sort by

149 publications mentioning hsa-mir-494 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-494. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 480
Western blot analysis showed a downregulation of dnmt3b in miR-494 -overexpressing Huh-7 cells and an upregulation in anti-miR-494 -transfected SNU182 cells (Fig. 2j), chosen based on miR-494 basal levels (Supplementary Fig.   S3A), demonstrating DNMT3B as a miR-494 direct target in HCC. [score:12]
Liu L Jiang Y Zhang H Greenlee AR Han Z Overexpressed miR-494 down-regulates PTEN gene expression in cells transformed by anti-benzo(a)pyrene-trans-7,8-dihydrodiol-9,10-epoxideLife Sci. [score:8]
Fig. 3MiR-494 targets CDKN2B, BBC3 and PTEN in HCC a QPCR and WB analyses of miR-494 and target genes in miR-494 overexpressing HepG2 and b Huh-7 cells. [score:7]
Specifically, through the modulation of epigenetic targets, miR-494 is able to remove DNA methylation tags and to trigger gene silencing of invasion-suppressor miRNAs leading to tumor metastasis [50], as well as to fine-tune its own expression by CpG island demethylation. [score:7]
MiR-494 overexpression increased cell cycle progression and promoted cell invasion and migration by targeting MCC and PTEN, whereas its inhibition decreased nodule size of MYC -driven mice liver tumors 18, 19. [score:6]
We showed that miR-494 upregulation results from simultaneous epigenetic changes, which is in agreement with previous studies describing the involvement of histone demethylation [46], but not DNA hypomethylation alone [17], in enhancing miR-494 expression in cancer cells. [score:6]
These findings demonstrated that an intricate network of epigenetic events regulate miR-494 transcription and that, in turn, it establishes complex feedback loops, by inhibiting DNMT3B and HDAC1 expression in HCC. [score:6]
MiR-494 in vivo silencing decreased PROM1 expression in miRNA -overexpressing xenografts (t-test; p = 0.002) (Fig.   1j), suggesting miR-494 influence on PROM1-specific regulation. [score:6]
In xenografts, miR-494 -mediated pten inhibition activated the PI3K/Akt oncogenic pathway favoring the accumulation of tumor-expanded myeloid-derived suppressor cells in tumor microenvironment and facilitating metastatic tumor spreading [20]. [score:5]
A decrease of p27, pten, and puma levels was displayed in miR-494-stably overexpressing cells, suggesting a long lasting inhibition in presence of a small miR-494 increase (Supplementary Fig.   S3C). [score:5]
Zhan MN MicroRNA-494 inhibits breast cancer progression by directly targeting PAK1Cell Death Dis. [score:5]
On the contrary, its decreased expression was detected in cholangiocarcinoma, breast, and gastrointestinal stromal tumors 31– 33, letting us to speculate that miR-494 might change its preferential target core depending on tissue context. [score:5]
Lower levels of these target genes were observed in tumors from miR-494 -overexpressing cells with respect to empty vector-derived tumors (t-test; p = 0.0004, p = 0.007, and p = 0.02, respectively) (Fig. 3f), further confirming our in vitro data. [score:5]
MiR-494 belongs to the widest miRNA cluster located in DLK1-DIO3 imprinted locus, which upregulation is found in a stem-like HCC subgroup with poor prognosis and is responsible, itself, for liver cancer development in mice 16– 18. [score:5]
MiR-494 -mediated caspase inhibition reflected cell viability and apoptosis variations, suggesting a central role for the caspase cascade in drug resistance of miR-494 -overexpressing cells. [score:5]
Aiming to rule out off-target effects, miR-494 -overexpressing cells were transfected with anti-miR-494 or controls before sorafenib administration (Supplementary Fig.   S5B). [score:5]
MiR-494 expression correlated with stem cell markers PROM1/CD133 and EPCAM in HCCs (Pearson’s correlation; p = 0.004; p = 0.006, respectively) (Fig.   1b, c), but not in cirrhosis, confirming miR-494 aberrant expression and its correlation with stemness markers as cancer-specific events [16]. [score:5]
Kim WK MicroRNA-494 downregulates KIT and inhibits gastrointestinal stromal tumor cell proliferationClin. [score:5]
β-actin was used to normalize qPCR and WB data a QPCR and WB analyses of miR-494 and target genes in miR-494 overexpressing HepG2 and b Huh-7 cells. [score:5]
g Box plot graph of miR-494 expression in HCC tumors divided on the basis of high or low HDAC1 and DNMT3B expression with respect to their median values. [score:5]
A recent paper reported a p53 -mediated hdac1 recruitment to PROM1 promoter causing a decrease of its transcription [44]; since we showed an inverse correlation between miR-494 and HDAC1 in HCCs, we can speculate that HDAC1 might participate to PROM1 regulation in miR-494 -overexpressing cells. [score:4]
An upregulation of pri-miR-494 was displayed in presence of epigenetic agents, with a stronger effect of DZNep-combined treatments (Fig.   2c). [score:4]
We also analyzed the multi-target activity of miR-494 as well as its complex epigenetic regulation and demonstrated miR-494 -associated mTOR pathway activation as a sorafenib resistance mechanism in HCC. [score:4]
Sun HB miR494 is an independent prognostic factor and promotes cell migration and invasion in colorectal cancer by directly targeting PTENInt. [score:4]
Our previous data reported an aberrant expression of circulating miR-494 in cirrhotic patients with HCC and a positive correlation between serum and tissue levels [22]; therefore, we wondered if miR-494 deregulation might represent a key event in hepatocarcinogenesis (Supplementary Fig.   S1 ). [score:4]
a–j U6RNA and β-actin were used as housekeeping genesTo study miR-494 role in vivo, we assayed miR-494 expression in DEN-HCC rats mirroring human disease complexity 23, 24. [score:4]
MiR-494 -overexpressing Huh-7 cells showed an enhanced resistance to doxorubicin challenge as determined by cell viability and caspase-3/7 assays (Fig. 6a), whereas its downregulation in SNU182 cells increased doxorubicin sensitivity (Fig. 6b), with only a marginal modulation of Akt/mTOR pathway. [score:4]
Epigenetic regulation of miR-494 expression in HCC. [score:4]
In line with previous findings describing an increase of miR-494 in 34% of tumor tissues and an upregulation of this miRNA cluster in a subclass of HCCs 17, 18, here we detected high miR-494 levels in 25% of tumors and an association with stemness-specific genes. [score:4]
a–j U6RNA and β-actin were used as housekeeping genes To study miR-494 role in vivo, we assayed miR-494 expression in DEN-HCC rats mirroring human disease complexity 23, 24. [score:4]
To ascertain miR/mRNA interaction, we mutated two miR-494 seed sequences exhibiting the highest likelihood of mRNA downregulation (Supplementary Fig. S2L). [score:4]
j QPCR analysis of miR-494 expression in xenograft mice following antagomiR-494 treatment. [score:3]
Any decrease of luciferase signal was detected for both mutated vectors in miR-494 -overexpressing cells (Fig. 2i). [score:3]
a, b, e, g PMXs: empty vector infected Huh-7 cells; miR-494: pMXs-miR-494 infected Huh-7 cells We next assessed miR-494 influence on stemness properties of HCC cells and observed that miR-494 overexpression increased PROM1, OCT4, and SOX2 core stemness genes, as well as ABCG2 transporter levels (Fig. 4d, e). [score:3]
We observed that miR-494 associated with sorafenib resistance in HCC preclinical mo dels and demonstrated that miR-494 -mediated mTOR pathway activation was responsible for decreased targeted therapy sensitization. [score:3]
c FACS Annexin-V plots of miR-494 overexpressing and control Huh-7 cells following doxorubicin treatment (10 µg/ml for 6 h). [score:3]
An increase of cell viability together with a decrease of caspase activity and cleavage were detected in Huh-7 cells following miR-494 enforced expression (Fig. 5c), whereas an opposite behavior was observed in anti-miR-494 -transfected SNU182 cells (Fig. 5d). [score:3]
a Box plot graph of miR-494 expression in responder (R) and non-responder nodules (NR) from Sorafenib treated HCC rats. [score:3]
a Cell images of miR-494 overexpressing Huh-7 cells or b miR-494 silenced SNU182 cells (10X magnification). [score:3]
Comparable data were obtained in miR-494 stably overexpressing cells (Supplementary Fig. S4A). [score:3]
k MSP analysis of the four tested CpG islands in miR-494 overexpressing and silenced (AM-494) HepG2 cells. [score:3]
d QPCR and western blot analyses of PROM1 expression in miR-494 or anti-miR-494 -transfected cells. [score:3]
f FACS analysis of PROM1 immunophenotype in miR-494 overexpressing and negative control (NC) Huh-7 cells. [score:3]
Fig. 7 a Box plot graph of miR-494 expression in responder (R) and non-responder nodules (NR) from Sorafenib treated HCC rats. [score:3]
MiR-494 overexpression in HepG2 and Huh-7 cells displayed a 27% and 23% increase of the S-phase cell population, respectively (t-test; p = 0.011, and p = 0.025) (Fig.   4c and Supplementary Fig. S2E), demonstrating that miR-494 is able to potentiate cell invasiveness and speed up cell cycle progression of HCC cells. [score:3]
In a hypoxia, miR-494 overexpression determined the activation of mTOR pathway, together with an increase of cell viability and a decrease of caspase-3/7 activity in Huh-7 cells. [score:3]
y-axis reports 2 [-ΔΔCt] values corresponding to miR-494 expression (log2 form). [score:3]
f QPCR analysis of miR-494 targets in the xenograft mo del. [score:3]
A demethylation pattern was observed in miR-494 -overexpressing cells, whereas a hypermethylation status was detected in miR-494-silenced cells, with CpG48 displaying the most significant variation (Fig. 2k). [score:3]
A 2.3-fold increase of invasive potential together with a 1.6-fold enhancement of migration capabilities were observed in miR-494 -overexpressing cells (t-test; p = 0.015 and p < 0.0001, respectively) (Fig.   4a, b). [score:3]
y-axis reports 2 [−ΔΔCt] values corresponding to miR-494 expression. [score:3]
y-axes report 2 [−ΔΔCt] values corresponding to miR-494 or PROM1 expression (log2 form). [score:3]
High mTOR phosphorylation levels in miR-494 -overexpressing cells let us to hypothesize a considerable involvement of this pathway in sorafenib sensitization (Fig.   6d and Supplementary Fig. S2A). [score:3]
The reporter assay showed a decreased luciferase activity of wild type, but not mutant (Supplementary Fig.   S3B, D), 3'UTR-vectors in miR-494 co -transfected with respect to control HepG2 cells (t-test; p < 0.05) (Fig.   3e), demonstrating PTEN, P27 and PUMA as miR-494 direct targets in HCC. [score:3]
FACS analysis showed a 1.6-fold increase of PROM1 positivity in miR-494 -overexpressing with respect to control cells (t-test; p < 0.0001) (Fig. 4f). [score:3]
At the light of our findings and because of incomplete data regarding epigenetic regulation of DLK1-DIO3 miRNAs in HCC [17], we investigated epigenetic auto-regulatory loops contributing to miR-494 expression. [score:3]
b Box plot graph of methylation status in HCC patients with high or low primary or mature miR-494 expression levels in tumor tissues with respect to matched non-tumor samples. [score:3]
In conclusion, this study illustrates the detrimental effect of miR-494 in sorafenib resistance via mTOR pathway activation and highlights its possible role as a therapeutic target and a candidate biomarker for patient stratification. [score:3]
Recently, Lim and coworkers validated MCC gene among miR-494 targets in HCC showing its implication in cell cycle transition, as demonstrated by functional analysis and silencing-specific experiments [18]. [score:3]
h Box plot graph of miR-494 or i PROM1 levels in control (pMXs) and miR-494 overexpressing tumor masses from xenograft mice. [score:3]
y-axes report 2 [-ΔΔCt] values corresponding to miR-494 levels (top graphs) or relative gene expression levels (bottom graphs). [score:3]
These findings let us to hypothesize that enhanced miR-494 levels, promoting oncogenic pathway activation and apoptotic signaling inhibition, might protect HCC cells against stressing events commonly observed in the tumor bulk, such as nutrient deprivation and hypoxia. [score:3]
a, b, e, g PMXs: empty vector infected Huh-7 cells; miR-494: pMXs-miR-494 infected Huh-7 cellsWe next assessed miR-494 influence on stemness properties of HCC cells and observed that miR-494 overexpression increased PROM1, OCT4, and SOX2 core stemness genes, as well as ABCG2 transporter levels (Fig. 4d, e). [score:3]
A 2.0-fold decrease of early apoptosis was observed in miR-494 -overexpressing cells (Fig. 5h), suggesting that miR-494 might strengthen cell resistance to nutrient deprivation by turning off the caspase pathway. [score:3]
A hypomethylation pattern was observed in 60% of tumors with respect to surrounding livers (Fig.   2a) in the absence of any association with primary and mature miR-494 levels (Fig.   2b), letting us to hypothesize DNA demethylation as a not a sufficient condition for miR-494 overexpression. [score:3]
Since miR-494 and miR-495 were shown to be the most potent cluster members influencing tumor cell proliferation [18], we also analyzed miR-495 expression in HCCs. [score:3]
f FACS Annexin-V plots of miR-494 overexpressing and control Huh-7 cells following sorafenib treatment (7.5 µM for 24 h). [score:3]
Strikingly, the fold-change between miR-494 -overexpressing and control cells was higher in vivo than in vitro (22.5 vs. [score:3]
Consistently, higher HIF1A levels were observed in miR-494 -overexpressing cells in basal and hypoxic conditions (Supplementary Fig. S4B, C), demonstrating the central role for miR-494 in cell survival following stressful events. [score:3]
c QPCR and WB analyses of miR-494 and target genes in miR-494 silenced SNU449, and d SNU182 cells. [score:3]
Regulatory loops involving epigenetic enzymes, such as dnmt3b, hdac1 and tet1, were assessed in HCC, highlighting the complexity of molecular events underlying miR-494 deregulation. [score:3]
a Correlation graph between miR-494 and miR-495 expression levels in tumor tissue from 28 randomly selected HCC patients. [score:3]
Western blot analysis showed an increase of akt, mtor, and ribosomal S6 phosphorylation levels in miR-494 -overexpressing Huh-7 cells (Fig.   5c), whereas miR-494 silencing determined a decrease of their phosphorylation in SNU182 cells (Fig.   5d). [score:3]
DNA sequence of precursor miR-494 was inserted between XhoI cloning sites of pMXs-miR-GFP/Puro retroviral expression vector according to the manufacturer's datasheet (Cell Biolabs, San Diego, USA). [score:3]
In starvation, an increase of cell viability and akt/mtor phosphorylation, together with decreased apoptotic markers were displayed in miR-494 -overexpressing Huh-7 cells (Fig. 5f). [score:3]
Fig. 5 a Cell images of miR-494 overexpressing Huh-7 cells or b miR-494 silenced SNU182 cells (10X magnification). [score:3]
NC: pre-miR negative control, NCi: anti-miR negative control Aiming to identify key pathways linked to miR-494 aberrant expression, we performed a computational analysis and focused our attention on CDKN1B/P27, PTEN, and BBC3/PUMA (Supplementary Fig.   S3B) due to their known roles in cell cycle progression, proliferation and apoptosis. [score:3]
e FACS Annexin-V plots of miR-494 overexpressing and control untreated Huh-7 (following 48 h of transfection). [score:3]
As frequently observed for cancer -associated miRNAs, miR-494 may behave as an oncogene or a tumor-suppressor gene in a tissue -dependent manner. [score:3]
Consistently, the xenograft mo del showed a lower doubling time (t-test; p = 0.044) (Fig.   7b) and a trend toward a higher tumor size (t-test; p = 0.124) (Fig.   7c) in miR-494 -overexpressing tumors, suggesting that miR-494 might influence tumor cell proliferation during sorafenib treatment. [score:3]
DNMT3B and DNMT3A are miR-494 hypothetical targets (Supplementary Fig. S2L), whereas HDAC1 does not display complementar -binding sites. [score:3]
MRNA levels were regulated as well, but at a lower extent and depending on cell context (Fig.   3a–d), letting us to speculate that co-regulatory mechanisms might be responsible for their fine-tuning following miR-494 modulation. [score:3]
Moreover, ERK1/2 [−] -dependent activation of miR-494 in non-small cell lung cancer induced tumor resistance to TRAIL treatment through BIM targeting [21]. [score:3]
The xenograft mo del was obtained by inoculating miR-494 stably overexpressing (pMXs-miR-494) Huh-7 cells. [score:3]
QPCR analysis verified miR-494 overexpression in pMXs-miR-494 Huh-7 cells (Supplementary Fig.   S2G) and in tumors derived from this cell clone in comparison with control cells (t-test; p = 0.006) (Fig.   1h). [score:3]
Liu K miR-494 promotes cell proliferation, migration and invasion, and increased sorafenib resistance in hepatocellular carcinoma by targeting PTENOncol. [score:3]
Annexin-V analysis strengthened these data showing a 2.0-fold decrease of early and late apoptosis in miR-494 -overexpressing cells after sorafenib administration (t-test; p < 0.05) (Fig. 6f). [score:3]
j WB analysis of dnmt3b in miR-494 overexpressing or silenced HCC cells. [score:3]
We investigated miR-494 expression in tumors and surrounding livers from 75 surgically resected HCC patients, showing a 2.4-fold upregulation of miR-494 in 25% of tumors compared to matched cirrhosis. [score:3]
y-axis reports relative miR-494 or pri-miR-494 expression values with respect to vehicle (DMSO) -treated samples. [score:3]
Fig. 1 a Correlation graph between miR-494 and miR-495 expression levels in tumor tissue from 28 randomly selected HCC patients. [score:3]
d Box plot graph of miR-494 expression in tumor (HCC) and non-tumor (NT) samples from the HCC rat mo del. [score:3]
Combination of low HDAC1 and DNMT3B levels strongly associated with higher miR-494 levels (t-test; p = 0.003) (Fig. 2g) and, consistently, a decrease of HDAC1 and DNMT3B mRNAs was detected in miR-494 -overexpressing cells (Fig. 2h). [score:3]
g WB analysis of apoptotic markers in miR-494 overexpressing Huh-7 cells following sorafenib or h sorafenib plus rapamycin treatment. [score:3]
6.7-folds, respectively) (Fig.   1h, Supplementary Fig. S2G), letting us to speculate that a possible crosstalk between tumor and stroma cells might contribute to miR-494 expression. [score:3]
MiR-494 overexpression enhanced cell resistance to sorafenib in Huh-7 cells, increasing cell viability, and decreasing caspase activity (Fig. 6d), whereas opposite results were displayed in anti-miR-494 -treated SNU182 cells (Fig. 6e). [score:3]
No variations in cell death were observed in untreated Huh-7 cells in the presence of miR-494 overexpression (Fig. 5e), letting us to speculate that increased viability might be due to a higher proliferation rather than an effective inactivation of apoptosis. [score:3]
h FACS Annexin-V plots of miR-494 overexpressing and control Huh-7 following 24 h of starvation. [score:3]
These data were confirmed by Annexin-V analysis displaying decreased early and late apoptotic events (1.4 and 1.3-folds, respectively) in miR-494 -overexpressing cells (t-test; p < 0.05) (Fig.   6c). [score:3]
MiR-494 upregulation and involvement in cancer progression was reported in lung, colorectal, and glioblastoma cancers, as well as in HCC 18, 19, 29, 30. [score:3]
Aiming to identify key pathways linked to miR-494 aberrant expression, we performed a computational analysis and focused our attention on CDKN1B/P27, PTEN, and BBC3/PUMA (Supplementary Fig.   S3B) due to their known roles in cell cycle progression, proliferation and apoptosis. [score:3]
Due to the well-established role of p27 as a G1/S checkpoint controller, we tested miR-494 involvement in cell cycle regulation. [score:2]
A 1.3-fold-change has been considered as a cutoff to discriminate between high or low primary and mature miR-494 expression levels in HCC vs. [score:2]
MiR-494 correlated with tumor size (Pearson’s correlation; p = 0.007) as well as with AFP, PROM1, and ABCG2 expression (Pearson’s correlation; p = 0.015, p = 0.034, and p = 0.023, respectively) (Fig.   1e–g, Supplementary Fig.   S2D); on the contrary, no correlation with EPCAM mRNA was found. [score:2]
NC: pre-miR negative control, NCi: anti-miR negative controlTo investigate if multiple epigenetic events might be involved in miR-494 regulation, HepG2 cells were treated with 5-Aza-2’-deoxycitidine (5-Aza), Trichostatin (TRC) and 3-Deazaneplanocin A (DZNep), inhibiting DNA methyl-transferases, histone deacetylases, and methyl-transferases. [score:2]
MiR-494 targets p27, pten, and puma in HCC. [score:2]
β-actin was used to normalize qPCR and WB data Since PTEN plays a pivotal role in cell motility and migration, we assessed invasion and migration capabilities of miR-494 -overexpressing Huh-7 cells by using a real-time cell analysis system as well as a wound healing assay. [score:2]
Cell viability assay displayed an association between high miR-494 basal levels and sorafenib resistance in HCC-derived cells (Fig.   7e), confirming a close relationship linking miR-494 expression to sorafenib response in preclinical mo dels. [score:2]
In agreement, a recent study showed that miR-494 -mediated pten regulation is involved in sorafenib resistance through the activation of PI3K/Akt pathway in HepG2 cells [38]. [score:2]
MiR-494 targets CDKN2B, BBC3 and PTEN in HCC. [score:2]
Li XT miR-494-3p regulates cellular proliferation, invasion, migration, and apoptosis by PTEN/AKT signaling in human glioblastoma cellsCell. [score:2]
a–j U6RNA and β-actin were used as housekeeping genes To have an insight on miR-494 regulation, a methylation-specific PCR (MSP) analysis of selected CpG islands (Supplementary Fig.   S2I) was conducted in HCC patients. [score:2]
MiR-494 is overexpressed in HCC and correlates with stem cell markers. [score:2]
Here, we showed that miR-494 regulates p27, pten, and puma in HCC cells and xenograft tumors, increasing cell cycle progression, cell survival in stressful conditions and enhancing invasive and clonogenic capabilities. [score:2]
Beside epigenetic regulation, our data suggested that post-transcriptional mechanisms might be involved in miRNA biogenesis determining final mature miR-494 levels. [score:2]
MiR-494 overexpression decreased p27, pten and puma proteins in HepG2 and Huh-7 cells (Fig.   3a, b), whereas its silencing increased their levels in SNU449 and SNU182 cells (Fig.   3c, d). [score:2]
MiR-494 is overexpressed in a HCC subgroup and correlates with tumor size and stemness markers in preclinical mo dels. [score:2]
Co-treatment with rapamycin sensitized miR-494 -overexpressing cells to sorafenib challenge when compared to sorafenib-only treated cells (Fig.   6g, h), demonstrating a strong participation of the mtor pathway in miR-494 -mediated sorafenib resistance, as confirmed by caspase inactivation and decreased PARP levels. [score:2]
To verify if DNMT3B regulation by miR-494 itself might be responsible for CpG island hypomethylation, a MSP analysis was performed in transfected HepG2 cells. [score:2]
TaqMan MicroRNA assays (Thermo Fisher Scientific) were used for quantifying miRNA-494 (ID: 002365) and miR-495 (ID:001108) expression, as previously described [8]. [score:2]
The mutagenesis of miR-494 seed sequence in BBC3, CDKN1B, and DNMT3B-3' UTR-containing vectors was performed by using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies) following the manufacturer's instruction. [score:2]
Accordingly, miR-494 -overexpressing Huh-7 cells showed a higher clonogenic potential as demonstrated by colony-forming unit assay (t-test; p < 0.0001) (Fig. 4g and Supplementary Fig. S2F), further supporting miR-494 key role in modulating stem cell phenotype. [score:2]
MiR-494 overexpression correlates with sorafenib resistance in. [score:2]
To have an insight on miR-494 regulation, a methylation-specific PCR (MSP) analysis of selected CpG islands (Supplementary Fig.   S2I) was conducted in HCC patients. [score:2]
Accordingly, we showed the steady association between miR-494 and core stemness genes in preclinical mo dels, as well as in human HCCs, suggesting a key role for miR-494 in PROM1 transcriptional regulation. [score:2]
NC: pre-miR negative control, NCi: anti-miR negative control To investigate if multiple epigenetic events might be involved in miR-494 regulation, HepG2 cells were treated with 5-Aza-2’-deoxycitidine (5-Aza), Trichostatin (TRC) and 3-Deazaneplanocin A (DZNep), inhibiting DNA methyl-transferases, histone deacetylases, and methyl-transferases. [score:2]
MiR-494 basal expression levels (2 [−ΔΔCt]) of each cell line are reported in table below the graph. [score:2]
Any difference in tumor size, doubling time, and Ki67 staining was observed when comparing miR-494 with control Huh-7-derived masses, suggesting that higher miR-494 levels do not influence tumor attachment and proliferation in our xenograft mo del. [score:1]
In line, miR-494 silencing in serum-deprived SNU182 cells reduced cell viability and increased apoptotic markers (Fig. 5g). [score:1]
MiR-494 regulates AKT/mTOR pathway and increases cell survival during stress conditions. [score:1]
f Correlation graph between miR-494 and AFP or g PROM1 mRNA levels in tumor samples from HCC rats. [score:1]
NCi: anti-miR negative control, AM-494: anti-miR-494. [score:1]
The luciferase activity of wild-type DNMT3B-3'UTR-vector decreased in miR-494 co -transfected cells in comparison to control cells (t-test; p = 0.015) (Fig. 2i). [score:1]
b Correlation graph between miR-494 and PROM1 or c EPCAM mRNA levels in tumor samples from 38 HCC patients. [score:1]
A positive correlation between miR-494 and miR-495 was found in tumors (Pearson’s correlation; p = 0.002) but not in surrounding livers (Fig.   1a, Supplementary Fig. S2A), suggesting their possible involvement in hepatocytes malignant transformation. [score:1]
Mature miR-494 levels only partially mirrored pri-miRNA levels, letting us to speculate that other mechanisms might be responsible for its maturation process. [score:1]
Notably, our previous findings showed that circulating miR-494 levels correlated with tissue ones in HCC patients [22], suggesting this miRNA as a non-invasive biomarker. [score:1]
A further confirm was obtained in stable miR-494 Huh-7 cells displaying an increased resistance to sorafenib challenge with respect to control cells (Supplementary Fig. S5A). [score:1]
MiR-494 regulates invasion capability, cell cycle progression, and stem cell phenotype in HCC. [score:1]
Oligonucleotide transfection of pre-miR-494, anti-miR-494, or negative controls (100 nM, Thermo Fisher Scientific, Whaltam, USA) was obtained by using TransIT-X2 dynamic delivery system (Mirus Bio, Madison, USA) according to the manufacturer's instructions. [score:1]
QPCR analysis displayed an association between high miR-494 levels and sorafenib resistance in rat HCCs (t-test; p = 0.045) (Fig.   7a). [score:1]
e Correlation graph between tumor size and miR-494 levels in HCC animals. [score:1]
In this scenario, miR-494 deserves attention as a putative biomarker for the identification of a subgroup of epigenetically distinct HCCs. [score:1]
Since pten is the principal negative modulator of Akt/mTOR pathway, we analyzed miR-494 influence on the activation of its downstream signaling cascade. [score:1]
CTR: vehicle control mice, AM-494: anti-miR-494 injected mice. [score:1]
y-axis reports 2 [−ΔΔCt] values corresponding to miR-494 levels. [score:1]
A negative correlation between miR-494 and PUMA or PTEN mRNAs (Pearson’s correlations; p = 0.012 and p = 0.020, respectively) was found in the combined -treated group but not in the sorafenib-only one (Fig. 7f), suggesting these molecular pathways mediating miR-494 therapeutic effects. [score:1]
A positive correlation between PROM1 and EPCAM mRNAs was found in tumor and non-tumor tissues (Pearson’s correlation; p < 0.0001) (Supplementary Fig.   S2B, C), whereas no correlation between miR-494 and other stem -associated genes (AFP, NESTIN, CD90, and ABCG2) was found in HCCs. [score:1]
c QPCR of primary (pri-miR-494) or mature miR-494 levels in HepG2 cells following epigenetic treatments. [score:1]
We reported that a combined anti-miR-494 -based therapeutic strategy is more efficient in terms of tumor stabilization in comparison to sorafenib-only treatment in DEN-HCC rats. [score:1]
AM-494: anti-miR-494The efficacy of a combined miRNA -based strategy was assessed in the rat mo del following anti-miR-494 and sorafenib co-administration (Fig.   7f). [score:1]
β-actin was used to normalize WB dataSubsequently, we tested miR-494 biologic effect following sorafenib treatment. [score:1]
y-axis reports 2 [-ΔΔCt] values corresponding to miR-494 levels (log2 form). [score:1]
c Representative cell cycle images of miR-494 -transfected HepG2 cells. [score:1]
d Cell viability assay, caspase-3/7 activity assay and WB analysis in miR-494 overexpressing Huh-7 or e miR-494 silenced SNU182 cells following sorafenib administration. [score:1]
31% of nodules isolated from anti-miR-494-sorafenib with respect to sorafenib-only treated animals (χ [2] test; p < 0.05). [score:1]
Representative IHC images (20X magnification) of Ki67 staining in control (pMXs) and miR-494 overexpresing Huh-7-derived xenograft masses. [score:1]
NC: pre-miR negative control, NCi: anti-miR negative control, AM-494: anti-miR-494. [score:1]
c Cell viability assay, caspase-3/7 activity assay and WB analysis in untreated miR-494 overexpressing Huh-7 or d miR-494 silenced SNU182 cells. [score:1]
d Correlation graphs between miR-494 and DNMT3B or e HDAC1 or f DNMT3A mRNAs in HCCs (N = 30). [score:1]
x-axis reports 2 [−ΔΔCt] values corresponding to miR-494 levels transformed in a log2 form; y-axis represents tumor size (cm). [score:1]
NC: pre-miR negative control; NCi: anti-miR negative control; AM-494: anti-miR-494. [score:1]
AM-494: anti-miR-494 The efficacy of a combined miRNA -based strategy was assessed in the rat mo del following anti-miR-494 and sorafenib co-administration (Fig.   7f). [score:1]
An increase of caspase activity was detected in anti-miRNA -treated miR-494 Huh-7 cells, resembling the value of empty vector cells (Supplementary Fig.   S5C). [score:1]
β-actin was used to normalize WB data Subsequently, we tested miR-494 biologic effect following sorafenib treatment. [score:1]
In the bottom part are illustrated percentage graphs representing treatment efficacy together with correlation graphs between miR-494 and PUMA or PTEN mRNA levels in tumor samples from sorafenib-only and anti-miR-494-sorafenib treated animals. [score:1]
A negative correlation between miR-494 and DNMT3B or HDAC1 mRNAs was observed in tumors (Pearson’s correlations; p = 0.006 and p = 0.018) (Fig.   2d, e), whereas a trend toward a negative correlation was detected with DNMT3A (Pearson’s correlation; p = 0.075) (Fig. 2f); on the contrary, no correlation was found with HDAC2, HDAC3, or HDAC4. [score:1]
Higher miR-494 levels were detected in 83% of HCCs with respect to non-tumor samples with a 4.6-folds increase (t-test; p = 0.002) (Fig.   1d). [score:1]
β-actin was used to normalize WB data To investigate the role of miR-494 in sorafenib response in vivo, miR-494 expression was analyzed in HCCs from DEN -treated rats receiving sorafenib intragastrically. [score:1]
a Cell viability assay, caspase-3/7 activity assay and WB analysis in miR-494 overexpressing Huh-7 or b miR-494 silenced SNU182 cells following doxorubicin treatment. [score:1]
To investigate the role of miR-494 in sorafenib response in vivo, miR-494 expression was analyzed in HCCs from DEN -treated rats receiving sorafenib intragastrically. [score:1]
Anti-miR-494 administration in both mo dels is described in Supplementary Material. [score:1]
No modulation of protein total amount was observed (Fig.   5c, d), suggesting a miR-494 -mediated post-transcriptional activation of this pathway. [score:1]
These data showed the involvement of miR-494 in HCC pathogenesis as well as in stem cell phenotype of liver tumors. [score:1]
In line, a positive but not strong correlation between primary and mature miR-494 was observed in HCC patients and cells (Supplementary Fig.   S2J, K). [score:1]
MiR-494 regulates response to treatments in HCC cells. [score:1]
PMXs and pMXs-miR-494 Huh-7 cells were seeded (25,000 cells/well) in serum free medium in the upper chamber. [score:1]
y-axis reports relative miR-494 values with respect to negative controls (NC or pMXs). [score:1]
pGL3: empty reporter vector, NC: pre-miR negative control, NCi: anti-miR negative control, AM-494: anti-miR-494. [score:1]
MiR-494 is epigenetically regulated in HCC. [score:1]
Fig. 6 a Cell viability assay, caspase-3/7 activity assay and WB analysis in miR-494 overexpressing Huh-7 or b miR-494 silenced SNU182 cells following doxorubicin treatment. [score:1]
f Cell viability assay, caspase-3/7 activity assay, and WB analysis in miR-494 overexpressing Huh-7 or g miR-494 silenced SNU182 cells in starvation condition. [score:1]
Nevertheless, as observed in human and rat HCCs, higher PROM1 levels were displayed in miR-494-derived tumors (t-test; p = 0.045) (Fig.   1i, Supplementary Fig. S2H). [score:1]
[1 to 20 of 183 sentences]
2
[+] score: 366
SOX9 expression was markedly suppressed by siSOX9; the upregulation of SOX9 after transfection with miR-494 inhibitor was abrogated by co-transfection of siSOX9 (Figure 5A and 5H). [score:10]
MicroRNA-494 expression was upregulated during IDD progression; its overexpression increased the expression of ECM catabolic factors such as matrix metalloproteinase and A disintegrin and metalloproteinase with thrombospondin motif in NP cells while decreasing that of anabolic genes such as type II collagen and aggrecan; it also induced the apoptosis of NP cells, as determined by flow cytometry. [score:9]
Based on our findings that miR-494 was upregulated in NP cells from severe IDD cases and that, we speculated that downregulation of SOX9 in IDD could be due to enhanced miR-494 expression. [score:9]
Therefore, strategies to downregulate the expression or to prevent the upregulation of miR-494 may have the potential to become a possible therapeutic and/or preventive approach for human IDD. [score:9]
Furthermore, miR-494 overexpression and inhibition suppressed and stimulated, respectively, SOX9 mRNA and protein expression, indicating that in degenerative NP cells. [score:9]
Meanwhile, B cell lymphoma (Bcl)-2 expression was down- and upregulated in cells transfected with miR-494 mimic and inhibitor, respectively, as determined by qRT-PCR and western blotting (Figure 3B and 3C). [score:8]
It is therefore possible that the increased miR-494 expression in IDD is associated with activation of NF-κB signalling, which was found to be required for upregulation of miR-494 expression in the present study. [score:8]
To determine whether ECM degradation and degenerative human NP cell apoptosis induced by miR-494 result from its direct targeting of SOX9, we co -transfected the cells with miR-494 inhibitor or miR-Scr along with short interfering (si)RNA against SOX9 (siSOX9) or siScr. [score:6]
The results of ELISA showed that co-transfection with miR-494 inhibitor and siSOX9 decreased MMP13 protein expression compared with transfection with miR-494 inhibitor alone (Figure 5K). [score:6]
SiNF-κB suppressed the upregulation of phospho-p65 and miR-494 induced by IL-1β (Figure 7C and 7D). [score:6]
In conclusion, we demonstrated that promoter hypomethylation and activation of NF-κB signalling induced upregulation of miR-494 expression in IDD. [score:6]
We also found that SOX9 knockdown reversed the effects of miR-494 inhibition on the expression of ECM markers such as type II collagen, aggrecan, sGAG, MMP3, MMP13, ADAMTS4, and ADAMTS5 and the rate of apoptosis in degenerative NP cells. [score:6]
We speculated that miR-494 targets would be downregulated in cells treated with 5-aza-CdR. [score:6]
Moreover, treatment with a demethylating agent increased miR-494 and decreased SOX9, type II collagen, and aggrecan expression in mild IDD NP cells, indicating that miR-494 is upregulated in IDD due to promoter hypomethylation. [score:6]
Moreover, the results of enzyme-linked immunosorbent assay (ELISA) showed that the variation tendency of MMP13 protein expression in extracellular matrix of NP cells transfected with mimic or inhibitor of miR-494 (Figure 2K) was in accordance with that of intracellular MMP13 protein expression (Figure 2I). [score:6]
Based on the above findings, we hypothesized that miR-494 may be involved in IDD development via direct targeting of SOX9. [score:5]
Target gene expression levels were normalized to that of β-actin, and miR-494 level was normalized to that of U6. [score:5]
In this study, we found that miR-494 overexpression increased the levels of MMP3, MMP13, ADAMTS4, and ADAMTS5 and decreased that of type II collagen, aggrecan and sGAG; these effects were reversed by inhibiting miR-494. [score:5]
We also found that IL-1β treatment increased miR-494 expression; however, this effect was blocked by treatment with the IκB kinase (IKK) inhibitor 2-[(aminocarbonyl)amino]-5-(4-fluorophenyl)-3-thiophenecarboxamide (TPCA-1) (Figure 7B). [score:5]
Transfection of miR-494 mimic decreased whereas miR-494 inhibitor increased the expression of type II collagen and aggrecan relative to the control (Figure 2B, 2C and 2H); this effect was confirmed by immunofluorescence staining (Figure 2J). [score:5]
Moreover, our findings are also consistent with the results from the work by Wang et al. [39], which reported that miR-494 inhibition protects NP cells from TNF-α -induced apoptosis by targeting JunD. [score:5]
An increase in sGAG content was observed after transfection with the miR-494 inhibitor alone, however, the increase was blocked by co-transfection with miR-494 inhibitor and siSOX9 (Figure 5L). [score:5]
MiR-494 overexpression increased the mRNA and protein levels of all four factors, whereas miR-494 inhibition had the opposite effect (Figure 2D–2G and 2I). [score:5]
Indeed, we observed a downregulation of SOX9 expression in severe as compared to mild IDD and an inverse correlation between miR-494 and SOX9 levels in degenerative NP cells. [score:5]
In addition, we assessed the changes in the expression of miR-494 targets. [score:5]
Additionally, the concentrations of sulfated glycosaminoglycan (sGAG), a main form of aggrecan secreted by NP cells in the intervertebral disc, declined in NP cells transfected with 494 mimic, while miR-494 inhibitor upregulated the concentrations of sGAG using 1,9-dimethylmethylene blue (DMMB) assay (Figure 2L), similar to the variation tendency of aggrecan using western blotting (Figure 2H). [score:5]
Using miRNA target prediction algorithms, we identified a putative miR-494 binding site in the 3′-UTR of human SRY-related high mobility group box (SOX)9, a critical regulator of chondrogenesis [20]. [score:4]
The role of activated nuclear factor (NF)-κB in the regulation of microRNA-494 expression was evaluated using specific inhibitors. [score:4]
SOX9 was identified as a target of negative regulation by microRNA-494. [score:4]
We therefore used a bioinformatics approach to predict miR-494 targets and identified a putative miR-494 binding site in the 3′-UTR of SOX9, and found that miR-494 directly binds to this site. [score:4]
MiR-494 was previously shown to be upregulated in degenerative human NP cells [17] and has been implicated in various pathological conditions through regulation of cell proliferation, apoptosis, and ECM degradation [18, 19]. [score:4]
For SOX9 knockdown, short interfering (si)RNA against SOX9 (siSOX9) and scrambled siRNA (siScr) (RiboBio) were co -transfected with miR-494 inhibitor or miR-Scr into NP cells using Lipofectamine 2000. [score:4]
SOX9 is a direct target of miR-494. [score:4]
NF-κB is also involved in the regulation of miRNA expression [31, 32]; in fact, three NF-κB binding sites have been identified in the 5′ flanking sequence of miR-494 [45]. [score:4]
Promoter hypomethylation and NF-κB activation were associated with microRNA-494 upregulation in IDD. [score:4]
Role of NF-κB signalling in the regulation of miR-494 expression. [score:4]
We found that miR-494 overexpression promotes apoptosis of degenerative human NP cells and ECM degradation via negative regulation of SOX9. [score:4]
These results indicate that miR-494 expression is regulated by NF-κB signalling in IDD. [score:4]
To determine whether SOX9 is direct target of miR-494, we generated luciferase reporter vectors containing the wild-type (WT) or mutant (MUT) 3′ UTR of SOX9. [score:4]
Promoter methylation was higher in mild than in severe IDD, corresponding to the lower miR-494 expression in the former relative to the latter (Figure 6A). [score:3]
To clarify the mechanism by which miR-494 induces ECM degradation and apoptosis of degenerative human NP cells, we used a bioinformatics approach to search for miR-494 target genes and found that the 3′-UTR of SOX9 contains sequences that are complementary to the miR-494 seed sequence (Figure 4A). [score:3]
MiR-494 expression is regulated by promoter methylation status. [score:3]
MiR-494 in turn promoted ECM degradation and apoptosis of degenerative human NP cells by direct targeting SOX9. [score:3]
These findings indicate that aberrant expression of miR-494 in IDD is due to hypomethylation of its promoter region. [score:3]
These results demonstrate that miR-494 overexpression induces apoptosis of degenerative human NP cells. [score:3]
We also found that miR-494 overexpression reduced SOX9 mRNA and protein levels in degenerative NP cells (Figure 4C and 4D). [score:3]
NP cells were transfected with miR-Scr (100 nM), miR-494 mimic (100 nM), or miR-494 inhibitor (100 nM) for 48 h, with untransfected cells serving as a control. [score:3]
We also demonstrate that aberrant miR-494 expression is partly controlled by hypomethylation of its promoter region and activation of nuclear factor (NF)-κB in IDD. [score:3]
To confirm these findings, we treated mild IDD NP cells with the demethylating agent 5-aza-2′-deoxycytidine (5-aza-CdR), and found that miR-494 expression was increased (Figure 6C). [score:3]
These results indicate that activation of NF-κB signalling increases miR-494 expression in IDD. [score:3]
To investigate the effect of miR-494 on degenerative human NP cells, miR-494 mimic, miR-494 inhibitor, or miR-Scr were transfected into the cells and the expression of ECM anabolic genes was assessed by qRT-PCR and western blotting. [score:3]
de/) were used to predict miR-494 target genes. [score:3]
Figure 2NP cells were transfected with miR-Scr (100 nM), miR-494 mimic (100 nM), or miR-494 inhibitor (100 nM) for 48 h, with untransfected cells serving as a control. [score:3]
These effects were reversed by microRNA-494 inhibitor treatment. [score:3]
Figure 5(A) SOX9 mRNA level in NP cells co -transfected with miR-494 inhibitor (100 nM) or miR-Scr (100 nM) and siSOX9 (100 nM) or siScr (100 nM), as determined by qRT-PCR. [score:3]
Methylation levels were higher in mild than in severe IDD NP tissue, consistent with the higher expression level of miR-494 in the latter. [score:3]
Furthermore, inhibiting miR-494 increased type II collagen and aggrecan and decreased MMP-3, MMP13, ADAMTS4, and ADAMTS5 mRNA and protein levels, the effect was reversed by siSOX9 (Figure 5B–5G and 5I). [score:3]
Activation of NF-κB signalling induces miR-494 expression. [score:3]
miR-494 inhibitor + siScr group. [score:3]
Figure 4(A) Putative miR-494 target site in the 3′-UTR of human SOX9 transcript predicted by bioinformatics analysis. [score:3]
Similar differences in type II collagen level were observed between NP cells transfected with miR-494 inhibitor alone and those co -transfected with siSOX9 by immunofluorescence (Figure 5J) and western blotting (Figure 5I). [score:3]
In addition, miR-494 level was reduced whereas those of SOX9, type II collagen, and aggrecan were enhanced in degenerative NP cells treated with two different NF-κB inhibitors. [score:3]
SOX9, type II collagen, aggrecan, MMP3, MMP13, A disintegrin and metalloproteinase with thrombospondin motif (ADAMTS)4, ADAMTS5, B cell lymphoma (Bcl)-2, and miR-494 expression was quantified by qRT-PCR on a 7500 Realtime PCR System (Applied Biosystems, Foster City, CA, USA) using the cycling conditions recommended by the manufacturer. [score:3]
Phosphorylated (p-) and total protein levels of NF-κB p65 (C) and miR-494 (D) expression was determined by western blotting and qRT-PCR, respectively, with β-actin and U6 used as the respective control. [score:3]
The converse was observed by inhibiting miR-494. [score:3]
Figure 3NP cells were transfected with miR-Scr, miR-494 mimic, or miR-494 inhibitor for 48 h, with untransfected cells serving as a control. [score:3]
MicroRNA-494 promotes ECM degradation and apoptosis of degenerative human NP cells by directly targeting SOX9. [score:3]
The expression of miR-494 in degenerative human NP tissue was examined by qRT-PCR (Figure 1B). [score:3]
Luciferase activity was markedly suppressed relative to the miR-Scr group by co-transfection of miR-494 mimic and the WT 3′-UTR of SOX9, while co-transfection of the SOX9 MUT 3′-UTR abrogated this effect (Figure 4B). [score:3]
The expression levels of SOX9 and miR-494 were negatively correlated (Figure 4H). [score:3]
Additionally, we demonstrated that miR-494 overexpression induces degenerative NP cell apoptosis, which is similar to the pro-apoptotic effect of other miRNAs in NP cells. [score:3]
NP cells were transfected with miR-Scr, miR-494 mimic, or miR-494 inhibitor for 48 h, with untransfected cells serving as a control. [score:3]
MiR-494 expression is regulated by methylation of CpG islands in the promoter region. [score:3]
The Pearson correlation coefficient was used to assess the correlation between miR-494 and SOX9 expression. [score:3]
In this study, we found that miR-494 expression was higher in NP tissue from severe as compared to mild IDD and was positively correlated with disc degeneration grade. [score:2]
MiR-494 induces ECM degradation and degenerative human NP cell apoptosis by targeting SOX9. [score:2]
We therefore investigated whether upregulation of miR-494 in degenerative NP tissue is the result of promoter hypomethylation. [score:2]
Moreover, flow cytometry analysis showed that siSOX9 transfection increased the incidence of degenerative NP cell apoptosis; the rate was even higher in cells that were co -transfected with siSOX9 and miR-494 inhibitor as compared to the latter alone (Figure 5M). [score:2]
MiR-494 expression level is correlated with IDD grade in degenerative human NP tissue. [score:2]
MicroRNA-494 expression in degenerative nucleus pulposus (NP) tissue was assessed by quantitative real-time PCR. [score:2]
We therefore investigated whether NF-κB signalling regulates miR-494 expression in IDD. [score:2]
We found that miR-494 expression was higher in NP tissue from severe as compared to mild IDD (Figure 1C); furthermore, miR-494 level was positively correlated with disc degeneration grade (Figure 1D). [score:2]
Thus, negative regulation of SOX9 by miR-494 contributes to ECM degradation and degenerative NP cell apoptosis in IDD. [score:2]
analysis revealed that transfection of miR-494 mimic increased whereas miR-494 inhibitor decreased the rate of apoptosis as compared to the control (Figure 3A). [score:2]
To clarify the mechanism underlying the aberrant expression of miR-494 in IDD, we compared the methylation status of the miR-494 promoter in mild and severe IDD NP tissue samples by methylation-specific PCR (MSP). [score:2]
MiR-494 expression in human NP tissue. [score:2]
MiR-494 exerts its functions by targeting SOX9 in degenerative human NP cells. [score:2]
The methylation status of the miR-494 promoter in NP samples was examined by MSP and BSP. [score:1]
The effect of microRNA-494 on extracellular matrix (ECM) metabolism and NP cell apoptosis was evaluated by transfection of microRNA-494 mimic or inhibitor. [score:1]
Effect of miR-494 on apoptosis of degenerative human NP cells. [score:1]
The regulation of SRY-related high mobility group box (SOX)9 expression by microRNA-494 was assessed with the luciferase reporter assay, and the methylation status of the microRNA-494 promoter was evaluated by methylation-specific PCR and bisulfite sequencing PCR. [score:1]
SOX9 was found to harbour a putative miR-494 binding site. [score:1]
MiR-494 target prediction and luciferase reporter assay. [score:1]
The wild-type (WT) or mutant (MUT) 3′-UTR segment containing the putative miR-494 binding site was amplified and inserted into the pGL3 control vector (RiboBio). [score:1]
This study investigated the expression and function of the microRNA-494 in intervertebral disc degeneration (IDD). [score:1]
HEK 293 cells were co -transfected with 100 ng of pGL3 vector harbouring WT or MUT 3′-UTR and 40 nM of miR-494 mimic or miR-Scr using Lipofectamine 2000. [score:1]
These results suggest that SOX9 plays an essential role in miR-494 -induced ECM degradation and apoptosis in degenerative human NP cells. [score:1]
These findings provide mechanistic insight into the role of miR-494 in IDD pathogenesis. [score:1]
β-actin and U6 were used as internal controls for phosphorylated NF-κB p65 and miR-494 levels, respectively. [score:1]
The luciferase reporter assay was used to determine whether miR-494 directly binds to the 3′-UTR of SOX9. [score:1]
The efficient transfection of miR-494 was confirmed by qRT-PCR (Figure 2A). [score:1]
However, the role of miR-494 in the pathogenesis of IDD is not well understood. [score:1]
These results indicate that miR-494 induces ECM degradation in degenerative human NP cells. [score:1]
Figure 6(A) Representative results of MSP analysis of miR-494 in human NP tissue from mild and severe IDD groups. [score:1]
Effect of miR-494 on ECM degradation of degenerative human NP cells. [score:1]
[1 to 20 of 105 sentences]
3
[+] score: 317
Other miRNAs from this paper: hsa-mir-30a, hsa-mir-122
We have found that Leishmania upregulates the expression of Rab5a, an early endosomal protein, by downregulating the expression of miR-494 in infected human macrophage as a consequence of gp63 -dependent degradation of c-Jun. [score:11]
Here, we have shown that L. donovani upregulates the expression of Rab5a in human macrophages by inhibiting the expression of miR-494 and retains Rab5a and EEA1 on PV to survive in an early endocytic (EE) compartment. [score:10]
Leishmania donovani infection downregulates the expression of miR-494 by degrading c-Jun in macrophagesTo understand the mechanism of upregulation of Rab5a expression in Leishmania infected human macrophages, we compared the miRNA profiles of uninfected and infected macrophages. [score:10]
To delineate the mechanism, we have shown that Leishmania upregulates the expression of Rab5a in infected macrophages by downregulating the synthesis of miR-494 by degrading c-Jun via gp63. [score:9]
To determine how L. donovani infection downregulates the expression of miR-494 in macrophages, we checked for the level of c-Jun subunit of AP-1 transcription factor in infected cells as it was previously reported that miR-494 expression is regulated by AP-1 transcription factor [25]. [score:9]
These results demonstrated that knocking down of Rab5a by siRNA or inhibiting the expression of Rab5a by miR-494 significantly inhibits the growth of parasite in macrophages. [score:8]
Leishmania after entering into human macrophages secretes gp63 which degrades c-Jun to downregulate the expression of miR-494 and thereby overexpress Rab5a in the infected cells. [score:8]
To determine how L. donovani infection downregulates the expression of miR-494 in macrophages, we have checked the expression of AP-1 transcription factor in infected human macrophages as it has been previously reported that AP-1 transcription factor is involved in the synthesis of miR-494 [25]. [score:8]
These results suggest that knocking down of Rab5a by siRNA or inhibiting the expression of Rab5a by miR-494 possibly targets internalized parasites to lysosomes as they will not be able to promote Rab5a -mediated constitutive fusion with early endosomes. [score:8]
Taken together, our results have demonstrated that L. donovani infection degrades c-Jun by their metalloprotease, gp63 to inhibit the synthesis of miR-494 and thereby upregulates the expression of Rab5a in infected human macrophages. [score:8]
In addition, our results also showed that L. donovani infection overexpresses Rab5a in human PBMCs (Fig 5A) by downregulating the expression of miR-494 (Fig 5B). [score:8]
Our results demonstrated that overexpression of miR-494 inhibits Rab5a expression in a concentration dependent manner. [score:7]
As not much work has been done about regulation of expression of Rab GTPases, we have first validated that miR-494 specifically regulates the expression of Rab5a using a chimeric construct containing 3 [/]-UTR of Rab5a with luciferase as heterologous reporter in mammalian cells. [score:7]
Leishmania donovani infection downregulates the expression of miR-494 by degrading c-Jun in macrophages. [score:6]
Subsequently, we have shown that L. donovani infection downregulates the expression of miR-494. [score:6]
Leishmania donovani downregulates the expression of miR-494 by degrading c-Jun in macrophages. [score:6]
1006459.g002 Fig 2 Leishmania donovani downregulates the expression of miR-494 by degrading c-Jun in macrophages. [score:6]
Finally, we have shown that overexpression of Rab5a by downregulating miR-494 in macrophages is essential for parasite survival. [score:6]
More than 80% inhibition of Rab5a protein expression was observed in 100 nM miR-494 transfected human macrophages in comparison to the control miR transfected cells (Fig 3D). [score:5]
These results indicated that inhibition of miR-494 expression in infected macrophages is also dependent on the extent of infection. [score:5]
Thus, Leishmania degrades c-Jun in infected human macrophages via their gp63 to inhibit the expression of miR-494. [score:5]
B. TargetScan prediction algorithms showing that 3 [/]-UTR of Rab5a of human and hamster contains an 8-mer target site that precisely matches the seed region of miR-494. [score:5]
In contrast, Leishmania infection does not induce the expression of Rab5a in mouse macrophages as miR-494 target site is absent in the 3 [/]-UTR of mouse Rab5a. [score:5]
Our results showed about 60% inhibition of the expression of miR-494 in L. donovani infected macrophages after 24 h of infection in comparison to uninfected cells (Fig 2C). [score:5]
This is the first demonstration that miR-494 negatively regulates the expression of Rab5a in HeLa cells and macrophages. [score:4]
To determine miR-494 mediated regulation of hereterologous expression of Rab5a chimeric construct, these chimeric reporter constructs were cotransfected with 40 nM miR-494 or control mimic miR into semiconfluent HeLa cells using Lipofectamine 2000 reagent (Invitrogen) as per manufacturer’s protocol. [score:4]
A. To determine miR-494 mediated regulation of hereterologous expression of Rab5a chimeric construct, pmir-GLO chimeric construct containing Rab5a 3 [/]-UTR or its mutant were cotransfected with 40 nM miR-494 or control mimic miR into semiconfluent HeLa cells. [score:4]
To demonstrate that miR-494 specifically regulates the expression of Rab5a, HeLa (Fig 3B) and THP-1 (Fig 3C) cells were transfected with miR-494 mimic (40 nM) or control mimic and levels of Rab5 isoforms were determined by qPCR using specific TaqMan probes. [score:4]
To determine miR-494 mediated regulation of hereterologous expression of Rab5a chimeric construct, pmir-GLO chimeric construct containing Rab5a 3 [/]-UTR or its mutant were cotransfected with 40 nM miR-494 or control mimic miR into semiconfluent HeLa cells. [score:4]
To determine miR-494 mediated regulation of endogenous expression of Rab5 isoforms, HeLa or THP-1 differentiated human macrophages were transfected with 40 nM miR-494 and levels of different isoforms of Rab5 were determined after 48 h by q PCR as described. [score:4]
Mutants in miR-494 target site of 3 [/]-flanking regulatory region of human Rab5a was generated by PCR -mediated mutagenesis. [score:4]
These results demonstrated that miR-494 regulates the expression of Rab5a in human cell. [score:4]
In order to validate the regulation of Rab5a expression by miR-494, we prepared chimeric construct by ligating 3 [/]-UTR of human Rab5a with luciferase as heterologous reporter. [score:4]
We observed that miR-494 specifically inhibits about 50% expression of Rab5a mRNA compared to the control mimic in both cells types. [score:4]
Most importantly, we have found that transfection of miR-494 specifically inhibits the expression of Rab5a protein in human macrophages and HeLa cells compared to the control mimic. [score:4]
miRNA-494 regulates the expression of Rab5a. [score:4]
miR-494 negatively regulates the expression of Rab5a. [score:4]
To determine miR-494 mediated regulation of endogenous expression of Rab5 isoforms, HeLa (B) or THP-1 differentiated human macrophages (C) were transfected with 40 nM miR-494 and levels of different isoforms of Rab5 were determined as described in and Methods. [score:4]
Subsequently, we have identified that miR-494 has a target site in 3 [/]-regulatory region of Rab5a of human and hamster but not in mouse. [score:4]
C. THP-1 differentiated macrophages were infected with Leishmania (MOI 1:20) and level of expression of miR-494 in infected cells was determined at indicated time by qPCR as described in and Methods. [score:3]
Similar results were also observed in HeLa cells overexpressing miR-494 (S4 Fig). [score:3]
Subsequently, our results showed that this is due to significant less recruitment of Rab5a on Leishmania-PV in miR-494 overexpressed human macrophages (Fig 8D). [score:3]
of control (*) and miR-494 overexpressed cells were analyzed by paired t test and levels of significance are indicated by P value. [score:3]
This analysis predicted that 3 [/]-UTR of Rab5a mRNA of human cells contains an 8-mer target site (5/-AUGUUUCA-3/) located between 191–198 nucleotides that precisely matches the seed region (positions 1–8) of miR-494 (Fig 2B). [score:3]
S4 Fig To determine the role of miR-494 in the expression of Rab5a, HeLa cells were transfected with 50 nM miR-494 or control mimic as described in and Methods and level of Rab5a protein was determined after 48 h by Western blot analysis using anti-Rab5a antibody. [score:3]
Interestingly, we observed that 8-mer target site of miR-494 is well conserved in the 3 [/]-UTR of Rab5a in hamster whereas it is completely absent in the 3 [/]-UTR of Rab5a in mice (Fig 2B). [score:3]
Similar results are also obtained in miR-494 overexpressed macrophages under identical conditions. [score:3]
of control (*) and Rab5a siRNA/miR-494 overexpressed cells were analyzed by paired t test and levels of significance are indicated by P value. [score:3]
Expression of normalized miR-494 or c-Jun in uninfected cells in respective experiment was arbitrarily chosen as one unit. [score:3]
The result presented in the Fig 3A showed that transfection with the miR-494 (40 nM) reduces about 50% luciferase activity of Rab5a 3 [/]-UTR reporter, whereas about 20% inhibition of mutant Rab5a 3 [/]-UTR reporter was detected. [score:3]
We also found that infection with MOI (MOI 1:40) led to higher suppression of miR-494 than with MOI (MOI 1:20) after 12 h of infection (Fig 2D). [score:3]
B. Human PBMC differentiated macrophages were infected with Leishmania (MOI 1:20) and level of expression of miR-494 in uninfected and infected cells was determined at indicated time by qPCR as described in and Methods. [score:3]
Similar results were also obtained in miR-494 (50 nM) overexpressed macrophages under identical conditions (Fig 8B and 8C). [score:3]
Consequently, we determined the level of expression of miR-494 in L. donovani infected human macrophage (MOI 1:20) at different time periods of infection. [score:3]
Finally, we checked the expression of Rab5a protein after 48 h of transfection of indicated concentration of miR-494 in THP-1 macrophages by Western blot analysis using specific antibody. [score:3]
Determination of the levels of Rab5a protein in miR-494 overexpressed HeLa cells. [score:3]
Recruitment of Rab5a on Leishmania-PV in miR-494 overexpressed human macrophages was detected using specific antibody by confocal microscopy. [score:3]
Determination of miR-494 mediated expression of Rab5 isoforms. [score:3]
Inset (C) shows the level of expression of miR-494 in THP-1 transfected cells. [score:3]
Our results have demonstrated that miR-494 binds with miR-494 recognition element present in the 3 [/]-UTR of Rab5a to repress the expression of Rab5a in human cells. [score:3]
These results indicated that miR-494 binds with miR-494 recognition element present in the 3 [/]-UTR of human Rab5a to repress the expression of Rab5a. [score:3]
To determine the specificity, we also made another chimeric construct of 3 [/]-UTR of Rab5a containing mutation in miR-494 recognition element (5 [/]-CGACACGG-3 [/]). [score:2]
are represented as mean ± S. D. of three independent experiments and expressed as relative luciferase activity compared to miR-494 untreated control cells arbitrarily chosen as one unit. [score:2]
were expressed as relative luciferase activity compared to miR-494 untreated control cell arbitrarily chosen as 1 unit. [score:2]
To determine the levels of expression of miR-494 in infected and uninfected cells, qPCR was done using TaqMan miRNA assays (Life Technologies, 4427975). [score:2]
Our analysis also predicted (S2 Fig) that miR-494 has highest affinity to its complimentary target site for Rab5a (mirSVR score: -1.2494) compared to Rab5b (mirSVR score: -0.0086) and Rab5c (mirSVR score: -0.1579) in human cells. [score:2]
Subsequently, cells were transfected with 50 nM miR-494 or Rab5a specific siRNA using RNAi max transfection reagent (Invitrogen) as per manufacturer’s protocol and cells were incubated for 48 h at 37°C. [score:1]
D. THP-1 differentiated human macrophages were transfected with indicated concentrations of miR-494 and levels of Rab5a protein were determined by Western blot analysis as described in and Methods. [score:1]
B. THP-1 differentiated human macrophages were transfected with 50 nM miR-494 or Rab5a specific siRNA and subsequently cells were infected with Leishmania promastigotes as described in and Methods. [score:1]
D. Similar experiments were carried out with indicated MOI of infection and level of miR-494 was detected after 12 h. E. THP-1 differentiated human macrophages were infected with Leishmania (MOI 1:20) and level of c-Jun in infected cells was determined at indicated time by Western blot analysis using specific antibody. [score:1]
These results also indicate the possibility of modulating endo-lysosomal pathway in parasite infected cells by miR-494 or small molecules to divert trafficking of Leishmania probably to lysosome which might be useful for developing future therapeutic intervention. [score:1]
S2 FigmiRanda generated sequence alignment of human miR-494 binding site in the 3 [/]-UTR of Rab5 isoforms. [score:1]
miRanda generated sequence alignment of human miR-494 binding site in the 3 [/]-UTR of Rab5 isoforms. [score:1]
No significant changes were observed in Rab5b and Rab5c levels in miR-494 transfected cells. [score:1]
D. THP-1 differentiated human macrophages were transfected with 50 nM miR-494 and infected with Leishmania for 24 h as described in and Methods. [score:1]
Quantitation of miR-494 in infected and uninfected macrophages. [score:1]
[1 to 20 of 76 sentences]
4
[+] score: 284
Other miRNAs from this paper: hsa-mir-183
To search for putative targets of miR-494, we use bioinformatics prediction software TargetScan (http://targetscan. [score:7]
[47] In our study, we used bioinformatics prediction software of TargetScan and miRDB to predict the potential target genes of miR-494, and finally PAK1 was identified as a functional target gene of miR-494. [score:7]
MiR-494 suppresses tumorigenesis as well as tumor invasion in vivoGiven that miR-494 inhibits cell growth, colony forming and motility in vitro, we constructed MDA-231-LUC cell line stably expressing miR-494 for in vivo assays. [score:6]
As miR-494 is downregulated in breast cancer tissue and breast cancer cell lines, we infer miR-494 would inhibit cancer cell proliferation. [score:6]
The ectopic expression of miR-494 significantly suppressed cell proliferation in both MDA-231-LUC and BT-549 cells (Figure 2a). [score:5]
Exogenetic overexpression of MiR-494 suppresses clonogenic ability and metastasis-relevant traits in vitroAs MDA-MB-231-LUC-D3H2LN (hereafter referred to as MDA-231-LUC) and BT-549 cells have a lower expression level of miR-494 among the cultured breast cancer cells evaluated, we performed further functional experiments mainly in these two cell lines. [score:5]
And pri-494 was cloned into the lentiviral expression plasmid pLVX-IRES-ZSGreen (Clontech Laboratories, CA, USA) for miR-494 stable overexpressing. [score:5]
[29] In chondrosarcoma, miR-494 targets SOX9 to inhibit cell proliferation and invasion in vitro. [score:5]
Collectively, these results demonstrated that ectopic miR-494 expression was capable of suppressing tumorigenesis as well as tumor invasion in vivo. [score:5]
And cell motility suppressed by miR-494 was significantly compromised by the re -expression of PAK1 (Figures 6d and e). [score:5]
Moreover, high expression of miR-494 was significantly associated with E-cadherin expression, but not with other clinical parameters (Supplementary Tables 3 and 4). [score:5]
More importantly, we confirmed that the significant downregulation of miR-494 and upregulation of PAK1 in breast cancer tissues compared with paired non-tumor specimens in breast cancer TMA assay (Figure 4e). [score:5]
We found that overexpression of miR-494 greatly inhibited the tumor-initiating ability of MDA-MB-231-LUC cells. [score:5]
Furthermore, ectopic expression of miR-494 suppresses clonogenic ability and metastasis-relevant traits in vitro as well as carcinogenesis and pulmonary metastasis in vivo. [score:5]
In accordance with the qRT-PCR analysis, strong positive expression of miR-494 was observed in adjacent normal breast tissue whereas very weak positive expression of miR-494 in infiltrating ductal carcinoma (Figure 1c). [score:5]
In addition, the analysis of correlation of PAK1 and miR-494 expression in the TMA showed that the expression of miR-494 and PAK1 was linear negative correlated (Figures 4f and g). [score:5]
And as it shows, we can see that PAK1 reverses miR-494 -mediated proliferation, migration and invasion suppression, which was jammed by JNK inhibitor sp600125 (Supplementary Figures 5E–G). [score:5]
And the stable expression of miR-494 in MDA-231-LUC cells suppressed cell proliferation, colony-forming and cell motility as miR-494 mimics worked (Supplementary Figures 1C–E). [score:5]
Coherence, ectopic expression of miR-494 markedly reduced PAK1 expression at protein level in MDA-231-LUC and BT-549 cells (Figure 4d). [score:5]
To validate PAK1 as a direct target of miR-494 and find out the exact binding sites, we cloned wild-type and mutant 3′UTR of PAK1 into the downstream of the Renilla luciferase gene respectively in the psiCHECK vector with a firefly luciferase coding gene as internal control (Figure 4b). [score:4]
[30] In pancreatic cancer, miR-494 is significantly downregulated in pancreatic cancer tissue and is correlated with tumor progression and might be an independent, poor prognostic factor for patient with pancreatic cancer. [score:4]
Collectively, these data supported that miR-494 directly targeted PAK1 in human breast cancer cells and specimens. [score:4]
Meanwhile, ectopic expression of miR-494 in MDA-231-LUC and BT-549 cells also inhibited the invasion ability assessed by Matrigel invasion assays as well (Figure 2e). [score:4]
Given that miR-494 inhibits cell growth, colony forming and motility in vitro, we constructed MDA-231-LUC cell line stably expressing miR-494 for in vivo assays. [score:4]
In an attempt to confirm PAK1 was the direct functional mediator of miR-494 -induced cell phonotype change, we ectopically expressed PAK1 together with miR-494 in MDA-231-LUC and BT-549 cells. [score:4]
These results indicated that miR-494 directly targeted PAK1 mainly in the position of site2 (Figure 4c). [score:4]
Exogenetic overexpression of MiR-494 suppresses clonogenic ability and metastasis-relevant traits in vitro. [score:4]
Downregulation of miR-494 in breast cancer. [score:4]
32, 33, 34 In breast cancer, a previous study reported that miR-494 promotes tumor growth and metastasis in 4T1 cell by targeting PTEN. [score:3]
By touching the boundary of the tumor, we found that in 5 of 7 mice primary tumors formed by MDA-231-LUC-pLVX-NC (hereafter referred to as pLVX-NC) invaded into the inside of the peritoneal, whereas all miR-494-expressed tumors were well encased out of the peritoneal (Figure 3c). [score:3]
This study suggests that miR-494 have an important role in tumorigenesis and metastasis and is supposed to be a potential therapeutic target of breast cancer. [score:3]
And bioluminescence imaging and lung weight analysis revealed that miR-494 overexpression had decreased the burden of lung metastasis to a certain extent (Figures 3e and f). [score:3]
All these data clearly shows miR-494 functions as a tumor suppressor in breast cancer. [score:3]
Meanwhile, H&E staining of lung showed that the metastatic area was also decreased in miR-494 -expressing group than that of control group to some extent. [score:3]
Furthermore, we find overexpression of miR-494 decreases breast cancer lung metastasis. [score:3]
The frequency of primary tumor formed by miR-494 -expressing cells was less lower than the control cells (Figure 3a). [score:3]
MDA-MB-231-LUC cells stably expressing miR-494 (hereafter referred to as pLVX494) were injected into the mammary fat pad of nude mice. [score:3]
Data analysis of miR-494 expression in breast cancer cell line was normalized to the internal control U6 and then evaluated using the 2 [ΔΔCt] method, while data analysis of miR-494 expression in patients tissues was performed using −ΔCt method. [score:3]
qRT-PCR analysis showed the cells infected with pLVX-494 expressed miR-494 effectively (Supplementary Figure 1B). [score:3]
Considering tumor invasion and metastasis are common features of the most aggressive and lethal tumors, we detected the effects of miR-494 overexpression on metastasis-relevant traits in vitro. [score:3]
Summing up previous reports, we know the expression and function of miR-494 are different among cancers. [score:3]
MiR-494 directly targets PAK1 in breast cancer. [score:3]
Meanwhile, H&E staining of lung showed that the metastatic area was also decreased in miR-494 -expressing group than that of control group to some extent (Figure 3g). [score:3]
To figure out whether JNK pathway is involved in miR-494 and PAK1 mediated biologic functions, we used JNK inhibitor sp600125 to block PAK1-rescued functions. [score:3]
And the results showed that the colony number of miR-494 overexpressed cells was lower than that of the control group (Figure 2b). [score:3]
In lung cancer, miR-494 targets BIM to modulate TRAIL -induced apoptosis. [score:3]
One possible reason is that we injected the miR-494 overexpressing cells into the tail vein of SCID mice instead of implanting the cells into the fat pad of the breast. [score:3]
While there are some other studies show that miR-494 activates AKT signal pathway to promote tumor survival and metastasis by targeting PTEN. [score:3]
[28] Here, in this study, we show that miR-494 is downregulated in clinical specimens of breast cancer by both qRT-PCR and in situ hybridization of a breast tissue microarray assay. [score:3]
And the association between the expression level of miR-494 and breast cancer clinical prognosis is worth further studied. [score:3]
org) and identified a common set of three candidate genes whose 3′ untranslated regions (3′UTRs) contain at least one putative miR-494 binding sequence and function related with cell proliferation and motility (Supplementary Figure 2). [score:3]
MiR-494 rather than miR-NC significantly suppressed the luciferase activity of reporter genes containing 3′-UTR of PAK1. [score:3]
On the base of the expression difference of miR-494 in breast cancer and normal tissue, we conjecture that miR-494 may have roles in carcinomas biological behaviors. [score:3]
More importantly, staining of PAK1 and miR-494 in breast cancer samples shows that expression of PAK1 is inversely correlated with that of miR-494. [score:3]
These findings showed that PAK1 can partially rescue miR-494 induced inhibition of proliferation, colony formation, migration and invasion in MDA-231-LUC cells, which suggested that PAK1 was a functional mediator of miR-494 in breast cancer cells. [score:3]
According to Targetscan prediction, there are two miR-494 binding sites on PAK1-3′UTR, site1 (301–307) and site2 (867–874) (Figure 4a). [score:3]
PAK1, which acts as an oncogene in breast cancer by activating MAPK signal pathway and remolding cytoskeletal, is demonstrated to be a functional target gene of miR-494. [score:3]
To further describe miR-494 expression levels within mammary epithelial cells in the context of mammary architecture, a breast tissue microarray that contained 50 breast cancer and paired non-neoplastic specimens were used for further analysis. [score:3]
These results indicated that the reduced miR-494 expression was a frequent event in human breast cancer cells and tissues, which may be involved in breast carcinoma progression. [score:3]
To confirm the possibility of miR-494 targeting predicted candidate gene, 3′UTR of APC, Rab5A and PAK1 containing miR-494 binding site were cloned into the downstream of Renilla luciferase gene in the psiCHECK-2 vector (Promega). [score:3]
The bioluminescence imaging and lung weight analysis revealed that miR-494 overexpression have decreased the burden of lung metastasis to a certain extent. [score:3]
These results indicated that miR-494 ectopic expression in MDA-231-LUC and BT-549 cells can strikingly decrease the ability of proliferation, clonogenicity and motility in vitro. [score:3]
Besides biological targeting, this study shows that PAK1 dysfunction contributes to miR-494 biological functions, especially in cancer progression. [score:3]
In vivo function study, we can see miR-494 significantly inhibits tumorigenesis of breast cancer. [score:3]
From the result we can see miR-494 showed a lower expression in breast cancer tissues compared with the adjacent non-neoplastic tissues (Figure 1b). [score:2]
And the result shows miR-494 is thoroughly low expressed in breast cancer tissue compared with normal tissue. [score:2]
[23] Although in human cholangiocarcinoma, miR-494 has a global regulatory role in cell cycle progression causing G [2]/M arrest. [score:2]
The result showed that the expression of miR-494 in all nine breast cancer cell lines were significantly reduced at different degrees compared with MCF-10A, an immortalized breast epithelial cell line (Figure 1a). [score:2]
MiR-494 suppresses tumorigenesis as well as tumor invasion in vivo. [score:2]
MiR-494 suppresses breast cancer proliferation, colony forming, migration and invasion though PAK1 dysfunction. [score:2]
To explore this assumption, we transiently transfected MDA-231-LUC and BT-549 cells with miR-NC or miR-494 mimics respectively. [score:1]
These findings strongly suggest that miR-494 has an important role in the initiation and progression of breast cancer. [score:1]
As expected, in wound healing and Transwell migration assays, MDA-231-LUC and BT-549 cells overexpressed miR-494 displayed a significant depression in migration compared with miR-NC group (Figures 2c and d). [score:1]
To the best of our knowledge, this is the first study to explore the role of miR-494 during malignant progression of breast cancer in vivo. [score:1]
To investigate whether PAK1 involved in miR-494 -mediated function through MAPK signal pathways, we firstly exam the activation of p38, ERK and JNK MAPK signal pathways in miR-494 overexpressed breast cancer cells. [score:1]
[37] To eliminate the error might cause by tumor cells infiltrating in some so called adjacent normal tissue, we perform in situ hybridization with a 3′ and 5′ DIG-labeled miR-494 probe on a breast cancer TMA. [score:1]
To study the in vivo metastasis effect of miR-494 in mice, pLVX-494 or pLVX-NC cells were injected into the tail vein of SCID mice, respectively. [score:1]
All these results indicate that JNK pathway, as a downstream of PAK1, is involved in miR-494 -mediated biological functions. [score:1]
PAK1 is involved in the biological behaviors of miR-494. [score:1]
Consistent with previous reports that PAK1 acted as an oncogene in breast cancer, [27] PAK1 silencing significantly decreased the proliferation ability, colony formation ability and motility in MDA-231-LUC cells (Figures 5b–d), which was similar to the phenotype induced by miR-494. [score:1]
In suit hybridization was performed with a 3′ and 5′ DIG-labeled miR-494 probe as we described. [score:1]
PAK1 plays an important role in regulating these events, as we have shown in Supplementary Figure 6 that cells transfected with miR-494 mimics show an actin remo deling type associated with cell motility, show a decrease filament bundle of stress fiber in cytoplasm and an increase of stress fiber bundle assemble in periphery compared with miR-NC. [score:1]
To investigate the roles of miR-494 in breast cancer initiation and progression, we firstly detected the expression level of miR-494 in nine human breast cancer cell lines by real-time qRT-PCR. [score:1]
[31] From that we see in most of human cancer, miR-494 acts as an antitumor-microRNA. [score:1]
Consistent with that, there is a reduction of cell proliferation after miR-494 transfection. [score:1]
Besides detecting the tumorigenesis and invasion in vivo, we also explored the miR-494 function in metastasis. [score:1]
Subsequently, the expression of miR-494 in clinical breast cancer tissues were also evaluated by qRT-PCR. [score:1]
However, the expression stratification of miR-494 was independent of clinical pathological characteristics such as nodal status, ER status, HER2 status and so on (Supplementary Tables 1 and 2). [score:1]
We applied in situ hybridization with a 3′ and 5′ DIG-labeled miR-494 probe on this TMA. [score:1]
35, 36 Another report suggested that miR-494, together with miR-183, is associated with metastatic events, but miR-494 single has no significance. [score:1]
HEK293T cells were transiently transfected with these constructs together with miR-494 or miR-NC mimics. [score:1]
Cells were transfected with miR-494 mimics for 48 h and then stimulated with ANS for different time periods. [score:1]
Indeed, we find F-actin alteration causes cell migration and invasion ability decreased after the transfection of miR-494. [score:1]
As MDA-MB-231-LUC-D3H2LN (hereafter referred to as MDA-231-LUC) and BT-549 cells have a lower expression level of miR-494 among the cultured breast cancer cells evaluated, we performed further functional experiments mainly in these two cell lines. [score:1]
Thus, to better understand the accurate roles of miR-494 in metastasis cascade of breast cancer, other animal mo dels like implanting the cancer breast cells into the fat pad of the breast and detecting the lung metastasis should be further studied. [score:1]
Furthermore, we assessed the effect of miR-494 on the activation of JNK pathway. [score:1]
And we found that miR-494 significantly attenuated the phosphorylation of JNK after ANS stimulation (Supplementary Figure 5B). [score:1]
[1 to 20 of 97 sentences]
5
[+] score: 243
Other miRNAs from this paper: mmu-mir-127, hsa-mir-127, mmu-mir-494
B. The gene expression levels (RQ) of NOTCH1 targets was investigated in A549 transfected as in A. CDKN1A expression was significantly upregulated after miR-494-3p overexpression compared with control. [score:9]
More importantly, its overexpression or the upregulation of its member miR-494-3p, predicts a poorer prognosis in lung cancer patients. [score:6]
Consistent with these findings [16], factors involved in epithelial-to-mesenchymal transition (EMT) were overexpressed after upregulation of miR-494-3p (Figure 4C). [score:6]
Lastly, PTEN, a validated target of miR-494-3p [18, 19] and a NOTCH1-regulated protein [20], was significantly decreased in response to ectopic expression of miR-494-3p (p = 0.04; Figure 7D). [score:6]
In turn, this promotes tumor growth and metastatic dissemination in vivo, potentially reflecting a general pro-tumorigenic role of miR-494-3p by simultaneously downregulating the PTEN tumor-suppressor and increasing NOTCH1 and PI3K-AKT-S6RP signaling in vitro and in vivo. [score:6]
With respect to disease outcome, we have shown here that miR-494-3p predicts shorter survival of NSCLC patients, and mechanistically promotes increased tumor growth and metastatic dissemination via activation of a NOTCH1-PI3K-AKT axis, a key signaling network of lung carcinogenesis and important therapeutic target [27]. [score:5]
Red and blue colors indicate over or underexpression of the gene in miR-494-3p -expressing cells, respectively. [score:5]
For miRNA transfection experiments, A549 cells were seeded at 2×10 [6] cells/ml in 6-wells plates and transfected with miR-494-3p Mimic (100 nM, Sigma Aldrich, Milan, Italy), miR-494-3p Inhibitor (150 nM, Sigma Aldrich) or with a Mimic/Inhibitor control (50 nM, Sigma Aldrich) in the presence of 5 µl of Lipofectamine 2000 (Thermo Fisher Scientific) in 1ml of OptiMem Medium (Thermo Fisher Scientific). [score:5]
In human lung tumors, miR-494-3p is highly expressed at the invasive front and its forced expression in lung cancer cells induces a stem-like phenotype, with increased side population compartment, tumor sphere formation, heightened cell motility, and increased NOTCH1 signaling. [score:5]
Our data validate an important role of miR-494-3p and DIO3-DLK1 miRNAs cluster as important biomarkers of lung carcinogenesis, highlighting that upregulation of those miRNAs is an oncogenic mechanism conserved in humans, where epigenetic deregulation of DIO3-DLK1 miRNAs is observed in more aggressive lung tumors. [score:5]
C. - D. NOTCH1 and miR-494-3p targets protein contents were analyzed in A549 cultures overexpressing or not (Ctrl) the miRNA. [score:5]
For these studies, we first analyzed the expression of 36 genes implicated in key cancer pathways (Supplementary Table 8) after modulation of miR-494-3p expression in A549 cells (Supplementary Figure 3A). [score:5]
A549 cells were reverse -transfected with Mimic/Inhibitor control and miR-494-3p Mimic/Inhibitor (26 nM) on a 96-wells plate pre-coated with reporter genes for 10 transcription factors (TF), as well as positive and negative controls (Cignal Finder Reporter array, Signal Transduction 10 Pathways, SaBiosciences Corp. [score:5]
Although these miRNAs were not generally significantly overexpressed in lung cancer compared to normal tissues (Supplementary Figure 2A), patients with high levels of miR-494-3p had a shorter disease-free survival time (p = 0.046; Supplementary Figure 2B). [score:4]
Importantly, SP cells exhibited a distinctive miRNAs expression profile compared to NSP cells (Figure 5B), as miR-494-3p miRNA was the most overexpressed miRNA in the SP fraction (FC = 8.2; Figure 5C). [score:4]
Further, there was no direct correlation between 14q genomic status and pri-miR-494 expression (Figure 3F). [score:4]
Regulation of miR-494-3p expression. [score:4]
D. Ingenuity pathway analysis of the 36 analyzed genes in A549 cells with ectopic miR-494-3p or control construct expression returned a signaling network with impact on cell survival, embryonic and organism development (Score 45). [score:4]
Firstly, we demonstrated in our series of 57 NSCLCs that there is a direct correlation between the precursor pri-miR-494 levels and its mature miR-494-3p expression (p = 0.002; Figure 3A). [score:4]
At the protein level, miR-494-3p upregulation increased both total NOTCH1 and NOTCH1 Intracellular Domain (NICD), as well as of CDKN1A (Figure 7C). [score:4]
E. Western Blot analysis of PI3K/AKT pathway members after miR-494-3p overexpression. [score:3]
, Redwood City, CA, USA) was used to infer on cellular networks with biological significance using as dataset the analyzed genes (Supplementary Table 8) in A549 cultures overexpressing the miR-494-3p or a control construct. [score:3]
For in vitro and in vivo experiments, differences among samples with miR-494-3p overexpression or control were analyzed using the unpaired Student's t test or the Mann-Whitney U test as indicated (Prism 4.0, GraphPad Inc). [score:3]
In particular, ZEB2 and S100A mRNAs were significantly increased upon miR-494-3p overexpression (p = 0.03 and 0.003, respectively; Figure 4C). [score:3]
Then, A549 cells overexpressing miR-494-3p or a control miRNA (Ctrl) were injected in the lateral tail vein of athymic mice (n = 26, Figure 6B) and lung cancer foci formation was monitored by MRI at day 11 and 17 after injection (Figure 6C). [score:3]
miR-494-3p overexpression enhances tumor motility in vitro and in vivoBased on the above results, we next analyzed the role of miR-494-3p in sustaining tumor cell motility and metastatic dissemination in vivo. [score:3]
To further test a role of miR-494-3p in sustaining tumor growth in vivo, A549 cells overexpressing miR-494-3p or control miRNA were injected subcutaneously in the lower flank of athymic mice (n = 14; Figure 5H). [score:3]
E. The IG-DMR decreased methylation of NSCLC samples (n = 12) was analyzed in function of pri-miR-494 expression levels. [score:3]
In parallel, miR-494-3p promotes NOTCH1 signaling and expression of downstream genes involved in EMT and cancer stemness (Figure 8). [score:3]
Similar findings were observed in vivo, as xenografts and metastatic foci generated by miR-494-3p -overexpressing A549 cells exhibited increased staining for phospo-S6RP (Figure 7F, 7G). [score:3]
A) miR-494-3p and pri-miR-494 expression correlation. [score:3]
F., G. A549 cells with forced miR-494-3p or a control Mimic expression were plated in low-adhesion plates in serum-free media. [score:3]
miR-494-3p expression was significantly higher in the invasive front than in tumor bulk specimens (p = 0.03; Figure 2E). [score:3]
Bars represent the average miR-494-3p expression level (RQ) from three independent experiments. [score:3]
miR-494-3p regulates pathways involved in cancer and development. [score:3]
Figure 4 A. - C. Heat-Maps of genes involved in apoptosis (A), cancer stem cells maintenance (B; PROM1, p = 0.007; NUMBL, p = 0.001; KLF4, p = 0.005; CDKN1A, p = 0.003, by Mann-Whitney U test), or epithelial-to-mesenchymal transition (C; ZEB2, p = 0.03; S100A, p = 0.003, by Mann-Whitney U test) upon enforced expression of a control (Ctrl) or miR-494-3p Mimic in A549 cultures. [score:3]
In contrast, reduced levels of miR-494-3p did not affect NOTCH1 activation (Supplementary Figure 4C and D), the levels of the NOTCH1 target CDKN1A (Supplementary Figure 4E), or of PI3K signaling in A549 cells (Supplementary Figure 4F). [score:3]
C. miR-494-3p expression in A549-SP and -NSP populations (fold difference = 8.2). [score:3]
Consistent with the data above, miR-494-3p overexpression was associated with PI3K pathway activation, with increased levels of phosphorylated AKT at Ser473, AKT2 at Ser474, total and AKT-activated PDK1 (pPDK1 [T346]), and phospo-S6RP protein (Figure 7E). [score:3]
In addition, tumors with high pri-miR-494 expression showed higher miR-494-3p levels (p = 0.02; Figure 3B). [score:3]
Differences in gene expression among A549 cells transfected with a miR-494-3p Mimic or a control were analyzed by Mann-Whitney U test. [score:3]
Analysis of a reporter array of 10 oncogenic transcription factors (Supplementary Table 9, [17]), demonstrated that A549-miR-494-3p expressing cells exhibited significant increased NOTCH1 pathway activity (p = 0.04; Figure 7A). [score:3]
A. - C. Heat-Maps of genes involved in apoptosis (A), cancer stem cells maintenance (B; PROM1, p = 0.007; NUMBL, p = 0.001; KLF4, p = 0.005; CDKN1A, p = 0.003, by Mann-Whitney U test), or epithelial-to-mesenchymal transition (C; ZEB2, p = 0.03; S100A, p = 0.003, by Mann-Whitney U test) upon enforced expression of a control (Ctrl) or miR-494-3p Mimic in A549 cultures. [score:3]
miR-494-3p overexpression enhances tumor motility in vitro and in vivo. [score:3]
Moreover, ectopic expression of the cluster member miR-494-3p enhanced the A549 side population compartment and CD133, NUMBL and KLF4 mRNA levels. [score:3]
Next, we overexpressed miR-494-3p in A549 and examined the percentage of SP cells compartment by FACS. [score:3]
Based on these results of NOTCH1 activation and PTEN repression, we next looked at potential alterations of PI3K signaling in A549 cells with modulation of miR-494-3p expression. [score:3]
Ingenuity pathway analysis suggested that miR-494-3p modulation influenced cellular networks implicated in “cell death and survival, embryonic development and organism development” (Score 45; focus molecules: 18; Figure 4D). [score:3]
Numbers indicate the quantification of proteins and phospho-proteins (normalized on the corresponding total protein) in miR-494-3p overexpressing cells compared to control. [score:2]
Interestingly, forced expression of miR-494-3p did not affect apoptosis-related mechanisms (Figure 4A), but significantly increased the levels of PROM1, CDKN1A, NUMBL and KLF4, four stem cell-related mRNAs, compared to controls (p = 0.007, 0.003, 0.001 and 0.005, respectively; Figure 4B). [score:2]
Ectopic miR-494-3p expression in non-adherent culture condition significantly enhanced A549 sphere formation ability and size, a marker of stemness, compared to control incubations (p = 0.04 for both analyses; Figure 5F, 5G). [score:2]
Genes found to be overexpressed or downmodulated in A549 cells transfected with the miR-494-3p compared to the control are shown respectively in red and green. [score:2]
Conversely, reduction of miR-494-3p levels in A549 by transfection with a miRNA Inhibitor (p = 0.03; Supplementary Figure 3C) did not affect the SP compartment compared to control (Supplementary Figure 3D). [score:2]
The 14q32 locus undergoes imprinting [15], and we next further characterized how miR-494-3p expression is regulated in human lung tissues. [score:2]
A549 cells with forced overexpression of miR-494-3p generated larger tumors compared to control cultures 18 days after injection (p = 0.006; Figure 5I). [score:2]
B) Pri-miR-494 expression levels compared with miR-494-3p levels. [score:2]
Numbers indicate the quantification of proteins in miR-494-3p overexpressing cells compared to control. [score:2]
miR-494-3p contribution to NOTCH1 pathway and PTEN regulation. [score:2]
B. - E. A549 cultures transfected with a miR-494-3p or a control Mimic were intravenously injected into the lateral tail vein of athymic nude mice (n = 13 per condition; B). [score:1]
Specifically, miR-494 has been shown to contribute to tumorigenesis of brain [25], lung [24] and liver [19] by affecting the PTEN/AKT pathway. [score:1]
A549 cells transfected with miR-494-3p generated significantly more and larger metastatic foci than controls (E). [score:1]
Schematic representation of miR-494-3p-NOTCH1-PI3K-AKT signaling in lung cancer cells. [score:1]
Based on the above results, we next analyzed the role of miR-494-3p in sustaining tumor cell motility and metastatic dissemination in vivo. [score:1]
Figure 2 A. Kaplan-Meier curves of NSCLC patients overall survival according to miR-494-3p levels. [score:1]
To better understand a potential involvement of 14q32 miRNAs and, in particular, miR-494-3p in tumor-initiating progenitor maintenance, the side (SP) and non-side (NSP) cell populations were sorted from A549 lung cancer cells (Figure 5A). [score:1]
Figure 8 A. Quantification of transcription factor (TF) activity in A549 transfected with miR-494-3p or control (Ctrl) Mimic. [score:1]
The 14q32 miR-494-3p is correlated to lung cancer patients’ prognosis. [score:1]
In a wound-healing assay, overexpression of miR-494-3p enhanced A549 cells migration compared to control samples (Ctrl) 72 h after transfection (p = 0.008; Figure 6A). [score:1]
Together, these results point to a novel signaling axis orchestrated by miR-494-3p-NOTCH1-PI3K activation (Figure 8) involved in lung cancer onset and metastatic dissemination. [score:1]
miR-494-3p is involved in lung tumor-initiating population maintenance. [score:1]
Figure 7 A. Quantification of transcription factor (TF) activity in A549 transfected with miR-494-3p or control (Ctrl) Mimic. [score:1]
Finally, we examined signaling pathways downstream of miR-494-3p potentially implicated in tumor-initiating cells. [score:1]
Correlation between miR-494-3p and pri-miR-494 levels has been analyzed using the Spearman Rank Correlation. [score:1]
Individual pri-miR-494 levels are displayed in NSCLCs according to the genomic alteration found. [score:1]
Together, the results obtained with the murine lung cancer mo del and analysis of patient cohorts suggested that miR-494-3p and, to a lesser extent, chromosome 14 miRNA cluster correlated with a more invasive, ABCG2 -positive phenotype in NSCLC. [score:1]
miR-494-3p involvement in molecular pathways relevant for cancer progression. [score:1]
High miR-494-3p levels were significantly associated with shorter patients’ overall survival (p = 0.03; Figure 2A). [score:1]
A. Kaplan-Meier curves of NSCLC patients overall survival according to miR-494-3p levels. [score:1]
Twenty-six male athymic nude-Foxn1 [nu] mice (Harlan Laboratories Srl) were injected intravenously into the lateral tail vein with 5×10 [5] A549 cells transfected with a Mimic control (Ctrl)or a miR-494-3p Mimic in a total volume of 200 μl of sterile PBS (13 mice per condition). [score:1]
In summary, we have identified miR-494-3p as a potentially critical theranostic marker of tumor progression in NSCLCs. [score:1]
A. A549 cells were transfected with a miR-494-3p or a control (Ctrl) Mimic. [score:1]
Correlation between pri-miR-494 and submicroscopic genomic alteration of DLK1-DIO3 region was analyzed using Fisher's exact test. [score:1]
In addition, IG-DMR demethylation in tumors relative to non-neoplastic lung parenchyma was more evident in NSCLCs with elevated pri-miR-494 levels (Figure 3E). [score:1]
In vivo tumor growth and metastatic dissemination analysesFourteen male athymic nude-Foxn1 [nu] mice (Harlan Laboratories Srl, Udine, Italy) at 6 weeks of age were injected subcutaneously into the lower flank with 5×10 [5] A549 cells transfected with a Mimic control (Ctrl) or a miR-494-3p Mimic in a total volume of 200 μl of sterile PBS (seven mice per condition). [score:1]
F. Xenografts generated from A549 cultures transfected with miR-494-3p or control (Ctrl) were analyzed for pospho-S6RP Ser235/236 by immunohistochemistry (pS6RP IHC). [score:1]
miR-494-3p enhanced lung cancer cells motility. [score:1]
miR-494-3p contribution to NOTCH and PI3K/AKT pathways. [score:1]
After 48h of transfection with miR-494-3p Mimic and control, A549 cells (5×10 [3] cells/ml) were seeded in poly-HEMA (20mg/ml, Sigma Aldrich) coated 6-wells plates in serum-free DMEM medium supplemented with 20 ng/ml human recombinant basic fibroblast growth factor (bFGF) and 20 ng/ml epidermal growth factor (EGF; all from Thermo Fisher Scientific). [score:1]
H., I. A549 cultures transfected with a miR-494-3p or a control (Ctrl) Mimic were subcutaneously injected in the right flank of athymic nude mice (n = 7 per condition). [score:1]
These data show that epigenetic but not genetic alterations could contribute to miR-494-3p deregulation in lung cancer, prompting us to investigate potential miR-494-3p-directed signaling pathways in NSCLC. [score:1]
Fourteen male athymic nude-Foxn1 [nu] mice (Harlan Laboratories Srl, Udine, Italy) at 6 weeks of age were injected subcutaneously into the lower flank with 5×10 [5] A549 cells transfected with a Mimic control (Ctrl) or a miR-494-3p Mimic in a total volume of 200 μl of sterile PBS (seven mice per condition). [score:1]
E. miR-494-3p analysis in tumor bulk and invasive front of 16 NSCLC cases. [score:1]
Based on these findings, we next looked at a potential role of miR-494-3p in potentially modulating lung cancer “stemness”. [score:1]
D., E. A549 cells were transfected with a miR-494-3p or a control (Ctrl) Mimic and the SP was analyzed by FACS as in A. The percentage of the SP is shown within each graph and quantified from four independent experiments in E. *, p = 0.02 by Mann-Whitney U test. [score:1]
Therefore, our data provide comprehensive evidence that miR-494-3p promotes activation of PI3K signaling, with concomitant activation of AKT-mTOR-pS6RP in lung cancer, contributing to tumor cell proliferation. [score:1]
miR-494-3p contributes in cancer progenitor cells maintenance and tumor growth. [score:1]
[1 to 20 of 96 sentences]
6
[+] score: 240
Other miRNAs from this paper: hsa-mir-20a, hsa-mir-21, hsa-mir-210, hsa-mir-519c
Overexpression of miR-494 upregulated HIF-1α expression through activating PI3K/Akt pathway under both normoxia and hypoxia, and had protective effects against hypoxia -induced apoptosis in L02 cells. [score:8]
Similarly, overexpression of miR-494 also increased mRNA levels of HIF-1α and HO-1 under hypoxia (Figure  3C), and upregulated proteins expression of p-Akt, HIF-1α and HO-1 in L02 cells (p < 0.05) (Figure  3D). [score:8]
To confirm whether miR-494 increased HIF-1α expression through PTEN/PI3K/Akt pathway in L02 cells, we detected proteins expression of PTEN, p-Akt, HIF-1α and its target gene HO-1. We found that mRNA levels of HIF-1α and HO-1 were increased by miR-494 (Figure  3A). [score:7]
Treatment of the L02 cells with PI3K inhibitor LY294002 inhibited miR-494-inducing HIF-1α and HO-1 expression (Figure  3). [score:7]
Functionally, we found that overexpression of miR-494 significantly increased mRNA and protein levels of HIF-1α under normoxia, resulted in the subsequence expression of downstream target gene HO-1 (p < 0.05) (Figure  2B, C). [score:7]
Our study is first to reveal the role of overexpression of miR-494 in regulating HIF-1α expression in L02 cells. [score:6]
In this study, we have shown that overexpression of miR-494 in L02 cells increased the expression of HIF-1α and its downstream gene HO-1 by activating the PI3K/Akt pathway. [score:5]
In our study, western blot analysis results showed that overexpression of miR-494 could markedly enhance Akt phosphorylation leading to the subsequent upregulation of HIF-1α and HO-1under normoxia and hypoxia, compared to control group (Figure  3). [score:5]
It suggested that miR-494 induced HIF-1α expression through some other pathways, not direct regulation. [score:5]
To detect the effect of miR-494 overexpression on HIF-1α expression, L02 cells were transfected with miR-494 mimic or miR -negative control via Lipo2000. [score:5]
Several studies revealed that miR-494 could target PTEN, leading to activate PI3K/Akt pathway which could augment HIF-1α expression [17, 20- 23]. [score:5]
These results suggested that overexpression of miR-494 increased HIF-1α and HO-1 expression levels under both normoxic and hypoxic conditions in L02 cells. [score:5]
Figure 2 Overexpression of miR-494 increased HIF-1α and HO-1 expression under both normoxia and hypoxia. [score:5]
Our results also showed that overexpression of miR-494 increased the expression of HIF-1α and its downstream gene HO-1 under normoxia and hypoxia in L02 cells (Figure  2). [score:5]
These results suggested that overexpression of miR-494 could augment HIF-1α expression through Akt activation in L02 cells. [score:5]
Furthermore, we found that overexpression of miR-494 increased the of expression HIF-1α through activating the PI3K/Akt signaling pathway and protected against hypoxia -induced apoptosis in the immortalized hepatocyte cell line L02. [score:5]
Comparing with the negative control group, the expression of miR-494 in mimic transfection group was significantly increased after transfection for 24 hours and 48 hours, respectively (Figure  2A), indicating that miR-494 overexpression system in L02 cells was successful in technology. [score:5]
Overexpression of miR-494 induced Akt activation and significantly increased HIF-1α and HO-1 expression under normoxia, compared to negative control (p < 0.05). [score:4]
In present study, we found that miR-494 was upregulated in L02 cells during hypoxia (Figure  1), which might represent an adaptive response to hypoxia challenge. [score:4]
We hypothesized that upregulation of miR-494 might represent an adaptive response to early hypoxia challenge. [score:4]
While the direct target genes of miR-494 should be demonstrated in our future study. [score:4]
Quantitative RT-PCR showed that miR-494 was up-regulated to peak after 4 hours of hypoxia in human liver cell line L02. [score:4]
MiR-494 overexpression increased HIF-1α and HO-1 expression under normoxia and hypoxia. [score:4]
Our results indicated that miR-494 levels were significantly upregulated after hypoxia for 4 hours, followed by decrease under further hypoxia (Figure  1). [score:4]
Our results indicated that overexpression of miR-494 significantly induced the expression of p-Akt, HIF-1α and HO-1 determined by qRT-PCR and western blot under normoxia and hypoxia, compared to negative control (p < 0.05). [score:4]
Our results showed that miR-494 were upregulated up to peak after 4 h of hypoxia in the L02 human hepatic cell line. [score:4]
Figure 1 Hypoxia induced upregulation of miR-494 in L02 cells. [score:4]
While several miRs profiling studies revealed that miR-494 was downregulated in animal ischemic/hypertrophic hearts [32, 33], Xiaohong Wang et al. reported that miR-494 levels were increased in ex vivo I/R mouse hearts [16]. [score:4]
In the present study, we wonder about the hypoxia -induced changes in miRNA-494 expression in L02 cells. [score:3]
Together, these findings provided evidence that overexpression of miR-494 might protect L02 cells against hypoxia -induced apoptosis. [score:3]
In conclusion, our investigations demonstrated that overexpression of miR-494 could augment HIF-1α expression through Akt activation in L02 cells for the first time. [score:3]
We hypothesize that miR-494 may have a role in influencing HIF-1α expression and contribute to the cellular response to hypoxia. [score:3]
Cells were incubated under hypoxia (1%O [2], 5%CO [2] in a 37°C incubator) for 4 hours, 8 hours, and 16 hours, followed by analysis for miR-494 expression by real-time qRT-PCR. [score:3]
Thus, these findings suggested that miR-494 might be a target of therapy for hepatic hypoxia/ischemia injury. [score:3]
To further establish the axis of miRNA-494/p-Akt/HIF-1α, cells were transfected with miR-494 mimic and treated with LY294002 (PI3K inhibitor, block the PI3K/Akt pathway) at 30 μM. [score:3]
miR-494 targeted PTEN resulting in the subsequent activation of the Akt pathway involved in various pathophysiologic processes, including cell apoptosis, survival, tumor metastasis, and angiogenesis [20, 22, 23]. [score:3]
We found that overexpression of miR-494 had protective effects against hypoxia -induced apoptosis in L02 cells. [score:3]
Of course, we could not exclude that other signaling molecules also contributed in miR-494-inducing HIF-1α expression. [score:3]
LY294002 treatment inhibited miR-494-inducing HIF-1α and HO-1 mRNA levels (Figure  3A, C), and abolished miR-494-inducing Akt activation leading to subsequent decrease of HIF-1α and HO-1 protein levels under both normoxic and hypoxic conditions (p < 0.05) (Figure  3B, D). [score:3]
Our results showed that overexpression of miR-494 also significantly increased mRNA and protein levels of HIF-1α and HO-1 (p < 0.05) (Figure  2D, E). [score:3]
Hypoxia -induced changes in miRNA-494 expression in human hepatic cell line L02. [score:3]
The miR-494 overexpression study was performed using miR-494 mimic (200 nM) and its negative control (200 nM). [score:3]
Our results showed that overexpression of miR-494 decreased apoptosis ratio under hypoxia comparing with negative control (Figure  4). [score:3]
However, more studies are needed to determine whether miR-494 activate the Akt pathway by targeting PTEN in L02 cells. [score:3]
Previous studies have demonstrated that miR-494 could target both proapoptotic proteins and antiapoptotic proteins to active the Akt-mitochondrial signaling pathway, leading to cardioprotective effects against ischemia/reperfusion -induced injury [16]. [score:3]
Transfected cells were exposed to hypoxia for 8 hours in our following study, because there was a more obvious difference of HIF-1α expression after 8 hours of hypoxia between miR-494 mimic group and miR -negative control group (data not shown). [score:3]
Overexpression of miR-494 protected L02 cells against hypoxia -induced apoptosis. [score:3]
Taken together, we supposed that miR-494 induced HIF-1α expression dependent on Akt activation. [score:3]
We found that there were no targets for miR-494 in 3’ UTR of HIF-1α. [score:3]
Moreover, miR-494 has cardioprotective effects against ischemia/reperfusion -induced injury by targeting both proapoptotic proteins (PTEN, ROCK1, CaMKIIδ) and antiapoptotic proteins (FGFR2 and LIF) to active the Akt-mitochondrial signaling pathway [16]. [score:3]
Moreover, apoptosis detection using Annexin V indicated that overexpression of miR-494 significantly decreased hypoxia -induced apoptosis in L02 cells, compared to control (p < 0.05). [score:2]
MiR-494 overexpression also decreased caspase-3/7 activity by 1.27-fold under hypoxia in L02 cells. [score:2]
MiR-494 increased HIF-1α expression through PI3K/Akt pathway. [score:2]
Figure 3 MiR-494 induced HIF-1α and HO-1 expression by activating PI3K/Akt pathway. [score:2]
It has been reported that miR-494 had cardioprotective effects against ischemia/reperfusion -induced injury through Akt activation [16]. [score:1]
While LY294002 treatment markedly abolished miR-494-inducing Akt activation, HIF-1α and HO-1 increase under both normoxic and hypoxic conditions (p < 0.05). [score:1]
To determine the effect of miR-494 on hypoxia -induced apoptosis in L02 cells, transfected cells incubated under hypoxia were stained with Annexin V-FITC/PI and detected by flow cytometry (Figure  4). [score:1]
org to predict the relationship between miR-494 and HIF-1α. [score:1]
However, the potential link between miR-494 and HIF-1α is unknown. [score:1]
One specific microRNA, miR-494 has been studied in cancer research and got more and more attention [20, 29- 31]. [score:1]
Therefore, the present study was undertaken to investigate the influence of miR-494 on HIF-1α expression and its relative mechanism in human hepatic cell line L02. [score:1]
MicroRNA-494 (miR-494) had cardioprotective effects against ischemia/reperfusion (I/R) -induced injury, but its functional relationship with HIF-1α was unknown. [score:1]
The role of miR-494 in liver cell was unclear. [score:1]
However, the relationship between miR-494 and HIF-1α has not been explored. [score:1]
To assess the effect of miR-494 on HIF-1α under hypoxia, transfected cells were exposed to hypoxia (1%O [2], 5%CO [2] in a 37°C incubator) for 8 hours. [score:1]
To further study the biological function of miR-494 in hypoxia, cell apoptosis was detected by Annexin V-FITC/PI staining and caspase-3/7 activity were analyzed by flow cytometry. [score:1]
This study was undertaken to determine if miR-494 was involved in the induction of HIF-1α. [score:1]
L02 cells were transfected with either miR-494 mimic or miR -negative control at 200 nM under normoxia. [score:1]
During hypoxia, overpression of miR-494 protected L02 cells against hypoxia -induced apoptosis. [score:1]
Though miR-494 was significantly increased during hypoxia for 4 hours in L02 cells. [score:1]
These data suggested that miR-494 had protective effects against hypoxia -induced apoptosis in L02 cells. [score:1]
A series of studies have revealed that miR-494 played an important role in tumor [23, 34, 35]. [score:1]
These findings indicated that alteration of miR-494 was dependent on the physiological/pathological conditions. [score:1]
The apoptosis ratio in miR-494 mimic group was significantly decreased comparing with control group both under hypoxia for 8 h and 16 h (p < 0.05) (Figure  4B). [score:1]
Figure 4 Effect of miR-494 on hypoxia -induced apoptosis was determined with Annexin V-FITC/PI binding staining by flow cytometry. [score:1]
Cells were transfected with miR-494 mimic or miR -negative control as described above. [score:1]
Simultaneously, almost all previous studies about miR-494 were implemented in tumour cells or myocardial cell. [score:1]
Cells were cultured to 30-50% confluence, and transfected with miR-494 mimic and negative control using Lipofectamine 2000 (Invitrogen) in serum-free Opti-MEM medium (Gibco) according to the manufacturer’s instruction. [score:1]
[1 to 20 of 78 sentences]
7
[+] score: 237
These data suggest that the therapeutic effect of hinokitiol in vivo in the suppression of breast tumor growth is associated with the upregulation of miR-494-3p, leading to the down-regulation of BMI1 expression. [score:11]
In conclusion, hinokitiol could target BCSCs in vitro and in vivo through upregulation of miR-494-3p, inhibiting BMI1 expression. [score:10]
On the other hand, miR-494-3p could inhibit gastrointestinal stromal tumor cell proliferation by targeting KIT [17] or suppressing invasion of prostate cancer cells through down-regulation of CXCR4 [18]. [score:10]
Furthermore, the down-regulation of BMI1 protein expression in xenograft tumors derived from miR-494-3p overexpressed BT-474 cells was confirmed by Western blot (Figure 5F). [score:8]
This study presents the tumor-suppressive function of miR-494-3p in breast cancer by inhibiting BCSC self-renewal and directly targeting BMI1 (Figure 4 and 5). [score:8]
Furthermore, overexpression of miR-494-3p in AS-B145 and BT-474 mammospheres suppressed BMI1 expression (Figure 4B). [score:7]
When AS-B145 or BT-474 cells were transfected with miR-494-3p inhibitor, the inhibitory effects of hinokitiol to BMI1 expression (Figure 3B) or mammosphere formation (Figure 3C) was abolished. [score:7]
This miRNA shortens the disease-free survival time in lung cancer patients with high expression levels [15] or the inhibition of PTEN by miR-494-3p, leading to the activation of Akt in nasal natural killer cell lymphoma [35]. [score:7]
Inhibition of miR-494-3p abolished the inhibitory effect of hinokitiol in targeting BMI1. [score:7]
The upregulation of miR-494-3p as well as down-regulation of BMI1 was observed in hinokitiol -treated xenograft tumors. [score:7]
The direct targeting of Sox9 by miR-494-3p led to the suppression of cell migration, invasion, as well as tumor growth of chondrosarcoma cells [36]. [score:6]
These results indicate that the inhibitory effect of hinokitiol to the self-renewal capability of BCSCs is mediated by miR-494-3p -induced BMI1 down-regulation. [score:6]
With transfection of miR-494-3p mimic, the overexpression of miR-494-3p significantly suppressed the primary and secondary mammosphere formations of AS-B145 (Figure 5A) and BT-474 cells (Figure 5B). [score:5]
The inhibition of miR-494-3p expression partially abolished the anti-BCSC effects of hinokitiol (Figure 3). [score:5]
Recently, miR-494-3p was demonstrated to target PAK1 in breast cancer cells, leading to the suppression of cell invasion [19]. [score:5]
Results regarding the inhibitory effect of hinokitiol in BMI1 expression through the induction of miR-494-3p suggest that hinokitiol has the potential to develop into a sensitization agent in breast cancer radiotherapy. [score:5]
The mediation of miR-494-3p on the suppressive effects of hinokitiol to the self-renewal capability and BMI1 expression in BCSCs. [score:5]
In conclusion, these data demonstrated that hinokitiol could suppress the self-renewal and tumorigenicity of BCSCs through miR-494-3p -mediated BMI1 inhibition. [score:5]
Overexpression of miR-494-3p in human breast cancer cells suppressed tumor growth of BCSCs in vivo. [score:5]
miR-494-3p has been reported to demonstrate oncogenic effects by modulating NOTCH1 and PTEN/PI3K/AKT signaling in non-small cell lung cancer [15], accelerating cell proliferation in liver cancer, and down-regulation or mutation in colorectal cancer [16]. [score:5]
These findings are consistent with the previous studies, which demonstrated that miR-494-3p induced cellular senescence in oral squamous carcinoma cells through the downregulation of BMI1 [27]. [score:4]
The miR-494-3p overexpression was introduced by the lentiviral delivery of miR-494-3p precursor into the BT-474 cells and performed xenograftment assay in vivo in NOD/SCID immunocompetent mice; the tumor growth of BT-474 cells with miR-494-3p overexpression was significantly slower than control tumors (Figure 5E, p= 0.0114). [score:4]
This finding suggests that hinokitiol may induce miR-494-3p expression through the down-regulation of EZH2, but the underlying molecular mechanism requires further investigation. [score:4]
Results show that the expression of BMI1 protein was higher in miR-494-3p [low] BT-474 cells than those of miR-494-3p [high] counterparts (Figure 5C). [score:3]
miR-494-3p as an oncosuppressor miRNA in breast cancer. [score:3]
Altogether, these data strongly suggest that miR-494-3p is an oncosuppressor miRNA in breast cancer. [score:3]
The expression of miR-494-3p in mammospheres was then detected after hinokitiol treatment. [score:3]
By contrast, other reports indicated that miR-494-3p could be a tumor suppressor miRNA. [score:3]
The association between miR-494-3p expression and overall survival rate of breast cancer patients was analyzed using public breast cancer datasets of GSE37405 and TCGA by online analysis tools. [score:3]
The expression of miR-494 is negatively correlated with survival time of breast cancer patients. [score:3]
miR-494-3p serves as an oncosuppressor in breast cancer. [score:3]
In order to sort the differential miR-494-3p expressing cells, the Smartflare beads was used (Merck Millipore, Temecula, CA, USA). [score:3]
RNU6B was used as internal control for analyzing miR-494-3p expression. [score:3]
Moreover, the results indicate that miR-494-3p functions as an oncosuppressor in breast cancer. [score:3]
Figure 6The correlation between miR-494 expression and overall survival in a GSE37405 dataset of ER+ breast cancer patients (A) or metastasis free survival in TCGA invasive breast cancer dataset (B) was analyzed by MIRUMIR or PROGmiR V2 website. [score:3]
BMI1 is a target of miR-494-3p. [score:3]
These results also show the tumor suppression effects of miR-494-3p. [score:3]
miR-494-3p mediates the suppressive effect of hinokitiol in the self-renewal of BCSCs. [score:3]
The correlation between miR-494 expression and overall survival in a GSE37405 dataset of ER+ breast cancer patients (A) or metastasis free survival in TCGA invasive breast cancer dataset (B) was analyzed by MIRUMIR or PROGmiR V2 website. [score:3]
The expression of miR-494-3p was significantly and inversely correlated with breast cancer patient survival in two independent public database sets. [score:3]
The expression of miR-494-3p in mammospheres was induced by hinokitiol. [score:3]
Immunohistochemistry analysis demonstrated a reduction of the positive stain of nuclear BMI1 in tumors derived from miR-494-3p overexpressed BT-474 cells (Figure 5F). [score:3]
Figure 3 (A) miR-494-3p expression in mammospheres derived from AS-B145 cells at Day 6 post hinokitiol treatment were determined by qRT-PCR. [score:3]
The results showed that the lower expression of miR-494 had a significant poor survival time (Figure 6, p= 0.00113 for GSE37405 and p=0.0125 for TCGA dataset). [score:3]
For analysis of the expression of miR-494-3p to the tumorigenicity of BT-474 cells, cells were transduced with lentivirus carrying negative control or miR-494-3p precursor which were purchased from BioSettia (San Diego, CA, USA) for 3 days and injected into mammary fads of NOD/SCID mice (purchased from National Laboratory Animal Center, Taipei, Taiwan) as 1×10 [6] cells/50 μl Matrigel/site. [score:3]
Analysis of the association between miR-494-3p expression and overall survival rate in breast cancer patients. [score:3]
Previous experiments demonstrated that BMI1 was a target of miR-494-3p in oral squamous carcinoma cells [27]. [score:3]
However, the role of miR-494-3p in regulation of self-renewal of BCSCs remains unclear. [score:2]
By qRT-PCR analysis, the expression levels of miR-494-3p in hinokitiol -treated tumors were significantly increased when compared to ethanol -treated group (Figure 7B, p=0.0002). [score:2]
These data were consistent with a recent study from Zhan et al., showing that the expression of miR-494 was significantly reduced in tumors when compared with adjacent non-neoplastic breast tissues [19]. [score:2]
Results showed that hinikitiol induced miR-494-3p in mammospheres derived from AS-B145 cells (Figure 3A). [score:1]
BT-474 cells were grew in a 10 cm dish for 80% confluency with 8 ml culture medium, added 8 μl miR-494-3p Smartflare-Cy5 beads and then incubated at 37°C for 16 hours. [score:1]
The function of miR-494-3p in carcinogenesis is controversial. [score:1]
The functions of miR-494-3p in cancer are controversial. [score:1]
Figure 4 (A) The alignment of BMI1 3’-UTR and miR-494-3p was obtained from the website of MICRORNA. [score:1]
Figure 5 (A, B) The AS-B145 (A) or BT-474 (B) cells were transfected with negative control (NC) or miR-494-3p (494-3p) mimic at a concentrations of 100 nM for 24 hours and performed primary mammosphere cultivation. [score:1]
The relationship between the expression of miR-494-3p and EGFR in breast cancer cells will be further investigated. [score:1]
In this analysis, BT-474 cells were further sorted into two populations of miR-494-3p [low] and miR-494-3p [high] groups with Smartflare miR-494-3p fluorescent probe (Figure 5C). [score:1]
Several reports suggested that miR-494-3p is an oncogenic miRNA. [score:1]
On the other hand, utilization of miR-494-3p oligos as an enhancer is also recommended to facilitate the therapeutic efficiency of hinokitiol in the future. [score:1]
In addition, miR-494-3p was negatively correlated with the overall survival of ER+ breast cancer patients (GSE37405) (Figure 6A) or metastasis-free survival of breast invasive carcinoma patients (TCGA data) (Figure 6B). [score:1]
293-T or AS-B145 cells were transfected with a negative control (NC) mimic or miR-494-3p (494-3p) mimic at a concentration of 100 nM together with wildtype BMI1 3’-UTR (BMI1 3’-UTR WT) or mutant from (BMI1 3’UTR del 762-768) for 48 h and determined luciferase activities. [score:1]
This study reports that the anti-CSC activity of hinokitiol was partially mediated by miR-494-3p. [score:1]
[1 to 20 of 63 sentences]
8
[+] score: 193
We observed that the overexpression of miR-494-3p not only suppressed the expression of Bmi1 (Figure 2B and Figure 3A) but also downregulated c-Myc mRNA (Figure S1). [score:10]
The expression of p16 [INK4a] and RB1 was obviously upregulated by the overexpression of miR-494-3p (Figure 2B), whereas that of p53 and p21 was only slightly increased by the overexpression of miR-494-3p (Figure 2B). [score:10]
The overexpression of miR-494-3p in SAS cells also significantly inhibited the mRNA expression of Bmi1 (Figure 3A). [score:7]
Comegna et al. also demonstrated that the overexpression of miR-494-3p in human diploid IMR90 fibroblasts led to senescence through the downregulation of heterogeneous nuclear ribonucleoprotein A3 and UV excision repair protein RAD23 homolog B [24]. [score:6]
Liu Y. Li X. Zhu S. Zhang J. G. Yang M. Qin Q. Deng S. C. Wang B. Tian K. Liu L. Ectopic expression of miR-494 inhibited the proliferation, invasion and chemoresistance of pancreatic cancer by regulating SIRT1 and c-Myc Gene Ther. [score:6]
The growth inhibition was significantly increased in the miR-494-3p overexpression group receiving 4 Gy irradiation (Figure 1B), but the enhanced radiosensitivity in Bmi1 knockdown cells was only observed when these were irradiated at 8 Gy (Figure 4B). [score:6]
We previously demonstrated that the overexpression of miR-494-3p in head and neck cancer-derived tumor initiating cells (HNC-TICs) reduces cancer stemness through the downregulation of B lymphoma Mo-MLV insertion region 1 homolog (Bmi1) [13]. [score:6]
We discovered that the overexpression of miR-494-3p in SAS OSCC cells could induce cellular senescence and enhance radiosensitivity, effects that may be mediated by the downregulation of Bmi1. [score:6]
Ohdaira et al. previously found that the overexpression of miR-494-3p in A549 lung cancer cells induced cellular senescence through inhibition of insulin-like growth factor 2 mRNA -binding protein 1 [23]. [score:5]
The simultaneous inhibition of Bmi1 and c-Myc, as well as other potential target genes, by overexpression of miR-494-3p may explain the better efficiency in enhancing radiosensitivity in SAS cells; however, this finding remains to be further investigated. [score:5]
We previously discovered that the overexpression of miR-494-3p in aldehyde dehydrogenase 1 (ALDH1)+ CD44+ HNC-TICs inhibited their cancer stemness [13]. [score:5]
We further analyzed the expression of miR-494-3p and Bmi1 among OSCC patients, and the results revealed a significantly inverse correlation between miR-494-3p and Bmi1 expression among OSCC patients (Figure 6). [score:5]
After transfection with the miR-494-3p inhibitor to inhibit the intracellular level of miR-494-3p, the SAS cells became resistant to radiation (Figure 1B). [score:5]
Here, we also confirmed that Bmi1 was inhibited by the overexpression of miR-494-3p mimic in SAS cells (Figure 2B). [score:5]
c-Myc is one of the targets of miR-494-3p [16, 25] and is essential for the inhibition of senescence mediated by CDK2 [26]. [score:5]
The present study demonstrated that miR-494-3p induced cellular senescence and downregulation of Bmi1 in SAS OSCC cells (Figure 2). [score:4]
These results suggested that miR-494-3p could enhance radiosenesivity in SAS cells through the induction of cellular senescence caused by the downregulation of Bmi1. [score:4]
Liborio-Kimura T. N. Jung H. M. Chan E. K. Mir-494 represses HOXA10 expression and inhibits cell proliferation in oral cancer Oral Oncol. [score:4]
We hypothesized that the effect that miR-494-3p has on enhancing radiosensitivity in SAS cells is due to the downregulation of Bmi1. [score:4]
We showed that the overexpression of miR-494-3p or knockdown of Bmi1 enhanced the radiosensitivity in SAS cells and activated the cellular senescence pathway. [score:4]
Furthermore, an inverse correlation was observed between miR-494-3p and Bmi1 expression among OSCC patients. [score:3]
We next examined if the overexpression of miR-494-3p in the SAS OSCC cell line could enhance radiosensitivity. [score:3]
2.4. miR-494-3p Was Inversely Correlated with Bmi1 Expression among OSCC Patients. [score:3]
This difference indicated that other target genes may also be involved in the induction of cellular senescence by miR-494-3p in SAS OSCC cells. [score:3]
Kwak S. Y. Yang J. S. Kim B. Y. Bae I. H. Han Y. H. Ionizing radiation-inducible miR-494 promotes glioma cell invasion through egfr stabilization by targeting p190b rhogap Biochim. [score:3]
On the other hand, other targets of miR-494-3p may also be involved in the radiosensitization effect of miR-494-3p in OSCC cells. [score:3]
The present study further examined the function of miR-494-3p and its target gene Bmi1 in the radiation response of the SAS OSCC cell line. [score:3]
The overexpression of Bmi1 with a pcDNA3-Bmi1 vector (Figure 4C) in SAS cells displayed a partial recovery of radiosensitization effect of the miR-494-3p mimic (Figure 4D). [score:3]
We previously found that Bmi1 was one of the targets of miR-494-3p [13]. [score:3]
HOXA1, a member of homeobox genes superfamily, has been reported as a target of miR-494-3p in oral cancer [19]. [score:3]
Wang J. Chen H. Liao Y. Chen N. Liu T. Zhang H. Zhang H. Expression and clinical evidence of miR-494 and pten in non-small cell lung cancer Tumour Biol. [score:3]
OSCC patients with low miR-494-3p or high Bmi1 expression displayed poor survival rates [13]. [score:3]
Given that radioresistance is one of the properties of HNC-TICs [15], the correlation between radiation response and miR-494-3p expression was examined first. [score:3]
We previously discovered that miR-494-3p expression was significantly decreased in stage III or stage IV OSCC patients [13]. [score:3]
We next examined if the overexpression of miR-494-3p could induce cellular senescence in SAS cells. [score:3]
Overexpression of miR-494-3p in SAS cells displayed significantly enhanced sensitivity to an irradiation of 4 Gy (Figure 1D, p = 0.0001). [score:3]
These data further support the tumor-suppressing function of miR-494-3p in OSCC. [score:3]
As shown in Figure 1, the expression of miR-494-3p displayed a negative correlation with cell survival after radiation in SAS cells (Figure 1A). [score:3]
The tumor suppression effect of miR-494-3p has been reported in pancreatic cancer [16], cervical cancer [17], small cell lung cancer [18], and OSCC [13, 19]. [score:3]
The mutant Bmi1 3′-UTR reporter plasmid used for deletion of the potential miR-494-3p binding region (Figure 3A) was further constructed by QuickChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies Inc. [score:2]
He W. Li Y. Chen X. Lu L. Tang B. Wang Z. Pan Y. Cai S. He Y. Ke Z. Mir-494 acts as an anti-oncogene in gastric carcinoma by targeting c-Myc J. Gastroenterol. [score:2]
Liu K. Liu S. Zhang W. Jia B. Tan L. Jin Z. Liu Y. Mir-494 promotes cell proliferation, migration and invasion, and increased sorafenib resistance in hepatocellular carcinoma by targeting pten Oncol. [score:2]
Chen B. Hou Z. Li C. Tong Y. MiRNA-494 inhibits metastasis of cervical cancer through Pttg1 Tumour Biol. [score:2]
These results indicate that miR-494-3p regulates the radiosensitivity of SAS OSCC cells. [score:2]
Ohdaira H. Sekiguchi M. Miyata K. Yoshida K. MicroRNA-494 suppresses cell proliferation and induces senescence in A549 lung cancer cells Cell Prolif. [score:2]
Compounds that are actively involved in the induction of miR-494-3p expression, including silibinin [13], could be considered as potential radiation sensitization agents for OSCC therapy. [score:2]
The role of miR-494-3p in carcinogenesis appears to be dependent on cancer types. [score:1]
2.2. miR-494-3p Induced Cellular Senescence in SAS Cells. [score:1]
After the transient transfection of the miR-494-3p mimic in SAS cells, the miR-494-3p was increased more than two thousand-fold in comparison with a negative control mimic at 24 h post-transfection (Figure 1C). [score:1]
The correlation between Bmi1 and miR-494 in tumor tissues was analyzed by real-time RT-PCR analysis and Spearman rank correlation test. [score:1]
The miR-494-3p mimic and negative control mimic were purchased from RiboBio Co. [score:1]
The detection of senescence -associated β-galactosidase (SA-β-Gal) activity indicated that transfection of the miR-494-3p mimic in SAS cells significantly induced cellular senescence at day 7 post-transfection (Figure 2A, 2.47% ± 1.61% in negative control mimic -transfected cells versus 14.63% ± 4.97% in miR-494-3p mimic -transfected cells, p = 0.0035). [score:1]
For miR-494-3p detection, 100 ng extracted RNA was used for complementary DNA (cDNA) synthesis with RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific Inc. ) [score:1]
Determining whether HOXA1 is also involved in the radiosensitization effect of miR-494-3p in OSCC cells requires further studies. [score:1]
By contrast, the oncogenic role of miR-494-3p has been shown in glioma [20], non-small cell lung cancer [21] and hepatocellular carcinoma [22]. [score:1]
2.1. miR-494-3p Enhanced Radiosensitivity in SAS OSCC Cells. [score:1]
[1 to 20 of 56 sentences]
9
[+] score: 137
Luciferase in vitro experiments confirmed that both miR-101 and miR-494 targeted and functionally suppressed CFTR construct mRNA translation with a moderate and strong action, respectively, and this activity was almost lost after mutation of the putative 3' UTR target-sites. [score:10]
Our preliminary in silico analysis found that both miR-101 and miR-494 may target SEC24 3’-UTR and two other genes, TGFB1 and MBL2, which are known to modify the development and/or the severity of lung disease in CF [2], suggesting the existence of a coordinated network of gene expression control by microRNAs. [score:8]
As for Duchenne muscular dystrophy [27], [28], quantification of selected miRNAs might be used as a sensitive biomarker tool of CF severity and functional suppression of CFTR -targeting miRNAs, such as miR-101 and/or miR-494, could prove a strategy to efficiently restore CFTR synthesis in patients carrying mutations leading to insufficient protein expression. [score:8]
In particular, after the in silico identification of a list of putative miRNAs able to target CFTR mRNA, we demonstrated by in vitro analysis that miR-101 and miR-494 were able to markedly suppress CFTR expression either alone and in combination. [score:7]
Furthermore, miR-101 and miR-494 seem to act synergistically on CFTR-reporter inhibition with a more than additive effect on the post-translational control and this could have a physiological relevance in the complex disease phenotypes observed in CF. [score:7]
Up-regulation of miR-494 in asthmatic samples [20] and direct influence in cell cycle progression of primary murine bronchial epithelial cells exposed to carcinogens [21], [22] suggest that miR-494 altered levels have effects mainly in the lung compartment. [score:5]
Therefore, alteration of miR-101 and/or miR-494 levels in CF patients could influence the disease clinical expression with particular implications in CF lung function, such as increased susceptibility to infections, chronic airways inflammation and response to specific therapies. [score:5]
Interestingly, our results are corroborated by expression profiling experiments of different human miRNAs from CF patients airway epithelial samples in which both miR-101 and miR-494 looked up-regulated (Relative Quantification ≥1.5) compared to non-CF individuals confirming an inverse correlation with CFTR levels [13]. [score:5]
The CFTR luciferase vectors with mutated target sites for miR-101 or miR-494 (pCFTR-3′UTR-mut101 and pCFTR-3′UTR-mut494, respectively) were generated using the Quickchange II Site-directed mutagenesis kit (Stratagene, Foster City, CA) and synthetic oligonucleotides (Sigma-Aldrich): mut101-F 5′-CTGACTCTTAAGAAGACTGCATTATATTTATTA GAG ATAGAAAATATCACTTGTC-3′ and mut101-R 5′-GACAAGTGATATTTTCT ATC TCTAATAAATATAATGCAGTCTTCTTAAGAGTCAG-3′; mut494-F 5′-CTCTAGGAAATATTTATTTTAATAA ACTT AC GAACATATATAACAATGCTG-3′ and mut494-R 5′-CAGCATTGTTATATATGTT CG TAA GTTTATTAAAATAAATATTTCCTAGAG-3′. [score:4]
We combined all these information with thermodynamic and on-line available expression data and, finally, we selected miR-101 and miR-494 microRNAs as the more likely regulators of the CFTR mRNA. [score:4]
The CFTR luciferase vectors with mutated target sites for miR-101 or miR-494 (pCFTR-3′UTR-mut101 and pCFTR-3′UTR-mut494, respectively) were generated using the Quickchange II Site-directed mutagenesis kit (Stratagene, Foster City, CA) and synthetic oligonucleotides (Sigma-Aldrich):mut101-F 5′-CTGACTCTTAAGAAGACTGCATTATATTTATTA GAG ATAGAAAATATCACTTGTC-3′ and mut101-R 5′-GACAAGTGATATTTTCT ATC TCTAATAAATATAATGCAGTCTTCTTAAGAGTCAG-3′; mut494-F 5′-CTCTAGGAAATATTTATTTTAATAA ACTT AC GAACATATATAACAATGCTG-3′ and mut494-R 5′-CAGCATTGTTATATATGTT CG TAA GTTTATTAAAATAAATATTTCCTAGAG-3′. [score:4]
Both miR-101 and miR-494 significantly suppressed luciferase expression compared to control microRNA with a corresponding decrease of about 40% (p<0.01) and 60% (p<0.001) as shown in Figure 2B. [score:4]
We identified a few miRNA-3’-UTR possible pairing with similar expression profiles and selected miR-101 and miR-494 for further analysis, since they showed the best possibility of positive interaction. [score:3]
Specificity of miR-101 and miR-494 CFTR suppression by recognition of the seed sequence. [score:3]
Notably, when miR-101 and miR-494 were co -overexpressed, a synergistic effect between miRNAs was observed, as highlighted by the strong reduction of the pCFTR-3’UTR reporter activity of approximately 80% (p<0.001). [score:3]
The most likely candidate miRNAs targeting the CFTR 3’UTR which overlapped in at least three prediction programs resulted miR-101, miR-144, miR-199-3p, miR-345, miR-376b, miR-377, miR-380, miR-494, miR-509-3p, miR-600 and miR-645. [score:3]
Ribonucleotide sequences of the putative miR-101 and miR-494 responsive elements in aligned human, rhesus and mouse CFTR 3’UTRs paired with the mature human miR-sequence (from TargetScan 5.1 database). [score:3]
Both miR-101 and miR-494 are conserved in Homo sapiens, Macaca mulatta and Mus musculus and each miRNA sequence has a single putative target site within the CFTR 3’UTR at position 1508–1514 and 1140–1147, respectively (Figure 1A). [score:3]
0026601.g002 Figure 2Mir-101 and mir-494 target the CFTR 3’-UTR. [score:3]
Mir-101 and mir-494 target the CFTR 3’-UTR. [score:3]
In particular, miR-101 responsive element is a 7mer-A1 having an exact match to positions 2–7 of the miRNA (the seed) and an immediate downstream 'A' which is across from microRNA nucleotide 1 while miR-494 target site is a 8-mer element that shares an exact complementarity to position 2–8 of the mature microRNA followed by an 'A'. [score:3]
In particular, the activity of the reporter construct mutated at the specific miR-101 seed (pCFTR-3’UTR-mut101) was unaffected by the concomitant transfection of miR-101 and led to a significant decreased luciferase value only with miR-494 over -expression (p<0.001). [score:3]
HEK293 were plated at a density of 3×10 [5] per well in 24-well plates and transiently transfected after 4–5 hours with 50 ng of Renilla luciferase expression constructs (pRLTK, pCFTR-3’UTR, pCFTR-3’UTR-mut101 or pCFTR-3′UTR-mut494), 12.5 ng of reference Firefly luciferase reporter (pGL3-SV40, Promega) and miRNA duplexes at 100 nM final concentration (hsa-mir-101 miRIDIAN Mimics MI0000739/MIMAT0000099, hsa-mir-494 miRIDIAN MimicsMI0003134/MIMAT0002816, miRIDIAN microRNA Mimic Negative Control #1, Dharmacon, Inc. [score:3]
miR-494 was able to significantly inhibit the reporter activity in a dose -dependent manner and at low concentrations. [score:3]
0026601.g003 Figure 3Specificity of miR-101 and miR-494 CFTR suppression by recognition of the seed sequence. [score:3]
Thus, miR-101 and miR-494 functionally interact with the CFTR 3’-UTR and suppress the corresponding protein product. [score:3]
These data suggest that modifications of the specific miRNA binding-sites in the CFTR 3’UTR are able to reduce the inhibitory function of miR-101 and miR-494 (Figure 3B). [score:3]
To verify whether miR-101 and/or miR-494 were able to target CFTR, HEK293 cells were co -transfected either with a reporter construct containing 741 base pairs of the human CFTR 3’UTR downstream of the Renilla luciferase open reading frame (Figure 2A) or with a control Renilla plasmid together with either a synthetic microRNA mimics (miR-101 or miR-494) or the negative control microRNA (miR-Ctr). [score:3]
miR-494 was also able to inhibit pCFTR-3’UTR in a dose -dependent manner and at low doses since the Renilla activity was significantly reduced of about 30% using a 10 nM miR-concentration (Figure S1). [score:3]
Future investigations will be addressed to confirm this hypothesis such as the characterization of the entire CFTR 3’-UTR in a panel of CF subjects carrying the same mutations and different clinical phenotype looking for sequence variants in the miR-responsive elements that could dramatically alter CFTR regulation as well as mutations in the miR-101 and miR-494 genes which could explain their altered expression. [score:2]
The 3′-UTR region of CFTR (813–1553 bp of 3HSAR032708) containing the predicted target sites of miR-101 and miR-494 was amplified from human genomic DNA using a proof reading Phusion High-Fi delity PCR master mix (Finnzymes, Espoo, Finland) with the following primers CFTR 3′UTR-F 5′-GC TCTAGAAGACCTTTGAACTAGAGTTTAGC-3′ and CFTR 3′UTR-R 5′-GC TCTAGAACACAAATGTATGGATTTTATTG -3′. [score:2]
The MRE specificity in the CFTR 3’UTR was evaluated by site-directed mutagenesis of the nucleotides at positions 3, 4, 6, 7 of the miR-101 seed sequence (TACTGTA to TA GAG AT) and at position 2, 3, 6, 8 of the miR-494 target site (ATGTTTCA to A ACTT AC G) (Figure 3A). [score:2]
At the same time, pCFTR-3’UTR-mut494 reporter activity was significantly reduced by miR-101 (p<0.05) while miR-494 transfection was nearly inactive. [score:1]
We speculate that microRNAs are largely responsible for how badly the illness affects patients since even minimal alterations in miR-101 and/or miR-494 levels could negatively influence the stability of the CFTR transcript which in turn might have an effect on the amount and maturation of CFTR protein and so on the degree of CF severity. [score:1]
Levels of luciferase activity in HEK293 cells co -transfected with increasing doses of miR-101 or miR-494 together with the CFTR wild-type 3’-UTR vector. [score:1]
No repression was observed with pCFTR-3’UTR constructs in which the putative miRNA -binding sites for miR-101 or miR-494 were altered (Figure 3B). [score:1]
Data are presented as the normalized activity of miR -transfected cells (miR-101 or miR-494) relative to cells transfected with miR-Ctr. [score:1]
In particular, miR-494 levels were altered in four of the five CF samples showing an up to 6-fold increase respect to normal airway brushings. [score:1]
The miR-101: CFTR mRNA heteroduplex displayed a mfe value of −14.2 kcal/mol whereas miR-494: CFTR hybrid structure showed a −13.5 kcal/mol value (Figure 1B). [score:1]
A fragment of 741 bp of the CFTR 3’-UTR, encompassing the putative responsive elements for miR-101 and miR-494, was cloned in pRLTK vector downstream to the Renilla luciferase coding sequence. [score:1]
Numbers indicate the predicted miR-101 and miR-494 seed sequences (in bold) using the numbering of the human CFTR 3’UTR (3HSAR032708 from UTRdb database). [score:1]
[1 to 20 of 41 sentences]
10
[+] score: 110
M6 cells stably expressing miR-494 (M6-miR-494) or scrambled miRNA (M6-scramble) and DB7 cells stably expressing miR-412 (DB7-miR-412) or scrambled miRNA (DB7-scramble) were established using puromycin selection and fluorescence activated cell sorting (FACS) sorting for red fluorescence protein (RFP) expression. [score:7]
Figure 4Over -expression of (a) miR-494 and (b) miR-412 inhibits expression of Birc4 and Bmpr1a, respectively. [score:7]
Click here for file 2Figure S8 - overexpression of miR-494 in M6 cells does not alter expression of Bmi1 or Ptpn12 determined by quantitative real-time RT-PCR. [score:5]
Figure S8 - overexpression of miR-494 in M6 cells does not alter expression of Bmi1 or Ptpn12 determined by quantitative real-time RT-PCR. [score:5]
Similarly, as shown in Table 4, only 12 out of 245 predicted targets were found to show an inverse correlation with expression of miR-494. [score:5]
Real-time RT-PCR demonstrated that the expression of Birc4 was reduced in mammary tumor epithelial cells that over-expressed miR-494. [score:5]
Increased expression of miR-494 and miR-412 was confirmed in the M6-miR-494 (Additional file 10) and DB7-miR-412 cells compared to control cells expressing scrambled miRNA. [score:4]
M6 cells and DB-7 cells were transduced with lentivirus expressing miR-494 and miR-412, respectively. [score:3]
Real-time RT-PCR was then performed to examine the expression of miR-494 in these cells. [score:3]
We transfected two mouse mammary tumor cell lines, M6 and DB7, with lentivirus expressing miR-494 and miR-412, respectively. [score:3]
Click here for file 1 Figure S7 - overexpression of miR-494 in M6 cells as determined by quantitative real-time RT-PCR. [score:3]
M6 cells were derived from a primary C3(1)/Tag tumor [34] and express low levels of miR-494, but relatively high levels of miR-412. [score:3]
The solid curves show the correlation coefficients for only those mRNAs that are predicted targets of miR-10b, miR-412 or miR-494. [score:3]
Three miRNAs were found to be highly expressed in the c-Myc mo del, including miR-494, miR-699 and miR-685. [score:3]
This pattern is a departure from a normal distribution and indicates that the tissue transcript levels of a subset of mRNAs, which have a predicted miRNA target sequence in the 3' UTR, are reduced by miR-10b, miR-412 and miR-494, respectively. [score:3]
DB7 cells were derived from a primary MMTV- PymT tumor [35] and express low levels of miR-412 but relatively high levels of miR-494. [score:3]
However, further analyses will confirm that miR-494 targets the putative mRNA sequence in the 3' UTR of Birc4. [score:3]
Figure S6 - Ingenuity Pathway Analysis™ of the potential target genes of miR-494. [score:3]
Figure S7 - overexpression of miR-494 in M6 cells as determined by quantitative real-time RT-PCR. [score:3]
Click here for file 0 Figure S6 - Ingenuity Pathway Analysis™ of the potential target genes of miR-494. [score:3]
M6 cells were transduced with plemiR lentivirus expressing miR-494. [score:3]
Moreover, all four probes on the array for miR-494 have 12 predicted target genes in common. [score:3]
In order to determine the functional relationship between an miRNA and its potential targets identified by the miRNA-mRNA inverse correlation analysis, we selected two miRNAs, miRNA-494 and miRNA-412, for further analysis. [score:3]
Quantitative real-time PCR revealed that expression of Birc4 was significantly reduced in M6-miR-494 cells but not in control cells (P = 0.004; Figure 4a). [score:3]
For instance, for miRNAs miR-10b, miR-412 and miR-494, the distribution curve of the correlation coefficients for all mRNAs and that for target mRNAs are notably different, with the latter showing a distinct shift that extended towards negative Pearson correlation coefficients (Additional file 9). [score:3]
Twelve of the mRNA target genes of miR-494 from Table 3 were input into Ingenuity (Ingenuity Systems, Inc. [score:3]
Cells were transduced with plemiR lentivirus expressing miR-494, miR-412, or plemiR_scramble lentivirus as control. [score:3]
miR-494 is highly expressed in human retinoblastoma [50]. [score:3]
Expression of miR-494 was highly associated with the c-Myc transgenic mo del (Table 3), and with the luminal-type mammary tumors (Table 4). [score:3]
A 1.9-fold increase in miR-494 expression was identified in M6-miR-494 cells compared to control M6 cells (P = 0.009; Additional file 11). [score:2]
Lentivirus plemiR-miR412 and plemiR-miR494 were prepared in 293T cells using the third-generation lentivirus packaging system. [score:1]
Global distribution of the Pearson correlation coefficients between mRNAs and (a) miR-10b, (b) miR-412 and (c) miR-494. [score:1]
miR-412 and miR-494 were PCR amplified from C57/B6J mouse genomic DNA. [score:1]
Among them, miR-494 is highly associated with the luminal-type of mammary tumors, suggesting a potential role for miR-494 in c-Myc -mediated oncogenic signaling and in mammary tumor differentiation. [score:1]
[1 to 20 of 34 sentences]
11
[+] score: 110
Other miRNAs from this paper: hsa-mir-1246, hsa-mir-4488, hsa-mir-4516
Further, we have shown that 2DG+TRAIL -induced miR-494 overexpression can be abrogated with MEK inhibition and that forced overexpression of miR-494 in the presence of MEK inhibition rescues a pro-apoptotic phenotype, thereby establishing the importance of MEK signaling in the regulation of this miRNA’s expression and its upstream location in the signaling cascade. [score:12]
MicroRNA inhibitors were purchased from Exiqon (Woburn, MA, USA) including miRCURY LNA Power Inhibitor Control (199020-04), miRCURY LNA Power Inhibitor hsa-miR-494 (427173-04), miRCURY LNA Power Inhibitor has-miR-1246 (426697-04) and a custom miRCURY LNA Power Inhibitor hsa-miR-4516. [score:11]
2DG alone did not directly enhance miR-494 expression; therefore, these data suggest that 2DG treatment enables enhanced miR-494 expression in the context of TRAIL treatment which enables apoptosis. [score:6]
Our findings provide compelling data that miR-494 expression, when upregulated by 2DG+TRAIL treatment in colon cancer cells, leads to colon cancer cell TRAIL sensitivity. [score:6]
Therefore, miR-494 overexpression could rescue the apoptotic phenotype of 2DG+TRAIL treatment even in the presence of an MEK inhibitor. [score:5]
Therefore, decreased miR-494 expression appeared to be associated with compromised apoptosis in 2DG+TRAIL -treated cells, and increased miR-494 expression was associated with conferring sensitization to TRAIL -induced apoptosis. [score:5]
Elevated expression of miR-1246 and -4516 had no effect on apoptosis; however, overexpression of only miR-494 conferred a significant increase in sensitivity to TRAIL (Figure 4, lower panel). [score:5]
This inhibition of apoptosis was reversed when these same cells were made to overexpress only miR-494 (Figures 6c and d). [score:5]
Constitutive activation of MEK increased miR-494, and inhibition of MEK, both by transfection with a dominant -negative MEK protein and with an MEK inhibitor, decreased miR-494 levels. [score:5]
2DG alone did not appear to directly enhance miR-494 expression but did enable enhanced miR-494 transcription upon TRAIL binding. [score:4]
MEK1/2 is upstream of miR-494 and regulates its expression in colon cancer cells treated with 2DG+TRAIL. [score:4]
This finding is consistent with miR-494 upregulation by ERK activation in non-malignant 293A cells. [score:4]
miR-4488 levels were very low and not detected by qRT-PCR and miR-494, miR-1246 and miR-4516 were significantly upregulated in cells treated with 2DG+TRAIL relative to controls treated with TRAIL or 2DG alone, validating the array data. [score:4]
HT-29 cells were electroporated with individual microRNA inhibitors and mimics for miR-494, miR-1246 or miR-4561. [score:3]
miR-494 expression sensitizes cancer cells to TRAIL -induced apoptosis. [score:3]
2DG+TRAIL treatment increased miR-494 levels, and increased miR-494 expression sensitized resistant cells to TRAIL -induced apoptosis. [score:3]
That this effect could be abrogated with an MEK inhibitor or Oncomir to miR-494 support our conclusions. [score:3]
Together, these results imply that MEK expression affects, and is upstream of miR-494. [score:3]
With MEK inhibition, miR-494 transcript levels in the 2DG+TRAIL -treated group decreased 18- and 10-fold, respectively, to near undetectable levels (P<0.05; Figure 6b). [score:3]
Therefore, it follows that 2DG+TRAIL -induced colon cancer cell death by increasing the expression of miR-494 via MEK activation. [score:3]
The combined antagonism of miRNAs did not decrease apoptosis to a greater extent than knockdown of 494 alone, indicating the singular importance of miR-494 in enhancing 2DG+TRAIL -induced apoptosis (Figure 4). [score:2]
We sought to determine critical regulators of miR-494. [score:2]
However, knockdown of either or both miR-494 and -1246 significantly decreased, but did not abolish, the apoptotic effect of 2DG+TRAIL. [score:2]
MiR-494, miR-4488 and miR-4516 were upregulated by 2.5-, 5.7- and 2.9-fold, respectively, under conditions of 2DG+TRAIL treatment compared with TRAIL alone, and 4.5-, 15.0- and 3.4-fold compared with 2DG alone. [score:2]
Though not different than those cells transfected with empty vector, miR-494 transcript levels were significantly increased by 39% in CA-MEK1 -expressing cells compared with DN-MEK cells (Figure 6a). [score:2]
We sought to elucidate the relationship between miR-494 and MEK signaling. [score:1]
MicroRNA mimics were purchased from Qiagen, including Syn-hsa-miR-494 (MSY0002816), Syn-hsa-miR-1246 (MSY0005898) and Syn-hsa-miR-4516 (MSY0019053). [score:1]
This sensitivity was not enhanced further when combining the miR-494 mimic with those of miR-1246 and miR-4516. [score:1]
[1 to 20 of 28 sentences]
12
[+] score: 51
For example, although inhibition of luciferase activity in a vector containing the full-length human ATF6 3′UTR indicated that each of the three miRNAs were capable of decreasing luciferase expression, in order to demonstrate that miR-145, miR-221 and miR-494 directly target the human ATF6 3′UTR, additional experiments using reporter constructs in which the predicted MREs for the individual miRNAs are deleted or mutated would be required. [score:8]
Here, we report decreased expression of ATF6 mRNA in F508 del CF bronchial epithelium both in vitro and in vivo and correlate this observation with increased expression of miR-145, miR-221 and miR-494, three miRNAs predicted to target the ATF6 3′UTR. [score:7]
ATF6, a protein of interest to us, was predicted to be regulated by three of the upregulated miRNAs - miR-145, miR-221 and miR-494 (Figure  1). [score:5]
Three of these miRNAs, miR-145, miR-221 and miR-494, were upregulated in F508 del-CFTR homozygous CFBE41o- versus non-CF 16HBE14o- bronchial epithelial cells and also in F508 del-CFTR homozygous or heterozygous CF (n = 8) versus non-CF (n = 9) bronchial brushings. [score:4]
Previously, we reported how altered levels of miR-145 and miR-494, together with other factors, can control decreased CFTR mRNA and protein expression in vivo and in vitro [13]. [score:3]
Expression of miR-145, miR-221 and miR-494 is increased in airway tissues from βENaC-transgenic versus wild-type mice. [score:3]
miR-145, miR-221 and miR-494 target human ATF6 via repression of an ATF6 3′UTR luciferase reporter. [score:3]
Figure  1A depicts the full-length human ATF6 3′UTR with predicted binding locations for miR-145, miR-221 and miR-494, and Figure  1B shows the locations and base pair matches of their proposed binding sites, adapted from TargetScan 6.2. [score:3]
Taken together, the data here demonstrate a role for miR-145, miR-221 and miR-494 in regulating ATF6. [score:2]
These results implicate miR-145, miR-221 and miR-494 in the regulation of ATF6 in CF bronchial epithelium, with miR-221 demonstrating structural and functional conservation between humans and mice. [score:2]
Interestingly, bioinformatic analysis of the murine ATF6 3′UTR revealed two predicted miRNA recognition elements for miR-221, whereas miR-145 and miR-494 were not identified as potential regulators. [score:2]
In order to determine whether human ATF6 is regulated by miR-145, miR-221 and miR-494, HEK293 cells were transiently transfected with a luciferase reporter vector containing the full-length wild-type 408 bp human ATF6 3′UTR and a reference Renilla luciferase reporter plasmid pRLSV40. [score:2]
Here, we extend our understanding of miR-145 and miR-494 in the context of CF bronchial epithelial cells by demonstrating their reciprocal relationship with ATF6 mRNA levels and provide evidence that miR-221 also contributes to the post-transcriptional regulation of ATF6. [score:2]
miR-145, miR-221 and miR-494 are conserved in mammals. [score:1]
It contains two predicted binding locations for miR-221, but none for miR-145 or miR-494. [score:1]
We have previously reported that miR-145 and miR-494 are increased in vitro and in vivo in CF versus non-CF bronchial epithelium [13]. [score:1]
In this study, we observed that levels of miR-145, miR-221 and miR-494 are increased in CF bronchial epithelial cells in vitro and in vivo. [score:1]
HEK293 cells (1 × 10 [5] in triplicate) were transiently co -transfected for 24 h with a WT-ATF6 3′UTR (OriGene, Rockville, MD, USA) firefly luciferase reporter vector containing the full-length 3′UTR (250 ng), a constitutive Renilla luciferase vector (100 ng) and 30 nM synthetic premiR mimics (PM) for miR-145, miR-221 and miR-494 (Applied Biosystems, Foster City, CA, USA) as indicated or with a scrambled control. [score:1]
[1 to 20 of 18 sentences]
13
[+] score: 44
Only two miRNAs (hsa-miR-1 and hsa-miR-133b) were shared by both TRU- and non-TRU-type adenocarcinoma; two others—hsa-miR-494 and ebv-miR-BART19—were upregulated by > 5-fold whereas hsa-miR-551b was downregulated by > 5-fold in the non-TRU type relative to the TRU type, confirming that they are histologically and molecularly dissimilar. [score:7]
Mir-494 has also been shown to regulate the accumulation and activity of myeloid-derived suppressor cells by targeting PTEN -mediated activation of the AKT signaling pathway [14]. [score:5]
In particular, hsa-miR-494 and ebv-miR-BART19 were upregulated by > 5-fold (8.03- and 6.98-fold, respectively), whereas hsa-miR-551b was down regulated by 7.30-fold in non-TRU as compared to TRU-type adenocarcinoma. [score:4]
One study found that miR-494 levels were upregulated in mouse bronchial epithelial cells exposed to benzo[a]pyrene, a well-known carcinogen present in coal tar, cigarette smoke, and smoked foods [16]. [score:4]
MiR-494 is an oncomiR in gastrointestinal stromal tumors that targets the KIT proto-oncogene [12]. [score:3]
001 hsa-miR-210 11p15.5 Up (3.23) 0.021 hsa-miR-30b 8q24.2 Down (-2.02) 0.015 hsa-miR-30c 1p34.2 Down (-2.32) 0.039 hsa-miR-494 14q32.3 Up (8.03) 0.021 hsa-miR-497 17p13.1 Down (-2.15) 0.014 hsa-miR-502 Xp11.23 Down (-2.43) 0.014 hsa-miR-532 Xp11.23 Down (-2.11) 0.049 hsa-miR-551b 3q26.2 Down (-7.30) 0.034 hsa-miR-622 13q31.1 Up (2.39) 0.015 Hierarchical clustering of 44 miRNA genes with significantly different expression (p<0.05) in tumor tissues. [score:3]
Both of miR-494 (Fig 4E) and ebv-miR-BART19 (Fig 4F) were only weakly expressed in normal lung tissue. [score:3]
In NSCLC cell lines, miR-494 has been shown to modulate BIM expression via the ERK1/2 [15]. [score:3]
MiR-494 was expressed in the bronchial epithelium in the non-TRU subtype. [score:2]
0160996.g004 Fig 4 (A) MiR-494 was weakly expressed in TRU-type. [score:2]
MiR-494 expression was low in TRU- but high in non-TRU-type adenocarcinoma (Fig 4A and 4B). [score:2]
Reactions contained 10× buffer, 0.15 μl of 100 mM dNTP with dTTP, 0.19 μl RNase inhibitor (20 U/μl), 0.8 μl of MultiScribe reverse transcriptase (50 U/μl), 3 μl miRNA-specific stem-loop primer [002365 (has-miR-494), 001535 (has-miR-551b), and 197235_mat (ebv-miR-BART19)] (Applied Biosystems), and 5 μl input RNA in a total volume of 1.5 μl. [score:2]
001 hsa-miR-210 11p15.5 Up (3.23) 0.021 hsa-miR-30b 8q24.2 Down (-2.02) 0.015 hsa-miR-30c 1p34.2 Down (-2.32) 0.039 hsa-miR-494 14q32.3 Up (8.03) 0.021 hsa-miR-497 17p13.1 Down (-2.15) 0.014 hsa-miR-502 Xp11.23 Down (-2.43) 0.014 hsa-miR-532 Xp11.23 Down (-2.11) 0.049 hsa-miR-551b 3q26.2 Down (-7.30) 0.034 hsa-miR-622 13q31.1 Up (2.39) 0.015 Three miRNAs (hsa-miR-494, hsa-miR-551b, and ebv-miR-BART19) were validated in an independent sample set of non-TRU- and TRU-type lung adenocarcinoma and corresponding normal lung tissue (n = 21 and 12, respectively) by qRT-PCR. [score:1]
Three miRNAs (hsa-miR-494, hsa-miR-551b, and ebv-miR-BART19) were validated in an independent sample set of non-TRU- and TRU-type lung adenocarcinoma and corresponding normal lung tissue (n = 21 and 12, respectively) by qRT-PCR. [score:1]
We also identified miR-494 as a potential molecular marker for non-TRU-type adenocarcinoma. [score:1]
The levels of mature has-miR-494 was higher in non-TRU- relative to TRU-type samples (p = 0.033, Fig 3A). [score:1]
[1 to 20 of 16 sentences]
14
[+] score: 44
In multiple human cancers, PTEN expressions are downregulated by miRNAs, which are shown in Table 1. Table 1 miRNA Locus Expression status Tumor type Reference MiR-21 17q23.1 Upregulated Colorectal, bladder, and hepatocellular cancer[112– 114] MiR-19a 13q31.3 Upregulated Lymphoma and CLL[87, 115] MiR-19b Xq26.2 Upregulated Lymphoma[87] MiR-22 17p13.3 Upregulated Prostate cancer and CLL[116, 117] MiR-32 9q31.3 Upregulated Hepatocellular carcinoma[118] MiR-93 7q22.1 Upregulated Hepatocellular carcinoma[119] MiR-494 14q32.31 Upregulated Cervical cancer[120] MiR-130b 22q11.21 Upregulated Esophageal carcinoma[121] MiR-135b 1q32.1 Upregulated Colorectal cancer[122] MiR-214 1q24.3 Upregulated Ovarian cancer[123] MiR-26a3p22.2 (MIR26A1)12q14.1(MIR26A2) Upregulated Prostate cancer[113] MiR-23b 9q22.32 Upregulated Prostate cancer[114] Abbreviations: CLL, chronic lymphocytic leukemia. [score:44]
[1 to 20 of 1 sentences]
15
[+] score: 38
To understand the role of immunological and genetic factors involved in the transition of brucellosis into chronic infection, target pathway prediction of miR-1238-3p, miR-494, miR-6069, and miR-139-3p was performed according to KEGG function annotations, which increased miRNA (miR-1238-3p) of target genes involved in immunologically effective pathways as shown in Figure 2. miRNAs (miR-494, miR-6069, and miR-139-3p) that were downregulated in the chronic group were considered common. [score:7]
To understand the role of immunological and genetic factors involved in the transition of brucellosis into chronic infection, target pathway prediction of miR-1238-3p, miR-494, miR-6069, and miR-139-3p was performed according to KEGG function annotations, which increased miRNA (miR-1238-3p) of target genes involved in immunologically effective pathways as shown in Figure 2. miRNAs (miR-494, miR-6069, and miR-139-3p) that were downregulated in the chronic group were considered common. [score:7]
miR-1238-3p was upregulated, while miR-494, miR-6069, and miR-139-3p were downregulated in the chronic group compared with the active group. [score:6]
Downregulated microRNAs, miRNA-494, and miR-139-3p have been proven to be involved in the carcinogenesis and development of various types of cancer in previous studies [75– 80]. [score:5]
In the present study, we uniquely determined that reduced expression of miR-139-3p, miR-6069, and miR-494 and induced expression of miR-1238-3p were significantly associated with chronic brucellosis. [score:5]
The predicted number of target genes is present in Figure 4.183 genes (3%) were regulated mutually by miR-494, miR-139-3p, and miR-6069. [score:4]
In the present study, miRNA-494 was linked to MAPK signaling pathway, regulation of actin cytoskeleton, chemokine signaling pathway, natural killer cell -mediated cytotoxicity, apoptosis, phagosome, T cell receptor signaling, Fc γ-R -mediated phagocytosis, cell-cycle, TGF- β signaling pathway, and complement and coagulation cascades in chronic brucellosis patients. [score:2]
Mutual KEGG pathway analysis of miR-494, miR-139-3p, and miR-6069 revealed that pathways related to these miRNAs in brucellosis have biological significance associated with the conversion of chronicity, including endocytosis, regulation of actin cytoskeleton, MAPK signaling pathway, cytokine-cytokine receptor interaction, and chemokine signaling pathways. [score:2]
[1 to 20 of 8 sentences]
16
[+] score: 38
Analysis of the target predictions for hsa-miR-342-3p and hsa-miR-494 as revealed by the public target prediction program TargetScan (release 5.1, April 2009) for involvement in neurodegeneration and neurodegenerative disorders. [score:7]
We also perceived that hsa-miR-494 is deregulated in different types of cancer [21- 23], and upregulated in a rat mo del for type 2 diabetes [24]. [score:5]
Beside others, putative target genes involved in neurodegenerative diseases were found for both, hsa-miR-342-3p and hsa-miR-494. [score:5]
Future studies also have to reveal whether hsa-miR-494 is also upregulated in other prion disorders. [score:4]
However, our analysis revealed that both miRNAs, hsa-miR-342-3p and hsa-miR-494, were significantly upregulated in BSE-infected macaques (Table 1). [score:4]
Click here for file Analysis of predicted targets for hsa-miR-342-3p and hsa-miR-494. [score:3]
Analysis of predicted targets for hsa-miR-342-3p and hsa-miR-494. [score:3]
C [T]-values derived from 4 independent qRT-PCR experiments comparing the expression of miRNAs hsa-miR-26a, hsa-miR-124a, hsa-miR-143, hsa-miR-145, hsa-miR-342-3p, and hsa-miR-494 in BSE-infected vs. [score:3]
The relative expression of selected miRNA candidates hsa-miR-26a, hsa-miR-124a, hsa-miR-143, hsa-miR-145, hsa-miR-342-3p, and hsa-miR-494 were validated by quantitative reverse transcription PCR (qRT-PCR) analysis using a higher number of animals. [score:3]
Since the mature forms of hsa-miR-342-3p and miR-494 reside on the 3'-arm of the pre-miRNA the stem-loop qRT-PCR cannot distinguish between DICER processed or unprocessed forms. [score:1]
[1 to 20 of 10 sentences]
17
[+] score: 34
Conversely, miR-23a, miR-149, miR-193b, and miR-324-3p were upregulated, whereas miR-15b, miR-29a, miR-181a, miR-195, and miR-494 were downregulated (Figure 6). [score:7]
Additionally, since PTEN has been shown to be one of hypothetical gene targets for miR-494, we analyzed its expression in MCF-10A cells treated with doxorubicin and undergone to STS, confirming the consistency of previously obtained results (Supplementary Figure 7). [score:5]
Finally, given that PTEN has been shown to be a hypothetical gene target for miR106b and miR-494, BAX for miR-128, and BIM (or BCL2L11) for miR-192, their gene expression was analyzed by means of quantitative Real-time PCR analysis (Supplementary Figure 5). [score:5]
Figure 5 Since miR-15b, miR-23a, miR-29a, miR-106b, miR-128, miR-192 and miR-494 were found downregulated and have been shown to induce chemoresistance (Figure 5), we evaluated the expression of some of them, including miR-15b (Hs04231486_s1), miR-23a (Hs03659093_s1) and miR-29a (Hs03849009_s1), through TaqMan microRNA expression assays (Supplementary Figure 4). [score:5]
Figure 5Since miR-15b, miR-23a, miR-29a, miR-106b, miR-128, miR-192 and miR-494 were found downregulated and have been shown to induce chemoresistance (Figure 5), we evaluated the expression of some of them, including miR-15b (Hs04231486_s1), miR-23a (Hs03659093_s1) and miR-29a (Hs03849009_s1), through TaqMan microRNA expression assays (Supplementary Figure 4). [score:5]
We found that some miRNAs, including miR-15b, miR-23a, miR-29a, miR-106b, miR-128, miR-192 and miR-494, were downregulated in MDA-MB-231 cells under STS conditions. [score:4]
MiR-15b and miR-23a have been shown to increase Cisplatin-resistance in lung cancer cell line A549 [28] and in tongue squamous cell carcinoma [29], whereas miR-29a induced Adriamycin and Docetaxel resistance in breast cancer (BC) [30], miR-128 enhanced antiblastic resistance in BC cells targeting BAX [31], miR-192 promoted Cisplatin-resistance in lung cancer cells A549/DDP [32], and, finally, miR-106b and miR-494 conferred radioresistance and Sorafenib-resistance in colorectal cancer and hepatocellular carcinoma silencing PTEN and p21 [33– 35]. [score:3]
[1 to 20 of 7 sentences]
18
[+] score: 34
Our results provide an extensive genome wide set of targets for miR-503, miR-103, and miR-494, and suggest that miR-503 may act as a tumor suppressor in breast cancer by its direct non-canonical targeting of DDHD2. [score:8]
There was enrichment for proliferation related genes in the targets identified for miR-503 and miR-494, but there were not enough target genes identified for miR-103 to produce meaningful results (Additional file 2) [38- 40]. [score:5]
Kim WK, Park M, Kim Y-K, You KT, Yang H-K, Lee JM, Kim H. MicroRNA-494 down-regulates KIT and inhibits gastrointestinal stromal tumor cell proliferation. [score:5]
Using previously published data we identified numerous miRNAs induced in fibroblasts transitioning from quiescence to proliferation, and selected three, miR-503, miR-103, and miR-494, for further study that were consistently induced by serum stimulation and predicted to target proliferation and or cell cycle related genes [34]. [score:3]
Additional file 2: GO term enrichment for experimentally determined miRNA targetomes for miR-503 and miR-494. [score:3]
miR-503, miR-103, and miR-494 have previously been shown to act as either oncogenes or tumor suppressors in different cellular contexts [22- 29]. [score:3]
miR-494 has been reported to function as an oncomiR in colorectal cancer and non-small cell lung cancer [23, 24], and as a tumor suppressor in cholangiocarcinoma and gastrointestinal stromal tumors [25, 28]. [score:3]
Here we identified miR-503, miR-103, and miR-494 as negative regulators of proliferation in primary human cells. [score:2]
miR-503, miR-103, and miR-494 repress proliferation. [score:1]
Although miR-494 targets also displayed extensive enrichment for 6-mers pairing outside of the miRNA 5′ seed region, the areas of enrichment were more diffuse, making them more difficult to investigate experimentally (Figure  4A). [score:1]
[1 to 20 of 10 sentences]
19
[+] score: 32
Among them, the expression patterns of 7 up-regulated (hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459) and 1 down-regulated miRNA (hsa-miR-4443) were consistent with the microarray data. [score:9]
8 of the most significantly up-regulated miRNAs (hsa-miR-4530, hsa-miR-4492, hsa-miR-4505, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p and hsa-miR-4459) and 3 of the most significantly down-regulated microRNAs (hsa-miR-29a-3p, hsa-miR-4443, hsa-miR-27b-5p) were selected as representatives for confirmation. [score:7]
For example, miR-494-3p was found to be act as a cancer gene that could promote glioma cell proliferation through the down -expression of PTEN, a tumor-suppressor gene [22, 23]. [score:5]
As shown in Figure  4, the expressions of hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 detected by qRT-PCR were consistent with the microarray data with significance (P < 0.05). [score:3]
The expressions of hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 detected by qRT-PCR were consistent with the microarray data. [score:3]
While miR-494 acts as an antioncogene in gastric carcinoma by targeting c-myc in gastric cancer [24, 25]. [score:3]
Hsa-miR-494-3p, a well-known miRNA, plays different roles in different malignancies and was found to be implicated in multiple cell processes including cell proliferation, apoptosis, and invasion. [score:1]
But all of the 8 miRNAs including hsa-miR-4530, hsa-miR-4492, hsa-miR-6125, hsa-miR-494-3p, hsa-miR-638, hsa-miR-6743-5p, hsa-miR-4459 and hsa-miR-4443 were found to be related with EV71 infection for the first time. [score:1]
[1 to 20 of 8 sentences]
20
[+] score: 31
Our analysis of genes hsa-mir-494 functionally-related revealed its involvement in regulating translation in mitochondria. [score:4]
Table S5 Compilation of target genes and/or genes co-regulated with hsa-miR-328, hsa-mir-494, hsa-mir-513 and hsa-mir-638. [score:4]
While lack of available experimental data precluded systematic questioning, we were able to analyze the target and/or co-regulated mRNAs for hsa-miR-328, hsa-miR-494, hsa-miR-513 and hsa-miR-638 (Table S5). [score:4]
Ten most significantly enriched processes for the genes targeted by hsa-miR-328, hsa-miR-494, hsa-miR-513 and hsa-miR-638 were scored and ranked in respect to the obtained p-values. [score:3]
In particular, the most significant result of hsa-mir-494 is in mitochondrial translation (p-value = 3.5×10 [−7]) (Figure S4). [score:3]
Five genes (hsa-miR-494, hsa-miR-1974, hsa-miR-1275, 16S rRNA and GAPDH) were selected for microarray data validation of differential expression in either subcellular compartment. [score:3]
Ontology enrichment analysis for target genes of hsa-miR-328, hsa-miR-494, hsa-miR-513 and hsa-miR-638. [score:3]
We found that all four mitomiRs were significantly involved in mitochondrial homeostasis, e. g hsa-mir-494 and hsa-mir-513 are both involved in ATP synthesis coupled electron transport (Figure 6). [score:1]
While 44 miRNAs showed a greater enrichment in the cytosolic Hy3-labeled RNA fraction, 13 miRNAs were significantly and reproducibly enriched in the mitochondrial Hy5-labeled RNA sample (ranging from 1.5- to 56-fold), namely hsa-miR-1973, hsa-miR-1275, hsa-miR-494, hsa-miR-513a-5p, hsa-miR-1246, hsa-miR-328, hsa-miR-1908, hsa-miR-1972, hsa-miR-1974, hsa-miR-1977, hsa-miR-638, hsa-miR-1978 and hsa-miR-1201 (Figure 5A). [score:1]
Our findings not only identify a novel set of mitochondrial miRNAs in humans, but also confirm the previous finding of enrichment of miR-494 in rat liver mitochondria [23]. [score:1]
hsa-miR-494 Chr14: 101496018–101496039 (+) 14q32.31 IntergenicEmbedded in a syntenic conserved region of mitochondrial carrier proteins [75]. [score:1]
To our surprise, despite the fact that most miRNAs are conserved accross metazoans [39], only two of the 13 mitomiRs, i. e hsa-miR-494 and hsa-miR-328, were highly conserved while the others were either human-specific or only conserved in primates (Table 1). [score:1]
Microarray data was independently verified by RT-PCR analysis assessing hsa-miR-494, hsa-miR-1275 and hsa-miR-1974. [score:1]
Thus beyond a role in the cytosol, hsa-miR-494 likely displays conserved functions relevant to its mitochondrial localization. [score:1]
[1 to 20 of 14 sentences]
21
[+] score: 31
In the current study, we observed increase in Xbp1 splicing which upregulates Chop (Supplementary Fig. 27e–g), but decreases in Atf3, a repressor of Chop as well as a direct target of miR-494 (refs 40, 41, 42, 43) (an upregulated cluster miRNA) in MMC treated with HG or TGF-β1 or in glomeruli from diabetic mice. [score:10]
Xbp1 splicing and Atf3 downregulation by miR-494 co-operate to upregulate Chop in MMC in response to HG or TGF-β. [score:7]
These data suggest two important ER stress-related signalling events, Xbp1 splicing and Atf3 downregulation by miR-494, which co-operate to upregulate Chop in response to HG or TGF-β1 in MMC (Fig. 9b). [score:7]
Similar trends were observed for miR-379, miR-494, miR-495 and miR-377, but not miR-822, suggesting that inhibition of hlnc-MGC (host RNA) by HMGC10 reduces the cluster miRNAs in HMC treated with TGF-β1 (Fig. 8a). [score:3]
TGF-β1 and HG significantly increased the expression of miR-379, miR-494, miR-495 and miR-377 as well as lnc-MGC, but not miR-882, compared with serum depleted (SD) or normal glucose (NG) controls respectively in cultured mouse MC (MMC; Fig. 2d). [score:2]
miR-379 is located at the 5′ end, miR-494 and miR-495 in the middle, and miR-377 downstream (Fig. 1c). [score:1]
The increases of lnc-MGC, miR-379, miR-494, miR-495 and miR-377 noted in glomeruli from diabetic WT mice were not observed in glomeruli from diabetic Chop- KO mice (five mice in each group). [score:1]
[1 to 20 of 7 sentences]
22
[+] score: 31
The most highly up-regulated miRNAs were miR-23b (+6.8) and miR-376c (+7.0), while miR-494 (–9.8) and miR-487b (–11.6) were the most down-regulated miRNAs (Table 1). [score:7]
Thus miR-98, miR-323-3p, miR-330-3p, miR-376a, miR-494, miR-598 were down-regulated by UVA and UVB, while miR-191, miR-376c and miR-501-5p were up-regulated by both. [score:7]
Among the 6 down-regulated miRNAs after UVA- and UVB-irradiation (miR-98, miR-323-3p, miR-330-3p, miR-376a, miR-494, miR-598) 3 miRNAs (miR-98, miR-330-3p and miR-376a) shared the common regulator element Hox-2.3-undefined-site-2 (gggggtgggggggag) in their promoter regions. [score:5]
Down-regulation was most pronounced in miR-494 (–9.8, UVA; –2.0, UVB) and miR-323-3p (–3.4, UVA; –7.7, UVB) (see Table 1, 2 and Fig. 2). [score:4]
Interestingly, of these ten commonly regulated microRNAs miR-98, miR-191, miR-323-3p, miR-330-3p, miR-494, and miR-598 were reported to be also deregulated after ionizing radiation [29], [30], [31] and miR-376a was shown to be a regulator of apoptosis in response to arsenic trioxide treatment [32]. [score:4]
The down-regulated miRNA-set consists of miR-98, miR-323-3p, miR-330-3p, miR-376a, miR-494 and miR-598. [score:4]
[1 to 20 of 6 sentences]
23
[+] score: 28
Among the other miRNAs expressed in association with Zr levels, we found that miR-152, miR-494 and miR-335 had hundreds of potentially regulated targets, demonstrating that they might have a relevant role in the context we are studying. [score:6]
As expected by the large number of predicted targets, miR-152, miR-335 and miR-494 resulted to share targets such as the cytokine receptor KIT, the Rho -dependent Protein Kinase (ROCK-1), proteins belonging to the tyrosine phosphatase family (PTPN11 and PTPN14) and proteins belonging to the Rho Guanine Nucleotide Exchange Factor (ARHGEF2, ARHGEF12 and ARHGEF17). [score:5]
The common targets we identified for miR-152, miR-494 and miR-335 seem to be largely involved in the regulation of inflammatory processes. [score:4]
Cellular location of targets shared by miR-152, miR-335 and miR-494. [score:3]
The seven miRNAs (miR-99b, miR-142-5p, miR-152, miR-193a-5p, miR-323-3p, miR-335, miR-494) associated with Zirconium levels with FDR P < 0.1, were selected for downstream target prediction analysis. [score:3]
In the present study on an obese population, we found that the exposure to Zr levels traced in hair is associated with a distinct signature of 7 miRNAs (miR-99b, miR-142-5p, miR-152, miR-193a-5p, miR-323-3p, miR-335, miR-494) expressed in peripheral blood. [score:3]
More specifically, we identified that miR-152, miR-494 and miR-335 had the largest number of potentially regulated mRNAs that were 254, 208 and 105 respectively. [score:2]
Seven miRNAs (miR-99b, miR-142-5p, miR-152, miR-193a-5p, miR-323-3p, miR-335, miR-494) resulted specifically associated with Zr levels. [score:1]
Using an FDR linear step-up adjustment for multiple comparisons (FDR P < 0.1), we found 7 miRNAs (miR-99b, miR-142-5p, miR-152, miR-193a-5p, miR-323-3p, miR-335, miR-494) specifically associated with Zr levels traced in the hair (Table 2). [score:1]
[1 to 20 of 9 sentences]
24
[+] score: 26
Not only was miR-494 the most downregulated miRNA when oncogenic ERK1/2 signaling was blocked, but its upregulation potentiated TNF-related apoptosis-inducing ligand (TRAIL) resistance via inhibition of pro-apoptotic Bim (Bcl-2-like protein 11), a protein known to be suppressed in NSCLC resistant to several antineoplastic agents 39– 42. [score:11]
logFC p-value B-statistic microRNA 0.98 3.53E-08 9.07 hsa-miR-1244 0.74 2.34E-07 7.34 hsa-miR-494 0.45 6.83E-07 6.34 hsa-miR-1979 0.31 3.97E-06 4.66 hsa-miR-1826 0.77 9.14E-06 3.85 hsa-miR-1281 −0.31 1.13E-05 3.65 hsa-miR-202 −0.37 1.14E-05 3.64 hsa-miR-4284 −0.49 1.70E-05 3.25 hsa-miR-221-star −0.89 6.51E-05 1.94 hsa-miR-3172 −0.63 9.48E-05 1.57 hsa-miR-548a-3p −0.43 1. 02E-04 1.49 hsa-miR-1272 −0.34 1.29E-04 1.27 hsa-miR-15a −0.40 1.59E-04 1.06 hsa-miR-3152 −0.22 2.56E-04 0.59 hsa-miR-142–5p 0.24 3.03E-04 0.43 hsa-miR-4270 −0.29 3.27E-04 0.35 hsa-miR-1910 −0.42 3.29E-04 0.35 hsa-miR-34a-star −0.18 3.78E-04 0.21 hsa-miR-381 −0.30 4.10E-04 0.13 hsa-miR-450b-5p 0.30 4.34E-04 0.08 hsa-miR-1469 We also looked for differentially expressed miRNAs (BH adjusted p < 0.05) that may target differentially expressed mRNAs (BH adjusted p < 0.05). [score:7]
Supplemental Table  3 shows the correlated miRNAs and mRNAs with their p-values from the analyses of differential expression after pemetrexed exposure, including the pair MTHFD2 (methylenetetrahydrofolate dehydrogenase, p = 1.46 × 10 [−5]) and hsa-miR-202 (p = 1.13 × 10 [−5]), as well as SUFU (pair suppressor of fused homolog, p = 1.1 × 10 [−4]) and hsa-miR-494 (p = 2.34 × 10 [−7]). [score:5]
Interestingly, the second highest differentially expressed miRNA in our study, hsa-miR-494, has also been associated with NSCLC cell survival, but contrary to miR-1244, the miRNA was demonstrated to have carcinogenic potential [38]. [score:3]
[1 to 20 of 4 sentences]
25
[+] score: 25
Li N. Zhao X. Wang L. Zhang S. Cui M. He J. miR-494 suppresses tumor growth of epithelial ovarian carcinoma by targeting IGF1R Tumour Biol. [score:5]
Sun H. B. Chen X. Ji H. Wu T. Lu H. W. Zhang Y. Li H. Li Y. M. miR-494 is an independent prognostic factor and promotes cell migration and invasion in colorectal cancer by directly targeting PTEN Int. [score:4]
Using cell lines, Shende et al. demonstrated that miR-142-3p and miR-494 overexpression decreases endogenous BMAL1 levels and increases PER2 oscillations, suggesting that both microRNAs play an important role in post-transcriptional modulations of core molecular clockworks in this cell lines [140]. [score:3]
Kwak S. Y. Yang J. S. Kim B. Y. Bae I. H. Han Y. H. Ionizing radiation-inducible miR-494 promotes glioma cell invasion through EGFR stabilization by targeting p190B rhoGAP Biochim. [score:3]
miR-494, miR-152, and miR-142-3p have been detected in mouse blood serum and were predicted to target 3′ UTR BMAL1 mRNA [141, 148, 149]. [score:3]
Moreover, miR-494 has insulin-like growth factor 1 receptor (IGF1R) as a predicted target [146]. [score:3]
Ohdaira H. Sekiguchi M. Miyata K. Yoshida K. MicroRNA-494 suppresses cell proliferation and induces senescence in A549 lung cancer cells Cell Prolif. [score:2]
Duan H. F. Li X. Q. Hu H. Y. Li Y. C. Cai Z. Mei X. S. Yu P. Nie L. P. Zhang W. Yu Z. D. Functional elucidation of miR-494 in the tumorigenesis of nasopharyngeal carcinoma Tumour Biol. [score:1]
On the other hand, miR-494 is related to lung cancer [142], gastrointestinal cancer [143], brain tumor [144], and nasopharyngeal carcinoma [145]. [score:1]
[1 to 20 of 9 sentences]
26
[+] score: 24
Therefore, miR-214 regulates Ca [2+] homeostasis, and prevents cardiomyocyte death and protects against cardiac I/R injury by inhibiting the expression of the Ca [2+]-handling molecule NCX1, as well as CaMKIIδ, BIM, and cyclophilin D. MiR-494 is one of the miRNA transcripts that is downregulated in human infarcted and murine I/R-injured heart [11]. [score:9]
Therefore, miR-214 regulates Ca [2+] homeostasis, and prevents cardiomyocyte death and protects against cardiac I/R injury by inhibiting the expression of the Ca [2+]-handling molecule NCX1, as well as CaMKIIδ, BIM, and cyclophilin D. MiR-494 is one of the miRNA transcripts that is downregulated in human infarcted and murine I/R-injured heart [11]. [score:9]
Wang et al. demonstrated that cardiac-specific overexpression of miR-494 in transgenic mice heart improves the recovery of cardiac function, reduces myocardial infarction size and prevents apoptosis by targeting the proapoptotic proteins PTEN, ROCK1, and CaMKIIδ, as well as antiapoptotic proteins FGFR2 and LIF, and via the subsequent activation of AKT signaling in mitochondria [72]. [score:5]
3.2.5. miR-494. [score:1]
[1 to 20 of 4 sentences]
27
[+] score: 24
Ectopic expression of miR-494 in PDAC cells resulted in downregulation of FOXM1, inhibition of β-catenin nuclear translocation, decreased cell proliferation, migration, invasion, and greater sensitivity to gemcitabine [37]. [score:8]
The analysis for the KC animals compared to controls revealed that miR-150, miR-494, miR-138, miR-148a*, miR-216a, and miR-217 (p-value = 0.01) were significantly downregulated (Table 1), whereas, miR-146b, miR-205, miR-31, miR-192, and miR-21 (p-value = 0.01) were significantly upregulated (Table 2). [score:6]
The microRNA microarray revealed significant downregulation of miR-494 at 25 weeks of PC progression in the KC mouse mo del. [score:4]
A recent study has also shown significant downregulation of miR-494 in human PC tissues compared to non-tumor tissues, correlating with PC metastasis and decrease free survival in patients. [score:3]
Furthermore, decreased expression of miR-494 is due to loss of SMAD4 in PC. [score:3]
[1 to 20 of 5 sentences]
28
[+] score: 21
Among the 63 upregulated and 49 downregulated miRNAs in both the CP and CLP plasma samples, six miRNAs, namely miR-340–5p, miR-877–5p, miR-3648, miR-1260a, miR-494–3p, and miR-1304–3p, were selected for expression validation (Table 3). [score:9]
Relative expression level (2 [−ΔΔCt]) of miR-340-5p, miR-877-5p, miR-3648, miR-1260a, miR-494-3p, and miR-1304-3p expression in the plasma of cleft palate patients (n =16), cleft lip with cleft palate patients (n = 33) and controls (n = 8) (Mann-Whitney U test). [score:5]
In contrast, three miRNAs, miR-1260a, miR-494–3p and miR-1304–3p, were significantly downregulated in both the CP and CLP plasma samples (Figure 2). [score:4]
Six miRNAs, namely miR-340–5p, miR-877–5p, miR-3648, miR-1260a, miR-494–3p, and miR-1304–3p, were found to be differentially expressed in both the NSCP and NSCLP plasma samples. [score:3]
[1 to 20 of 4 sentences]
29
[+] score: 20
Expression levels of the other miRNAs were calculated as fold changes based on the miR-214 expression level of 1. miR-148, miR-494, miR-124, miR-193, and miR-300 showed increased expression levels from day 1 to 7. miR-148 showed very high expression levels (2272 to 6517 fold changes compared with that of miR-214) (Figure 3B), while miR-132, miR-186, miR-199, miR-338, and miR-219 showed decreased expression from day 1 to 7 (Figure 3C). [score:8]
The second group that had a low expression level on day 1 and a high expression level on day 7 included miR-148, miR-494, miR-124, miR-193, and miR-300. [score:5]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG We have previously shown that miR-124 is expressed in human core blood hematopoietic progenitor cells (HPCs) and it specifically binds to the Tip110 3′UTR and has a regulatory effect on core blood HPCs [7]. [score:4]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG (A) Schematic of the Tip110 3′UTR region with predicted miRNA binding sites (Tip110 miRNA). [score:1]
Figure 3Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 19
To assess potential biological mechanisms of acute DEP exposure, we identified putative targets for miR-513a-5p, miR-494, and miR-96, three miRNAs whose expression was significantly altered after DEP exposure. [score:5]
We assessed the potential biological functions of select miRNAs by identifying putative miRNA targets using TargetScan and miRDB for miR-513a-5p, miR-494, miR-96, and miR-923. [score:5]
Overall, gene network analysis on putative targets for miR-494 and miR-513 lead us to speculate that these two miRNAs may play a role in the regulation of a cell’s inflammatory response. [score:4]
Very little is known about miR-494; however, its putative target mRNAs indicate an enriched gene network for NF-κB canonical and virus-activated signaling. [score:3]
In agreement with our microarray data, each miRNA showed the same trend in regulation, specifically, miR-513a-5p, miR-494, and miR-923 each increased in response to DEP, whereas miR-96 decreased in DEP -treated samples (Figure 2). [score:2]
[1 to 20 of 5 sentences]
31
[+] score: 17
Other miRNAs from this paper: hsa-mir-524, hsa-mir-500a, hsa-mir-298, hsa-mir-500b
As seen in the final mo del, the input stimulus (TGF-beta1+BMP2) inhibits the expression of 3 miRNAs (miR-494, miR-524-5p, miR-298) and activates miR-500, which is in turn suppressed by TRPS1. [score:7]
In our mo del, its expression is regulated by the stimulus as well as by miR-494 and miR-524-5p. [score:4]
Four miRNAs (miR-524-5p, miR-494, miR-298 and miR-500) were found to be potentially involved in the regulation of chondrogenesis. [score:2]
In summary, the applied multi-step selection procedure resulted in a set of 11 network components, including 4 miRNAs (miR-524-5p, miR-494, miR-298 and miR-500), 4 transcription factor genes (SOX9, TRPS1, MEF2C and SATB2) and 3 chondrogenic marker genes coding for components of the extracellular matrix (COL2A1, ACAN and COL10A1). [score:1]
Nodes represent either a miRNA (miR-524-5p, miR-494, miR-298, miR-500), a transcription factor gene (SOX9, MEF2C, TRPS1, SATB2) or a chondrogenic marker gene (COL2A1, COL10A1, ACAN). [score:1]
The interaction with miR-494 is underpinned by prior knowledge (blue connection in Figure 4), but surprisingly there is also a predicted binding site for miR-524-5p within the TRPS1 mRNA. [score:1]
SATB2, a transcription factor mainly associated with osteogenesis [11], is repressed by miR-500 and miR-494, as predicted by the mo del. [score:1]
[1 to 20 of 7 sentences]
32
[+] score: 16
Yamamoto and colleagues recently reported miR-494 negatively regulates the expression of the mitochondrial transcription factor A and mitochondrial biogenesis in C [2]C [12] myoblasts (Yamamoto et al., 2012). [score:4]
The exercise -induced down regulation of miR-494 without protein may be an important regulatory step in the molecular machinery promoting mitochondrial -based adaptation following divergent contractile activity. [score:3]
Moreover, decreased miR-494 expression has also been associated with increased PGC-1α mRNA following acute swimming exercise in mice (Yamamoto et al., 2012). [score:3]
The array contained 13 common miRNAs previously shown in the literature to be regulated following resistance or endurance exercise, and amino acid ingestion in human skeletal muscle including hsa-miR-1, hsa-miR-9-3p, hsa-miR-16-5p, hsa-miR-23a-3p, hsa-miR-23b-3p, hsa-miR-31-5p, hsa-miR-133a-3p, hsa-miR-133b, hsa-miR-181a-5p, hsa-miR-378a-5p, has-miR-451a, hsa-miR-486-5p, and hsa-miR-494-3p. [score:2]
MicroRNA-494 regulates mitochondrial biogenesis in skeletal muscle through mitochondrial transcription factor A and Forkhead box j3. [score:1]
The miR-494, previously implicated in mitochondrial biogenesis responses (Yamamoto et al., 2012), was the only miRNA to decrease post-exercise, an effect that was only evident in the placebo group. [score:1]
miR-494 decreased at 4 h post-exercise only with PLA (~87%, P < 0.05; Figure 2D). [score:1]
Figure 2(A) mir-181-5p, (B) miR-378-5p, (C) miR-486-5p, and (D) miR-494-3p abundance at rest and at 4 h post-exercise recovery following a concurrent exercise session of resistance (8 sets of 5 leg extension at 80% 1-RM) and endurance (30 min cycling at 70% VO [2peak]) exercise and ingestion of either 500-mL PLA or PRO beverage immediately after exercise. [score:1]
[1 to 20 of 8 sentences]
33
[+] score: 16
Ectopic expression of miR-494 inhibited the proliferation, invasion, and chemoresistance of pancreatic cancer by regulating SIRT1 and c-Myc. [score:6]
c-Myc and SIRT1 expression levels were inversely correlated with miR-494 expression in pancreatic cancer tissues due to direct interaction with the 3′UTR with the mRNA transcripts of both c-Myc and SIRT1, and restoring miR-494 sensitized the cells to chemotherapy (Liu Y. et al., 2015). [score:6]
In pancreatic cancer, miR-494 was down-regulated and correlated with poor prognosis. [score:4]
[1 to 20 of 3 sentences]
34
[+] score: 16
MiR-494 can trigger gene silencing of multiple invasion-suppressor miRNAs by inhibiting genomic DNA demethylation by direct targeting of TET1, thereby leading to tumor vascular invasion. [score:8]
MiR-494 is overexpressed in human HCC tissues and joins in transformation by regulating the G1/S cell cycle transition through targeting mutation suppressors in colorectal cancer tumors [86]. [score:8]
[1 to 20 of 2 sentences]
35
[+] score: 15
For top 10 downregulated microRNAs (hsa-miR-106b-5p, hsa-miR-26b-5p, hsa-miR-494, hsa-miR-425-5p, hsa-miR-363-3p, hsa-miR-15b-5p, hsa-miR-185-5p, hsa-miR-150-5p, hsa-miR-223-3p, hsa-miR-142-5p), we included those have been shown to be deregulated in cancer (having no controversial expression status; some of these microRNAs have been shown to be upregulated in some cancer types, whereas, downregulated in other cancer types), and have either expression data or functional studies in stem cells. [score:15]
[1 to 20 of 1 sentences]
36
[+] score: 15
Recently, it has been established that miR-27a/b and miR-494 regulate tissue factor pathway inhibitor α (TFPIα) expression suggesting a possible role of these miRNAs in the estrogen mediated downregulation of TFPIα involved in breast cancer (Ali et al., 2016). [score:9]
The role of microRNA -27a/b and microRNA-494 in oestrogen mediated downregulation of tissue factor pathway inhibitor α. J. Thromb. [score:6]
[1 to 20 of 2 sentences]
37
[+] score: 15
The differential expression of mir-494, mir-197 and the predicted microRNA target gene TNFSF14 was verified by real-time PCR and ELISA. [score:5]
We analyzed the expression of mir-494 and mir-197 with real-time PCR and confirmed that the expression was significantly decreased in MS patients compared with controls (P = 0.02 and P = 0.04; Figure 3A-B). [score:4]
Figure 3 Verification of the differential expression of A) mir-494 and B) mir-197 between MS patients (n = 16) and healthy controls (n = 12) by real-time PCR. [score:3]
To verify the results from the DNA microarray analysis we selected mir-494 and mir-197 because they were among the microRNAs that had the largest fold change in expression between MS patients and controls of all the microRNA (Table 1). [score:3]
[1 to 20 of 4 sentences]
38
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Several analyses provided evidence that miRNA genes (miR-101, miR-145, miR-223, miR-384, miR-494, miR-509-3p, and miR-1246) regulate CFTR expression, as well as anion transport, particularly in patients with F508 del mutation [58, 59, 60, 61, 62]. [score:5]
Another miRNA significantly elevated in CF brushings, miR-221, was found to down-regulate ATF6, along with miR-145 and miR-494 [70]. [score:4]
Increased expression of miR-145, miR-223, and miR-494 was found in bronchial brushings from CF patients as compared to non-CF brushings [61, 62] and demonstrated the complexity in post-transcriptional regulation of CFTR. [score:3]
Megiorni et al. found that increased levels of miR-101 and miR-494 repress CTFR expression in vitro [59], whereas miR-138 was found to repress SIN3A, leading to increased CFTR levels [63]. [score:3]
[1 to 20 of 4 sentences]
39
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-328, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-503, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
Furthermore, miR-494, once activated by the ERK 1/2 pathway in NSCLC, targets BIM 3′ UTR, inducing the downregulation of BIM and consequently inhibiting apoptosis [86]. [score:8]
miR-494 acts as an oncomir by repressing apoptosis processes targeting PTEN and caspases 3/7, whose levels are all decreased in human bronchial epithelial cells (transformed by chemical carcinogen anti-Benzo-A-Pyrene-Diol-Epoxide) harboring miR-494 upregulation [85]. [score:6]
miR-494, miR-27a, miR-328. [score:1]
[1 to 20 of 3 sentences]
40
[+] score: 14
Of particular interest, up-regulated miRNAs miR-494 and miR-495 were predicted to target CTNND2, while up-regulated miR-376c and miR-409-3p were predicted to target NR2F2, which were both down-regulated in primary MB specimens relative to CD133+ NSCs (Table S4). [score:14]
[1 to 20 of 1 sentences]
41
[+] score: 14
miR-378, miR-422a, miR-593 and miR-494 from the first group, which affected the CD3G gene (responsible for the CD3-gamma subunit), and were down-regulated in cancer tissues, when compared to adjacent normal tissues (Table 5), whereas miR-378 was up-regulated in blood sera of cancer patients (Table 8). [score:6]
In In this study, the TargetScanHuman database identified13 miRNAs (miR-1200, miR-378d,e,i,c,h,b,f, miR-422a, miR-3690, miR-619, miR-4446-3p, miR-2909, miR-4777-5p, miR-136, miR-515-5p, miR-4659a,b-3p, miR-494 and miR-593) which were conserved and similar to the CD3G gene. [score:3]
Since miR-378, miR-422a, miR-593, miR-494, miR-138 and miR-214 could target the CD3 subunits, some of which have been studied in different cancers and have been considered as biomarkers to detect cancer at the early stages, it is then highly likely that miRNAs damage the immune system so that it cannot distinguish cancer cells. [score:2]
For instance, reduction in levels were observed for miR-422a in patients with laryngeal carcinoma [45] and colorectal cancer [43], miR-593 in esophageal cancer patients [47] and miR-494 in cholangiocarcinoma (CCA) [48], lung cancer [49] and gastrointestinal tumor [50]. [score:1]
From the first group only 6 miRNAs (miR-378, miR-422a, miR-593 and miR-494, miR-515 and miR-136), from the second group one miRNA (miR-138) and from the third group only one miRNA (miR-214) were identified and studied, based on their levels in tissues or blood sera of different cancer patients. [score:1]
Has-miR-422a, has-miR-593 and has-miR-494 which represented other miRNAs predicted for CD3G also showed a similar decrease in levels in tumor tissues. [score:1]
[1 to 20 of 6 sentences]
42
[+] score: 13
mmu-miR-6922-5p, mmu-miR-6907-5p, mmu-miR-3113-5p, mmu-mir-494 (down regulated in group 2), mmu-miR-5100, mmu-miR-7066-3p, and mmu-let-7d-3p (upregulated in group 2). [score:5]
MiR-494 is reported to be downregulated in other tumor types 40, 41 which is in agreement with findings from the current study. [score:3]
The miR494 expression was restored in both cardamonin treated groups (p < 0.01). [score:3]
Therefore we selected MiR-494 and miR-3113 for validation. [score:1]
The miR494 was recently included in the panel of microRNAs recommended for the detection of early relapse in postoperative colorectal cancer patients. [score:1]
[1 to 20 of 5 sentences]
43
[+] score: 13
Interestingly, MYC contributes to EZH2 upregulation through repression of miR-26a, which targets EZH2, while EZH2 upregulates MYC by inhibiting miR-494, which targets MYC. [score:13]
[1 to 20 of 1 sentences]
44
[+] score: 13
For the first set of MSCs only 3 miRNAs (miR-324-3p, miR-494-3p, and miR-1260a) were observed to be statistically significant (p < 0.05) between passages 3 and 7. For the second set of MSCs, 7 miRNAs (let-7i, miR-25-3p, miR-106b-5p, miR-130b-3p, miR-199a-5p, miR-365a-5p, and miR-1260a) were statistically significant between passages 4 and 8. MiR-1260a was found to be significantly different between early and late passages for both MSC sets; however, it was upregulated at passage 7 for the first MSC set and downregulated at passage 8 for the second MSC set. [score:7]
Five of the miRNAs (miR-320c, miR-320d, miR-365a-3p, miR-494, and miR-1305) did not have detectable expression when using the platform. [score:3]
In evaluating early passage MSCs (13 cell lines) against the 4 cell lines of the mesoderm lineage, 5 miRNAs (miR-15b-5p, miR-25-3p, miR-320d, miR-324-3p, and miR-494-3p) were observed to be significantly upregulated (p < 0.05) in the non-MSC lines. [score:2]
Out of the 13 miRNAs being evaluated for new consensus miRNAs in MSCs, 8 miRNAs had detectable expression in both the microarray and experiments (miR-22-3p, miR-27a-3p, miR-34a-5p, miR-193b-3p, miR-320b, miR-324-3p, miR-494, and miR-1260a). [score:1]
[1 to 20 of 4 sentences]
45
[+] score: 13
Twelve of them (miR-10b, miR-15a, miR-19a, miR-26b, miR-30a, miR-30c, miR-125a, miR-125b, miR-148a, miR-148b, miR-195 and miR-320) are down-regulated both in dogs and in humans whereas one (miR-494) is up-regulated in both species and four (miR-29a, miR-181a, miR-196a and miR-374a) are down-regulated in dogs but up-regulated in humans. [score:13]
[1 to 20 of 1 sentences]
46
[+] score: 13
Interestingly, high expression of TGFβ3 stimulates miR-494 in decidual mesenchymal stem cells (dMSCs) which in turn inhibits M2 macrophage polarization by reducing PGE2 production (49). [score:5]
The supernatant from miR-494 overexpressing dMSCs impairs HUVEC capillary formation by suppressing VEGF. [score:5]
miR-494 arrests the transition of growth and synthesis phase (G [1]/S transition) by targeting cyclin-dependant kinase 1 (CDK1) and cyclin D1 (CCND1) (39). [score:3]
[1 to 20 of 3 sentences]
47
[+] score: 12
Prediction results for specific miRNAs in TARGETSCAN include the following: miR-129-3p and miR-494 target HMGCS1; miR-150 targets MMP14; miR-150, and 92b target MMP16. [score:9]
Increased expression of miR-494, miR-769-3p and miR-490-3p was associated with ≥70% coronary stenosis. [score:3]
[1 to 20 of 2 sentences]
48
[+] score: 12
No inhibition was found when transfecting HepG2 with the other selected miRNAs or with miR-494 (Figure 2A). [score:3]
Commercial assays for miR-181a-5p, miR-23a-3p, miR-16-5p, miR-195-5p, miR-494, and U6 snRNA (endogenous reference control) (Life Technologies, Madrid, Spain) were used to quantify expression levels of miRNAs in human cell lines and/or hepatocytes. [score:2]
To confirm the specificity of this result, we compared levels of F11 mRNA with those of miR-494 (that showed no in silico or in vitro effect on FXI expression) and we found no association between these two molecules (r = −0.033; p = 0.727) (Figure 4B). [score:2]
Linear regression analysis between endogenous mature miRNAs (miR-181a-5p and miR-494) levels and F11 mRNA (A & B respectively). [score:1]
In this sense, we found that a neutral miRNA (miR-494) neither interacted nor correlated with F11 mRNA (Figure 4B). [score:1]
HepG2 cells were transfected with 100 nM mimic precursors miR-181a-5p (181a), miR-23a-3p (23a), miR-16-5p (16), miR-195-5p (195), miR-494 (494) or SCR. [score:1]
Additionally, a negative control miRNA (miR-494; see Table 1), which was not predicted to bind to F11 mRNA (only 2 prediction algorithms) and with a liver expression >500 au, was also investigated (Table 1). [score:1]
0111713.g002 Figure 2HepG2 cells were transfected with 100 nM mimic precursors miR-181a-5p (181a), miR-23a-3p (23a), miR-16-5p (16), miR-195-5p (195), miR-494 (494) or SCR. [score:1]
[1 to 20 of 8 sentences]
49
[+] score: 11
In our recent study, we have shown that reduced expression of miR-139-3p, miR-6069 and miR-494 and induced expression of miR-1238-3p were significantly associated with chronic brucellosis [43]. [score:5]
In our previous study, more than 2000 miRNAs were screened in peripheral blood mononuclear cells of patients with acute or chronic brucellosis and we determined that while the expression level of miR-1238-3p was increased, miR-494, miR-6069 and miR-139-3p were decreased in the chronic group in comparison to the acute infection group [43]. [score:3]
Altered expressions of miR-1238-3p, miR-494, miR-6069 and miR-139-3p in the formation of Chronic Brucellosis. [score:3]
[1 to 20 of 3 sentences]
50
[+] score: 10
However, other predicted miRNAs that also target the 3′UTR of il12A and il12B, including miR-590-5p, miR-340-5p, miR-23a, miR-23c and miR-494-3p, were not involved in the inhibition of IL-12 production in Omp25 -expressing THP-1 cells. [score:7]
In total, seven miRNA–mRNA target duplexes were predicted by these algorithms (Figure S3 in), including miR-590-5p, miR-21-5p, miR-340-5p, miR-23a, miR-23b, miR-23c, and miR-494-3p. [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 10
The constructed networks from significantly up-regulated miRNAs and significantly down-regulated target genes involved 13 miRNAs from JIA (Fig. 4a) and 29 miRNAs from CF (Fig. 4b), 4 (miR-494, miR-370, miR-326, and miR-505) of them were common (p = 1.2E-03, Table S4 in Supplementary information). [score:9]
2 of those miRNAs (miR-494, miR-551a) are common to both groups (p = 3E-02). [score:1]
[1 to 20 of 2 sentences]
52
[+] score: 10
MiR-494 could suppress the progression of BN in vitro by targeting CXCR4 through the Wnt/β-catenin signaling pathway [100]; and the expression level of miR-30e was lowered in both plasma and breast cancer tissues of BN patients and plasma miR-30e expression was statistically related to the patients age and clinical stage of BN [101]. [score:9]
Experiments have shown that miR-494, miR-1973 and miR-21 could not only be used as diagnostic biomarkers but also circulating cell-free treatment response biomarkers in HL [73]. [score:1]
[1 to 20 of 2 sentences]
53
[+] score: 9
MiR-494 was upregulated in DLBCL and downregulated in FL, while miR-181a showed an opposite expression pattern, suggesting that these miRs may serve as potential specific biomarkers for both DLBCL and FL. [score:9]
[1 to 20 of 1 sentences]
54
[+] score: 9
To confirm the miRNA array data in PC3 cells, qRT-PCR (Taqman technique) was used to confirm the differential expression of three miRNAs (miR-555, miR-654 and miR-182) identified as up-regulated by ATO and three miRNAs (miR-494, miR-1255a and miR-550a) that were down-regulated by ATO. [score:9]
[1 to 20 of 1 sentences]
55
[+] score: 9
MicroRNA-494 downregulates KIT and inhibits gastrointestinal stromal tumor cell proliferation. [score:5]
Another miRNA, miR-494, which is a negative regulator of KIT has been shown to be significantly low in GISTs which indicates a promising therapeutic target in GISTs (Kim et al., 2011). [score:4]
[1 to 20 of 2 sentences]
56
[+] score: 8
Other miRNAs from this paper: hsa-mir-127, hsa-mir-154, hsa-mir-376c, hsa-mir-495, hsa-mir-496
Based on the qRT-PCR results, the hESCs with higher MEG3 and MEG8 expression were classified as MEG3-ON hESCs, in which several miRNAs from this locus, miR-127-3p, miR-154, miR-376c, miR-494, miR-495, and miR-496, were also abundantly expressed (Figure  1B). [score:5]
The UPL probe system (Roche) was used to detect the expression of miRNAs, including miR-127-3p, miR-376c, miR-494, miR-495, miR-496, and miR-154. [score:3]
[1 to 20 of 2 sentences]
57
[+] score: 8
Downregulation of the miR-130b–301b cluster impairs cellular senescence in prostate cancer [29], while miR-494-3p increases the radiosensitivity of oral squamous cell carcinoma cells through the induction of cellular senescence caused by the downregulation of Bmi1 [30]. [score:7]
miR-494-3p Induces Cellular Senescence and Enhances Radiosensitivity in Human Oral Squamous Carcinoma Cells. [score:1]
[1 to 20 of 2 sentences]
58
[+] score: 8
Among these: 3 miRNAs (i. e. miR-26a-5p, miR-143-3p, and miR-4454) were expressed in both RAA and LAA; 6 miRNAs (i. e. miR-30c-5p, miR-125b-5p, miR-133b, miR- 145-5p, miR-451a, and miR-4484) were expressed in only RAA; and 3 miRNAs (i. e. miR-1, miR-23b-3p, and miR-494) were expressed in only LAA. [score:7]
Our qRT-PCR data validated the results for all of these miRNAs except miR-451a and miR-494. [score:1]
[1 to 20 of 2 sentences]
59
[+] score: 8
On the contrary, miR-494-3p is up-regulated after drug treatment; in a previous work of Shen and collaborators, they demonstrated that a constitutive over -expression of this miRNA reduced tumor growth, migration and invasion [49]. [score:6]
Further, a validation of the expression of miR-4284, miR 21-5p, and miR-494-3p was performed using TaqMan Assay. [score:2]
[1 to 20 of 2 sentences]
60
[+] score: 8
On the other hand, genomic loss of miR-494 or miR-599 promotes increased expression in melanoma cells, and introduction of antisense-miRNA oligonucleotides targeted to miR494 or miR599 promotes melanoma cell proliferation through up-regulation of [143]. [score:8]
[1 to 20 of 1 sentences]
61
[+] score: 7
Consistent with a report of miR-494 up-regulation in bronchial epithelial cells exposed to DEP [88] we also found this miRNA to be up-regulated in CF versus non-CF bronchial brushings [112]. [score:7]
[1 to 20 of 1 sentences]
62
[+] score: 7
of these, miR-21, miR-214, and miR-494 are upregulated in NSCLC. [score:4]
Several research reported that PTEN function as a target gene of miR-21 [28], miR-214 [29], miR-494 [30], miR-26a [31], miR-144 [32] and miR-153 [33]. [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 7
Other miRNAs from this paper: hsa-mir-223, hsa-mir-200b, hsa-mir-145, hsa-mir-200c
For CF, this is illustrated for the ΔF508 CFTR mutation, the most common mutation in CF, by studies that show that there is increased expression of miR-145, miR-223, and miR-494 in vivo in the bronchial epithelium of ΔF508 patients and this correlated with decreased CFTR expression [25, 29]. [score:7]
[1 to 20 of 1 sentences]
64
[+] score: 7
Likewise, upregulated miR-494 was found to directly target the 3′-UTR of PTEN and this was associated with tumor aggressiveness and tumor metastasis (100). [score:7]
[1 to 20 of 1 sentences]
65
[+] score: 7
Other miRNAs from this paper: hsa-mir-21, hsa-mir-130a
We observed that centenarians overexpress seven small noncoding RNAs of which four (scaRNA-17, mir-21, mir-130a, and mir-494) are known to be associated with a range of health-beneficial and life span-enhancing actions including telomerase over -expression in Cajal bodies, neuro-protection in ischemia, cardioprotection, and inhibition of mitochondrial damage and apoptosis [6- 9]. [score:7]
[1 to 20 of 1 sentences]
66
[+] score: 7
Zhang L. Niu T. Huang Y. Zhu H. Zhong W. Lin J. Zhang Y. Compound 331 selectively induces glioma cell death by upregulating miR-494 and downregulating Cdc20 Sci. [score:7]
[1 to 20 of 1 sentences]
67
[+] score: 7
Eight microRNAs were found by to be upregulated (including mir-21, let-7, 18, 29c, 142-3p, 155, 146b) and one downregulated (miR-494) in cancer. [score:7]
[1 to 20 of 1 sentences]
68
[+] score: 7
They have identified miR-483, miR-877, miR-337-5p, miR-546, and miR-494 as being upregulated, and miR-770-5p, miR-487b, miR-220, miR-212, and miR-712 as downregulated by adenosine signaling in MΦs. [score:7]
[1 to 20 of 1 sentences]
69
[+] score: 7
Of these 16 miRNAs, 9 were downregulated (let-7d, miR-106b, miR-122a, miR-141, miR-183, miR-195, miR-200a, miR-335, mir424) and 7 were upregulated (miR-100, miR-199a, miR-296, miR-29a, miR-29c, miR-99a, mir-494). [score:7]
[1 to 20 of 1 sentences]
70
[+] score: 7
miR-494 is up-regulated early in AKI, with increased urine levels detected in rodent mo dels of renal IRI and patients with AKI. [score:4]
However, miR-494 also targets pro-apoptotic proteins in the AKT pathway, and to exert protective effects. [score:3]
[1 to 20 of 2 sentences]
71
[+] score: 7
miR-424, miR-542-3p, and miR-454 were the most upregulated, and miR-494, miR-490-5p, and miR-486-5p were the most downregulated miRNAs in tumor in comparison to the normal tissue (28). [score:7]
[1 to 20 of 1 sentences]
72
[+] score: 7
Regeneration-miRNAs were up-regulated (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), while degenerative-miRNAs (miR-1, miR-29c, and miR-135a) were down-regulated in mdx mice and in DMD patients’ muscles. [score:7]
[1 to 20 of 1 sentences]
73
[+] score: 7
Exosomal mRNAs and miRNAs derived from tumor cells were recovered in lymph node stroma and lung fibroblasts, and were shown to significantly affect mRNA translation in the target cells, exemplified by abundant recovery of exosomal miR-494 and miR-542-3p, which targeted cadherin17 [89]. [score:7]
[1 to 20 of 1 sentences]
74
[+] score: 7
Real-time quantitative PCR allowed analysis of six miRNAs that were differentially expressed in the experimental groups: miR-31-3p, miR-134, miR-136-3p, miR-376C-3p, miR-494, and miR-424-5p (Table 6). [score:3]
Microarray and qRT-PCR methods also showed an increased expression of miR-494 in rough microtexture when compared to nanotexture. [score:2]
mRNA and microRNA oligoarray data were confirmed by qRT-PCR for five mRNAs (SMURF2, NOTCH1, PHOSPHO1, COL24A1, and FGF1) and six microRNAs (miR-31-3p, miR-134, miR-136-3p, miR-376c-3p, miR-424-5p, and miR-494). [score:1]
These miRNAs are associated with several functions like apoptosis (miR-134 and miR-494), bone mineralization (miR-31-3p, miR-136-3p, miR-376C-3p, and miR-424-5p), and cell growth and proliferation (miR-134) (http://geneontology. [score:1]
[1 to 20 of 4 sentences]
75
[+] score: 6
Other miRNAs from this paper: hsa-mir-22, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-15b, hsa-mir-125a
MiR-494 has been reported to be able to inhibit TET1 gene expression through targeting its 3′UTR region in human hepatocellular carcinoma (HCC) [98]. [score:6]
[1 to 20 of 1 sentences]
76
[+] score: 6
miR-494-3p was further shown to target ROCK1, while miR-122 has been demonstrated to modulate RhoA and influence motility of hepatocellular carcinoma cells [30]. [score:3]
Iwawaki Y MiR-494-3p induced by compressive force inhibits cell proliferation in MC3T3-E1 cellsJ. [score:2]
This includes miR-21, which has been shown to mediate substrate mechanical memory of MSCs [27], miR-21, miR-100 and miR-5096 which changed in response to mechanical stretch in human periodontal ligament stem cells [28] and miR-494-3p, which was sensitive to compressive force in MC3T3-E1 cells [29]. [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 6
It was also observed that miR-494 regulates mitochondrial biogenesis by inhibiting FOXJ3 expression [172]. [score:6]
[1 to 20 of 1 sentences]
78
[+] score: 6
In particular, miR-494 and miR-542-3p modulated the expression of cadherin-17 with concomitant upregulation of matrix metalloproteinases. [score:6]
[1 to 20 of 1 sentences]
79
[+] score: 6
In HOZOT-17, 73 miRNAs were expressed at levels more than 1.5-fold higher than in Tconv cells, whereas only three miRNAs (miR-155, miR-494, and miR-148a) were expressed at levels lower than in Tconv cells. [score:5]
They are as follows: let-7a, let-7c, let-7e, let-7f, let-7g, let-7i, miR-15b, miR-16, miR-18a, miR-22, miR-26b, miR-27a, miR-27b, miR-29b, miR-30c, miR-125b, miR-133b, miR-146b, miR-148a, miR-150, miR-155, miR-181a, miR-181b, miR-181d, miR-223, miR-320, miR-491, and miR-494. [score:1]
[1 to 20 of 2 sentences]
80
[+] score: 6
The majority of the miRNAs had alterations in expression that were consistent between the two species, except for miR-323-3p, miR-369-5p, miR-410, miR-411, miR-433, miR-494 and miR-130a, which were expressed discordantly in the tumors from the two different species (Table 1). [score:5]
Consistent with the interspecies shift based on PC2, 3 out of the first 5 implicated miRNAs (miR-411, miR-410, miR-382, miR-495 and miR-494) were differentially modulated in human and mouse samples (Table 1). [score:1]
[1 to 20 of 2 sentences]
81
[+] score: 5
However, hsa-mir-494 is an independent prognostic marker for colorectal neoplasm patients, and this miRNA promotes cell migration and invasion in colorectal neoplasms by directly targeting PTEN [57]. [score:4]
The potential candidate hsa-mir-494 is supported by the literature [PMID: 25270723]. [score:1]
[1 to 20 of 2 sentences]
82
[+] score: 5
41, 42 Several miRNAs, including miR-21, miR-216a, miR-217 and miR-494, have been shown to confer sorafenib resistance in HCC by inhibiting autophagy through targeting phosphatase and tensin homolog (PTEN). [score:5]
[1 to 20 of 1 sentences]
83
[+] score: 5
PTEN participates in two overlaps and targets hsa-miR-106b, hsa-miR-141, hsa-miR-17, hsa-miR-21, hsa-miR-26a and hsa-miR-494 whilst simultaneously being targeted by them. [score:5]
[1 to 20 of 1 sentences]
84
[+] score: 5
Other miRNAs from this paper: mmu-mir-205, hsa-mir-205, hsa-mir-214, mmu-mir-214, mmu-mir-494
But it is unclear whether and how these confirmed miRNAs such as miR-205, miR-494, miR-214 directly targeting PTEN co-regulate the PTEN/Akt pathway, further effects the DDP resistance and other biological function in a collaborative or antagonistic manner. [score:5]
[1 to 20 of 1 sentences]
85
[+] score: 5
A positive feedback loop exists between MYC and EZH2: MYC stimulates EZH2 expression by reducing its negative regulators, miR-26a and miR-101; EZH2 can also increase the abundance of MYC by repressing miR-494. [score:4]
Meanwhile, EZH2 can also repress miR-494 to create a positive feedback loop, which in turn increases MYC abundance and then sustains miR-29 repression in BCL [10]. [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 5
Activation of microRNA-494 -targeting Bmi1 and ADAM10 by silibinin ablates cancer stemness and predicts favourable prognostic value in head and neck squamous cell carcinomas. [score:3]
In gastric cancer tissue miR-448 (Wu et al., 2016) and in tumor initiator cells of head and neck squamous cell carcinoma miR-494 (Chang et al., 2015) were also identified as novel regulators of ADAM10. [score:2]
[1 to 20 of 2 sentences]
87
[+] score: 5
Almost half of the combined down-regulated miRNAs are encoded at chromosomal loci near another miRNA on the list (Table 2 ) and are possibly transcribed by the same primary miRNA gene transcripts [32], [35]: a) mir-142-5p and 142-3p; b) mir-494, 376a*, 496, and 369-3p; c) mir-23b, 27b and 24-1*; d) mir-34b* and 34c; and e) mir-17* and 20a. [score:4]
Pri-miR-494 showed a 18% increase in the depressed group, but this did not achieve significance either (p = 0.088). [score:1]
[1 to 20 of 2 sentences]
88
[+] score: 5
Altered expressions of miR-1238-3p, miR-494, miR-6069, and miR-139-3p in the formation of chronic brucellosis. [score:3]
In one of our previous studies, more than 2,000 miRNAs were screened in peripheral blood mononuclear cells of patients with acute or chronic brucellosis, and we determined that while the expression level of miR-1238-3p increased, miR-494, miR-6069, and miR-139-3p decreased in the chronic group compared to the acute group. [score:2]
[1 to 20 of 2 sentences]
89
[+] score: 5
Welten SMJ Inhibition of 14q32 MicroRNAs miR-329, miR-487b, miR-494, and miR-495 increases neovascularization and blood flow recovery after ischemiaCirc. [score:3]
We found that four miRNAs (miR-134, miR-410, miR-409-3p and miR-494) from C14MC were significantly associated with IDH mutation. [score:2]
[1 to 20 of 2 sentences]
90
[+] score: 4
According to the study conducted by Mo and colleagues, human ESCs with low MEG3 expression level (designated as MEG3-OFF) also showed significantly low expressions of DLK1-DIO3 locus-derived noncoding RNAs, including MEG8, miR-127, miR-376, miR-494, miR-495, miR-496, and miR-154, compared to its counterpart MEG3-ON [68]. [score:4]
[1 to 20 of 1 sentences]
91
[+] score: 4
For example, mir-494 and mir-1294 were reported to downregulate c-Myc, which is a known transcriptional activator of h TERT, in pancreatic cancer and esophageal squamous cell carcinoma [94, 177]. [score:4]
[1 to 20 of 1 sentences]
92
[+] score: 4
Name Assay ID Target sequence hsa-miR-1 002222 UGGAAUGUAAAGAAGUAUGUAU hsa-miR-15a 000389 UAGCAGCACAUAAUGGUUUGUG hsa-miR-16 000391 UAGCAGCACGUAAAUAUUGGCG hsa-miR-20a 000580 UAAAGUGCUUAUAGUGCAGGUAG hsa-miR-21 000397 UAGCUUAUCAGACUGAUGUUGA hsa-miR-126 002228 UCGUACCGUGAGUAAUAAUGCG hsa-miR-133a 002246 UUUGGUCCCCUUCAACCAGCUG hsa-miR-146a 000468 UGAGAACUGAAUUCCAUGGGUU hsa-miR-210 000512 CUGUGCGUGUGACAGCGGCUGA hsa-miR-221 000524 AGCUACAUUGUCUGCUGGGUUUC hsa-miR-222 002276 AGCUACAUCUGGCUACUGGGU hsa-miR-454 002323 UAGUGCAAUAUUGCUUAUAGGGU hsa-miR-486 001278 UCCUGUACUGAGCUGCCCCGAG hsa-miR-494 002365 UGAAACAUACACGGGAAACCUC RNU44 001094 CCUGGAUGAUGAUAGCAAAUGCUGACUGAA CAUGAAGGUCUUAAUUAGCUCUAACUGACU RNU48 001006 GAUGACCCCAGGUAACUCUGAGUGUGUCG CUGAUGCCAUCACCGCAGCGCUCUGACC Real-time PCR reactions were modified for a smaller final volume of 15 μl per well, using the same reagent proportions as recommended by the manufacturer. [score:2]
Name Assay ID Target sequence hsa-miR-1 002222 UGGAAUGUAAAGAAGUAUGUAU hsa-miR-15a 000389 UAGCAGCACAUAAUGGUUUGUG hsa-miR-16 000391 UAGCAGCACGUAAAUAUUGGCG hsa-miR-20a 000580 UAAAGUGCUUAUAGUGCAGGUAG hsa-miR-21 000397 UAGCUUAUCAGACUGAUGUUGA hsa-miR-126 002228 UCGUACCGUGAGUAAUAAUGCG hsa-miR-133a 002246 UUUGGUCCCCUUCAACCAGCUG hsa-miR-146a 000468 UGAGAACUGAAUUCCAUGGGUU hsa-miR-210 000512 CUGUGCGUGUGACAGCGGCUGA hsa-miR-221 000524 AGCUACAUUGUCUGCUGGGUUUC hsa-miR-222 002276 AGCUACAUCUGGCUACUGGGU hsa-miR-454 002323 UAGUGCAAUAUUGCUUAUAGGGU hsa-miR-486 001278 UCCUGUACUGAGCUGCCCCGAG hsa-miR-494 002365 UGAAACAUACACGGGAAACCUC RNU44 001094 CCUGGAUGAUGAUAGCAAAUGCUGACUGAA CAUGAAGGUCUUAAUUAGCUCUAACUGACU RNU48 001006 GAUGACCCCAGGUAACUCUGAGUGUGUCG CUGAUGCCAUCACCGCAGCGCUCUGACCReal-time PCR reactions were modified for a smaller final volume of 15 μl per well, using the same reagent proportions as recommended by the manufacturer. [score:2]
[1 to 20 of 2 sentences]
93
[+] score: 4
At the same time point (6-hour), miR-15a*, miR-1825, miR-183*, miR-34b, miR-494, and miR-574-5p were found to be down-regulated (>1.5-fold, p<0.05) in H1N1 infected cells. [score:4]
[1 to 20 of 1 sentences]
94
[+] score: 4
Validation of a selected few by qPCR identified 10 miRNAs - miR-133b-3p, miR-208b-3p, miR-21-5p, miR-125a-5p, miR-125b-5p, miR-126-3p, miR-210-3p, miR-29a-3p, miR-494-3p and miR-320a, that were significantly up-regulated in HF myocardium compared to normal controls. [score:3]
MiR-210-3p is closely related to hypoxia 41, 42, and interestingly, both miR-320a and miR-494 are reported to be associated with cardiac apoptosis induced by ischemia 43, 44. [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 4
MiR-494 modulates TRAIL -induced apoptosis through BIM down-regulation and is regulated by ERK1/2 [33]. [score:4]
[1 to 20 of 1 sentences]
96
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-205, hsa-mir-210, hsa-mir-221, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-125b-2, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-130b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-362, hsa-mir-363, hsa-mir-376c, hsa-mir-371a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-342, hsa-mir-151a, hsa-mir-324, hsa-mir-335, hsa-mir-345, hsa-mir-423, hsa-mir-483, hsa-mir-486-1, hsa-mir-146b, hsa-mir-202, hsa-mir-432, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-455, hsa-mir-545, hsa-mir-376a-2, hsa-mir-487b, hsa-mir-551a, hsa-mir-571, hsa-mir-574, hsa-mir-576, hsa-mir-606, hsa-mir-628, hsa-mir-629, hsa-mir-411, hsa-mir-671, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-889, hsa-mir-876, hsa-mir-744, hsa-mir-885, hsa-mir-920, hsa-mir-937, hsa-mir-297, hsa-mir-1233-1, hsa-mir-1260a, hsa-mir-664a, hsa-mir-320c-2, hsa-mir-2861, hsa-mir-378b, hsa-mir-1260b, hsa-mir-378c, hsa-mir-1233-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-664b, hsa-mir-378j, hsa-mir-486-2
In a longitudinal study using plasma samples from non-HCV-infected injection drug users who eventually acquired the infection, miR-122 and miR-885-5p were increased in abundance during acute infection, whereas miR-494 and miR-411 were decreased in expression. [score:3]
Lastly, a signature of eight miRNAs (miR-494, miR-29b-3p, miR-551a, miR-606, miR-876-5p, miR-30c-5p, miR-221-3p, and miR-150-5p) was identified in serum of children infected with EV71 (119). [score:1]
[1 to 20 of 2 sentences]
97
[+] score: 4
Some miRNAs have been identified to regulate the expression of FoxM1, including miR-149, miR-134, miR-370, miR-494, miR-194, and miR-24-1 [37– 43]. [score:4]
[1 to 20 of 1 sentences]
98
[+] score: 4
Interestingly, two of significantly upregulated miRNAs after IR exposures in hESC, such as hsa-mir-1275 and hsa-mir-494, were recently found to localize to mitochondria [65]. [score:4]
[1 to 20 of 1 sentences]
99
[+] score: 4
Additionally, two miRNAs upregulated in the basis pontis of bovine spongiform encephalopathy-infected macaques, miRNA-342-3p and miRNA-494-3p [23], were also enriched in sCJD, but exclusively in the FC region. [score:4]
[1 to 20 of 1 sentences]
100
[+] score: 4
Previous studies have provided evidence for the important roles of deregulated expression of miRNAs in the pathogenesis of CC, including miR-29, miR-122, miR-124, miR-145, miR-146a, miR-200c, miR-370, miR-373, miR-376c and miR-494 [30– 36]. [score:4]
[1 to 20 of 1 sentences]