracil treatment, suggesting that miR-497 may be used as a combination therapy for CRC treatment in the future. [score:3]
In summary, we have identified that KSR1 is a novel target of miR-497. [score:3]
KSR1 was one of the putative targets of miR-497 (Figure 3A). [score:3]
Comparison of clinical patothologic factors and normalized expression of miR-497 in 62 pairs of CRC. [score:3]
To stably overexpress miR-497 in CRC cells, the lentiviral packaging kit was used (Thermo Fisher Scientific). [score:3]
MiR-497 levels are down-regulated in human colorectal cancer tissues. [score:3]
MiR-497 is down-regulated in human CRC specimens. [score:3]
MiR-497 regulates 5-fluorouracil chemosensitivity by targeting KSR1 in colorectal cancer cells. [score:3]
The correlations between miR-497 expression levels and KSR1 levels in human CRC tissues were analyzed using Spearman's rank test. [score:3]
As shown in Figure 3E, expression levels of KSR1 and miR-497 were inversely correlated in 62 human CRC specimens (Spearman's correlation r=-0.6407). [score:3]
To explore whether miR-497 targets KSR1 by binding to its 3′-UTR region, SW1116 cells were co -transfected with the wild type (WT) or mutant (Mut) KSR1 luciferase reporter in the presence of miR-497 or miR-NC. [score:3]
Our study highlights a key role of miR-497 in inhibiting CRC tumorigenesis. [score:3]
Figure 2 A. Relative expression levels of miR-497 in SW1116/miR-497 and SW1116/miR-NC stable cell lines were confirmed by Taqman RT-qPCR. [score:3]
To determine the expression levels of miR-497 in human CRC specimens, RT-qPCR analysis was performed in 62 pairs of tumor specimens and matched adjacent normal tissues. [score:3]
Furthermore, cell growth rate in the presence of 5-fluorouracil was assayed using CCK-8 proliferation assay at different time points, we found that forced expression of KSR1 resulted in more resistance to 5-fluorouracil treatment in miR-497 -overexpressing CRC cells (Figure 5B). [score:3]
Restoration of KSR1 reverses miR-497 -suppressed cell proliferation, migration and invasion. [score:3]
Among them, miR-497 has been demonstrated to function as a tumor suppressor. [score:3]
Our results showed that overexpression of miR-497 in SW1116 cells significantly increased chemosensitivity to 5-fluorouracil treatment (Figure 5A). [score:3]
The results showed that miR-497 expression levels in tumor tissues were significantly lower than those in adjacent normal ones (Figure 1A). [score:3]
The combination of miR-497 and 5-fluorouracil treatment significantly induced cellular apoptosis, whereas forced expression of KSR1 partially abolished the apoptotic effect induced by the combination of miR-497 and 5-fluorouracil treatments (Figure 5C). [score:3]
Consistent with in vitro data, levels of KSR1 and p-ERK1/2 in tumor tissues from miR-497 overexpression group were much lower than those of miR-NC group analyzed by immunoblotting assay (Figure 6E). [score:2]
MiR-497 renders CRC cells more sensitive to 5-fluorouracil treatment by targeting KSR1. [score:2]
A. SW1116 cells stably expressing miR-NC or miR-497 were treated with different concentrations of 5-fluorouracil for 48 h, and analyzed by CCK-8 Assay. [score:2]
[#] indicates significant difference at p < 0.05 compared to miR-497 and KSR1 overexpression. [score:2]
MiR-497 inhibits cell proliferation, migration and invasion. [score:2]
To further test whether miR-497 and its target KSR1 play a role in cellular apoptosis in the presence of 5-fluorouracil treatment, FACS analysis and caspase-3 assay were performed. [score:2]
MiR-497 overexpression showed lower tumor weight compared with miR-NC. [score:2]
* indicates significant difference at p < 0.05 when compared miR-497 expression levels in positive lymph node metastasis with those in negative ones. [score:2]
MiR-497 suppresses tumorigenesis in vivo. [score:2]
Figure 5 A. SW1116 cells stably expressing miR-NC or miR-497 were treated with different concentrations of 5-fluorouracil for 48 h, and analyzed by CCK-8 Assay. [score:2]
Figure 6 A. SW1116/miR-497 or SW1116/miR-NC cells (5 × 10 [6] cells) were dispersed in 100 μL (l of serum-free RPMI 1640 medium, and subcutaneously injected into both sides of posterior flanks of the nude mice (n = 8). [score:1]
To further study the role of miRNA-497 in regulating cell proliferation, migration and invasion, we found that cell growth and migration were attenuated in SW1116/miR-497 cells compared with SW1116/miR-NC cells (Figures 2B and 2C). [score:1]
B. The reporter constructs containing the WT or MUT KSR1 3′ UTR regions were co -transfected with miR-NC or miR-497 and pRL-TK plasmids into SW1116 cells. [score:1]
Figure 4 A. SW1116 cells were co-tranfected with miR-497 or miR-NC, and with empty vector or KSR1 cDNA without 3′-UTR region. [score:1]
A. SW1116/miR-497 or SW1116/miR-NC cells (5 × 10 [6] cells) were dispersed in 100 μL (l of serum-free RPMI 1640 medium, and subcutaneously injected into both sides of posterior flanks of the nude mice (n = 8). [score:1]
Lentivirus carrying miR-497 or negative control (miR-NC) was packaged using HEK293T cells following the manufacturer's manual. [score:1]
Figure 3 A. The complementary pairings of miR-497 with KSR1 wild-type (WT) and mutant (MUT) 3′ UTR reporter constructs are shown. [score:1]
C. SW1116 cells were transfected with miR-497 or miR-NC plasmids as above. [score:1]
A. The complementary pairings of miR-497 with KSR1 wild-type (WT) and mutant (MUT) 3′ UTR reporter constructs are shown. [score:1]
In addition, miR-497 levels were markedly lower in the patients with lymph node metastases than those in the patients without lymph node metastases (Figure 1C and Table 1), which was consistent with the above result, since lymph node metastases commonly occurs in high grade tumors. [score:1]
SW1116 cells were seeded in a 24-well plate and co -transfected with the wild type or mutant reporter plasmid, pRL-TK plasmid, and miR-497 or miR-NC. [score:1]
A. SW1116 cells were co-tranfected with miR-497 or miR-NC, and with empty vector or KSR1 cDNA without 3′-UTR region. [score:1]
SW1116/miR-497 and SW1116/miR-NC cells were plated at a density of 5 × 10 [4] cells per well in the upper chamber without serum. [score:1]
B. SW1116/miR-497 and SW1116/miR-NC cells were plated 2000 cells per well in 96-well plates, and cell proliferation was determined using Cell Counting Kit-8 (CCK-8) to detect the absorbance at 450 nm every day. [score:1]
C. SW1116/miR-497 and SW1116/miR-NC cells were cultured to 90% confluence. [score:1]
B. SW1116/miR-497 cells produced smaller tumors than control 30 days after injection. [score:1]
SW1116 cells were infected by lentivirus carrying miR-497 or miR-NC in the presence of polybrene (Sigma-Aldrich) and selected by puromycin (Sigma-Aldrich) for two weeks to obtain SW1116/miR-497 and SW1116/miR-NC stable cell lines. [score:1]
After the selection by puromycin, stable cell lines termed as SW1116/miR-497 and SW1116/miR-NC were established. [score:1]
C. Average weights of tumors from SW1116/miR-497 and SW1116/miR-NC groups. [score:1]
In order to test whether miR-497 inhibits tumor growth and angiogenesis of CRC in vivo, SW1116/miR-497 or SW1116/miR-NC cells were injected into both posterior flanks of immunodeficient mice, and tumor sizes were started to be measured after 2 weeks of injection. [score:1]
[1 to 20 of 93 sentences]
4
[+] score: 311
The tumor weight inhibition rate of Hi-miR497/34a (75.47%) was greater than the total inhibition rate (65.33%) induced by Hi-miR497 and Hi-miR-34a, whereas the tumor volume inhibition rate of Hi-miR497/34a was comparable to the total inhibition rate of Hi-miR497 and Hi-miR-34a. [score:9]
Chek1 (putative target of miR-497 identified by the algorithm DIANA miRPath v. 2.0), cdc25a (miR-497) [55], and cdk6 (miR-497and miR-34a) [55, 56] are involved in the indirect or direct regulation of the cyclin E1 downstream genes cdk2, RB and E2f3 (target for miR-34a, [33, 57]). [score:8]
In our previous study [17], we reported that an antitumor agent, resveratrol, upregulates the expression of several miRNAs (including miR-497 and miR-34a), and thus might inhibit the proliferation of lung cancer cells. [score:8]
Downregulation of the expression of miR-34a (Figure S1a) or miR-497 (Figure S1b) with inhibitors had no effect on the growth of A549, H460, and H1299 cells (Figure S1c) because the endogenous levels of these miRNAs in these cells are low. [score:8]
Our results indicated that miR-497 and miR-34a synergistically inhibit cell proliferation, predominantly by repressing the expression of their cotarget, CCNE1. [score:7]
Knockdown of CCNE1 significantly inhibited cell viability and G [0]/G [1] arrest in A549 cells, whereas miR-497 or miR-34a overexpression did not enhance the effect of CCNE1 knockdown (Figure 4b and 4c). [score:7]
In conclusion, we showed that miR-497 and miR-34a act cooperatively to regulate certain aspects of tumorigenesis, including the growth of lung cancer cell lines, especially through their cooperative effect on the downregulation of cyclin E1 expression. [score:7]
Our data indicated that the tumor-suppressive miR-34a and miR-497 could co-inhibit cyclin E1, suggesting that cyclin E1 is a key target mediating the anti-tumor effect of miR-34a and miR-497 in lung cancer. [score:7]
These and our results, together with the strong possibility that more miR-497 or miR-34a targets will be discovered soon, suggest that these two miRNAs regulate proliferation-related mRNAs (including CCNE1), and thus function as tumor suppressors. [score:6]
First, expression plasmids transiently expressing miR-497 (Hi-miR497), miR-34a (Hi-miR-34a), and a plasmid coexpressing miR-497 and miR-34a (Hi-miR497/34a) were constructed and verified by DNA sequencing and a TaqMan [®] MicroRNA Assay (Figure S4). [score:6]
miR-34a is downregulated in lung cancer tissues and cells [23, 24]; however, few reports have examined the expression of miR-497 in lung cancer. [score:6]
This indicates that the negative correlation between cyclin E1 expression and miR-497 or miR-34a levels is due to post-transcriptional modulation of cyclin E1 expression. [score:5]
Previous studies showed that miR-34a targets the oncogenes CDK4, CDK6, CCND1, MET, and BCL2 [36, 43, 44], whereas miR-497 targets the oncogenes CCND2 and BCL2 [37, 45] in various types of cancer. [score:5]
Cells were transiently transfected with 50 nM miR-497 mimic, miR-34a mimic, miR-497 inhibitor, miR-34a inhibitor, CCNE1 siRNA (Qiagen, Germany), or siRNA negative control (NC siRNA; Qiagen) using Lipofectamine 2000 (Invitrogen). [score:5]
Three bioinformatics algorithms (Targetscan 5.0, RNAhybrid 2.1, and RNA22) predicted that miR-497 and miR-34a target CCNE1, which encodes the cyclin E1 protein. [score:5]
The proliferation inhibition rate of Hi-miR497/34a (55.99%) was almost the same as the total inhibition rate (54.82%) of Hi-miR497 and Hi-miR-34a at 72 h. The colony formation rate of cells transiently transfected with Hi-miR497, Hi-miR-34a, or Hi-miR497/34a decreased by 36.84 ± 7.02%, 41.23 ± 4.09%, or 64.04 ± 2.92% (Figure 5b). [score:5]
Several studies have demonstrated that miR-34a retards lung cancer cell growth or induces apoptosis by targeting TGFβR2 [23], Axl [27], Notch-1 [28], or HDM4 [29], whereas miR-497 does so by targeting HDGF [26] in lung cancer. [score:5]
This evidence collectively suggests that miR-497 and miR-34a inhibit cell growth and might function as tumor suppressors. [score:5]
The major finding of our study is that miR-497 and miR-34a synergistically inhibit the expression of the same gene, CCNE1, and the function of its encoded protein, cyclin E1, thereby impeding the growth of lung cancer cells. [score:5]
Here, we studied the function of miR-497 in lung cancer cells, and showed that miR-497 and miR-34a inhibit cell growth in vitro and in vivo, supporting our hypothesis that the two miRNAs function as tumor suppressors. [score:5]
MIR497 and MIR34A were then inserted individually into the pcDNA™6.2-GW/EmGFPmiR vector (Invitrogen) using the BLOCK-iT™ Pol II miR RNAi Expression Vector Kit (Invitrogen), to generate the expression constructs Hi-miR497 and Hi-miR34a, respectively. [score:5]
This suggests that the coexpression of miR-497 and miR-34a enhanced the effect of each individual miRNA on the modulation of cyclin E1 expression. [score:5]
The cell viability of A549, H460, and H1299 lung cancer cells was decreased by 66.71 ± 1.65%, 46.36 ± 1.96% and 72.10 ± 4.02 %, respectively, in response to miR-34a overexpression, and by 60.71 ± 4.63%, 74.94 ± 3.58%, and 73.71 ± 6.50%, respectively, in response to miR-497 overexpression (Figure 1b). [score:5]
Synergistic effects of miR-497 and miR-34a on cotargeting CCNE1A549 cells stably expressing cyclin E1 (designated Hi-CCNE1a) were generated (Figure S5). [score:5]
mt-CCNEδ contains two seven-base mutations in the miR-497 target regions (at nt 247–253 and nt 483–490 of the CCNE1 3′-UTR), completely abolishing its binding to miR-497. [score:4]
The protein encoded by CCNE1, a newly identified cotarget for miR-34a and miR-497, plays a key role in regulating the growth of lung cancer cells, and its effect is mediated by the cooperative action of the two miRNAs. [score:4]
The loss or deletion of chromosome 17p13.1 or 1p36 has been reported in various types of cancer, including lung cancer [31, 32], suggesting that the downregulation of miRNA-497 or miRNA-34a in these cancers arises from genomic DNA loss or deletion. [score:4]
CCNE1 knockdown affected the miR-497 and miR-34a induced inhibition of proliferation. [score:4]
mt-CCNEβ and mt-CCNEγ each contain one seven-base mutation in the miR-497 target region (at nt 247–253 or nt 483–490, respectively, in the CCNE1 3′-UTR), partly abolishing their binding to miR-497. [score:4]
Although miR-497 is downregulated in lung cancer [25, 26], its specific role remains to be determined. [score:4]
Because CCNE1 was identified as a direct target of miR-497 and miR-34a, we investigated whether the effects of miR-497 and miR-34a on cell proliferation were mediated by the modulation of CCNE1 expression. [score:4]
CCNE1 is a direct target of miR-497 and miR-34a. [score:4]
Son et al. reported that miR-497 is downregulated in lung cancer [25]; however, its role in lung cancer remains unclear. [score:4]
However, real-time quantitative polymerase chain reaction (real-time qPCR) showed no changes in CCNE1 mRNA levels in response to miR-497 or miR-34a upregulation (Figure S3c). [score:4]
Based on previous data, we designed a study to test the hypothesis that cyclin E1 expression is coregulated by miR-497 and miR-34a in lung cancer. [score:4]
miR-497 and miR-34a suppress colony formation and tumorigenesis. [score:3]
These results support the assumption that the effects of miR-497 and miR-34a on cell growth are mediated by its modulation of CCNE1 expression. [score:3]
The miR-497 target sequences at nt 223–254 and nt 467–492 of the CCNE1 3-UTR are highly conserved among nine species (Figure S2c). [score:3]
CCNE1 is a putative target of miR-497 and miR-34a. [score:3]
miR-497 and miR-34a act synergistically by cotargeting CCNE1. [score:3]
The average volume of tumors expressing Hi-miR497 (149.40 ± 17.84 mm [3]), Hi-miR-34a (190.80 ± 19.36 mm [3]), or Hi-miR497/34a (39.60 ± 14.32 mm [3]) was lower than that of the mock group (458.20 ± 30.64 mm [3]) (Figure 5c). [score:3]
The transfection mixtures contained 100 ng of plasmid and 50 nM synthetic mimic, inhibitor, Hi-miR497, Hi-miR34a, or Hi-miR497/34a. [score:3]
miR-34a, located at 1p36, has been extensively studied as a microtumor suppressor [33, 34], and miR-497, located at 17p13.1, is deleted in 93% of small-cell lung cancers [35]. [score:3]
Synergistic effects of miR-497 and miR-34a on cotargeting CCNE1. [score:3]
Hi-CCNE1-a cells transfected with Hi-miR497/34a expressed lower levels of cyclin E1 protein than those transfected with Hi-miR497 or Hi-miR34a (Figure 6a). [score:3]
Our study extends the results of others by showing that miR-34a and miR-497 cotarget CCNE1 in lung cancer cells. [score:3]
Several studies have reported that miR-497 and miR-34a are potential anticancer agents based on their ability to target oncogenes [24, 25, 36, 37]. [score:3]
Therefore, overexpression of CCNE1 abolished the growth retardation induced by miR497 and miR34a in A549 cells, and CCNE1 mediates the synergistic effects of miR-497 and miR-34a. [score:3]
Overexpression of miR-497 or miR-34a in A549, H460, and H1299 lung cancer cells by transfection with miR-497 or miR-34a mimics (Figure S3a and S3b) markedly reduced the levels of cyclin E1 protein (Figure 3a). [score:3]
Taken together, these data indicate that miR-497 and miR-34a cooperate in inhibiting tumor growth. [score:3]
Because CCNE1 is a cotarget of miR-497 and miR-34a, we examined whether the two miRNAs exert synergistic effects on cell growth. [score:3]
Two predicted target sequences for miR-497 were identified at nt 223–254 and nt 467–492 (Figure S2a). [score:3]
The 535-nt 3′ untranslated region (UTR) of CCNE1 was screened for complementarity to the seed sequences of miR-497 and miR-34a. [score:3]
The average weight of tumors expressing Hi-miR497 (456.00 ± 27.20 mg), Hi-miR-34a (554.00 ± 28.80 mg), or Hi-miR497/34a (184.00 ± 28.80) was lower than that of the mock group (750.00 ± 40.00 mg) after 5 weeks (Figure 5d). [score:3]
miR-497 and miR-34a inhibit the proliferation of human lung cancer cells. [score:3]
However, because the endogenous levels of miR-34a and miR-497 are low in A549 cells, transfection with miR-497 and miR-34a inhibitors did not affect the levels of luciferase activity (Figures 3d and 1f). [score:3]
To the best of our knowledge, this is the first study to demonstrate the cooperative effect of miR-497 and miR-34a, which belong to different miRNA families, on inhibiting cancer cell growth. [score:3]
Elevated levels of miR-497 or miR-34a inhibit cell proliferation. [score:3]
A549 cells were transfected with Hi-miR497, Hi-miR34a, Hi-miR497/34a, or inhibitors. [score:3]
miR-497 and -34a have a similar seed sequence, indicating that they might share similar functions; therefore, in the present study, these miRNAs were selected for the identification of potential targets and to explore their roles in lung cancer. [score:3]
Figure 1(a) The relative levels of miR-497 and miR-34a were determined with the TaqMan [®] MicroRNA Assay and are expressed as fold change after normalization to the internal control, U6BsnRNA. [score:2]
Analysis of the expression of miR-497 and miR-34a in lung cancer cells showed that the levels of miR-497 and miR-34a (Figure 1a) were reduced by 24.29 ± 2.50% and 9.43 ± 2.96% in A549, 16.11 ± 5.20% and 4.51 ± 0.34% in H460, 53.55 ± 9.28% and 18.25 ± 2.14% in H1299, 43.00 ± 15.46% and 87.01 ± 27.73% in H446, and 42.17 ± 4.26% and 32.04 ± 4.58% in QG56 lung cancer cells, respectively, compared to those in normal bronchial epithelial 16HBE cells. [score:2]
miR-497 and miR-34a synergistically retard cell growth. [score:1]
When the wt-CCNE plasmid was cotransfected with the miR-497 mimic, the luciferase activity was markedly reduced by 40.09 ± 1.99% (Figure 3f). [score:1]
Moreover, when either plasmid (mt-CCNEβ or mt-CCNEγ) with only one mutant site was cotransfected with the miR-497 mimic, the luciferase activity was slightly reduced, whereas cotransfection of the mt-CCNEδ plasmid, which contained two completely mutated binding sites, with the miR-497 mimic reversed the miR-497 induced reduction of luciferase activity (Figure 3f). [score:1]
control siRNA, control siRNA + miR-497 mimic vs. [score:1]
Therefore, miR-497 and miR-34a, with seed sequences 5′-AGCAGCA-3′ and 5′-GGCAGUG-3′, respectively, can bind to the same sequence (3′-UCGUCGU-5′) in the 3′ UTR of CCNE1; however, there are three-base variations between their seed regions. [score:1]
Figure 2Elevated levels of miR-497 and miR-34a retard cell growth in vitro and in vivo(a) Colony formation by A549 cells transfected with the miR-497 mimic or the miR-34a mimic was examined in soft agar. [score:1]
miRNA-497 and miRNA-34a are located on chromosomes 17p13.1 and 1p36, respectively. [score:1]
The effects of miR-497 (b) or miR-34a (c) on tumor formation were examined in a nude mouse xenograft mo del. [score:1]
Mean ± SD (#P < 0.01, Hi-miR497/34a vs. [score:1]
Cyclin E1 mediates the effects of miR-497 or miR-34a on cell growth. [score:1]
The Hi-miR497/34a -transfected cell treatment generated tumors with smaller volumes (c) and lower tumor weights (d), as determined at necropsy, than those of tumors generated with mock -transfected cells. [score:1]
Mean ± SD, n = 5 (#P < 0.01, Hi-miR497/34a vs. [score:1]
Although the sequence of the miR-34a seed region pairs with G:U complementarity at nt 247, 248, and 253 of the UTR, the seed regions of miR-497 (5′-AGCAGCA-3′) and miR-34a (5′-GGCAGUG-3′) are complementary to the same sequence at nt 247–253 (5′-UGCUGCU-3′) in the UTR. [score:1]
A549 cells transiently transfected with mock (empty plasmid), Hi-miR497, Hi-miR34a, or Hi-miR497/34a were inoculated s. c. into the bilateral inguino-abdominal flanks of nude mice. [score:1]
Cells transfected with miR-497/miR-34a formed fewer and smaller colonies than cells transfected with Hi-miR-34a or Hi-miR497 alone. [score:1]
Hi-miR497;#P < 0.01, at 72 and 96 h, Hi-miR497/34a vs. [score:1]
Mean ± SD, n = 3 (#P < 0.01 Hi-miR497/34a vs. [score:1]
This indicated that the average volume and average weight of tumors transfected with Hi-miR497/34a were lower than those in the other groups after 5 weeks. [score:1]
Typical histograms of the cell-cycle arrest induced by miR-497 or miR-34a in A549 cells are shown in Figure 1d. [score:1]
This suggests that the synergistic effects of miR-497 and miR-34a are correlated with the levels of cyclin E1. [score:1]
Hi-miR497, Hi-miR497/34a vs. [score:1]
However, when the mt-CCNEδ plasmid was cotransfected with Hi-miR497/34a, the luciferase activity did not differ from that of cells cotransfected with either Hi-miR497 or Hi-miR34a alone (Figure 6b). [score:1]
The viability of cells transiently transfected with Hi-miR497, Hi-miR-34a, or Hi-miR497/34a was reduced at 48, 72, and 96 h. At 72 h, cell viability decreased from 2.28 ± 0.17 in the mock group to 1.73 ± 0.17, 1.58 ± 0.09, or 1.0 ± 0.02 in cells transfected with Hi-miR497, Hi-miR-34a, or Hi-miR497/34a, respectively, indicating that the Hi-miR497/34a plasmid caused a more marked reduction in cell viability than the Hi-miR497 or Hi-miR-34a plasmids (Figure 5a). [score:1]
The bilateral inguino-abdominal flanks of nude mice were inoculated subcutaneously (s. c. ) with A549 cells transfected with normal control (NC) (left flank) or miR-497 (right flank) mimics or with NC (left flank) or miR-34a (right flank) mimics. [score:1]
The miR-497 -mimic -transfected or miR-34a -mimic -transfected cells generated tumors with smaller volumes and lower weights, as determined at necropsy, than those of tumors generated with NC -mimic -transfected cells in the contralateral flanks. [score:1]
Figure 5(a) The cell-growth curves for A549 cells transfected with Hi-miR497, Hi-miR-34a, or Hi-miR497/34a at 24, 48, 72, and 96 h. Means ± SD, n = 3 (*P < 0.05, at 48 h, Hi-miR497/34a vs. [score:1]
The effect of miR-497 or miR-34a on tumorigenicity was examined in vivo. [score:1]
To examine the interaction between miR-497 and CCNE1, the binding sites in CCNE1 were completely mutated, or mutated individually at each nucleotide (Figure 3e). [score:1]
Therefore, the combination of miR-34a and miR-497 could be superior to each individual miRNA in its ability to retard lung cancer cell growth to some extent. [score:1]
However, the relationship between miR-497 and miR-34a is complex and requires further research. [score:1]
At 5 weeks, the average volumes (588.39 ± 117.34 mm [3]) and weights (308.57 ± 26.53 mg) of tumors in groups of seven mice injected with cells transfected with miR-497 mimics were lower than those (1293.16 ± 198.57 mm [3] and 427.14 ± 365.31 mg) in the control group injected with the NC mimic (Figure 2b), while the average volumes (190.25 ± 67.79 mm [3]) and weights (72.86 ± 31.84 mg) of tumors in mice injected with cells transfected with miR-34a mimics were lower than those (913.14 ± 455.23 mm [3] and 287.20 ± 131.09 mg) in the control group injected with the NC mimic (Figure 2c). [score:1]
The bilateral inguinoabdominal flanks of nude mice were injected s. c. with NC -mimic -transfected A549 cells (left flank) and miR-497 -mimic -transfected A549 cells (right flank), or with NC -mimic transfected A549 cells (left flank) and miR-34a -mimic -transfected A549 cells (right flank). [score:1]
To confirm that CCNE1 is targeted by miR-497 and miR-34a, we investigated the effects of miR-497 and miR-34a on cyclin E1 levels by immunoblotting. [score:1]
Hi-miR497 or Hi-miR34a). [score:1]
Transfection with miR-497 or miR-34a mimics caused cell-cycle arrest at G [0]/G [1] phase in A549, H1299, and H460 lung cancer cells (Figure 1c). [score:1]
Hi-miR497/34a -transfected A549 cells were injected s. c. into the right inguino-abdominal flanks of nude mice. [score:1]
The cooperative effects of miR-497 and miR-34a on tumor formation were examined in a nude mouse xenograft mo del. [score:1]
Cotransfection of the wt-CCNE plasmid with Hi-miR497/34a reduced luciferase activity to a greater extent than cotransfection of wt-CCNE with Hi-miR497 or Hi-miR34a alone (Figure 6b). [score:1]
To investigate the cooperative activities of miR-497 and miR-34a, we used the isocaudomers BamHI (NEB, Beverly, MA) and BglII (NEB) to ligate both MIR497 and MIR34A into the vector to generate the expression construct Hi-miR497/34a, which was confirmed by DNA sequencing. [score:1]
The effect of miR-497 and miR-34a on the colony forming ability of A549 cells was assessed. [score:1]
Cells transfected with miR-497 or miR-34a mimics showed fewer (31.33 ± 2.44 and 21.00 ± 4.00 colonies per well, respectively) and smaller colonies than those observed in the control groups (71.00 ± 9.33 colonies per well) (Figure 2a). [score:1]
Elevated levels of miR-497 and miR-34a retard cell growth in vitro and in vivo. [score:1]
Synergistic effects of miR-497 and miR-34a on tumor growth retardation. [score:1]
Therefore, miR-497 and miR-34a share one binding site (nt 247–253) in the 3′-UTR of CCNE1. [score:1]
[1 to 20 of 106 sentences]
5
[+] score: 232
The expression of miR-497 in 26 cases of BC tissues was downregulated in comparison with that in corresponding noncancerous breast tissues, but the expression of miR-497 was upregulated in only 4 cases of BC tissues (Figure  1A). [score:11]
In previous study, type I insulin-like growth factor receptor (IGF-1R) was identified as a functional and direct target of miR-497 in colorectal cancer and cervical cancer [17, 18], and downregulation of miR-497 could lead to the overexpression of IGF-1R, which leads to malignant transformation and tumor development [41]. [score:10]
Then, we analyzed the correlation of miR-497 expression with prognosis of BC patients, and found that patients with high miR-497 expression showed better DFS and OS than those with low miR-497 expression. [score:7]
Thus, whether downregulation of miR-497 might lead to the activation of HER-2 by inducing upregulation of IGF-1R in human BC is unclear and remains to be elucidated in future studies. [score:7]
By analysis of the expression of 319 microRNAs in 9 primary human male breast tumors and in epithelial cells from 15 male gynecomastia specimens, Lehmann and his colleagues showed that miR-145 and miR-497 were identified as most prominently down-regulated in male BC [40]. [score:6]
By analysis of the genome-wide expression profiling of miRNAs, Yan and his colleagues showed that seven miRNAs of hsa-miR-497, hsa-miR-31, hsa-miR-355, hsa-miR-320, rno-mir-140, hsa-miR-127 and hsa-miR-30a-3p were significantly downregulated in BC [20]. [score:6]
It was observed that patients with low miR-497 expression showed poorer differentiation grade, higher incidence of lymph node metastasis and advanced clinical stage, suggesting that downregulation of miR-497 played an important role in BC progression. [score:6]
By statistical analyses, low miR-497 expression was observed to be closely correlated with higher differentiation grade, positive HER-2 expression, higher incidence of lymph node metastasis and advanced clinical stage. [score:5]
B. The 5-year OS of BC patients with high miR-497 expression was significantly higher than that of those patients with low miR-497 expression (P = 0.0018). [score:5]
The median value of miR-145 in all BC tissues was 1.46 and used as a cutoff value, and all patients were divided into two groups: high-miR-497 expression group (≥1.46; n = 74; mean ± SD: 2.04 ± 0.38) and low-miR-497 expression group (<1.46; n = 54; mean ± SD: 0.45 ± 0.28). [score:5]
Moreover, the 5-year OS of low-miR-497 expression group (57.3%) was significantly shorter than that of high-miR-497 expression group (71.2%; P = 0.0018) (Figure  2B). [score:5]
As shown in Figure  2A, the 5-year DFS of low-miR-497 expression group (60.4%) was significantly shorter than that of high-miR-497 expression group (81.2%; P = 0.0124). [score:5]
The expression of miRNA was defined based on the threshold cycle (Ct), and relative expression levels were calculated as 2 [-[(Ct of miR-497)-(Ct of U6)]] after normalization with reference to expression of U6 small nuclear RNA. [score:5]
Here, we first detect the expression of miR-497 in 30 pairs of BC and corresponding noncancerous breast tissues, and showed that the relative expression level of miR-497 in BC was significantly lower than that in noncancerous breast tissues. [score:5]
As shown in Table  2, it was observed that miR-497 expression, along with age, tumor size, differentiation grade, histological type, ER status, PR status, HER status, lymph node metastasis and clinical stage, was responsible for efficacy of surgical treatment in BC patient, by indicating that status of miR-497 expression was significantly correlated with DFS (P = 0.005) and OS (P = 0.036) of BC patients. [score:5]
A. The 5-year DFS of BC patients with high miR-497 expression was significantly higher than that of those patients with low miR-497 expression (P = 0.0124). [score:5]
As shown in Table  1, low miR-497 expression was observed to be closely correlated with higher differentiation grade, positive HER-2 expression, higher incidence of lymph node metastasis and advanced clinical stage (P = 0.005, 0.024, 0.001 and 0.010, respectively). [score:5]
Interestingly, low miR-497 expression was found to be correlated with positive HER-2 expression. [score:5]
Correlations of miR-497 expression with disease-free survival (DFS) and overall survival (OS) of BC patients. [score:5]
Our data provided the first evidence that downregulation of miR-497 was correlated with BC progression, and miR-497 might be a potential molecular biomarker for predicting the prognosis of patients. [score:4]
Abbreviations: HR hazard ratio, 95% CI, 95% confidence interval, ER estrogen receptor, PR progesterone receptor, HER-2 c-erbB-2. Table 3 Mulivariate analyses of different prognostic factors in BC patients  Disease-free survival Overall survival Variables HR (95% CI) P -value HR (95% CI) P -valueTumor size (cm)1.660 (0.875-1.914)0.1150.707 (0.680-1.188)0.073Differentiation grade1.146 (0.794-1.326)0.2041.522 (0.891-1.927)0.163Lymph node metastasis2.102 (1.377-2.456)0.009 [*]1.749 (1.087-2.514)0.011 [*]Clinical stage3.071 (2.318-3.549)0.021 [*]2.362 (1.693-2.720)0. 037 [*] MiR-497 expression 1.535 (1.127-2.337)0.016 [*] 2.123 (1.836-3.015)0.008 [*] [*] P < 0. [score:4]
These results indicated that downregulation of miR-497 might be correlated with poor survival of BC patients. [score:4]
Moreover, patients with high miR-497 expression had better 5-year disease-free and overall survival compared with the low miR-497 group (P = 0.0124 and 0.0018, respectively). [score:4]
Abbreviations: HR hazard ratio, 95% CI, 95% confidence interval, ER estrogen receptor, PR progesterone receptor, HER-2 c-erbB-2. Table 3 Mulivariate analyses of different prognostic factors in BC patients  Disease-free survival Overall survival Variables HR (95% CI) P -value HR (95% CI) P -valueTumor size (cm)1.660 (0.875-1.914)0.1150.707 (0.680-1.188)0.073Differentiation grade1.146 (0.794-1.326)0.2041.522 (0.891-1.927)0.163Lymph node metastasis2.102 (1.377-2.456)0.009 [*]1.749 (1.087-2.514)0.011 [*]Clinical stage3.071 (2.318-3.549)0.021 [*]2.362 (1.693-2.720)0. 037 [*] MiR-497 expression 1.535 (1.127-2.337)0.016 [*] 2.123 (1.836-3.015)0.008 [*] [*] P < 0. [score:4]
Here, the focus is on miR-497, which has been reported to be downregulated in a variety of malignant tumors, including cervical cancer, colorectal cancer, and prostate cancer [17- 19]. [score:4]
Our data showed that miR-497 was significantly downregulated in BC tissues and could be served as a potential molecular biomarker for the prediction of poor prognosis. [score:4]
Taken together, the current study indicates that miR-497 is downregulated in BC tissues and might be an independent molecular biomarker for predicting the prognosis of BC patients. [score:4]
Our data indicated that the relative level of miR-497 expression in BC tissues was significantly lower than that in corresponding noncancerous breast tissues (P = 0.0046). [score:3]
Correlations of miR-497 expression with clinicopathologic features of BC patients. [score:3]
It was shown that miR-497 expression was an independent molecular biomarker for the predicting of DFS (HR: 1.535, 95% CI: 1.127-2.337, P = 0.016) and OS (HR: 2.123, 95% CI: 1.836-3.015, P = 0.008) in BC patients (Table  3). [score:3]
Moreover, the correlations of miR-497 expression with clinicopathologic features of BC patients were statistically analyzed. [score:3]
B. The mean expression level of miR-497 in BC tissues was significantly lower than that in corresponding noncancerous breast tissues (P = 0.0046). [score:3]
However, the status of miR-497 expression in female BC and its prognostic roles are unclear. [score:3]
Univariate and multivariate analyses indicated that low miR-497 expression was an independent poor prognostic factor for BC patients. [score:3]
Taqman quantitative reverse transcription (qRT)-PCR detection of miR-497 expression. [score:3]
More importantly, both the univariate and multivariate survival analyses demonstrated that low miR-497 expression was correlated with shorter OS and DFS in BC, which was also consistent with the prognostic significance of miR-497 in other human malignancies, such as cervical cancer and neuroblastoma. [score:3]
Meanwhile, it was also reported that miR-497 could modulate multidrug resistance of human cancer cell lines by targeting Bcl-2 [39]. [score:3]
In human cervical cancer, low miR-497 expression appeared to be an unfavorable prognostic factor for patients [17]. [score:3]
However, there were no significant correlations between miR-497 expression and other clinicopathologic factors including age, tumor size, histological type, ER and PR status (P = 0.204, 0.777, 0.078, 0.590 and 0.598, respectively). [score:3]
Additionally, Shen’ et al. reported that miR-497 could induce apoptosis of breast cancer cells by targeting Bcl-w [21]. [score:3]
MiR-497 was remarkably downregulated in human BC tissues. [score:3]
Univariate and multivariate analyses were performed using the Cox proportional hazards mo del to analyze the prognostic significance of miR-497 expression. [score:3]
A. qRT-PCR was performed to respectively detect the relative miR-497 expression in 30 pairs of BC and corresponding noncancerous breast tissues. [score:3]
Our results indicated that status of miR-497 expression in tissues was significantly correlated with tissue differentiation grade, HER-2 status, incidence of lymph node metastasis and clinical stage of BC patients. [score:3]
It was shown that the mean expression level of miR-497 in BC tissues (mean ± SD: 1.23 ± 0.63) was remarkably lower than that in noncancerous breast tissues (mean ± SD: 2.89 ± 0.34; P = 0.0046; Figure  1B). [score:3]
First, as the number of patients in this study is smaller, a larger case population is needed to confirm the prognostic value of miR-497 expression in BC. [score:3]
Figure 1 Taqman qRT-PCR detection of relative miR-497 expression in tissue samples. [score:3]
Then, we detected the expression of miR-497 in another 128 cases of BC tissues and analyzed its clinicopathologic and prognostic significance. [score:3]
Then, the correlations of miR-497 expression with clinicopathologic features of patients were statistically analyzed. [score:3]
These results indicated that miR-497 might be an important modulator involved in BC development. [score:2]
MiR-497, identified from the microRNA cluster site at chromosome 17p13.1, has been reported to function as a tumor suppressor in a variety of human cancers, including non-small cell lung cancer, hepatocelluar cancer, neroblastoma, colorectal cancer and breast cancer [18, 21, 36- 38]. [score:2]
The cDNA was synthesized from 5 ng of total RNA by using the Taqman miRNA reverse transcription kit (Applied Biosystems, Foster City, CA), and the expression levels of miR-497 were quantified by using miRNA-specific TaqMan MiRNA Assay Kit (Applied Biosystems). [score:2]
In the present study, qRT-PCR assay was performed to detect the expression of miR-497 in BC and corresponding noncancerous breast tissues. [score:2]
Taqman qRT-PCR assay was performed to detect the expression of miR-497 in 30 pairs of BC and corresponding noncancerous breast tissues. [score:2]
To further investigate the correlations of miR-497 with various clinicopathologic features of BC patients, the relative expression of miR-497 was determined in another 128 cases of BC tissue samples. [score:1]
However, the prognostic significance of miR-497 in BC is not fully understood. [score:1]
The aim of this study was to investigate the clinicopathologic and prognostic significance of miR-497 expression in human breast cancer (BC). [score:1]
Finally, further investigation of the cell biology of miR-497 and its potential as a therapeutic target in BC are clearly warranted. [score:1]
The Chi-squared test was used to investigate the significance of miR-497 expression as correlated with clinicopathologic features in BC. [score:1]
Thus, the aim of this study was to investigate the correlations of miR-497 expression with clinicopathologic features and prognosis of BC patients. [score:1]
Finally, we determined the potential role of miR-497 in BC prognostic prediction. [score:1]
Of 128 BC patients, 74 (57.8%) were placed in the high-miR-497 group and 54 (42.2%) were placed in the low-miR-497 group. [score:1]
Furthermore, multivariate analyses were performed to evaluate those clinicopathogic features significant in univariate analyses (tumor size, differentiation grade, lymph node metastasis, clinical stage and status of miR-497 expression). [score:1]
Next, univariate analyses were performed to evaluate the expression of miR-497 and other clinicopathologic features on prognosis of BC patients. [score:1]
To further investigate the correlation of miR-497 expression with survival of BC patients, Kaplan-Meier analyses were performed. [score:1]
[1 to 20 of 65 sentences]
6
[+] score: 220
Other miRNAs from this paper: hsa-mir-15a, hsa-mir-107, hsa-mir-204, hsa-mir-206
We also found that miR-497 overexpression could inhibit BDNF expression, and inhibited its downstream signal pathways (PI3K/AKT) in vitro and in vivo. [score:9]
BDNF expressionis upregulated, and inversely correlated with miR-497 expression in NSCLC tissues. [score:8]
Restoration expression of miR-497 significantly inhibited cell proliferation, colony formation, migration, invasion, and suppressed tumor growth in nude mice. [score:7]
These results show that miR-497 inhibits thyroid cancer by suppressing BDNF, suggesting that miR-497 is a potential therapeutic target for thyroid cancer. [score:7]
Forced expression of BDNF rescued miR-497 -suppressed BDNF expression on the mRNA level and protein level (Figure 5A, 5B). [score:7]
To identify the target genes of miR-497, three bioinformatic databases (TargetScan, miRanda, and PicTar) were used to predict gene targets for miR-497. [score:7]
To fully understand the mechanism of miR-497 in inhibiting human thyroid cancer progression, three bioinformatic databases (TargetScan, miRanda, and PicTar) were used to predict miR-497 targets. [score:7]
miR-497 expression is downregulated in human thyroid cancer tissues. [score:6]
However, recently two reports reveal that miR-497 expression is upregulated, and functions as an oncogene, in glioma [20] and colorectal cancer [21]. [score:6]
Moreover, BDNF expression was upregulated, and inversely correlated with miR-497 in thyroid cancer tissues. [score:6]
qRT-PCR analysis confirmed that miR-497 expression was upregulated in cells transfected with miR-497 mimic compared to cells transfected with miR-NC (Figure 2A). [score:5]
To test the functional relevance of miR-497 suppressing BDNF in thyroid cancer, we generated a BDNF overexpressing vector, and transfected it into TPC-1 cells. [score:5]
Forced expression of miR-497 decreased BDNF expression on both the mRNA level and protein level (Figure 3C, 3D). [score:5]
We found that miR-497 overexpression inhibited cell proliferation, colony formation, migration, and invasion of TPC-1 cells (Figure 2B–2E). [score:5]
Here, we found that miR-497 expression was downregulated in thyroid cancer samples compared with adjacent normal tissues. [score:5]
Figure 5(A, B) BDNF expression on mRNA level (A) and protein level(B) was determined in TPC-1 cells transfected with miR-497 mimic with/without BDNF overexpression plasmid. [score:5]
In addition, miR-497 overexpression also decreased p-PI3K and p-AKT expression, which are known downstream molecules of BDNF (Figure 3D). [score:5]
Importantly, forced expression of BDNF also restored miR-497 -inhibited cell proliferation, colony formation, migration, and invasion of thyroid cancer cells (Figure 5C–5F). [score:5]
BDNF is directly suppressed by miR-497 in thyroid cancers cells. [score:4]
miR-497 is downregulated in human thyroid cancer specimens. [score:4]
To examine the role of miR-497 in thyroid cancer development, TPC-1 cells with low miR-497 expression were transfected with miR-497 mimic or miR-Negative Control (miR-NC). [score:4]
These results suggested that miR-497 directly suppresses BDNF by binding its seed region of the 3′-UTR region in human thyroid cancer cells. [score:4]
BDNF is directly suppressed by miR-497 in thyroid cancer cells. [score:4]
Restoration of BDNF effectively reversed the tumor-suppressive functions of miR-497 on thyroid cancer cell proliferation, colony formation, migration, and invasion. [score:3]
These results suggested that miR-497 inhibits tumorigenicity in thyroid cancer. [score:3]
These data indicate that miR-497 suppresses thyroid cancer tumorigenicity in vivo by repressing BDNF. [score:3]
miR-497 inhibits thyroid cancer cell proliferation, migration, and invasion. [score:3]
BDNF has an inverse correlation with miR-497 expression in thyroid cancer. [score:3]
The expression of miR-497 was inversely correlated with BDNF mRNA levels in the 48 patients with thyroid cancer (r = −0.651; p < 0.001) (Figure 4C). [score:3]
These results suggest miR-497 inhibits thyroid cancer by repressing BDNF. [score:3]
Focusing on genes that promoted tumor progression and metastasis, BDNF was selected as a putative miR-497 target based on a sequence at 300–306 bp (Figure 3A). [score:3]
In advanced clinical stages (TNM stage III-IV),miR-497 levels were downregulated compared with those in low clinical stages(TNM stage I and II) (Figure 1B). [score:3]
miR-497 and BDNF and its downstream protein expression were determined in tumor tissues by qRT-PCR and western blot, respectively. [score:3]
miR-497 suppresses thyroid cancer tumorigenicity in vivo by repressing BDNF. [score:3]
To explore whether miR-497 targets BDNF by binding to its 3′-UTR region, TPC-1 cells were co -transfected with the wild type (WT) or mutant-type (MUT) BDNF luciferase reporter plasmid, and miR-497 mimic or miR-NC. [score:3]
Association between miR-497 expression and clinicopathological features of human thyroid cancer. [score:3]
Restoration of BDNF reverses miR-497 -suppressed cell proliferation, colony formation, migration, and invasion of thyroid cancer cells. [score:3]
The miR-497 overexpression group displayed smaller size and lower weight tumors than that of the miR-NC group (Figure 6B, 6C). [score:3]
miR-497 expression was negatively associated with advanced clinical stage and lymph node metastasis. [score:3]
Levels of miR-497 in thyroid cancer tissues were downregulated compared to adjacent normal tissues (Figure 1A). [score:3]
miR-497, a highly conserved miRNA encoded by the first intron of the MIR497HG (Gene ID: 100506755) gene on human chromosome 17p13.1 [12], is a tumor suppressor in multiple cancers [13– 19]. [score:3]
miR-497 inhibits cell proliferation, colony formation, migration and invasion of thyroid cancer cells. [score:3]
Restoration of BDNF reversed the tumor suppressive effect of miR-497 in thyroid cancer. [score:3]
Next, we determined the correlation between BDNF mRNA levels and miR-497 expression in the same human thyroid cancer specimens using Spearman's rank correlation analysis. [score:3]
These results suggested that miR-497 acts as a tumor suppressor in thyroid cancer cells. [score:3]
Here, we confirmed that BDNF is suppressed by miR-497 in thyroid cancer by luciferase activity assay, qRT-PCR, and western blot. [score:2]
These inconsistent findings indicate that dysregulation of miR-497 may play diverse roles in different cancers depending on the detail tumor type and the cellular microenvironment [22]. [score:2]
We also found that levels of p-PI3K and p-AKT in tumor tissues from the miR-497 overexpression group were decreased compared to the miR-NC group (Figure 6F). [score:2]
For the dual-luciferase assay, 3′-untranslated region (3′-UTR) regions of BDNF containing predicted miR-497 seed-matching sites and corresponding mutant sites were amplified by PCR using human cDNA template. [score:2]
miR-497 expression was increased in the miR-497 group compared to the miR-NC group (Figure 6D), while BDNF mRNA and protein levels were decreased (Figure 6E, 6F). [score:2]
Tumor growth was lower in the miR-497 group from Day 20 to Day 35 than that of the miR-NC group (Figure 6A). [score:1]
TPC-1 cells were seeded in a 24-well plate and co -transfected with wild-type(WT) or mutant-type(MUT) 3′-UTR of BDNF reported plasmid, miR-497 mimic or miR-NC, and pRL-TK plasmid. [score:1]
After being grown to 70~80% confluence, cells were transfected with miR-497 mimic (UGUUUGGUGUCACACGACGAC) (Gene Pharma Co. [score:1]
Figure 3(A) The complementary pairings of miR-497 with BDNF wild-type (WT) and mutant (MUT) 3′-UTR reporter constructs. [score:1]
2 × 10 [6] TPC-1 cells transfected with miR-497 mimic or miR-NC were harvested, washed, and re-suspended in 100 μl of serum-free DMEM medium. [score:1]
We found that miR-497 levels in tumor tissues were correlated with clinical stages and lymph node metastasis, but not with age, gender, or tumor size (Table 1). [score:1]
To determine miR-497 levels in human thyroid cancer specimens, qRT-PCR analysis was performed in 48 pairs of thyroid cancer tumor specimens and matched adjacent normal tissues. [score:1]
To examine miR-497's role in thyroid cancer tumorigenicity in vivo, TPC-1 cells transfected with miR-497 mimic or miR-NC were harvested, and then injected into nude mice. [score:1]
miR-497 expression was detected using the TaqMan MicroRNA assay Kit (Applied Biosystems, Foster City, CA, USA), with an ABI7900 real-time PCR system (Applied Biosystems), using miR-497 and U6 primers (Applied Biosystems). [score:1]
The correlations between miR-497 levels and BDNF mRNA levels were analyzed using Spearman's rank test. [score:1]
Figure 1(A) Relative miR-497 levels were determined in 48 pairs of thyroid cancer specimens and corresponding adjacent normal tissues. [score:1]
We also determined miR-497 and BDNF levels in the tumor tissues. [score:1]
Luciferase activities were reduced in the cells cotransfected with the WT-BDNF reporter plasmid and miR-497 mimic, but not in the cells cotransfected with the MUT-BDNF reporter plasmid and miR-497 mimic (Figure 3B). [score:1]
Figure 6(A) Growth curves for tumor volumes in xenografts of nude mice from the TPC-1/miR-497 and TPC-1/miR-NC groups. [score:1]
[1 to 20 of 64 sentences]
7
[+] score: 213
We identified 3 significantly down-regulated miRNAs (miR-378-3p, miR-483-5p and miR-497-5p) and 1 up-regulated miRNA (miR-222-3p) (Figure 1B), which had > 2-fold differences of expression levels between angiosarcoma and hemangioma (Figure 1B). [score:9]
miR-497 inhibits ISO-HAS cell proliferation and invasion in vitro by down-regulation of KCa3.1We observed that miR-497-5p targeted KCa3.1, and KCa3.1 played an important role in controlling ISO-HAS cell proliferation and invasion. [score:8]
After transfecting ISO-HAS cells with miR-497-5p mimics, expression of KCa3.1 was significantly inhibited, and CCK8 assay revealed that the proliferation of ISO-HAS cells overexpressed with miR-497-5p was mildly suppressed by around 20% (Figure 6A). [score:8]
Among the target genes predicted by bioinformatic software, quite a few potassium channels are listed, and KCa3.1, a potential target gene of miR497-5p, showed highest mRNA expression in human angiosarcoma tissue in our preliminary RT-PCR experiment. [score:7]
We have suggested that miR-497-5p targeted KCa3.1 and exhibited a tumor suppressive effect by inhibiting angiosarcoma cell proliferation and invasion. [score:7]
However, in the in vivo experiment, miR-497-5p strongly inhibited tumor development similar to TRAM-34, possibly because miR-497-5p may have restricted tumor development by strongly inhibiting tumor cell invasion to the surrounding tissue and decreasing cell proliferation. [score:7]
Consistent with findings in other cancer cells, suppression of KCa3.1 by application of TRAM-34 or or up -regulating miR-497-5p strongly inhibited angiosarcoma cell proliferation by down -regulating cyclinD1, survivin and P53 and retaining cells in G0/G1 phase (Figure 4). [score:7]
This finding was confirmed by the down-regulated expression of KCa3.1 at mRNA and protein levels in ISO-HAS cells transfected with miR-497-5p mimics (Figure 3D–3F). [score:6]
miR-497 inhibits ISO-HAS cell proliferation and invasion in vitro by down-regulation of KCa3.1. [score:6]
miR-497-5p inhibited ISO-HAS cell proliferation and invasion by down-regulation of KCa3.1. [score:6]
KCa3.1 blockade or miR-497-5p overexpression suppressed the development of angiosarcoma tumors in nude mice. [score:6]
Therefore, we suggested that miR-497-5p negatively regulated the gene expression of KCa3.1 by targeting KCa3.1 mRNA for cleavage. [score:6]
By application of 500 nM of 1-EBIO, an KCa3.1 channel activator, the inhibition of miR-497-5p mimics on cell proliferation, cell cycle, and cell invasion were partially restored by up -regulating KCa3.1 expression (Figure 6A–6C). [score:6]
To determine whether mir-497-5p directly targets KCa3.1 in angiosarcoma, we first studied the expression of miR497-5p and KCa3.1 in tumor cell lines and primary endothelial cells, including ISO-HAS angiosarcoma cells, human hemangioma endothelial cells (hHVECs), human microvascular endothelial cells (hMVECs), and human umbilical vein endothelial cells (hVECs). [score:6]
We observed that expression of miR-497-5p was significantly down-regulated in human ISO-HAS cells compared with HVECs, hMVECs, or hVECs (Figure 2D, left panel). [score:5]
The relative expression levels of miR497-5p and KCa3.1 mRNAs were normalized to human U6 small nuclear RNA and human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and expressed as mean ± standard deviation (SD). [score:5]
Among these miRNAs, miR-497 is down-regulated in breast, gastric, and colorectal cancer and promotes cell proliferation and invasion by up -regulating raf-1/Ccnd1, EIF4E, and insulin growth factor 1 receptor in breast, gastric, and colorectal cancer [21– 23]. [score:5]
Blocking KCa3.1 channels or up -regulating miR-497-5p suppressed development of tumors in nude mice. [score:5]
Using the transfection reagent (Lipofectamine 2000, Invitrogen) plasmid expressing 3′-UTR KCa3.1 or 3′-UTR Mut KCa3.1 constructs and miR-497-5p mimics (Ribo, Guangzhou, China) or non -targeting miR-497-5p (Ribo, Guangzhou, China) or empty vehicles were cotransfected into cultured 293T cells. [score:5]
Ectopic expression of miR-497-5p in 293T cells significantly inhibited luciferase activity in the cells transfected with the 3′-UTR KCa3.1 reporter vector, but it did not change luciferase activity in cells transfected with the 3′-UTR Mut KCa3.1 reporter vector (Figure 3A–3C). [score:5]
In addition, forced expression of miR-497-5p suppressed angiosarcoma cell proliferation, blocked cell cycle progression, and reduced cell invasion (Figure 6). [score:5]
We observed that inducing miR-497-5p mimics into angiosarcoma cells resulted in strong inhibition of cell invasion, but only mild reduction of cell proliferation, which is different from the inhibitory effects of TRAM-34 on proliferation and invasion of angiosarcoma cells. [score:5]
We observed that miR-497-5p (previously known as miR-497) was down-regulated in angiosarcoma. [score:4]
miR-497-5p regulates KCa3.1 expression in angiosarcoma cells. [score:4]
In this study, we showed that KCa3.1 is important for angiosarcoma cell invasion because inhibiting KCa3.1 channel with TRAM-34 or up -regulating miR-497-5p reduced the cell migration through a matrix gel (Figure 5). [score:4]
The present study provided evidence that miR-497-5p targeting KCa3.1 is strongly associated with malignancy development of human angiosarcoma. [score:4]
A possible explanation for this observation is that KCa3.1 channels might be regulated by other molecules or signal pathways that have not yet been identified, or miR-497-5p may have other targets that are involved in tumor malignancy. [score:4]
Flow cytometry showed that up-regulation of miR-497-5p retained 10% more ISO-HAS cells in G0/G1 phase and reduced the cell numbers in S phase (Figure 6B). [score:4]
This suggests that miR-497-5p is a suppressor of angiosarcoma, as reported in other cancers. [score:3]
We predicted and confirmed that KCa3.1 is a novel target of miR497-5p (Figure 3). [score:3]
We observed that miR-497-5p targeted KCa3.1, and KCa3.1 played an important role in controlling ISO-HAS cell proliferation and invasion. [score:3]
Therefore, miR-497-5p showed antiproliferative and anti-invasive effects, probably mediated through targeting KCa3.1. [score:3]
Luciferase reporter assay was performed to verify whether KCa3.1 is the direct target of miR-497-5p. [score:3]
These results suggested that miR-497-5p was bound complementarily to 3′-UTR KCa3.1, and thus inhibited luciferase activity. [score:3]
We explored whether manipulation of miR-497-5p expression can alter tumor cell behavior. [score:3]
Animals were inoculated subcutaneously in the right flank with 5 × 10 [6] ISO-HAS cells suspended in 200 μL PBS containing 0.1% DMSO (TRAM-34 control group, 4 mice) or 30 μM TRAM-34 (TRAM-34 group, 5 mice), or transfected with miR-497-agomiR (miR-497-5p group, 4 mice) or non -targeting-miR-497-agomiR (miR-497-5p negative control group, 4 mice). [score:3]
In breast cancer, miR-497 expression pattern is negatively correlated with pathologic stage, lymphatic metastasis, tumor size, and HER-2 amplification; therefore, miR-497 may be a new prognostic marker for breast cancer [22]. [score:3]
Thus the miR-497-5p/KCa3.1 pair would be a new promising potential target for the treatment of angiosarcoma. [score:3]
Figure 6(A) Ectopic miR-497-5p expression altered ISO-HAS cell proliferation, which was partially reversed by application of 1-EBIO. [score:3]
Expression of miR-497-5p and KCa3.1 in angiosarcoma specimens, cell lines, and cultured endothelial cells of varied origin. [score:3]
For invasion assay, ISO-HAS cells transfected with miR-497-5p mimics exhibited markedly decreased expression of KCa3.1 and decreased invasive ability by reducing migrated cells for more than 70% (Figure 6C). [score:2]
The dissected tumors in TRAM-34 and miR-497-5p group showed a significantly decreased KCa3.1 expression as compared with the control group (Figure 7G, 7H). [score:2]
MiR-497-5p targeted KCa3.1 in ISO-HAS cells. [score:2]
In addition to the functional role in cell proliferation, miR-497-5p/KCa3.1 also is important for cell invasion. [score:1]
In details, ISO-HAS cells in serum-free medium containing 0.1% DMSO or TRAM-34 (1, 5 or 10 μM) or cells transfected with miR-497 mimics were seeded in 24-well plates with a density of 2 × 10 [5] cells/well, and incubated for 24 h. Electrophoresis was performed on a 10% polyacrylamide/SDS gel containing 1 mg/mL gelatin. [score:1]
Cells were pretreated with TRAM-34 at different concentrations (0, 0.2, 1, 5 and 10 μM) for 8 hours or transfected with miR-497-5p mimics with or without subsequent addition of 500 nM 1-EBIO. [score:1]
Figure 3(A) The wild type and mutant complementary sequences of the KCa3.1 mRNA 3′-UTR are shown with the miR-497-5p sequence. [score:1]
Similarly, mice inoculated with miR-497-5p transfected cells were killed after 25 days, and xenografted tumors showed markedly decreased weight and size (Figure 7D–7F). [score:1]
In the present investigation, we showed that miR-497-5p targeted KCa3.1 in angiosarcoma cells, showing an important role in angiosarcoma cell proliferation and invasion in vitro and tumor formation in vivo. [score:1]
Among them, 5 selected tumor relevant miRNAs (miR-378-3p, miR-483-5p and miR-497-5p, miR-222-3p and miR-126-3p) were validated with semiquantitative RT-PCR in all 27 angiosarcoma and 15 hemangioma samples. [score:1]
A decreased MMP9 activity was observed by gelatin zymography in cells transfected with miR-497-5p mimics (Figure 6F). [score:1]
Cells treated with transfection reagent with empty vectors and miR-497-5p mimics were the negative control. [score:1]
, Delaware, USA) using a dye (SYBR Green, Qiagen, Shanghai, China) to amplify KCa3.1 (sense, 5′-GAGAGGCAGGCTGTTAATGC-3′; antisense, 5′-ACGTGCTTCTCTGCCTTGTT-3′) and miR497-5p (sense, 5′-CCTTCAGCAGCACACTGTGG-3′; antisense, 5′-CAGTGCAGGGTCCGAGGTAT-3′). [score:1]
U6 RNA and GAPDH mRNA were used as normalization controls for miR-497-5p and KCa3.1. [score:1]
Cell proliferation and cell cycle were assessed on the miR-497 mimic transfected cells with or without subsequent addition of KCa3.1 channel activator 1-EBIO. [score:1]
[1 to 20 of 55 sentences]
8
[+] score: 209
Shen et al. reported that upregulation of miR-497 expression in MCF-7 breast cancer cells causes cellular growth inhibition, apoptotic enhancement and G0/G1 phase arrest [9], in our study, we transfected miR-497 mimics into MDA-MB-231 cells to induce its overexpression. [score:10]
Overexpression of miR-497 inhibited cellular growth, suppressed cellular migration and invasion, and caused a G1 cell cycle arrest, likely by targeting cyclin E1. [score:9]
Inhibited cellular growth, suppressed cellular migration and invasion, and G1 cell cycle arrest were observed upon overexpression of miR-497 in cells, possibly by targeting cyclin E1. [score:9]
Together these results demonstrated that transient overexpression of miR-497 suppressed the colony formation ability of MDA-MB-231 cells, and indicate that overexpression of miR-497 suppressed cellular proliferation. [score:9]
Overexpression of miR-497 inhibited cellular growth, suppressed cellular migration and invasion, and caused a G1 arrest. [score:7]
These results indicate that miR-497 may function as a tumor suppressor, and could be a therapeutic target for the development of future treatments for breast cancer. [score:6]
s showed that miR-497 binds the 3′-untranslated region (3′-UTR) of cyclin E1, suggesting that cyclin E1 is a direct target of miR-497. [score:6]
We found that the expression of miR-497 was significantly lower in breast cancer specimens, which suggested that the expression of miR-497 was associated with the development of breast cancer. [score:6]
Together these results indicated that overexpression of miR-497 can suppress cellular migration and invasion ability. [score:5]
The artificial upregulation of miR-497 using cyclin E1 as a therapeutic agent could offer a promising new direction for future breast cancer treatment. [score:5]
MiR-497 targets cyclin E1 and regulates its expression in MDA-MB-231 cells. [score:5]
Overexpression of miR-497 in MDA-MB-231 cells inhibited cell migration and invasion. [score:5]
These results showed that overexpression of miR-497 in MDA-MB-231 cells inhibited cellular migration. [score:5]
We searched for potential targets of miR-497 using several online databases, including targetscan, miRanda, miRBase and miRGen, and all four databases indicated that the cyclin E1 mRNA contained miR-497 binding sites. [score:5]
Overexpression of miR-497 in MDA-MB-231 cells inhibited cell proliferation. [score:5]
In summary, our findings suggest that miR-497 can specifically regulate cell growth and invasion by targeting cyclin E1 in MDA-MB-231 cells. [score:4]
Previous studies showed that miRNA-497 (miR-497) was downregulated in several kinds of tumors, including human melanoma [6], gastric cancer [7] and adrenocortical carcinoma [8]. [score:4]
However, whether miR-497 regulates other target genes to control breast cancer cell growth and invasion is still unknown. [score:4]
Additionally, we found that the protein levels of cyclin E1 were significantly lower in miR-497 -overexpressing cells than those in NC cells. [score:3]
Expression of miR-497 was lower in breast cancer specimens than adjacent normal tissues. [score:3]
A recent study by Shen et al. suggested that miR-497 might induce apoptosis in MCF-7 breast cancer cells by targeting Bcl-w [9]. [score:3]
Figure 7 miR-497 targeted cyclin E1. [score:3]
Cell cycle was affected following overexpression of miR-497 in MDA-MB-231 cells. [score:3]
Thus, we hypothesized that miR-497 may function as a tumor suppressor. [score:3]
To test whether cyclin E1 is a real target of miR-497, we constructed the psiCHECK-2/ cyclinE1 3′-UTR plasmid, which contains the 3′-UTR of cyclin E1. [score:3]
The purpose of this study was to examine the expression levels of miR-497 in human breast cancer and its function in MDA-MB-231 breast cancer cells. [score:3]
In this study, we examined the expression levels of miR-497 in breast cancer specimens and adjacent normal tissues. [score:3]
The expression of miR-497 in breast cancer specimens was lower than adjacent normal tissues (P < 0.05). [score:3]
Together, these findings support the prediction that cyclin E1 is a downstream target of miR-497. [score:3]
The results showed that the expression of miR-497 was lower in breast cancer specimens than adjacent normal tissues (Figure  1). [score:3]
Taken together, these results indicate that miR-497 could directly bind to the cyclin E1 3′-UTR region to regulate cyclin E1 in MDA-MB-231 cells. [score:3]
Similar results were also observed in breast cancer, in which the expression level of miR-497 was significantly lower in breast cancer patients and miR-497 levels inversely correlated with malignancy of breast cancer [9- 11]. [score:3]
These results indicate miR-497 could be considered a therapeutic target for the development of treatment for breast cancer. [score:3]
Through dual-luciferase assays, we confirmed the cyclin E1 3′-UTR as a direct target of miR-497 in MDA-MB-231 cells. [score:3]
These results indicated that the overexpression of miR-497 could impact cell cycle progression in MDA-MB-231 cells. [score:3]
s were performed to analyze the regulation of putative target of miR-497, and western blot assays were used to validate the dual-luciferase results. [score:3]
Thus, these results indicate that miR-497 may acts as a tumor suppressor in breast cancer. [score:3]
Exogenous overexpression of miR-497 significantly inhibited the cell growth as indicated by MTT assays and colony formation assays. [score:3]
Our results have shown that overexpression of miR-497 in breast cells greatly influences cell proliferation, migration, invasion and cell cycle progression. [score:3]
The proliferation of MDA-MB-231 cells transfected with miR-497 was inhibited in a dose- and time -dependent manner compared with the NC group. [score:2]
These results show that miR-497 could directly interact with the cyclin E1 3′-UTR in the psiCHECK-2 reporter plasmid, leading to the degradation of RL mRNA. [score:2]
Moreover, the dual-luciferase and western blot assays identify cyclin E1 as a downstream target of miR-497. [score:2]
Western blot assays confirmed that overexpression of miR-497 reduced cyclin E1 protein levels. [score:2]
MiR-497 may act as a tumor suppressor gene in breast cancer. [score:2]
In this study, we first demonstrated that the expression of miR-497 was significantly lower in breast cancer specimens compared with adjacent normal tissues. [score:2]
Next we examined the effects of miR-497 expression on cell proliferation by transfecting MDA-MB-231 cells with miR-497 or negative control (NC) mimics and performing MTT assays. [score:2]
Furthermore, western blot analysis (Figure  7C) showed that cyclin E1 protein levels were lower in the miR-497 -overexpressing group compared with the NC group. [score:2]
MiR-497 and NC mimics were purchased from Gene Pharma (Shanghai, China), and sequences are as follows: miR-497, 5′-CAGCAGCACACUGUGGUUUGU-3′, and NC, 5′-UUGUACUACACAAAAGUACUG-3′. [score:1]
Cells (2 × 10 [3]) were plated in 96-well plates (BD Biosciences, USA) and incubated at 37°C until the cells reached 30–40% confluence, followed by transfection with 50 nM or 100 nM miR-497 or NC mimics. [score:1]
The interaction between miR-497 and cyclin E1 mRNA has not been previously reported. [score:1]
After transfection with 100 nM miR-497 or NC mimics, 400 cells were plated in a 6-well plate in complete medium, and the plate was shaken to disperse the cells equally. [score:1]
Quantitative polymerase chain reaction was used to measure the expression levels of miR-497 in 40 breast cancer specimens and adjacent normal breast tissues. [score:1]
MDA-MB-231 cells transfected with miR-497 or NC mimics were analyzed by flow cytometry. [score:1]
The cell cycle distributions of the miR-497 (100 nM) group and NC group were analyzed by flow cytometry. [score:1]
The expression levels of miR-497 were measured by quantitative polymerase chain reaction (qPCR) in forty breast cancer specimens and adjacent normal tissues. [score:1]
To study how overexpression of miR-497 affects cellular migration and invasion, we performed wound healing assays and transwell assays with MDA-MB-231 cells transfected with miR-497 mimics (100 nM) or NC mimics. [score:1]
Moreover, cell migration and invasion abilities were also significantly reduced by overexpression of miR-497 in MDA-MB-231 cells, as shown by wound healing assays and transwell assays. [score:1]
As shown in Figure  4, the cell-free area of the miR-497 group was significantly wider than the NC group at 24 h after drawing the “scratch” line on the monolayer cells. [score:1]
The FL/RL ratio in the miR-497 group was approximately 1.5-fold higher than the NC group (P < 0.05) (Figure  7B). [score:1]
Figure  7A shows the binding site of miR-497 to cyclin E1 3′-UTR is located 247–254 bp upstream of the cyclin E1 3′-UTR. [score:1]
The respective proportion of G1 phase, S phase and G2 phase cells of miR-497 and NC groups are indicated. [score:1]
MDA-MB-231 cells were transfected with miR-497 mimics (100 nM) or NC mimics, and when cells reached 90% confluence, a scratch was made through each well using a sterile pipette tip. [score:1]
Cells were transfected with either miR-497 or NC mimic, along with psiCHECK-2/cyclin E1 3′-UTR, and luciferase activity was analyzed. [score:1]
MDA-MB-231 cells transfected with miR-497 (100 nM) or NC mimics were harvested 36 h after transfection, centrifuged at 1,200 rpm for 10 min and washed three times with cold PBS. [score:1]
Expression levels of miR-497 were analyzed by using one-step qRT-PCR (EzOmics SYBR qPCR kit); the miR-497 stem-loop primer, U6 primer and EzOmics SYBR qPCR kit were all purchased from Biomics Biotechnology Inc (Jiangsu, China). [score:1]
Cells transfected with 50 nM and 100 nM miR-497 mimics groups showed significantly lower optical density (OD) values at 490 nm than the NC group from day 2 until day 5, in a time- and dose -dependent manner (Figure  2). [score:1]
While the NC group filled in the gap at 48 h, the monolayer of miR-497 -transfected cells still showed a clear gap in the scratched region. [score:1]
The Cyclin E1 3′-UTR was cloned into the psiCHECK-2 vector, which contains the RL gene, and co -transfected into cells together with miR-497 or NC mimics (100 nM) using lipofectamine, according to the manufacturer’s instructions. [score:1]
[1 to 20 of 68 sentences]
9
[+] score: 150
Other miRNAs from this paper: hsa-mir-10b
Our study demonstrated that the down-regulation of Twist can inhibit metastasis and angiogenesis in pancreatic cancer, along with the confirmation of Twist being a direct target of miR-497. [score:9]
The function role of miR-497 on the cell growth, invasion and tubule formation of HUVECs in vitroOur study demonstrated that the down-regulation of Twist can inhibit metastasis and angiogenesis in pancreatic cancer, along with the confirmation of Twist being a direct target of miR-497. [score:9]
Moreover, functional studies demonstrated that the over -expression of Twist could inhibit the level of miR-497 in pancreatic cancer cells, and the expression of miR-497 was markedly increased in Twist -depleted Bxpc-3 cells. [score:7]
As shown in Figure 7A-7B, in comparison with normal tissues, the levels of miR-497 and VEGFA mRNA were down-regulated and up-regulated in pancreatic cancer tissues, respectively. [score:7]
As shown in Figure 5E, the cell growth of HUVECs was significantly inhibited after transfection with miR-497 mimic at the 48 h, 72 h and 96 h. The CM from miR-497 -upregulated Bxpc-3 cells exhibited fewer invaded cells and tubule formation than the control group (Figure 4F-4G). [score:6]
Our results showed that the over -expression of miR-497 inhibits angiogenic activity of HUVECs, resembling the effects of Twist knockdown on HUVECs. [score:6]
The over -expression of miR-497 suppresses the angiogenesis in vitro, consistent with the effects of Twist knockdown in the same cells. [score:6]
Next, dual-luciferase reporter assay was used to unveil whether miR-497 regulate the expression of Twist directly or indirectly. [score:5]
Recent studies found that miR-497 blocks liver cancer cell cycle at G1 phase by suppressing the expression of CDK4, CCNE1 and BTRC [24]. [score:5]
In addition, the expression of Twist and VEGFA were significantly increased in anti-miR-497 transfected cells in comparison with those transfected with anti-control, and the ectopic expression of miR-497 in Bxpc-3 cells decreased the protein level of Twist and VEGFA (Figure 5D). [score:5]
Figure 7 A. Relative expression of miR-497 in 68 pancreatic cancer tissues was inhibted in comparison to matched adjacent normal pancreatic tissues. [score:5]
The expression of Twist was regulated by miR-497 directly. [score:5]
A. Relative expression of miR-497 in 68 pancreatic cancer tissues was inhibted in comparison to matched adjacent normal pancreatic tissues. [score:5]
Whereas the down-regulated of miR-497 promoted cell growth, invasion and tubule formation of HUVECs (Figure 4E-4G). [score:4]
As a novel promoter of tumor angiogenesis, VEGFA was reported to be a direct target of miR-497 in liver cancer [18]. [score:4]
In this study, Twist is identified as a new direct target of miR-497. [score:4]
Twist is a direct target of miR-497. [score:4]
A previous study demonstrated that miR-497 induced cell apoptosis by negatively regulating Bcl-2 protein expression at the post-transcriptional level in human breast cancer [22]. [score:4]
Moreover, Twist was identified as a direct physiological target of miR-497. [score:4]
org, we found that Twist might be a potential target of miR-497 (Figure 5A). [score:3]
Bxpc-3 cells were transfected with miR-497 mimic to increase the expression of miR-497, and Capan-1 cells were transfected with anti-miR-497 to decrease the level of miR-497. [score:3]
MiR-497 mimic, inhibitor (anti-miR-497) and their matched negative controls (mimic control or anti-control) were synthesized by GenePharma (Shanghai, China). [score:3]
The expression levels of miR-497 and VEGFA in 68 cases of pancreatic cancer specimens as well as their matched adjacent normal pancreatic tissues were analyzed by qRT-PCR. [score:3]
D. The level of Twist was inversely correlated with miR-497 expression in pancreatic cancer tissues. [score:3]
Additionally, the expression of miR-497 was inversely correlated with the level of Twist (Figure 7D). [score:3]
To elucidate whether miR-497 could suppress the angiogenic activity of pancreatic cancer cells. [score:3]
Twist promotes pancreatic cancer angiogenesis through miR-497 targeting of VEGFA. [score:3]
In this study, we showed for the first time that Twist played an important role as a promoter of angiogenesis in human pancreatic cancer through regulation of miR-497/VEGFA axis. [score:2]
MiR-497 was reported to inhibit metastasis and angiogenesis in breast [18], ovarian [37] and lung [38] cancer. [score:2]
However, the regulatory effect of miR-497 on luciferase activity was abolished following the co-transfection of Twist-3′UTR-mu in Bxpc-3 cells (Figure 5C). [score:2]
However, whether the dysregulation of miR-497 contributes to pancreatic cancer metastasis and angiogenesis is currently unclear. [score:2]
On the contrary, such activity was increased in miR-497 depleted Bxpc-3 cells (Figure 5C, right). [score:1]
In conclusion, our current findings are consistent with the hypothesis that Twist promotes angiogenesis via miR-497/VEGFA axis in pancreatic cancer. [score:1]
However, it is currently obscure whether miR-497 involves in pancreatic cancer cell angiogenesis. [score:1]
The relations between CD34 and Twist or VEGFA as well as the relationships between Twist and miR-497 or VEGFA were analyzed by correlation analysis. [score:1]
Our results found that miR-497 was decreased in pancreatic cancer tissues, which was in consistent with the published reports [18, 39]. [score:1]
Nowadays, although few authors have arguably showed that miR-497 exert proliferative role in malignant neoplasms [21], but the weight of evidence favors the anti-proliferative role of miR-497 [22- 24]. [score:1]
Double-stranded oligonucleotides corresponding to the wild-type (wt) or mutant (mu) miR-497 binding site in the 3′UTR of Twist (Twist-3′UTR-wt and Twist-3′UTR-mu) were synthesized into the pMIR-REPORT system (Applied Biosystems). [score:1]
In addition, there is a significant inverse correlation between miR-497 and Twist in pancreatic cancer specimens. [score:1]
A. The miR-497 binding site in the 3′-UTR of Twist mRNA. [score:1]
MiR-497 mimic, anti-miR-497 and their matched controls were transfected into Bxpc-3 and Capan-1 cells, and explored the effect of miR-497 on the biological behaviors of HUVECs in vitro. [score:1]
Figure 5 A. The miR-497 binding site in the 3′-UTR of Twist mRNA. [score:1]
The function role of miR-497 on the cell growth, invasion and tubule formation of HUVECs in vitro. [score:1]
Together, our data suggesting that miR-497 exerted as a anti-angiogenic factor in pancreatic caner cells. [score:1]
B. The level of miR-497 was detected in Bxpc-3 and Capan-1 cells by qRT-PCR. [score:1]
[1 to 20 of 45 sentences]
10
[+] score: 66
Results obtained show that miR-29b-3p, miR-29c-3p and miR-20a-5p were upregulated upon osteogenic differentiation, while miR-143-3p, miR-195-5p and miR-497-5p were downregulated (Figure 2B). [score:7]
On the other hand, miR-143-3p, miR-195a-5p and miR-497-5p expression was downregulated in osteo- versus basal condition at day 7 but not at day 3 (Figure 2A). [score:6]
In conclusion, the present study demonstrates that miR-195 (and the clustered miR-497 gene) acts as a negative regulator of osteogenesis in human primary bone marrow MSC, an inhibitor of MSC proliferative capacity and an anti-angiogenic player. [score:4]
Among the analyzed miRNAs, miR-195-5p (and the genomic closely located miR-497-5p - Supplementary Figure 3) were selected for further analysis since 1) this is the first report showing downregulation of miR-195-5p in human primary MSCs under osteogenic differentiation conditions versus basal control, 2) the profile is consistent for all MSC donors during 28 days, and 3) other biological mechanisms for this miRNA in primary human MSC are still unexplored. [score:4]
C. ALP and RUNX2 expression levels in human MSC electroporated with either SCR, miR-195, miR-497. [score:3]
Cell viability was significantly decreased in miR-195 and miR-497 -overexpressing MSC (P < 0.001) in comparison with the SCR control (Figure 4A). [score:3]
Conditioned medium from miR-195, miR-497 or SCR expressing MSC, were placed on top of E10 growing CAM into a 3mm silicone ring under sterile conditions. [score:3]
Angiogenesis is decreased by miR-195 and miR-497 expression in primary human MSC. [score:3]
miR-195 and miR-497- overexpressing cells did not show ALP activity (negative for ALP staining) while SCR control MSC showed positive ALP staining in 9% of the well surface (Figure 3B). [score:3]
Thus, in general terms, the miR-195 and miR-497 regulation of osteogenic differentiation are likely conserved from mouse to human. [score:2]
This result is in agreement with the significant reduction in ALP mRNA expression level in miR-195 and in miR-497-electroporated cells compared with SCR control (P < 0.05) (Figure 3C). [score:2]
Moreover, expression levels of the key osteogenic differentiation marker RUNX2 was diminished in miR-195 and miR-497-electropotared cells compared with SCR control (P < 0.05) (Figure 3C). [score:2]
Interestingly, miR-195 is located within less than 10kb distance from miR-497, in chromosome 17 (sequence details are shown in Supplementary Table 2). [score:1]
Therefore, miR-195 and miR-497 impaired MSC proliferation. [score:1]
A. A representative experiment on cell viability of miR-195 and miR-497 in human MSC. [score:1]
To determine the effect of miRNAs on proliferation, MSC (Passage 7) electroporated with Pre-miR miRNA Precursors miR-195, Pre-miR miRNA Precursors miR-497 or Pre-miR miRNA Precursor Negative Control (Scrambled - SCR) were plated in 96-well plates in sextuplicates. [score:1]
miR-195 and miR-497 decrease osteogenesis in human primary MSC. [score:1]
Gain-of-function studies revealed miR-195 (and the clustered miR-497) decreased cell proliferation, as determined by significant decreases in the number of positive cells for the cellular proliferation marker Ki-67, which is present during all active phases of the cell cycle, and in the overall number of cells. [score:1]
A recent study by Grünhagen et al. showed that miR-195-miR-497 cluster impaired osteoblast differentiation in mouse cells [27]. [score:1]
A. miR-195 and miR-497 levels after electroporation of human MSC with miR-195 and miR-497 were determined by quantitative real time PCR. [score:1]
miR-195 and miR-497 affects cell proliferation of primary human MSC. [score:1]
MC3T3 cells (3×10 [6]) plated in a 10-cm culture dish were transfected with 50 nM Pre-miR miRNA Precursors miR-143, Pre-miR miRNA Precursors miR-195, Pre-miR miRNA Precursors miR-497 or Pre-miR miRNA Precursor Negative Control (Scrambled - SCR) (Life Technologies) using Lipofectamine 2000 transfection reagent (Invitrogen, Life Technologies). [score:1]
Figure 4 A. A representative experiment on cell viability of miR-195 and miR-497 in human MSC. [score:1]
Cells were transfected with either SCR, miR-143 (used as a positive control), miR-195 or miR-497. [score:1]
To further confirm if cell proliferation was indeed affected by miR-195 and miR-497, staining with the proliferation marker Ki-67 was quantified. [score:1]
B. ALP staining 7 days after electroporation of human MSC with scrambled negative control (SCR), miR-195 or miR-497 (5X; microscope scale: 50 μm; photography scale: 2 mm). [score:1]
miR-146b-5p, miR-29b-3p, miR-29c-3p, miR-20a-5p, miR-143-3p, miR-195-5p and miR-497-5p expression levels were measured by quantitative real-time PCR. [score:1]
miR-195 and miR-497 sequence annotations were obtained from the miRBase database (http://www. [score:1]
Human primary MSC (Lonza) (0.5×10 [6]) were mixed with Pre-miR miRNA Precursors miR-195, Pre-miR miRNA Precursors miR-497 or Pre-miR miRNA Precursor Negative Control (Scrambled - SCR) (Life Technologies) in an electroporation cuvette and electroporated using OPTI-MEM I (Invitrogen, Life Technologies) in a Gene Pulser Xcell Electroporation Systems (Bio-Rad) with the following conditions: voltage - 250 V, capacitance - 950 μF, resistance - 200 Ω [46]. [score:1]
In conclusion, our data shows that both miR-195 and miR-497 decrease cell proliferation in human primary MSC. [score:1]
To further elucidate the impact of miR-195 and miR-497 during osteogenic differentiation of human primary MSC, these were successfully electroporated with SCR control, miR-195 or miR-497 (P < 0.05) (Figure 3A) and allowed to differentiate with osteogenic supplements up to 7 days. [score:1]
Figure 3 A. miR-195 and miR-497 levels after electroporation of human MSC with miR-195 and miR-497 were determined by quantitative real time PCR. [score:1]
miR-195 and miR-497 modulates osteogenic differentiation in primary human MSC and mouse MC3T3 cell line. [score:1]
Therefore, we concluded that miR-195 and miR-497 play an anti-osteogenic differentiation role in human primary MSC cells. [score:1]
miR-195, miR-497 or SCR-electroporated MSC, and anti-miR-195 or SCR negative control -transfected MSC, were grown on top of cover-slips. [score:1]
B. Confocal imaging of MSC cells 48 hours after electroporation of SCR, miR-195 or miR-497. [score:1]
[1 to 20 of 36 sentences]
11
[+] score: 65
miR-195 and miR-497 regulate TARBP2 and DICER expression in adrenocortical tumorsTo explore a possible involvement of miRNAs in TARBP2 regulation, we first searched for the published under-expressed miRNAs in ACCs, thus showing an inverse expression pattern compared with TARBP2. [score:8]
In line with the expression pattern, we previously showed that over -expression of miR-195 and miR-497 can inhibit cell growth with concomitant increase of apoptosis in NCI-H295R ACC cells (Özata et al. 2011). [score:7]
Together, it is intriguing to speculate that the phenotypic effect observed in ACC cell line upon alteration of miR-195 and miR-497 expression may be mediated through TARBP2 and DICER downregulation. [score:6]
Noteworthy, the four carcinomas with TARBP2 copy number gain and low TARBP2 expression exhibited high expression of miR-195 and miR-497. [score:5]
Here, we demonstrate that mature miR-195 and miR-497 can directly regulate TARBP2 and DICER expression in ACC. [score:5]
We observed a significant reduction of TARBP2 and DICER mRNA and protein expression levels in the cells over -expressing miR-195 or miR-497 compared with the cells transfected with pre-miR -negative control. [score:4]
miR-195 and miR-497 regulate TARBP2 and DICER expression in adrenocortical tumors. [score:4]
Downregulation of miR-195 and/or miR-497 has been observed in several tumor types, including ACC (Soon et al. 2009, Özata et al. 2011, Patterson et al. 2011, Schmitz et al. 2011), liver (Xu et al. 2009), bladder (Han et al. 2011), breast (Li et al. 2011), and peritoneal carcinoma (Flavin et al. 2009). [score:4]
Next, we adopted the Ago2-immunoprecipitation approach to determine whether TARBP2 and DICER are direct targets of miR-195 and/or miR-497. [score:4]
miR-497 had a stronger repressive effect on both TARBP2 and DICER, and the combined over -expression of the two miRNAs showed a synergic effect on posttranscriptional regulation (Fig. 5D). [score:4]
To confirm whether TARBP2 and DICER were biological targets of miR-195 and miR-497 in adrenocortical tumors, we transfected NCI-H295R cells with miRNA mimics (pre-miR-195 and/or pre-miR-497). [score:3]
We observed a significant enrichment of endogenous mRNAs for both genes in cells over -expressing miR-497 (P<0.05). [score:3]
The analysis identified let-7 family members, miR-195 and miR-497, as possible regulators of TARBP2. [score:2]
NCI-H295R cells were transfected using Amaxa Nucleofector technology (Lonza, Basel, Switzerland) with pre-miR-195, pre-miR-497 (PM10827 and PM10490 respectively; Applied Biosystems/Ambion), or siTARBP2 (sc-106846; Santa Cruz Biotechnology, Inc. [score:1]
As let-7 family members were not significantly deregulated in ACCs compared with adenomas in our cohort (Özata et al. 2011), we focused on miR-195 and miR-497. [score:1]
Cells (2×10 [6] cells/dish) were transfected with pre-miR Negative control#1, pre-miR-195 or pre-miR-497, and seeded in six tissue culture plates (10 cm). [score:1]
Here, we analyzed the levels of miR-195 and miR-497 in additional five ACC cases included in this study. [score:1]
Thus, we immunoprecipitated Ago2 complexes in NCI-H295R cells after induced over -expression of miR-195 or miR-497 and measured the abundance of the co-immunoprecipitated TARBP2 and DICER mRNAs by RT-qPCR. [score:1]
Expression levels of miR-497 (ID_001043) and miR-195 (ID_000494) were quantified in the NCI-H295R cells after transfection experiments to evaluate transfection efficiency. [score:1]
[1 to 20 of 19 sentences]
12
[+] score: 55
The study on regulatory mechanism of miR-497 mainly refers to be a potential prognostic marker and functions as a tumor suppressor in human cervical cancer, breast cancer, and hepatocellular carcinoma [18– 20]. [score:4]
Interestingly, results displayed that the circulating miR-497 levels were overexpressed at 4 h, 8 h, 12 h, and 24 h in patients, contrasted by that in healthy volunteers as shown in Figure 1(a) and Table 2. This data supported our previous hypothesis and demonstrated that the miR-497 was highly associated with human AMI indeed, notwithstanding the exact regulatory mechanism of miR-497 was unclear. [score:4]
However, the expression levels of miR-497 in AMI were unclear, especially the circulating miR-497 that was detectable in the human plasma [23]. [score:3]
It showed that expression of miR-497 was enhanced significantly at 4 h, 8 h, 12 h, and 24 h as shown in Table 2 and Figure 1(a). [score:3]
We assessed the expression of circulating miR-497 in AMI patients at 4 h (±30 min), 8 h (±30 min), 12 h (±30 min), 24 h (±30 min), 48 h (±30 min), and 72 h (±30 min), by contrast to that in healthy volunteers, by using qRT-PCR. [score:3]
In this study, we focused on the expression levels of circulating miR-497 in AMI and the roles of plasma miR-497 as a promising biomarker for AMI. [score:3]
In this study, we compared the expression levels of circulating miR-497 in AMI with that in healthy volunteers. [score:2]
Thus, it is reasonable to make a hypothesis that miR-497 could be highly associated with the regulation of AMI pathophysiological processes, which was not reported up to date. [score:2]
Moreover, Yin et al. found that knockdown of miR-497 effectively attenuates ischemic brain infarction and improves neurological outcomes in mice after focal cerebral ischemia [22]. [score:2]
Interestingly, it is noteworthy that miR-497 has emerged as key mediators of posttranscriptional gene silencing in both pathogenic and pathological aspects of ischemic stroke biology [21]. [score:1]
Further study supported the correlation between plasma cTnI and miR-497 by statistical analysis (Figure 2(b) r = 0.573, P < 0.001). [score:1]
ROC curve with AUC was performed by using miR-497 levels to differentiate the AMI group from the healthy group (Figure 3). [score:1]
A relatively small number of samples was enrolled to prove the consideration of circulating miR-497 as a biomarker for AMI in this study. [score:1]
Because of fundamental effects of miR-497 on infarction [22], we made the question if the miR-497 was associated with AMI which belongs to the infarction and if circulating miR-497 could be denoted as promising biomarker for diagnosing AMI. [score:1]
It is the first report on the roles of miR-497 on human AMI. [score:1]
Furthermore correlation analysis was conducted to analyze the correlation between circulating miR-497 levels and cTnI. [score:1]
Moreover, time courses were depicted to analyze the dynamic process of circulating miR-497 and cTnI levels in AMI patients. [score:1]
The miR-497 levels reached the peak at 8 h and were reduced gradually after that time point. [score:1]
Specificity and Sensitivity of Circulating miR-497. [score:1]
It illustrated that circulating miR-497 may have potential performances for diagnosing the AMI, just like the plasma cTnI [3, 33]. [score:1]
The time course curve of plasma cTnI concentrations was similar to miR-497 (Figure 2(a)). [score:1]
Plasma miR-497 was isolated by using miRNeasy Mini Kit (Qiagen, Valencia, CA). [score:1]
The data showed a positive correlation between circulating levels of miR-497 and cTnI concentrations in AMI patients (r = 0.573, P < 0.001) (Figure 2(b)). [score:1]
These results declared that there was faithworthy sensitivity and specificity to identify the AMI patients by using circulating miR-497. [score:1]
It showed that the miR-497 levels were changed in a time dependent manner. [score:1]
It also suggested the specific roles of plasma miR-497 levels in diagnosing AMI. [score:1]
It played fundamental roles in the further study on mechanism of miR-497 in human AMI. [score:1]
By using denoted threshold score of circulating miR-497, the high specificity and sensitivity were achieved at 4 h, 8 h, 12 h, and 24 h for detection of AMI from control group. [score:1]
There was no significant difference of expression of miR-497 at 48 h and 72 h. Meanwhile, the circulating cTnI concentrations were also assayed by ELISA assay. [score:1]
Analysis of Correlation between Circulating miR-497 Levels and AMI. [score:1]
So it is suspected that miR-497 takes fundamental effects on infarction that AMI belongs to. [score:1]
Comparison of Circulating miR-497 and cTnI Levels in Patients with Those in Healthy Volunteers. [score:1]
Δct levels of miR-497 were −5.23 ± 0.67, −3.99 ± 1.47, −4.62 ± 1.35, −5, 62 ± 1.68, −6.22 ± 0.86, and −6.34 ± 1.15 at 4 h, 8 h, 12 h, 24 h, 48 h, and 72 h, respectively. [score:1]
However, luckily and importantly, we not only gained a promisingly novel biomarker for AMI diagnosis but also opened the first study on mechanism of miR-497 in human AMI. [score:1]
So, the data revealed that the circulating miR-497 had the effective performance for AMI diagnosis and supported the previous presumption that circulating miR-497 was effective to identify the AMI as a novel biomarker. [score:1]
The data of miR-497 and cTnI were analyzed by the Kolmogorov-Smirnov test to examine whether they followed the normal distribution. [score:1]
To identify if the circulating miR-497 exhibited the promising roles as a biomarker for diagnosing AMI, we detected the plasma concentrations of cTnI, a classic marker of myocardial injury (Figure 1(b)), and assessed the correlation between plasma cTnI and miR-497. [score:1]
In conclusion, circulating miR-497 might be a promising biomarker for AMI identification and there was high association between human miR-497 and acute myocardial infarction. [score:1]
[1 to 20 of 38 sentences]
13
[+] score: 32
Focusing on the conserved miRNAs presented in Table 1, we found that of the 14 miRNAs downregulated in our study relative to normal bone, six were published as upregulated in osteosarcoma relative to osteoblasts, namely the miRNAs miR-126, miR-142-3p, miR-195, miR-223, miR-451 and miR-497, while miR-31/miR-31* was upregulated compared to bone and downregulated compared to osteoblasts. [score:11]
All of the miRNAs that were confirmed downregulated in clinical samples compared to bone are known to act as tumor suppressors in other types of cancers, that is miR-1, miR-126/miR-126*, miR-133b, miR-144, miR-195, miR-223 and miR-497 [38], [39], [40], [41], [42], [43]. [score:5]
miR-451 and miR-497 showed a trend towards being significantly decreased, miR-31 showed a heterogenous expression pattern, and miR-19b, miR-29b and miR-142-3p were expressed at comparable level in clinical samples and bone. [score:5]
The highly downregulated miRNAs presented in Table 1 were miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-363, miR-486-5p and members of the miR-1/miR-133a, miR-206/miR-133b, miR-451/miR-144 and miR-497/miR-195 clusters. [score:4]
Among these, miR-126/miR-126*, miR-142-3p, miR-150, miR-223, miR-486-5p and members of the miR-1/miR-133a, miR-144/miR-451, miR-195/miR-497 and miR-206/miR-133b clusters were found to be downregulated in osteosarcoma cell lines. [score:4]
A set of miRNAs, miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-142-3p, miR-133b, miR-144, miR-195, miR-223, miR-451 and miR-497 was identified with an intermediate expression level in osteosarcoma clinical samples compared to osteoblasts and bone, which may reflect the differentiation level of osteosarcoma relative to the undifferentiated osteoblast and fully differentiated normal bone. [score:2]
As predicted, the 13 miRNAs miR-1, miR-18a, miR-18b, miR-19b, miR-31, miR-126, miR-133b, miR-142-3p, miR-144, miR-195, miR-223, miR-451 and miR-497 showed opposite regulation when the osteosarcoma clinical samples were compared against bone or osteoblasts. [score:1]
[1 to 20 of 7 sentences]
14
[+] score: 30
The protein expression level of CDC25A (A) or CCNE1 (B) in C2C12 cells transduced with lentivirus expressing dTuD-miR-322 or dTuD-miR-497, respectively. [score:5]
0143864.g005 Fig 5The protein expression level of CDC25A (A) or CCNE1 (B) in C2C12 cells transduced with lentivirus expressing dTuD-miR-322 or dTuD-miR-497, respectively. [score:5]
The mRNA expression level of CDC25A or CCNE1 in C2C12 cells transduced with dTuD-miR-322 or dTuD-miR-497. [score:3]
S3 FigThe mRNA expression level of CDC25A or CCNE1 in C2C12 cells transduced with dTuD-miR-322 or dTuD-miR-497. [score:3]
The transduction of dTuD-miR-322 and dTuD-miR-497 significantly increased the mRNA levels of target CDC25A (40%, p < 0.001) and CCNE1 (57%, p < 0.001) (S3 Fig). [score:3]
In our study, dTuD-miR-195 and dTuD-miR-497 repressed specifically target miRNAs but not the other miRNA family members (Fig 3), indicating that cross-reactivity among different miRNA family members was not detectable. [score:3]
Previous studies have confirmed that the miR-424 and miR-497 restrain cell proliferation by targeting human cell division cycle 25 homolog A (CDC25A) and G1/S-specific cycllin-E1 (CCNE1), respectively [20, 21]. [score:3]
We transduced the C2C12 cells with dTuD lentivirus targeting miR-322, miR-497 or no-specific control sequences (dTuD-Ctrl). [score:3]
We transfected dTuD-miR-195 or dTuD-miR-497 into 293A cells respectively and then measured the expression level of each miRNA in this cluster. [score:1]
We observed that only miR-195 or miR-497 was significantly decreased in cells transduced with corresponding dTuD, whereas no significant effects were found on other family members (Fig 3B and 3C). [score:1]
[1 to 20 of 10 sentences]
15
[+] score: 28
CRC comparison; miR-4417 and miR-497 were one of the continuously upregulated or downregulated miRNAs in adenoma-carcinoma transition and their mRNA targets were predicted using five algorithm: TargetScan, miRanda, PICTAR2, RNAHybrid and miRWalk on miRWalk 2.0 platform. [score:11]
CRC comparison; miR-4417 and miR-497 were one of the continually upregulated or downregulated miRNAs in adenoma-carcinoma transition. [score:7]
Although, our investigation was limited to determine the expression level of miR-497 and its predicted target, CCND1 mRNA and protein level according to several functional analyses - such as luciferase assay -based methods - carried out in different types of cancers revealed that miR-497 (and miR-195) directly targets the 3’-UTR region of cyclin D1 [67– 69]. [score:5]
Although, no experimental data is available to date about the interaction of miR-497-CCND1 in colorectal cancer, the overexpression of cyclin D1 mRNA might cause by the underexpression of miR-497 in colorectal adenoma and cancer by posttranscriptional silencing. [score:5]
[1 to 20 of 4 sentences]
16
[+] score: 26
Other miRNAs from this paper: hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3
Moreover, the co-transfection of si-hsa_circ_0018289 and miR-497 inhibitor could decrease the miR-497 expression compared to hsa_circ_0018289 knockdown group (Figure 6D). [score:5]
HeLa cells transfected with miR-497 mimics or inhibitor showed the decreased or increased expression levels of hsa_circ_0018289 (Figure 6C). [score:5]
MiR-497 has been identified as tumor suppressor and inhibits the proliferation, migration and invasion of retinoblastoma, cervical cancer cells [13, 14]. [score:4]
Figure 6 (A) The putative target miR-497 for hsa_circ_0018289 predicted using Arraystar’s home-made software. [score:3]
Results indicated that hsa_circ_0018289 interacted with miR-497, suggesting the miRNA ‘sponge’ role and the potential downstream targets of hsa_circ_0018289 in cervical cancer tumorigenesis. [score:3]
In present study, hsa_circ_0018289 was observed to directly bind to miR-497, which was validated by luciferase reporter assays. [score:1]
Besides, we also detected the interaction of hsa_circ_0018289 with miR-497. [score:1]
Besides, miR-497 mimics or miR-NC (2 ng) were also transfected into HEK293T cells using Lipofectamie 2000 (Invitrogen). [score:1]
Hsa_circ_0018289 acted as ‘sponge’ and interacted with miR-497. [score:1]
Hsa_circ_0018289 interacted with miR-497. [score:1]
Although the further functional experiments are absent, the interaction within hsa_circ_0018289 and miR-497 could indicate the sponge role of hsa_circ_0018289 to miR-497. [score:1]
[1 to 20 of 11 sentences]
17
[+] score: 25
Additionally, upregulation of either miR-497 or miR-200c inhibits proliferation of bladder cancer cells by downregulating E2F3 [40, 67]. [score:9]
Silencing of miR-497 enhanced the migration and invasion of BTCC cells through upregulation of E2F3 and subsequently facilitated the development of BTCC, and the rescue effect of E2F3 expression partly reversed the inhibition of migration and invasion induced by miR-497 [40]. [score:9]
In another study, miR-497 was found to be markedly down-regulated in human bladder transitional cell carcinoma (BTCC) tissue samples and dual-luciferase reporter assays demonstrated the specificity of miR-497 to target E2F3 [40]. [score:5]
The miR-15 family members, including miR-15a, miR-15b, miR-16-1, miR-16-2, miR-195 and miR-497, are clustered on three separate chromosomes [38]. [score:1]
It was suggested that reduced miR-497 was associated with poorer prognosis of BTCC patients and miR-497/E2F3 axis may be valuable biomarkers for BTCC progression [40]. [score:1]
[1 to 20 of 5 sentences]
18
[+] score: 24
From the 20 most differentially regulated microRNAs (10 most up-regulated and 10 most down-regulated, see Table 2) 7 are shared with female breast cancer (miR-21, miR-127, miR-122a, miR-135b, miR-140, miR-497, miR-145). [score:8]
The most prominently down-regulated microRNAs miR-145 and miR-497 are already identified as down-regulated in female breast cancer [7, 8]. [score:7]
miR-21, miR519d, miR-183, miR-197, and miR-493-5p were identified as most prominently up-regulated, miR-145 and miR-497 as most prominently down-regulated in male breast cancer. [score:7]
Further studies attribute already quite well characterized tumor-suppressor function to miR-145 and miR-497 in other malignancies as well [16, 19, 20]. [score:1]
Welch -based t-test demonstrates a statistically significant difference between carcinoma samples and the controls for miR-21, miR-145, and miR-497, but only a trend for miR-519d (Figure 3). [score:1]
[1 to 20 of 5 sentences]
19
[+] score: 21
Compared with the normal breast tissue controls, the expression levels of miR497-5p were markedly down-regulated (Figure  3F; mean fold change 0.3) in triple -negative breast cancers. [score:5]
In addition, miR-497-5p and miR-195-5p, in the miR-497-195 cluster located in the intronic region of MIR497HG at 17p13.1, were both significantly down-regulated (p <0.05; fold change 3.0-3.3) in triple -negative breast cancer. [score:4]
Li et al. described that miR-497-5p and miR-195-5p in this cluster were both down-regulated in human breast cancer tissues and cell lines [26]. [score:4]
Our results provide evidence showing in vivo that both miR-497-5p and miR-195-5p are down-regulated in triple -negative breast cancer tissues. [score:4]
Relative expression levels of (F) miR-497-5p and (G) miR-195-5p in 23 samples are shown. [score:3]
Two 5p miRNA forms, miR497-5p and miR-195-5p, located at two different loci in the miR-497-195 cluster are shown in Figure  3E. [score:1]
[1 to 20 of 6 sentences]
20
[+] score: 20
Among the three microRNAs (Shi et al., 2012; Xu et al., 2012, 2015) (miR-497-5p, miR-145-5p, miR-128-3p) previously reported to target p70s6k1 mRNA and inhibit its translation, only miR-128-3p was downregulated by TXL during I/R. [score:10]
Because TXL was reported to decrease expression of microRNAs and increase levels of their corresponding proteins under certain conditions (Wang J. Y. et al., 2014; Zhang et al., 2014, 2017), we used quantitative PCR to examine levels of several microRNAs (Shi et al., 2012; Xu et al., 2012, 2015) (miR-497-5p, miR-145-5p, and miR-128-3p) known to target the mRNA of p70s6k1 in HCMs (Figure 6B). [score:5]
MiR-497 decreases cisplatin resistance in ovarian cancer cells by targeting mTOR/P70S6K1. [score:2]
There were no significant differences in levels of the other two microRNAs, miR-497-5p and miR-145-5p, in these two groups. [score:1]
MicroRNAs (miR-497-5p, miR-145-5p, and miR-128-3p) were reverse transcribed using miScript II RT Kit (Qiagen, Valencia, CA, USA) and then quantified by quantitative real-time RT-PCR using the miScript SYBR green PCR kit (Qiagen). [score:1]
The miR-497-5p, miR-145-5p, and miR-128-3p levels were determined with the 2 [(−ΔΔCT)] relative quantification method, using U6 as an internal control. [score:1]
[1 to 20 of 6 sentences]
21
[+] score: 20
Of the miRNAs that were significantly up- or down-regulated, five were shared between acutely and persistently infected cattle (bta-miR-17-5p, bta-miR-144, bta-miR-497, bta-miR-22-5p, and bta-miR-1281). [score:4]
The miRmap algorithm reported that 6 of the 19 miRNAs dysregulated in bovine serum in response to FMDV could potentially target different regions of the FMDV A24 Cruzeiro RNA genome: bta-miR-17-5p, bta-miR-497, bta-miR-146a, bta-miR-1224, bta-miR-31, and bta-miR-150. [score:4]
The up-regulated miRNA species included bta-miR-17-5p, bta-miR-146a, bta-miR-144, bta-miR-34a, bta-miR-369-3p, bta-miR-497, and bta-miR-22-5p (Table  2 and Fig.   2a). [score:4]
Despite that, the miRNA profiles generated from human serum collected from individuals infected with related + ssRNA viruses (Dengue virus and HCV) showed some dysregulated miRNAs shared with the ones reported for FMDV here, which included: let-7 g, miR-22-5p, miR-23b-5p, miR-146a, and miR-497 [51, 52]. [score:2]
Of the differentially regulated miRNAs, 16 (bta-miR-23b-5p, let-7 g, bta-miR-22-5p, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-455-3p, bta-miR-154a, bta-miR-369-3p, bta-miR-26b, bta-miR-34a, bta-miR-205, bta-miR-181b, bta-miR-146a, bta-miR-17-5p, and bta-miR-31) have previously been described to play a role in cellular proliferation or apoptosis (Fig.   6b, orange circle). [score:2]
As shown in the top portion of Table  3: bta-miR-22-5p, bta-miR-147, bta-miR-1224, bta-miR-144, bta-miR-497, bta-miR-154a, bta-miR-17-5p, bta-miR-205, and bta-miR-31, with fold changes of 2.17, 5.28, 5.69, 23.78, 24.62, 24.05, 40.84, 41.22, and 43.37, respectively. [score:1]
The remaining 8 miRNAs (bta-miR-497, bta-miR-144, bta-miR-181b, bta-miR-22-5p, bta-miR-23b-5p, bta-miR-17-5p, bta-miR-154a, and bta-miR-369-3p) detected in this study were found to be clustered. [score:1]
Eleven of the miRNAs are encoded in intergenic regions, including: bta-miR-1281, bta-miR-150, bta-miR-181b, bta-miR-497, bta-miR-144, bta-miR-34a, bta-miR-154a, bta-miR-146b, bta-miR-17-5p, bta-miR-205, and bta-miR-31. [score:1]
The only chromosomes in the Bos taurus genome that were associated with more than one of the identified miRNAs were: chromosome #8 with bta-miR-23b-5p, bta-miR-31, and bta-miR-455-3p; chromosome #16 with bta-miR-34a, bta-miR-181b, and bta-miR-205; chromosome #19 with bta-miR-22-5p, bta-miR-144, and bta-miR-497; and finally chromosome #21 with bta-miR-154a and bta-miR-369-3p. [score:1]
[1 to 20 of 9 sentences]
22
[+] score: 19
These results indicate that miR-497, miR-351 and miR-31 may serve as mediators of neutrophilic inflammation by targeting genes that regulate neutrophil recruitment to the airways; predicted targets of each miRNA are listed in Additional file 9: Table S6. [score:6]
In the second approach, we constructed putative miRNA/mRNA regulatory networks and identified three miRNAs (miR-497, miR-351 and miR-31) as candidate master regulators of genes associated with neutrophil recruitment. [score:3]
The trans-eQTL locus shared by miR-322 and miR-503 was also weakly associated with the expression of miR-351 and miR-497 (p [adjusted] < 0.1). [score:3]
The bioinformatic analysis we conducted to identify miRNAs that may act as key regulators of genes involved in granulocyte (eosinophil and neutrophil) recruitment pointed to three miRNAs of interest for neutrophils, namely miR-497, miR-351 and miR-31. [score:2]
We identified three miRNAs, miR-497, miR-351 and miR-31, that are candidate master regulators of genes associated with neutrophil recruitment. [score:2]
For the set of genes that were positively correlated with neutrophils (n = 674 at FDR < 0.1), we identified miR-497, miR-351 and miR-31 as candidate regulatory hubs (Fig.   7). [score:2]
Pairwise Pearson Correlation Values Among miR-322, miR-252, miR-497, and miR-503. [score:1]
[1 to 20 of 7 sentences]
23
[+] score: 16
miRNAs that are downregulated in angiosarcoma are miR-497-5p, -378-3p and 483-5p, of which miR-497-5p interacts with the potassium intermediate conductance calcium-activated channel KCa3.1 [89, 90]. [score:4]
Other than miR-497-5p, the miR-17-92 cluster is significantly upregulated in MYC proto-oncogene (MYC)-amplified angiosarcoma [91]. [score:4]
Experimental upregulation of miR-497-5p results in reduced levels of KCa3.1 and impairs cellular proliferation, progression of the cell cycle and cellular invasion. [score:4]
In clinical practice, miR-497-5p could be used as a therapeutic agent, directly targeting KCa3.1, and thus preventing tumour progression and invasion. [score:4]
[1 to 20 of 4 sentences]
24
[+] score: 15
Overexpression of miR-497 and miR-890 can also affect the DDR and enhance cellular sensitivity to cisplatin and IR by promoting WEE1 expression [42, 44]. [score:5]
For example, almost all of the miR-15 family miRNAs (miR-15a/b, miR-195, miR-424, and miR-497) were downregulated across a number of different cell lines, including endothelial cells, non-small cell lung cancer (NSCLC) cells, and lymphoblasts [97], whereas miR-148b was repressed by IR in endothelial cells, but induced by IR in non-Hodgkin lymphoma [98, 99]. [score:4]
Zhu W. Zhu D. Lu S. Wang T. Wang J. Jiang B. Shu Y. Liu P. miR-497 modulates multidrug resistance of human cancer cell lines by targeting Bcl2 Med. [score:3]
Another study also found reduced expression of miR-15 family members (miR-15a, miR-15b, miR-16, miR-195, miR-424, and miR-497) and miR-155 in cisplatin-resistant cells. [score:3]
[1 to 20 of 4 sentences]
25
[+] score: 15
Here, we identified eight types of miRNAs, namely, the highly expressed miR-15a-5p, miR-17-5p, miR-20a-5p, miR-21-5p, miR-96, miR-106b-5p, and miR-3653 as well as the poorly expressed miR-497-5p. [score:5]
The qRT-PCR results demonstrated that miR-106b-5p (p = 0.000), miR-3653 (p = 0.000), miR-17-5p (p = 0.000), miR-96 (p = 0.000), miR-15a-5p (p = 0.000), miR-20a-5p (p = 0.000), and miR-21-5p (p = 0.000) were highly expressed in cancer tissues, while miR-497-5p (p = 0.016) was expressed at very low levels. [score:5]
In addition, miR-497 can inhibit the proliferation of cervical cancer cells by acting on cyclin E1 [34]. [score:3]
These miRNAs included miR-106b-5p, miR3653, miR-3188, miR-497-5p, miR-218-5p, miR-17-5p, miR-96, miR-15a-5p, miR-20a-5p, miR-21-5p, and miR-590-5p (Table 3). [score:1]
miR-497 is also closely associated with the prognosis of many types of cancers, such as kidney and pancreatic cancers [35, 36]. [score:1]
[1 to 20 of 5 sentences]
26
[+] score: 14
According to previous studies in cancer (MCF-7) cells EGCG up-regulates the expression of miR-16, a member of the miR-15b family (family of miR-16/miR-15a/miR-497/miR-322/miR-195) and consequently, EGCG down-regulates Bcl-2 expression level and thus counteracts cancer progression [25]. [score:11]
A. Cartoon showing the murine mmu-miR-15b (family of miR-16/miR-15a/miR-497/miR-322/miR-195) with STIM2 3’-untranslated region (3’-UTR) with seed sequence. [score:3]
[1 to 20 of 2 sentences]
27
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
Cell cycle and Neurotrophin signaling pathway were regulated by ssc-miR-20b, ssc-miR-128, ssc-miR-497, ssc-miR-195 and ssc-miR-371-5p through corresponding putative target genes. [score:4]
P53 signaling pathway was regulated by ssc-miR-20b, ssc-miR-497 and ssc-miR-195 through targeting CCNG2, CDKN1A, CASP8, GADD45G, CHEK1, SESN1 and CCNE1. [score:4]
Ssc-miR-106a, ssc-miR-363, ssc-miR-195, ssc-miR-497, ssc-miR-146b, ssc-miR-92b-5p, ssc-miR-20b and ssc-miR-935 were highly expressed in hpiPSCs than that in mpiPSCs (Fig 3A). [score:3]
Ssc-miR-195 and ssc-miR-497 were highly expressed in hpiPSCs and they were also located in the same genome loci in chromosome 12. [score:3]
[1 to 20 of 4 sentences]
28
[+] score: 14
For example, we found a significant downregulation of miR-27a, miR-411 and miR-497 in bladder cancer patient B09 and a significant upregulation of miR-379, miR-381 and miR-411 in kidney cancer patient K44 (Figure  5B). [score:7]
However, the editing sites in miR-379 and miR-497 appear to be targets of ADARB1 [12, 13]. [score:3]
In addition, our remapping method proved to be more sensitive and was able to detect editing in additional species, for example, of miR-379 in human, and of miR-497* in mouse and opossum (Figure  3; Table S2 in Additional file 2). [score:1]
Several editing events within the seed were found to be much more ancient than previously recognized: editing of miR-27a was found in placental mammals and platypus, thus presumably dating back at least 220 million years, while editing of miR-187*, miR-497 and miR-1251 was shared between placental mammals and marsupials, whose last common ancestor lived 180 million years ago [20]. [score:1]
Editing of miR-376b, miR-376c, miR-379, miR-381, miR-411 and miR-497 was significantly correlated with age in both species, demonstrating that the age-related increase of editing frequencies at specific sites is conserved between species (Figure  4B). [score:1]
Human Macaque Mouse Opossum Platypus Chicken Human SNP Opossum SNP Known ValidatedmiR-27a6>1%>1%  >1% No-Human [e]---miR-99b*2 >1%>1%   No-Human [c]-Mouse [c]Mouse [c]miR-140*16   >5% >5%NoNo----miR-187*5  >1%>1%  NoNo----miR-301a20 >1% >5% >5%NoNo----miR-376a-13>1%>1%>1%   No-Human [b,c,d]-Mouse [b,c,d,e,f]Mouse [b,c]miR-376b6>5% >5%   No-Human [b,c,d]-Mouse [b,c,d,f,g]Mouse [b,c]miR-376c6>5% >5%   No-Human [e]-Mouse [b,d,e,f]Mouse [b]miR-3795 >5%>5%   No-Human [a,c,e]-Mouse [c,d,e,f]Mouse [c]miR-3814>5%>5%>5%   No-Human [e]Human [e]Mouse [d,f,g]-miR-4115>5%>5%>5%   No-Human [b,d]-Mouse [c,d,e]Mouse [c]miR-45517 >1%   >1%No-Human [e]Human [e]--miR-4972>5%>5%>5%>5%  NoNoHuman [e]Human [e]Mouse [d,e]-miR-497*20>5%>5%    NoNoMouse [d]---miR-12516 >5%>5%>1%  NoNoMouse [d,e]-                     - -Summary of the output from the miRNA editing detection pipeline, run with a 5% or 1% frequency cutoff. [score:1]
[1 to 20 of 6 sentences]
29
[+] score: 13
Recently, miR-195 and miR-497 were shown to suppress breast cancer cell proliferation and invasion via targeting Raf-1 and CCND1 [32]. [score:5]
In mamanlian, only miR-195, miR-497 and miR-424 are expressed [30]. [score:3]
In human, miR-195 and mir-497 were shown potential tumor suppressor gene in primary peritoneal tumorgenesis [13]. [score:3]
MiR-195 belongs to miR-15 gene family which includes miR-15a/b/c, miR-16a/b/c, miR-497 and miR-424. [score:1]
MiR-195 is clustered with miR-497 [13] and belongs to miR-15 family [14]. [score:1]
[1 to 20 of 5 sentences]
30
[+] score: 13
Recently, miR-497 was demonstrated to bind to the 3′ untranslated regions of IGF-1R mRNA, and upregulation of miR-497 downregulated IGF-1R protein expression. [score:11]
Further investigation showed that small interfering RNA -mediated IGF-1R knockdown could mimic the effect of enforced miR-497 expression on the malignant phenotypes of cervical cancer cells (108). [score:2]
[1 to 20 of 2 sentences]
31
[+] score: 13
MiR-195 functions as a tumor suppressor miRNA by targeting several genes involved in cell cycle acceleration and anti-apoptotic factors including BCL-2. Another BCL-2 targeting miRNA is miR-497 demonstrated to directly hybridize to the predicted 3′-UTR target sites of this gene. [score:10]
As shown in Figure 4, we identified the BCL-2 gene as being a specific target of miR-21, miR-181a, miR-181b, miR-29a, miR-29b, miR-497, miR-195, let-7a, miR-34a and miR-1915 (Figure 4 and Table 4). [score:3]
[1 to 20 of 2 sentences]
32
[+] score: 12
MicroRNA-497 targets insulin-like growth factor 1 receptor and has a tumour suppressive role in human colorectal cancer. [score:4]
Analysis of and miR-497 expression, regulation and role in breast cancer. [score:4]
is repressed in breast cancer (Li et al., 2011) and gastric cancer (Deng et al., 2013) owing to hypermethylation of CpG islands upstream of the miR-497/miR-195 locus. [score:1]
Human chromosomal locus of gene is derived from the miR-497/miR-195 locus at human chromosome 17p13.1 (Figure 2). [score:1]
is derived from the miR-497/miR-195 locus at human chromosome 17p13.1 (Figure 2). [score:1]
is repressed in colorectal cancer owing to deletion of the miR-497/miR-195 locus (Guo et al., 2013), while is repressed in colorectal adenoma mainly owing to epigenetic silencing and in part owing to deletion (Menigatti et al., 2013). [score:1]
[1 to 20 of 6 sentences]
33
[+] score: 12
The cytoplasmic levels of miR-373 and miR-497*, which were not decreased by XPO5 knockdown via siRNA treatment, were significantly decreased by XPO1 inhibition via LMB treatment (Figure 4E and 4F), indicating that XPO1 acts as an alternative nucleo-cytoplasmic transporter for these miRNAs. [score:4]
Except for miR-373 and miR-497*, the mature miRNA levels of all tested miRNAs were significantly lower after XPO5 down-regulation (Figure 4D). [score:4]
The levels of the miRNAs miR-302c, miR-302c*, miR-125b, miR-196a, miR-155, miR-527, miR-30b*, miR-106b, miR-373 and miR-497* were chosen to exemplify the effect of XPO5 knockdown on the cytoplasmic level of miRNAs. [score:2]
The levels of (E) miR-373 and (F) miR-497* were significantly lower after XPO1 inhibition via leptomycin B (LMB) compared with control -treated cells (Ctrl). [score:2]
[1 to 20 of 4 sentences]
34
[+] score: 12
MiR-497-5p exerts tumor-suppressive function in human angiosarcoma, reintroduction of miR-497-5p reduces KCa3.1 expression by targeting its mRNA 3′-UTR (Chen et al., 2016). [score:7]
miR-497–5p inhibits cell proliferation and invasion by targeting KCa3.1 in angiosarcoma. [score:5]
[1 to 20 of 2 sentences]
35
[+] score: 12
Tijsen et al. (2014[155]) also demonstrated that when mice were injected subcutaneously with locked nucleic acid (LNA) -based antimiR-15b, the loss of the miR-15 family members (miR-15-5p, miR-16-5p, miR-195-5p, miR-322 (mouse homolog to human miR-424-5p), and miR-497-5p resulted in a significant up-regulation of TGFβR1 and SMAD3 mRNA, and a trend towards up-regulation of p38, TGFβR2, TGFβR3, SMAD4, SMAD7, and endoglin mRNA. [score:7]
The miR-15/107 family includes miR-15a-5p, miR-15b-5p, miR-16-5p, miR-103-3p, miR-107 (which are expressed in all vertebrates), miR-195-5p, miR-424-5p, miR-497-5p, miR-503-5p (which are expressed in mammals), and miR-646 (human specific) (Finnerty et al., 2010[53]). [score:5]
[1 to 20 of 2 sentences]
36
[+] score: 12
Tumor suppressor miRNAs (miR-15b, miR-16, miR-34, miR-181b, miR-181c, and miR-497) target anti-apoptotic Bcl-2. These miRNA clusters are downregulated in gastric cancer cells, leading to increased expression of Bcl-2 and inhibition of apoptosis. [score:12]
[1 to 20 of 1 sentences]
37
[+] score: 11
Levels of miR-497 correlated with oxygen-glucose deprivation -induced effects on N2A cells: decreased miR-497 suppressed cell death, whereas increased miR-497 increased neuronal loss. [score:3]
These studies show that miR-497 promotes ischemic neuronal death by repressing expression of Bcl-2 and Bcl-w, supporting the role of apoptosis in the pathogenesis of ischemic brain injury [89, 90]. [score:3]
As miR-497 directly binds to the 30-UTR of Bcl-2/-w, the knockdown of cerebral miR-497 in mice enhanced Bcl-2/-w protein levels in the ischemic region, attenuated brain infarction, and improved neurological outcome after focal ischemia. [score:3]
There is also specific induction of miR-497 in mouse brain after transient ischemia, and in mouse N2A neuroblastoma (N2A) cells after oxygen-glucose deprivation [86]. [score:1]
Another, miR120 is positively correlated with better prognosis in stroke patients and antagonists to miR497, infused prior to stroke, reduce infarct volume. [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 11
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
severe (p<0.05) cfa-let-7d, cfa-miR-101, cfa-miR-10a, cfa-miR-1296, cfa-miR-1306, cfa-miR-1307, cfa-miR-130a, cfa-miR-136, cfa-miR-17, cfa-miR-181b, cfa-miR-196b, cfa-miR-197, cfa-miR-215, cfa-miR-22, cfa-miR-30d, cfa-miR-33b, cfa-miR-497, cfa-miR-503, cfa-miR-574, cfa-miR-628, cfa-miR-676 Comparing the miRNA differential expression analyses between disease states obtained by RT-qPCR and RNAseq, we observed discordances between the two methods. [score:5]
severe (p<0.05) cfa-let-7c, cfa-miR-10a, cfa-miR-1307, cfa-miR-132, cfa-miR-136, cfa-miR-181a, cfa-miR-181b, cfa-miR-196b, cfa-miR-20a, cfa-miR-30d, cfa-miR-33b, cfa-miR-34c, cfa-miR-497, cfa-miR-499, cfa-miR-676 Mild vs. [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 11
For the efficient target CHEK1, miR-497 repressed it only in normal stage, and it had contribution to the ‘regulation of double-strand break repair via homologous recombination’ process only in CIN I stage. [score:4]
For the efficient target CCNE1, miR-497 repressed it only in normal stage, and it had contribution to the ‘DNA replication initiation’ process only in CIN I stage. [score:3]
Our finding suggests that based on miR-497’s differential regulation on CHEK1, the homologous recombination repair for DNA double-strand break was stimulated in CIN I stage, which may enhance the chance of HPV integration. [score:2]
Our finding suggests that based on miR-497’s differential regulation on CCNE1, the cell cycle G1/S transition may be promoted in CIN I stage. [score:2]
[1 to 20 of 4 sentences]
40
[+] score: 10
Interestingly, several miRNAs were significantly upregulated (miR-196a and miR-200a), or downregulated (miR-7, miR-124 and miR-497) among which miR-124 was the most significantly downregulated miRNA (Figure 1A). [score:10]
[1 to 20 of 1 sentences]
41
[+] score: 10
For example, Cluster 51 targets the expression of 141 genes (Additional file 1: Tables S6 and S7) including 13 genes (PPM1A, TSPAN5, APP, PIM1, COPS2, CSDE1, WDTC1, AP2A1, CARM1, FURIN, EPB49, FAM134A, and SH3BGRL2) known [26] to be targets of a small set of miRNAs (miR-15A, miR-16, miR-15B, miR-195, miR-424, miR-497), a highly significant enrichment (FDR < 0.0001). [score:7]
Access to the measured miRNA expression data from the same whole blood samples [27] allowed us to compare the expression levels of five of these six miRNAs (miR-497 was not measured) with expression levels of the 13 genes. [score:3]
[1 to 20 of 2 sentences]
42
[+] score: 10
In our data, VEGF, ECAM1 and numerous genes involved in angiogenesis were down-regulated, as well as angiogenic signaling mediators PI3K, p85 and Akt-1. Among these genes, our data suggest that the expression of PECAM1 was regulated by let-7i, miR-322 and miR-497, and the expression of VE-cadherin and β-cadherin regulated by miR-27a. [score:10]
[1 to 20 of 1 sentences]
43
[+] score: 10
LncRNAs regulate glucose uptake and glycolytic flux by modulating GLUTs and glycolic enzymes HK2 was a direct target of miR-497, long non-coding RNA PVT1 acts as molecular sponge to repress miR-497, as a result, PVT1 promotes glycolysis and cell proliferation in osteosarcoma and form a PVT1/miR-497 axis in the Warburg effect through regulation of HK2 expression [39] (Fig. 1). [score:8]
Song J, Wu X, Liu F, Li M, Sun Y, Wang Y, et al. Long non-coding RNA PVT1 promotes glycolysis and tumor progression by regulating miR-497/HK2 axis in osteosarcoma. [score:2]
[1 to 20 of 2 sentences]
44
[+] score: 9
So we paid more attention to miR-15a, miR-15b, miR-16, miR-195, miR-424 and miR-497, which are the targeted results for CX3CL1 in the Targetscan Database. [score:5]
In order to investigate whether some micro -RNA contained in the MVs played a role, we searched CX3CL1 in the TargetScan database (version 6.2) and identified six putative micro -RNA (miR-15a, miR-15b, miR-16, miR-195, miR-424 and miR-497) targets to CX3CL1 mRNA by matching the seed regions of each. [score:3]
The real-time quantitative PCR analysis indicated that there were relatively high levels of miR-15a, miR-15b and miR-16 contained in hWJMSC-MVs, but none or low levels of miR-195, miR-424 and miR-497 (Figure  7B). [score:1]
[1 to 20 of 3 sentences]
45
[+] score: 9
Several miRNAs were reported to inhibit different downstream genes to delay the progress of HCC, including miR-636 (inhibiting Ras-PI3K/AKT pathway) [40], miR-16 (inhibiting COX-2) [41], miR-497 (inhibiting CHEK1) [42], and so on. [score:9]
[1 to 20 of 1 sentences]
46
[+] score: 9
By inhibiting vascular endothelial growth factor A (VEGFA) and astrocyte elevated gene-1 (AEG-1), miR-497 suppresses microvessel densities in xenograft cancers [72]. [score:5]
CCNE1, CDC25A, CCND3, CDK4, and BTRC have been identified as direct targets of miR-497 and miR-195, which leads to aberrant cell proliferation in hepatocarcinogenesis [24]. [score:4]
[1 to 20 of 2 sentences]
47
[+] score: 9
Notably, a group of miRNAs including miR-16 and miR-195, which belong to the miR-15/16 family involving miR-15a/b, miR-16, miR-195, miR-424 and miR-497, are downregulated in human glioblastoma cells, and their abnormal expression patterns are associated with the survival rate of GBM patients compared to non-tumorous cells (7– 9). [score:5]
For example, downregulation of miR-195 and miR-497 may strongly affect cell cycle progression and lead to an aberrant cell proliferation in hepatocellular carcinoma cell lines (25). [score:4]
[1 to 20 of 2 sentences]
48
[+] score: 9
A. Real-time PCR showed that the expression of human miR-133b, miR-204-5p, miR-30e-5p, miR-4270, miR-129-2-3p, miR-202-3p, miR-195-5p, miR-664b-3p, miR-497-5p, miR-34b-5p, miR-513a-5p, and miR-101-3p was statistically higher in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
Real-time PCR revealed that hsa-miR-133b, hsa-miR-204-5p, hsa-miR-30e-5p, hsa-miR-4270, hsa-miR-129-2-3p, hsa-miR-202-3p, hsa-miR-195-5p, hsa-miR-664b-3p, hsa-miR-497-5p, hsa-miR-34b-5p, hsa-miR-513a-5p, and hsa-miR-101-3p were statistically upregulated in human Sertoli cells of SCOS patients compared to OA patients (Figure 3A). [score:3]
Figure 3 A. Real-time PCR showed that the expression of human miR-133b, miR-204-5p, miR-30e-5p, miR-4270, miR-129-2-3p, miR-202-3p, miR-195-5p, miR-664b-3p, miR-497-5p, miR-34b-5p, miR-513a-5p, and miR-101-3p was statistically higher in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
[1 to 20 of 3 sentences]
49
[+] score: 8
For example, the nerve growth factor receptor pathway was enriched in miR-regulated PINs of miR-520d-3p, miR-497-5p, miR-125a-5p, miR-125b-5p, and miR-31-5p, and the epidermal growth factor receptor pathway was enriched in miR-regulated PINs of miR-520d-3p, miR-21-5p, and miR-497-5p. [score:3]
Notably, our results (Figures 2 and S1 and Table S4) showed that let-7c (Figure 2), miR-497-5p, miR-125b-5p, and some other miRNAs of miRNA-regulated PINs, performed well when used as breast cancer diagnostic markers. [score:2]
For example, in the miR-497-5p-regulated PIN, the term “androgen receptor signaling pathway” was enriched. [score:2]
We noted that 7 miRNAs had enriched GO terms related to apoptosis, cell death, and cell proliferation, i. e., miR-520d-3p, miR-497-5p, miR-125b-5p, miR-21-5p, miR-31-5p, let-7c, and miR-125-5p. [score:1]
[1 to 20 of 4 sentences]
50
[+] score: 7
Other miRNAs from this paper: hsa-mir-138-2, hsa-mir-138-1
Huang et al. showed that miR-497 could inhibit the proliferation of NSCLC by inhibiting the protein expression of YAP1, suggesting that YAP1 plays an oncogenic role in NSCLC. [score:7]
[1 to 20 of 1 sentences]
51
[+] score: 7
Here, 37 miRNAs (miR-16, miR-23a, miR-23b, miR-143, miR-145, miR-195,miR-221, miR-222, miR-497 et al. ) were found to be downregulated in hormone-refractory late-stage prostate carcinomas, whereas 14 miRNAs were upregulated in hormonerefractory carcinomas. [score:7]
[1 to 20 of 1 sentences]
52
[+] score: 6
Among the fifteen miRNAs in the top group, two miRNAs were highly likely to be upregulated, i. e., hsa-miR-24and hsa-miR-885-5p, whereas thirteen miRNAs were highly likely to be downregulated, i. e., hsa-miR-26b, hsa-let-7b, hsa-miR-185, hsa-miR-142-3p, hsa-miR-29b, hsa-miR-483-5p, hsa-miR-144*, hsa-miR-145*, hsa-miR-629*, hsa-miR-222*, hsa-miR-497, hsa-miR-675 and hsa-miR-106b*, in the eutopic endometrium of patients with endometriosis compared with the controls (Table 2). [score:6]
[1 to 20 of 1 sentences]
53
[+] score: 6
Other miRNAs from this paper: mmu-mir-497a, mmu-mir-497b
Shan K, Pang R, Zhao C, Liu X, Gao W, Zhang J, et al. IL-17-triggered downregulation of miR-497 results in high HIF-1α expression and consequent IL-1β and IL-6 production by astrocytes in EAE mice. [score:6]
[1 to 20 of 1 sentences]
54
[+] score: 6
Other miRNAs from this paper: mmu-mir-497a, mmu-mir-497b
Luo Q. Li X. Gao Y. Long Y. Chen L. Huang Y. Fang L. MiRNA-497 regulates cell growth and invasion by targeting cyclin E1 in breast cancer Cancer Cell Int. [score:3]
Luo et al. [22] declared that overexpression of MicroRNA-497 inhibited breast cancer cellular migration and invasion, which were documented by trans-well assay. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 6
Similarly, miR-15a and miR-497 share most of their targets and they belong to the same miR-15 family (Figure 3B). [score:3]
Interestingly, most of these miRNAs are coincident with those appearing in Table 1 (miR-374b, miR-148a, miR-181a, miR-373, miR-320a, miR-93, miR-106b, miR-497, miR-23a, miR-19b, miR-107, miR-15a, miR-330-5p, miR-144), indicating that, apart from being targeting many mRNAs, these miRNAs are participating in the most reliable interactions. [score:3]
[1 to 20 of 2 sentences]
56
[+] score: 6
The miR-200bc/429 cluster, miR-497 and miR-181b, have been shown to be down-regulated in gastric cancer cell lines [12], [13], [14], and these miRNAs have been suggested to play a role in the development of multidrug resistance by modulating apoptosis through the regulation of BCL2 [15]. [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Both miR-302b and -497 can target BCL2; increased levels of miR-497 were shown to be critical for mitochondria -dependent neuronal apoptosis [129]. [score:3]
Yadav S. Pandey A. Shukla A. Talwelkar S. S. Kumar A. Pant A. B. Parmar D. MiR-497 and miR-302B regulate ethanol -induced neuronal cell death through BCL2 protein and cyclin D2 J. Biol. [score:2]
In a human neuroblastoma cell line, in vitro long term ethanol exposure (72 h) results in a dramatic increase in miR-302b and miR-497. [score:1]
[1 to 20 of 3 sentences]
58
[+] score: 6
For example, miR-125b, miR-320b, miR34a-5p and miR-497–5p have been associated with acute myocardial infarction [61, 68– 70] affecting its occurrence, pathogenesis and mortality risk, and miR-125b, miR-320b, miR-497–5p and miR-99b-5p have been associated with atherosclerosis and coronary artery disease development [61, 71, 72]. [score:4]
Comparison of the pericardial fluid miRNA profile to other biofluids revealed that 7 miRNAs (miR-21–5p, miR-148a-3p, miR-152, miR-93–5p, miR-29b-3p, miR-184 and miR-218–5p) were present in all fluid types and 6 miRNAs (miR-125b-5p, miR-320b, miR-34a-5p, miR-497–5p, miR-99b-5p and let-7d-3p) were specific to pericardial fluid. [score:1]
When comparing the miRNAs detected from the pericardial fluid samples over the global mean (i. e. Cp < 30) with the 12 body fluid types profiled previously by Weber and others [25], six of the miRNAs (miR-125b-5p, miR-320b, miR-34a-5p, miR-497–5p, miR-99b-5p and let-7d-3p) were found to be specific for pericardial fluid (Table 5). [score:1]
[1 to 20 of 3 sentences]
59
[+] score: 6
The expression of both miR-16 and miR-497 did not change with age (Fig.   2a). [score:3]
The relative expression of (MS00031423, QIAGEN Pty Ltd, Doncaster, Australia), the (miR-15a, MS00008785; miR-15b, MS00008799; miR-16, MS00031493; miR-195, MS00008953; miR-497, MS00031906; QIAGEN Pty Ltd, Doncaster, Australia), miR-199a (MS00007602; QIAGEN Pty Ltd, Doncaster, Australia) and miR-590 (MS00010269; QIAGEN Pty Ltd, Doncaster, Australia) were measured using quantitative real-time reverse transcription PCR (qRT-PCR) on an ABI ViiA7 (PE Applied Biosystems, Foster City, CA). [score:1]
Consistent with this view, miRNA implicated in rodent cardiomyocyte quiescence,, miR-497 and miR-195, were identified in Clusters 4, 4 and 1, respectively, from the. [score:1]
members miR-15b, miR-16, miR-195 and miR-497 were identified in Clusters 5, 2, 1 and 4, respectively. [score:1]
[1 to 20 of 4 sentences]
60
[+] score: 5
By analysis of the global expression profile of miRNAs in primary breast cancer and normal adjacent tumor tissues (NATs), Yan et al. showed that seven miRNAs (miR-497, miR-31, miR-355, miR-320, mir-140, miR-127, and miR-30a-3p) were downregulated more than twofold in BC tissue compared with normal adjacent tissues [14]. [score:5]
[1 to 20 of 1 sentences]
61
[+] score: 5
In this way, 13 novel miRNAs (including miR-150, miR-497, and miR-344-3p) were found to show differential expression patterns between GK diabetic rats and normal Wistar rats for the first time, providing more new potential targets for research on T2DM. [score:5]
[1 to 20 of 1 sentences]
62
[+] score: 5
In vitro silencing of circPVT1 inhibits tumor cell proliferation(69) Up AML Potentially pro-tumorigenic role and associates with 8q24 chromosome amplicons(70) Up HNSCC Potentially pro-tumorigenic by sponging miR-497-5p. [score:3]
A third article confirms the oncogenic potential of circPVT1: the circularized transcript is high in head and neck squamous cell carcinoma (HNSCC), especially in patients with TP53 mutations, and has the ability to sponge miR-497-5p (71). [score:2]
[1 to 20 of 2 sentences]
63
[+] score: 5
However, some miRNAs, such as hsa-miR-7b and hsa-miR-497, had a high number of targets both in TargetScan (top 4.0% and 0.8%, respectively) and miRanda (top 6.0% and 11.2%, respectively), which were also included in our analysis, but they were not identified as hub nodes after our consecutive analysis. [score:5]
[1 to 20 of 1 sentences]
64
[+] score: 5
Lin et al. found robust and significant downregulation of 8 miRNAs in the hypertonic dialysate group (miR-31, miR-93, miR-100, miR-152, miR-497, miR-192, miR-194, and miR-200b) and increased expression of miR-122 was observed in the hypertonic dialysate group compared with the saline and control groups [26]. [score:5]
[1 to 20 of 1 sentences]
65
[+] score: 5
It is also the common candidate target of other ten significantly differentially expressed miRNAs, i. e. miR-203, miR-195-5p, miR-497-5p, miR-424-5p, miR-16, miR-15b-5p, miR-27a, miR-27b, miR-101 and miR-590-3p. [score:5]
[1 to 20 of 1 sentences]
66
[+] score: 5
In addition to miR-15b human dermal fibroblasts also express miR-15a and miR-16-1 at high and comparable copy numbers, whereas the expression levels of miR-16-2, miR-195, and miR-497 were clearly lower (suppl. [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 5
In addition, overexpression of miR-497 lead to suppression of IGF1-R activity in colorectal cancer cells [144]. [score:5]
[1 to 20 of 1 sentences]
68
[+] score: 5
MiR-497 targeted and repressed MEK1 expression in HeLa cells [104]. [score:4]
Interestingly, miR-497 was also associated with a decreased RAF1 and ERK1 protein levels. [score:1]
[1 to 20 of 2 sentences]
69
[+] score: 5
Hullinger et al showed that an 8-mer LNA complementary to the seed region of the miR-15 family members, including miR-15a, -15b, 16-1, -16-2, -195 and miR-497, was more potent in eliciting derepression of downstream targets than a 16-mer LNA -modified targeting a specific family member, while both compounds showed comparable uptake to cardiac tissue (Hullinger et al, 2012). [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 5
Other miRNAs from this paper: hsa-mir-199a-1, hsa-mir-199a-2, hsa-mir-506
In addition, recently miR-497 and miR-506 were reported to inhibit cell proliferation and induce apoptosis by targeting YAP1 in HCC [31, 32]. [score:5]
[1 to 20 of 1 sentences]
71
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-2, hsa-let-7c, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-2, hsa-mir-100, hsa-mir-29b-2, mmu-let-7i, mmu-mir-99b, mmu-mir-125a, mmu-mir-130a, mmu-mir-142a, mmu-mir-144, mmu-mir-155, mmu-mir-183, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-148a, mmu-mir-143, hsa-mir-181c, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-181a-1, hsa-mir-200b, mmu-mir-298, mmu-mir-34b, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-130a, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-125a, mmu-mir-148a, mmu-mir-196a-1, mmu-let-7a-2, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-mir-15a, mmu-mir-16-1, mmu-mir-21a, mmu-mir-22, mmu-mir-23a, mmu-mir-24-2, rno-mir-148b, mmu-mir-148b, hsa-mir-200c, hsa-mir-155, mmu-mir-100, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-181c, hsa-mir-34b, hsa-mir-99b, hsa-mir-374a, hsa-mir-148b, rno-let-7a-2, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7i, rno-mir-21, rno-mir-22, rno-mir-23a, rno-mir-24-2, rno-mir-29b-2, rno-mir-34b, rno-mir-99b, rno-mir-100, rno-mir-124-1, rno-mir-124-2, rno-mir-125a, rno-mir-130a, rno-mir-142, rno-mir-143, rno-mir-144, rno-mir-181c, rno-mir-183, rno-mir-199a, rno-mir-200c, rno-mir-200b, rno-mir-181a-1, rno-mir-298, hsa-mir-193b, hsa-mir-568, hsa-mir-572, hsa-mir-596, hsa-mir-612, rno-mir-664-1, rno-mir-664-2, rno-mir-497, mmu-mir-374b, mmu-mir-497a, mmu-mir-193b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-568, hsa-mir-298, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, hsa-mir-664a, mmu-mir-664, rno-mir-568, hsa-mir-664b, mmu-mir-21b, mmu-mir-21c, rno-mir-155, mmu-mir-142b, mmu-mir-497b, rno-mir-148a, rno-mir-15a, rno-mir-193b
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
For instance, the high conservation of flanking sequence downstream of mir-497~195 can be attributed to the presence of an antisense transcript 'c17orf49'. [score:1]
A few pri-miRNAs exhibit conservation along the entire length of the pri-miRNA (for example mir-497~195, mir-99b~let-7c~mir-125a, mir-124-2, mir-130a and mmu-mir-568) (Figure 10). [score:1]
Cluster Mapped ESTs Mapped cDNAs mir-497~195 Human: CR737132, DB266639, DA2895925, BI752321, AA631714 Human: AK098506.1 Rat: CV105515 mir-144-451 Human: R28106 Mouse: AK158085.1 Rat: AW919398, BF2869095, AI008234 mir-99b~let-7e~mir-125a Human: DB340912 Human: AK125996 mir-143~145 Human: BM702257 mir-181a-1~181b-1 Human: DA528985, BX355821 Mouse: BE332980, CA874578 mir-29b-2~29c Human: BF089238 Mouse: AK081202, BC058715 mir-298~296 Human: W37080 mir-183~96~182 Human: CV424506 mir-181c~181d Human: AI801869, CB961518, CB991710, BU729805, CB996698, BM702754 Mouse: CJ191375 mir-100~let-7a-2 Human: DA545600, DA579531, DA474693, DA558986, DA600978 Human: AK091713 Mouse: BB657503, BM936455 Rat: BF412891, BF412890, BF412889, BF412895 Mouse: AK084170 mir-374b~421 Human: DA706043, DA721080 Human: AK125301 Rat: BF559199, BI274699 Mouse: BC027389, AK035525, BC076616, AK085125 mir-34b~34c Human: BC021736 mir-15a-16-1 Human: BG612167, BU932403, BG613187, BG500819 Human: BC022349, BC022282, BC070292, BC026275, BC055417, AF264787 Mouse: AI789372, BY718835 Mouse: AK134888, AF380423, AF380425, AK080165 mir-193b~365-1 Human: BX108536 hsa-mir-200c~141 Human: AI969882, AI695443, AA863395, BM855863.1, AA863389 mir-374a~545 Human: DA685273, AL698517, DA246751, DA755860, CF994086, DA932670, DA182706 Human: AK057701 Figure 2 Predicted pri-miRNAs, their lengths, and features that support the pri-miRNA prediction. [score:1]
[1 to 20 of 4 sentences]
72
[+] score: 4
Previous microarray analyses revealed that 23 miRNAs are downregulated in CRC tissues (Additional file 1: Table S3), including miR-497 [21], miR-9 [22], miR-30a [23], and miR-139 [24]. [score:4]
[1 to 20 of 1 sentences]
73
[+] score: 4
Other miRNAs from this paper: hsa-mir-145
Shao XJ The down-regulation of microRNA-497 contributes to cell growth and cisplatin resistance through PI3K/Akt pathway in osteosarcomaCell. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
Through profiling and comparing miRNA expression between P1 and P10 rat cardiomyocytes, members of the miR-15 family, including miR-195, miR-15a, miR-15b, miR-16, and miR-497, were identified as important regulators of postnatal cardiomyocyte mitotic arrest [11]. [score:4]
[1 to 20 of 1 sentences]
75
[+] score: 4
Other miRNAs from this paper: mmu-mir-497a, mmu-mir-497b
Wang W MicroRNA-497 suppresses angiogenesis by targeting vascular endothelial growth factor A through the PI3K/AKT and MAPK/ERK pathways in ovarian cancerOncol. [score:4]
[1 to 20 of 1 sentences]
76
[+] score: 4
Recently, similar observations have been made where edited miR-497* (also with A-C mismatch) showed increased processing by Drosha and was found to be the most downregulated in ADAR2 deficient mice [33]. [score:4]
[1 to 20 of 1 sentences]
77
[+] score: 4
001 hsa-miR-210 11p15.5 Up (3.23) 0.021 hsa-miR-30b 8q24.2 Down (-2.02) 0.015 hsa-miR-30c 1p34.2 Down (-2.32) 0.039 hsa-miR-494 14q32.3 Up (8.03) 0.021 hsa-miR-497 17p13.1 Down (-2.15) 0.014 hsa-miR-502 Xp11.23 Down (-2.43) 0.014 hsa-miR-532 Xp11.23 Down (-2.11) 0.049 hsa-miR-551b 3q26.2 Down (-7.30) 0.034 hsa-miR-622 13q31.1 Up (2.39) 0.015 Hierarchical clustering of 44 miRNA genes with significantly different expression (p<0.05) in tumor tissues. [score:3]
001 hsa-miR-210 11p15.5 Up (3.23) 0.021 hsa-miR-30b 8q24.2 Down (-2.02) 0.015 hsa-miR-30c 1p34.2 Down (-2.32) 0.039 hsa-miR-494 14q32.3 Up (8.03) 0.021 hsa-miR-497 17p13.1 Down (-2.15) 0.014 hsa-miR-502 Xp11.23 Down (-2.43) 0.014 hsa-miR-532 Xp11.23 Down (-2.11) 0.049 hsa-miR-551b 3q26.2 Down (-7.30) 0.034 hsa-miR-622 13q31.1 Up (2.39) 0.015 Three miRNAs (hsa-miR-494, hsa-miR-551b, and ebv-miR-BART19) were validated in an independent sample set of non-TRU- and TRU-type lung adenocarcinoma and corresponding normal lung tissue (n = 21 and 12, respectively) by qRT-PCR. [score:1]
[1 to 20 of 2 sentences]
78
[+] score: 4
Down-regulation of miR-186, miR-203, miR-181b or miR-497 could influence the sensitivity of ovarian, breast, lung or gastric cancer to cisplatin treatment [8, 9]. [score:4]
[1 to 20 of 1 sentences]
79
[+] score: 4
Interestingly, among the miRNAs found to be upregulated in exosomes in response to cytokines, several of them including miR-146a, miR-146b, miR-195, miR-290a-3p, miR-362-3p and miR-497 are known to be involved in cell death [29- 34]. [score:4]
[1 to 20 of 1 sentences]
80
[+] score: 3
We chose the top scoring miRNA constructs from the second-round, confirmation screen: mir-497, mir-96, mir-141, and mir-184 (figure 1d). [score:1]
We also included three miRNA constructs encoding miRNAs belonging to the same families of the top hits, which were also represented in the 20 best-performing miRNA constructs of the confirmation screen: mir-16-2, mir-182, and mir-200a, which are related to mir-497, mir-96, and mir-141 respectively (figure 1d). [score:1]
Two members from the miR-15/16 family, i. e. miR-16 and miR-497, were also identified in our screen. [score:1]
[1 to 20 of 3 sentences]
81
[+] score: 3
As illustrated in Figure 4a, the expression levels of hsa-miR-497 are approximately equal in both tissues; while, it has diverse isomiR distribution patterns (p value≈0) between G1235N and G1245T tissue. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-30e
Interestingly, ectopic miR-34a was shown to sensitizecolorectal carcinoma cells to 5-fluorouracil [33]; meanwhile,miR-497 reduces tumor cell proliferation and sensitizes to 5-fluorouracil by inactivating KSR1 [34], and targets N-RAS to increase temozolomide -dependent apoptosis in gliomas [35]. [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
A recent study on miRNA profiling in childhood asthma showed that several miRNA genes, including let-7e, miR-98, and miR-497 demonstrated an over two-fold up-regulation in moderate-to-severe asthma as compared to the control group [46]. [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 3
The other component comprises several circuits involving miR-17, miR-195 and miR-497 together with NF1 (a hypoxia-activated gene), TFAP4 (another cancer gene with prognostic importance in gastric carcinoma), MYC and HNF1A, and common target genes, which can mainly be classified as cancer genes. [score:3]
[1 to 20 of 1 sentences]
85
[+] score: 3
We tested the expression levels of miR-218, miR-497, miR-30b and miR-137 in A549, A549/CDDP and A549/PTX cell lines. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
Of 262 miRNAs in the network significantly correlated with at least one pathway, 8020 miRNA pairs (out of >20,000 possible pairs) were candidates for pathway cotargeting, including hsa-miR-497 and hsa-miR-503 (ER, Ras, and TGF-β), hsa-miR-20a and hsa-miR-372 (EGFR and p53), and hsa-miR-192 and hsa-miR-215 (BRCA1 and HER2). [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
For example, miR-195, miR-497, and miR-30b were found to be enriched in the cerebellum whereas miR-218, miR-221, miR-222, miR-26a, miR-128a/b, miR-138 and let-7c were highly expressed in the HIP. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
Similarly, according to the miRanda algorithm miR-497, miR-15a, miR-424, miR-195, miR-16 and miR-15b can target UCP2, accessed on February 25, 2016. [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
Among these miRNAs, let-7 family members such as let-7f [29], miR-34a [30], miR-127 [31], miR-148a [32], miR-424 [33] and miR-497 [34] are known to display tumor suppressor effects in tumors. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
For example, lower miR-497 levels in human CRC tissues induce KSR1 expression which is associated with CRC cancer occurrence, advanced stages, metastasis and chemoresistance [10]. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
miR-15b, a member of the miR-16 family(miR15a/b, miR-16, miR-195, miR-424 and miR-497), which targets genes important for the G1 - S transition, is reported increased in HCC [12]. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
For instance, Olsen et al. reported miR-206 and miR-497 being expressed at significantly higher levels in the adult cerebellum compared to other brain regions in rats. [score:2]
In mice, on the other hand, Bak et al. reported that miR-195, miR-497, and miR-30b are enriched in the mouse cerebellum (Bak et al., 2008) whereas Hohjoh and Fukushima reported cerebellar enrichment of miR-16, - miR-34a, in addition to miR-195 (Hohjoh and Fukushima, 2007). [score:1]
[1 to 20 of 2 sentences]
93
[+] score: 3
For example, some miRNAs (miR-497, miR-128, miR-15, and miR-16) can induce apoptosis by targeting BCL2 in neuronal cells [9, 53, 54]. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
Other miRNAs from this paper: hsa-mir-34a
XIST is associated with tumor progression through targeting miR-34a-5p or miR-497/MACC1 axis in nasopharyngeal carcinoma [22] and gastric cancer [19] individually. [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-205, hsa-mir-210, hsa-mir-221, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-125b-2, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-130b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-362, hsa-mir-363, hsa-mir-376c, hsa-mir-371a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-342, hsa-mir-151a, hsa-mir-324, hsa-mir-335, hsa-mir-345, hsa-mir-423, hsa-mir-483, hsa-mir-486-1, hsa-mir-146b, hsa-mir-202, hsa-mir-432, hsa-mir-494, hsa-mir-495, hsa-mir-193b, hsa-mir-455, hsa-mir-545, hsa-mir-376a-2, hsa-mir-487b, hsa-mir-551a, hsa-mir-571, hsa-mir-574, hsa-mir-576, hsa-mir-606, hsa-mir-628, hsa-mir-629, hsa-mir-411, hsa-mir-671, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-889, hsa-mir-876, hsa-mir-744, hsa-mir-885, hsa-mir-920, hsa-mir-937, hsa-mir-297, hsa-mir-1233-1, hsa-mir-1260a, hsa-mir-664a, hsa-mir-320c-2, hsa-mir-2861, hsa-mir-378b, hsa-mir-1260b, hsa-mir-378c, hsa-mir-1233-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-664b, hsa-mir-378j, hsa-mir-486-2
Markers for liver fibrosis in HBV-infected patients have also been examined, with miR-345-3p, miR-371a-5p, and miR-2861 reported as positive indicators of fibrosis, whereas miR-486-3p and miR-497-5p exhibited lower expression at all stages of fibrosis when compared to non-fibrosis CHB patients (173). [score:2]
[1 to 20 of 1 sentences]
96
[+] score: 2
Rats with increased IOP due to a hypertonic saline eye injection had decreased expression of MicroRNA-181c, MicroRNA-497, MicroRNA-204, Let-7a, MicroRNA-29b, MicroRNA-16, MicroRNA-106b, and MicroRNA-25 in their retinas [34]. [score:2]
[1 to 20 of 1 sentences]
97
[+] score: 2
Combined with previous studies, we chose seven candidate miRNAs which have been reported to be regulated by TGF-β treatment: miR-21, miR-155, miR-367, miR-497, miR-15a, miR-195, and miR-221 [25– 29] (Figure 4A). [score:2]
[1 to 20 of 1 sentences]
98
[+] score: 2
Other miRNAs from this paper: hsa-mir-21, hsa-mir-181a-2, hsa-mir-181a-1
MiR-497 is a potential prognostic marker in human cervical cancer and functions as a tumor suppressor by inducing caspase-3 -dependent apoptosis to decrease cell growth [92]. [score:2]
[1 to 20 of 1 sentences]
99
[+] score: 2
For example, the 17th-ranked pair miR-497-5p-miR-424-5p is a co-functional miRNA pair. [score:1]
However, as recorded by miRBase, miR-424-5p is a member of mir-322 gene family while miR-497-5p stems from the mir-497 family. [score:1]
[1 to 20 of 2 sentences]
100
[+] score: 2
To further evaluate miRNA mimics on the inhibition of cell proliferation in A2780, we selected top 10 anti-proliferative miRNAs (miR-7, miR-124a, miR-192, miR-193a, miR-193b, miR-199a [*], miR-432 [*], miR-497, miR-506 and miR-517c) from the first screen, and examined the cell viability in A2780 cells transfected with different concentrations of miRNAs (5, 25, 50 nM). [score:1]
We discovered pro-proliferative miRNAs (miR-9 [*], miR-93, miR-130a, miR-130b, miR-301, miR-302b, miR-302d, miR-363, miR-372, miR-373), and anti-proliferative miRNAs (miR-7, miR-124a, miR-192, miR-193a, miR-193b, miR-199a [*], miR-432 [*], miR-497, miR-506, miR-517c) in A2780 cells. [score:1]
[1 to 20 of 2 sentences]