sort by

109 publications mentioning hsa-mir-483 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-483. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 210
The miR-483-3p and miR-483-5p expression levels compared with IGF2 expression A. miR-483-3p expression compared with IGF2 expression by (Rs= 0.4984, p< 0.0001); B. miR-483-5p expression compared with IGF2 expression by (Rs= 0.6659, p< 0.0001). [score:10]
Figure 2A positive correlation between IGF2 and miR-483 in CRC tissuesThe miR-483-3p and miR-483-5p expression levels compared with IGF2 expression A. miR-483-3p expression compared with IGF2 expression by (Rs= 0.4984, p< 0.0001); B. miR-483-5p expression compared with IGF2 expression by (Rs= 0.6659, p< 0.0001). [score:10]
However, when the seed regions of the targeting site were mutated (pMIR-MUT-3′UTR), the effects of miR-483-3p on luciferase activity were abolished (Figure 5D), suggesting that miR-483-3p may specifically suppress the DLC-1 gene expression, at least in part, by directly binding to its 3′UTR. [score:8]
Figure 6Transfection with miRNA483-3p antagomir induced DLC-1 expression and inhibited cell growth A. Transfection with miRNA483-3p antagomir induced DLC-1 expression in SW480 Cells. [score:7]
Furthermore, by suppressing its target DLC-1 gene and inducing CRC cell proliferation, miR-483-3p may provide a new target for CRC therapy. [score:7]
Cell viability was determined at 48h after transient transfection with miR-483-3p mimics or negative control (NC) by CCK8 assay (* p<0.05, non-parametric t test); B. showed lower DLC-1 expression levels in CRC tissues than adjacent normal tissues(N); C. Sequence-specific suppression of DLC-1 expression by miR-483-3p mimics, NC represents negative control; D. miR-483-3p mimics could not bind mutant sequences in DLC-1 3′UTR. [score:6]
We showed that miR-483-3p could promote CRC cell proliferation and suppress DLC-1 expression by directly binding the 3′UTR of mRNA. [score:6]
This study provides new insight into the mechanism of IGF2 oncofunction and suggests that the LOI or overexpression of IGF2 may, at least in part, mediate oncoeffect through the overexpression of miR-483. [score:5]
Meanwhile, 59 out of 77 cases showed higher miR-483-3p expression (76.62%, p<0.0001; Figure 1B) and 62 had higher miR-483-5P expression (80.52%, p<0.0001; Figure 1C). [score:5]
The results showed that transfection of miRNA483-3p antagomir induce expression of DLC-1 and inhibit cancer cell growth (Figure 6), further verifying the oncofunction of miR-483-3p. [score:5]
miR-483 was coexpressed with IGF2Since miR-483 is located within the IGF2 gene, we hypothesized that miR-483 may be coexpressed with the IGF2 gene. [score:5]
Transfection with miRNA483-3p antagomir induced DLC-1 expression and inhibited cell growth. [score:5]
Enhanced expression of both miR-483 and IGF2 in CRC tissuesWe examined the expression levels of miR-483-3p, miR-483-5p and IGF2 in 77 cases of primary colorectal cancers and their adjacent non-cancerous tissues by quantitative RT PCR. [score:5]
Finally, we found that transfection of miR-483-3p antagomir could induce the expression of DLC-1 and inhibit cancer cell growth. [score:5]
After examining the Targetscan and miRbase database, we predicted DLC-1 to be a putative target gene of miR-483-3p, which may bind to the 3′UTR sequences of the DLC-1 mRNA. [score:5]
miR-483-3p suppressed DLC-1 expression and promoted proliferation of CRC cells. [score:5]
When compared their expression levels using TagMan, we found positive correlations between IGF2 mRNA and miR-483-3p (r=0.4984, p<0.0001; Figure 2A), and between IGF2 mRNA and miR-483-5p expression (r=0.6659, p< 0.0001; Figure 2B). [score:4]
Figure 1Overexpression of IGF2, miR-483-3p and miR-483-5p in colorectal cancers compared to matched normal tissues A. Relative expression levels of IGF2 in colorectal cancer and matched normal tissues (n=77). [score:4]
Expression levels of miR-483-3p and miR-483-5p in serum samples from CRC patients (n=55) and normal controls (n=31). [score:3]
The expression levels of both miR-483-3p and miR-483-5p were normalized to U6 snRNA and are presented as fold changes (2 [−ΔΔCt]) above NC. [score:3]
In other words, the mechanism by which IGF2 causes carcinogenesis may be at least partially attributed to aberrantly increased miR-483 expression. [score:3]
Recent findings have shown that the IGF2 locus harbors a miRNA, miR-483, within the seventh intron; a positive correlation was found between IGF2 and miR-483-3p and miR-483-5p expression in the tumors studied [2, 11]. [score:3]
To further confirm the inhibitory effect of miR-483-3p on DLC-1 and its oncofunction, a colony formation experiment was performed using SW480 cells which were transfected with either miRNA483-3p antagomir or control antagomir. [score:3]
Enhanced expression of both miR-483 and IGF2 in CRC tissues. [score:3]
Cells were stained with crystal violet solution and the number of colonies was counted; C. The colony formation on the culture wells We examined the expression levels of miR-483-3p, miR-483-5p and IGF2 in 77 cases of primary colorectal cancers and their adjacent non-cancerous tissues by quantitative RT PCR. [score:3]
Chemically synthesized RNAs including miR-483-3p mimics, negative control, and its inhibitor were obtained from Ruibo bioscietech (Ruibo biotechnology, China). [score:3]
In line with their enhanced expressions in primary tumor specimens, miR-483-5p were also readily detected at high levels in the serum samples of CRC patients, but there was no significant difference in miR-483-3p levels between CRC patient serum and normal control serum. [score:3]
Figure 5miR-483-3p promoted cell proliferation by specifically targeting DLC-1 3′UTR A. transfection with miR483-3p mimics promoted cell proliferation. [score:3]
Given that aberrantly expressed blood miRNAs were closely associated with tumor detection, regardless of their derivation, circulating miR-483 would be a good candidate for potential noninvasive biomarker of CRC. [score:3]
These results allow us to propose that miR-483 may be coexpressed with its host gene, IGF2. [score:3]
These results suggest that miR-483-3p and miR-483-5p have a similar expression pattern as the IGF2 gene, and all are increased in CRC. [score:3]
Since miR-483 is located within the IGF2 gene, we hypothesized that miR-483 may be coexpressed with the IGF2 gene. [score:3]
miR-483-3p promoted cell proliferation by specifically targeting DLC-1 3′UTR. [score:3]
C. Relative miR-483-5p expression levels in colorectal tumor and matched normal tissues (n=77). [score:3]
A. Transfection with miRNA483-3p antagomir induced DLC-1 expression in SW480 Cells. [score:3]
Each construct was co -transfected into HCT116 cells with 50 nM miR-483 mimics, inhibitor (antisense) or negative control (NC), and 200ng pMIR-GLO-WT-DLC1 or pMIR-GLO-MUT-DLC1 vector. [score:3]
Cells were stained with crystal violet solution and the number of colonies was counted; C. The colony formation on the culture wells In this study, we investigated the overexpression of IGF2 intron-derived miR-483 in tissues and serums of CRC patients and explored the molecular mechanisms by which overexpressed miR-483 predisposes to colorectal cancer. [score:3]
B. Relative miR-483-3p expression levels in colorectal cancer and matched normal tissues (n=77). [score:3]
Immunoblot analysis was performed in SW480 cells transfected with miRNA483-3p antagomir using antibodies against DLC-1 and β-actin; B. Inhibition of colony formation in SW480 cancer cells transfected with miR-483-3p antagomir. [score:3]
miR-483 was coexpressed with IGF2. [score:3]
Accordingly, several subsequent studies have shown that miR-483 can serve as potential biomarkers for various cancers [13– 15], however the mechanism by which elevated miR-483 impacts the development of cancer remains unclear. [score:2]
When HCT116 cells were co -transfected with targeting vectors pMIR-WT-3′UTR and miR-483-3p mimics, luciferase activities were significantly reduced compared to cells transfected with control sequences (Figure 5C). [score:2]
To validate whether DLC-1 is targeted by miR-483-3p, a dual luciferase reporter assay was performed using constructs in which wild type and mutated sequences were cloned into the reporter vectors (pMIR-WT-3′UTR and pMIR-MUT-3′UTR). [score:2]
Overexpression of IGF2, miR-483-3p and miR-483-5p in colorectal cancers compared to matched normal tissues. [score:2]
The results showed the miR-483-5p AUC for CRC and control was 0.712 (95% CI: 0.6020–0.8220; p=0.0012, Figures 4D), whereas the miR-483-3p AUC was 0.6012 (95% CI: 0.4694–0.7329; p=0.1219, Figures 4C), indicating that serum miR-483-5p might serve as a potential biomarker for discriminating CRC from normal controls. [score:1]
A positive correlation between IGF2 and miR-483 in CRC tissues. [score:1]
No promoter activity was detected within 2kb sequences upstream of miR-483. [score:1]
Tissue miR-483-3p was found to have a sensitivity of 76.62% and a specificity of 62.34%, whereas miR-483-5p had a sensitivity of 51.59% and a specificity of 84.42% for CRC detection. [score:1]
Each of these constructs were transfected into HCT116 cells together with miR-483-3p mimics or negative control sequences and measured after 48h, and normalized using Rluc expression levels as control (*, p<0.05, non-parametric t test; NS, p<0.05). [score:1]
miR-483-5p as a potential CRC marker. [score:1]
ROC curve analysis was utilized to analyze the diagnostic accuracy of serum miR-483-3p and miR-483-5p. [score:1]
HCT116 cells were seeded in a 96-well plate at a density of 1×10 [4] cells per well, incubated overnight, and then transfected with either negative control or miR-483-3p mimic through Lipofectamine 2000 (Invitrogen, USA) and cultured at 37°C and 5% CO2 for 48 hours. [score:1]
To study the biological function of miR-483 in colorectal cancer, we used a gain-of-function approach by transfecting the HCT116 cell line with either chemically synthesized miR-483-3p mimics or control oligo sequence. [score:1]
At the cut-off value of less than 22.15, the sensitivity and the specificity of miR-483-5P were 80.65% and 60%, respectively. [score:1]
MiR-483-3p and miR-483-5p yield an area under the curve (AUC) value of 0.7333 and 0.7136, respectively. [score:1]
A. No significant differences in serum miR-483-3p levels were found between CRC patients and normal controls (p<0.05). [score:1]
B. A significant difference was found in serum miR-483-5p level between CRC patients and normal controls (p<0.01). [score:1]
E. miR-483-3p binding sequences in DLC-1 3′UTR are shown on top, miR-483-3p sequences are shown in the middle, and DLC-1 3′ UTR mutant sequences are shown on the bottom. [score:1]
MiR-483-3p and miR-483-5p yield an area under the curve (AUC) value of 0.6012 and 0.7120, respectively. [score:1]
For serum miR-483-3p and miR-483-5p detection, miR-16 serum level (PN4427975) was used as the normalized control. [score:1]
Cells were stained with crystal violet solution and the number of colonies was counted; C. The colony formation on the culture wells A. transfection with miR483-3p mimics promoted cell proliferation. [score:1]
A cut-off value, which maximizes the sum of sensitivity and specificity, of 9.22 was selected for miR-483-3p and 12.27 for miR-483-5p. [score:1]
The sensitivity and specificity of miR-483-3p in patients with CRC were 76.62% and 62.34%, and the sensitivity and specificity of miR-483-5p were 51.59% and 84.42%, respectively. [score:1]
Cell lines were co -transfected with pGL3-483P containing sequences upstream miR-483(483P); pGL3 basic vector without promoter as a negative control (NC) and pGL3 control vector as a positive control (PC). [score:1]
In this study, we evaluated the feasibility of using tissue and serum miR-483-3p/5p as a noninvasive diagnostic test for early detection of CRC and explored the oncofunction of miR-483 and the mechanism of colorectal carcinogenesis through the overexpression of the IGF2 gene and miR-483. [score:1]
SW480 cells were transfected with either 50nM miRNA483-3p antagomir or negative control antagomir (NC). [score:1]
Figure 3No promoter activity was detected within 2kb sequences upstream of miR-483. [score:1]
Our results showed that there was undetectable promoter activity in a 2kb fragment upstream miR-483, suggesting that miR-483 may be co-transcribed with the IGF2 gene driven by the IGF2 promoter. [score:1]
We showed that serum miR-483-5p has an acceptable sensitivity for the detection of CRC, making it a potential non-invasive biomarker for CRC screening. [score:1]
In addition, there was a positive correlation between miR-483 and IGF2, both of which were increased in CRC tissues. [score:1]
At the cut-off value of less than 22.15 for serum miR-483-5P, the sensitivity and the specificity were 80.65% and 60%, respectively. [score:1]
For colony formation, 4×10 [5] HEK293T cells were transfected using Lipofectamine 2000 (Invitrogen, USA) with either 50nM miRNA-483-3p antagomir or 50nM NC antagomir (RiboBio Co. [score:1]
It should be noted that the miR-483-3p mimic had less of an effect on cell proliferation than miR-483-3p antagomir. [score:1]
[1 to 20 of 73 sentences]
2
[+] score: 210
Activation of the maternal IGF2 allelic by miR483We next examined whether miR483 upregulated IGF2 expression by altering the imprinting or by increasing expression from the non-imprinted allele. [score:8]
We next examined whether miR483 upregulated IGF2 expression by altering the imprinting or by increasing expression from the non-imprinted allele. [score:8]
We found that both miR483 and miR483-5p upregulated the expression of the endogenous IGF2. [score:6]
Upregulation of IGF2 by miR483-5pmiRNAs have been reported to be able to modify expression and imprinting status of several genes [32, 33]. [score:6]
miR483 epigenetically upregulated IGF2 by reducing promoter suppression mediated by histone H3 lysine 27 methylation. [score:6]
Inhibition of miR483 by a synthetic inhibitor (anti miR483-5p) decreased invasion and migration of tumor cells (Figures 4C, 4D). [score:5]
In this study, we provide the first evidence that miR483 directly binds to the first upstream imprinted promoter (P2) of the IGF2 gene, where it participates in the regulation of allelic expression. [score:5]
By altering the epigenotype in the promoter, miR483 upregulates IGF2 production by relaxing IGF2 imprinting. [score:4]
We examined if the miR483 -mediated upregulation of IGF2 would affect cell proliferation in transfected tumor cells. [score:4]
miR483 upregulates IGF2. [score:4]
Induced expression of miR483 and mir483-P specifically reduced the binding of SUZ12 to the imprinting regulatory region of the IGF2 promoter (Figure 6D). [score:4]
Upregulation of IGF2 by miR483-5p. [score:4]
For miR483-5P inhibiting, a pair of oligonucleotides JH3816 (5’-GATCCCTCCCTTCTTTCCTCCCGTCTTTTTTTTG-3’) and JH3817 (5’-AATTCAAAAAAAAGACGGGAGGAAAGAAGGGAGG-3’) were synthesized for cloning. [score:3]
We then used Q-PCR to quantitate IGF2 expression in miR483 transfected cells. [score:3]
B. Biallelic expression of IGF2 in miR483-transfeced cells. [score:3]
These data suggest that miR483 activates IGF2 expression, as previously reported [34]. [score:3]
Thus, induced expression of miR483 increased proliferation and colony formation in both ASPC and HCT116 cancer cell lines. [score:3]
miR-CT: miRNA random control; Anti-miR483: miR483-5p inhibitor. [score:3]
We first confirmed the expression of pre-miR483 and miR483-5p in the transfected stable cells. [score:3]
Induced expression of miR483 led to the activation of the normally imprinted allele. [score:3]
miR483 is well-defined oncogenic microRNA that is overexpressed in a variety of human tumors [39– 42]. [score:3]
miR483 may inhibit allelic H3K27 methylation by preventing PRC2 docking. [score:3]
The miR483 expression vectors were constructed by cloning pre-miR483 (precursor miRNA) and miR483-5p (mature miRNA) into pGreenPuro vector (#SI505A-1, SBI, CA). [score:3]
Note the increased cell migration in the miR483-5p treated cells and the reduced migration in the miR483-5p inhibitor group. [score:3]
Expression of miR483-5p, miR483-3P and control U6 were quantitated by qPCR. [score:3]
B. Expression of virally transfected miR483 in ASPC cells. [score:3]
miR483 did not alter CTCF or SUZ12 mRNA expression in transfected cells (Supplementary Figure 3). [score:3]
Treatment of ASPC tumor cells with the miR483 inhibitor decreased pAKT (Figure 7A). [score:3]
C. Quantitation of IGF2 expression in ASPC clones transfected with the empty vector, miR483-5p (5P), and miR483. [score:3]
Oligonucleotides used for vector construction are listed in Supplementary Table 1. For the anti miR483-5p (the synthetic inhibitor), a pair of oligonucleotides JH3820 (5’-GATCCGAGAGGAGAAGACGGGAGGAGAGGAGTGAGGAGGCGTGATGGAACCACTCCCTTCTTTCCTCCCGTCTTCCCCCTCTTTTTTG-3’) and JH3821 (5’-AATTCAAAAAAGAGGGGGAAGACGGGAGGAAAGAAGGGAGTGGTTCCATCACGCCTCCTCACTCCTCTCCTCCCGTCTTCTCCTCTCG-3’) were synthesized to construct the vector (Supplementary Table 2). [score:3]
A. Strategy to examine the role of miR483 in controlling IGF2 allelic expression. [score:3]
These data suggest that induced expression of miR483 turned IGF2 maintenance of imprinting (MOI) cancer cells into LOI cells. [score:3]
Note that both the “A” and “C” alleles are expressed in miR482-5P and miR483 cells. [score:3]
Figure 3 A. Strategy to examine the role of miR483 in controlling IGF2 allelic expression. [score:3]
Taken together, our data suggest that miR483 induces epigenetic modifications in the IGF2 promoter complex, resulting in enhanced gene expression and loss of imprinting. [score:3]
We found that induced expression of miR483-5p led to an increase in pAKT. [score:3]
The fact that miR483 binds to the most upstream imprinted IGF2 promoter P2 suggests that it may participate in the regulation of IGF2 imprinting. [score:2]
The specific binding of miR483 to IGF2 promoters suggest a role for this microRNA in the regulation of the gene. [score:2]
In summary, using Cas9 immunoprecipitation we identified the oncogenic miR483 as a critical component in the regulatory complex of IGF2 imprinting. [score:2]
Figure 7 A. The activated AKT pathway by miR483-5p. [score:1]
miR483 induces epigenetic modifications of IGF2 promoters. [score:1]
To explore the mechanism underlying the LOI, we used chromatin immunoprecipitation (ChIP) to examine whether miR483 -mediated loss of IGF2 imprinting is related to H3K27 methylation in the IGF2 promoter region (Figure 6A). [score:1]
C. Binding of biotin-miR483-5p to the IGF2 promoter. [score:1]
Putative mo del of the miR483-IGF2-AKT pathway. [score:1]
Cells were plated in 6 well plates at 1 × 10 [5] cells/plate for 16 h and were transfected with biotin-miR483-5p or biotin-control RNA (20 pmol/well) using lipofectamine 2000 and OPTI-MEM I reduced serum medium (Invitrogen, CA). [score:1]
For miR483-5p, a pair of oligonucleotides JH2033 (5’-GATCCAAGACGGGAGGAAAGAAGGGAGTTTTTTG-3’) and JH2034 (5’-AATTCAAAAAACUCCCUUCUUUCCUCCCGUCUUG-3’) were synthesized for cloning. [score:1]
A. The activated AKT pathway by miR483-5p. [score:1]
In both the miR483 and miR483-5p clones, however, we found that the “C” allele products (111 bp and 60 bp) were also detected (lanes 3-4). [score:1]
In this study, however, we found that miR483 itself does not affect SUZ12 abundance (Supplementary Figure 2). [score:1]
In this study, we found that miR483 was able to bind to IGF2 promoter P2. [score:1]
DNAs that interacted with biotin-miR483-5p were pulled down using streptavidin beads according to the manufacturer's protocol (Invitrogen, CA). [score:1]
miR483 enhances tumor colony formation and cell proliferation. [score:1]
Identification of the binding of miR483 to the IGF2 promoter. [score:1]
We transfected tumor cells with biotin-labeled miR483-5p and random miRNA (miR-NT). [score:1]
The miR483 precursor (pre-miR483) is derived from IGF2 intron 7 by cleavage by the Dicer ribonuclease; this produces both the mature sense miRNA (miR483-5p) and the mature antisense miRNA (miR483-3p) (Figure 2A). [score:1]
Construction of miR483 and miR483-5p vectors. [score:1]
The nonimprinted IGF2 promoter 1 [26] was not affected by miR483 and miR483-5p (Figure 6C, site S6). [score:1]
In the miR483- and miR483-5p cells, the “C” allele was activated, accounting for 20% to 30% of total IGF2 mRNA transcripts (Figure 5C). [score:1]
As seen in Figure 4B, miR483-5p and miR483 caused ˜2.5-3 fold more tumor colonies than did the empty vector control group. [score:1]
Synthetic miR483 interacts with the IGF2 promoterThe miR483 precursor (pre-miR483) is derived from IGF2 intron 7 by cleavage by the Dicer ribonuclease; this produces both the mature sense miRNA (miR483-5p) and the mature antisense miRNA (miR483-3p) (Figure 2A). [score:1]
miR483-3P was increased ˜26-fold in the miR483 group. [score:1]
Figure 1Identification of miR483 as a component of the IGF2 promoter complex A. Diagram of the CRISPR Cas9 -guided chromatin immunoprecipitation. [score:1]
Cells were transfected with miR483, miR483-5p, and random miRNA. [score:1]
Unlike lncRNAs, miR483 is a very short RNA, and we do not know how such a short microRNA, while binding to the promoter, also affects the binding of two other chromatin binding factors, SUZ12 and CTCF. [score:1]
miR483 activates the AKT pathway. [score:1]
We used lentiviral vectors to transfect miR483 precursor (pre-miR483) and miR483-5p into two tumor cell lines (ASPC and HCT116) that maintain normal IGF2 imprinting [25]. [score:1]
C. Identification of miR483 in the IGF2 promoter complex. [score:1]
5P: miR483-5p; 3P: miR483-3P. [score:1]
In ASPC and HCt116 tumor cells, both miR483-5p and miR483 significantly enhanced cell growth by day 5 of culture (Figure 4A). [score:1]
These data suggest that the imprinted “C” allele was reactivated by miR483 and miR483-5p, leading to the relaxation or loss of IGF2 imprinting. [score:1]
After transient transfection, the biotin-miR483-5p interacting chromatin complex was pulled down by streptavidin beads. [score:1]
Figure 2Biotinylated miR483 binds to the IGF2 promoter A. Location of miR483-5p and its precursor in the IGF2 locus. [score:1]
Similarly, using Western blot we found that miR483-5p increased IGF-II protein in treated cells (Figure 3D). [score:1]
Figure 5miR483 induces loss of IGF2 imprinting A. Schematic diagram of IGF2 imprinting in miR483 -transfected cells. [score:1]
We utilized a CRISPR Cas9 -guided chromatin immunoprecipitation assay to pull down the IGF2 promoter complex, and we identified miR483 as a molecule that interacts with the IGF2 promoter and participates in the regulation of IGF2 imprinting. [score:1]
In this study, we showed that miR483 reduced the binding of CTCF to the IGF2 promoter (Figure 6D. [score:1]
Real-time PCR was performed to quantitate the binding of miR483 to the IGF2 promoter. [score:1]
Using small RNA library sequencing, we identified miR483, a well-defined oncogenic miRNA, as an RNA that interacted with the IGF2 promoter complex. [score:1]
After reverse transcription, using Q-PCR we found that miR483-5p was increased ˜27-fold in both the miR483 and 483-5P transfected cells (Figure 3B). [score:1]
miR483-5p binds to the promoter and reactivates the maternal allele, leading to loss of IGF2 imprinting (LOI). [score:1]
What is the specific binding sequence of miR483-5p? [score:1]
Activation of the maternal IGF2 allelic by miR483. [score:1]
Identification of the binding of miR483 to the IGF2 promoterLoss of IGF2 imprinting, a molecular hallmark of many tumors, is characterized by activation of the normally suppressed maternal promoters [25, 26]. [score:1]
There was no detectable signal of miR483 in the vector control or in the random gRNA control (gCT) groups. [score:1]
Similarly, miR483-5p also increased cell invasion (Figure 4C) and migration (Figure 4D, Supplementary Figure 2) in both ASPC and HCT116 cells. [score:1]
Quantitative PCR was used to quantitate the abundance of miR483 in the Cas9-captured complex. [score:1]
No interaction of miR483 was observed with the non-imprinted IGF2 promoter P1 or with the imprinted promoters P3 or P4. [score:1]
Identification of miR483 as a component of the IGF2 promoter complex. [score:1]
These data demonstrate a new role of the oncogenic miR483 in promoting tumor growth. [score:1]
miR483 promotes the formation of tumor colony. [score:1]
Does miR483 bind to IGF2 promoter P2 using base pairing mechanism as it does when it binds to the 3’-UTR region? [score:1]
Instead, miR483 significantly reduced the binding of SUZ12 to the IGF2 promoter (Figure 6D). [score:1]
The miR483 lentiviruses were produced in 293T cells and ASPC cells were transfected with viral supernatants in fresh medium containing 5 mg/ml polybrene (Sigma, MO). [score:1]
Synthetic miR483 interacts with the IGF2 promoter. [score:1]
Using a Cas9 immunoprecipitation assay, we identified miR483, an IGF2 intronic microRNA, as a regulatory component in the IGF2 promoter complex. [score:1]
After binding to IGF2 promoter P2, miR483 decreases the binding of CTCF and SUZ12 and consequently reduces H3K27 methylation. [score:1]
A. Schematic diagram of IGF2 imprinting in miR483 -transfected cells. [score:1]
We then used quantitative PCR to confirm the binding of miR483 to the IGF2 promoters. [score:1]
A. Location of miR483-5p and its precursor in the IGF2 locus. [score:1]
We examined whether miR483 affects the binding of CTCF and SUZ12 to the IGF2 promoter region. [score:1]
B. The proposed mo del of miR483-5p in tumorigenesis. [score:1]
As miR483 binds to the IGF2 promoter, we were interested in examining if the miRNA was able to control the activity of this promoter. [score:1]
For pre-miR483, a pair of oligonucleotides JH2031 (5’-GATCCGAGGGGGAAGACGGGAGGAAAGAAGGGAGUGGUUCCAUCACGCCUCCUCACUCCUCUCCUCCCGUCUUCUCCUCUCG-3’) and JH2032 (5’-AATTCGAGAGGAGAAGACGGGAGGAGAGGAGUGAGGAGGCGUGAUGGAACCACUCCCUUCUUUCCUCCCGUCUUCCCCCUCG-3’) were synthesized for cloning. [score:1]
miR483 induces epigenetic modifications of IGF2 promoters IGF2 imprinting is associated with specific monoallelic methylation of histone 3 lysine 27 (K27) in the gene promoters [37]. [score:1]
miR483 induces loss of IGF2 imprinting. [score:1]
Future studies are needed to address the specific role of the miR483-5p/IGF pathway in animal mo dels. [score:1]
Biotinylated miR483 binds to the IGF2 promoter. [score:1]
[1 to 20 of 107 sentences]
3
[+] score: 172
miR-125a-3p and miR-483-5p are upregulated during the differentiation of hADSCs, and target proteins are downregulated in MSL. [score:9]
Total ERK1/2 (T-ERK1/2) and total phosphorylated ERK1/2 (T-p-ERK1/2) from whole cell protein lysate were downregulated by the miR-483-5p mimic, while they were upregulated by the miR-483-5p inhibitor in hADSCs following transfection for 72 h (Fig. 3E). [score:9]
Moreover, n-T-ERK1/2 and n-p-ERK1/2 were downregulated in the cotransfected group compared to that of the miR-125a-3p inhibitor group while upregulated compared to that of the miR-483-5p mimic group (Fig. 5D). [score:7]
Next, after each group was induced to mature adipocytes for 12 days, C/EBPα, PPARγ, and FABP4 were upregulated by the agomir of miR-125a-3p or miR-483-5p; while they were downregulated by the antagomir of miR-125a-3p or miR-483-5p (Fig. 2D,E). [score:7]
In comparison to the control and miR-125a-3p inhibitor, cotransfection with the miR-125a-3p inhibitor and miR-483-5p mimic resulted in decreased expression of T-ERK1/2 and T-p-ERK1/2 to the levels of the miR-483-5p mimic group (Fig. 5C). [score:7]
To determine whether miR-483-5p regulates the RhoA/ROCK1/ERK1 pathway, we compared the expression levels of these proteins in hADSCs transfected with the miR-125a-3p inhibitor, miR-483-5p mimic, or cotransfection of the miR-125a-3p inhibitor and miR-483-5p mimic, and found that cotransfection did not change the T-ERK1/2 or T-p-ERK1/2 levels but apparently changed the n-T-ERK1/2 and n-p-ERK1/2 levels. [score:7]
To determine whether miR-125a-3p and miR-483-5p jointly regulate the activity of the RhoA/ROCK1/ERK1/2 pathway, we first detected the expression of T-ERK1/2, T-p-ERK1/2, n-T-ERK1/2, and n-p-ERK1/2 following transfection of hADSCs with the mimic or inhibitor of miR-125a-3p. [score:6]
n-T-ERK1/2 and n-p-ERK1/2 were downregulated in the LV-miR-125a and LV-miR-483 groups, and even greater downregulation was observed in the cotransfection group compared to the LV-miR-125a and LV-miR-483 groups (Fig. 6G). [score:6]
Next, we cotransfected the miR-125a-3p inhibitor and miR-483-5p mimic to test ERK1/2 expression in hADSCs. [score:5]
In the de novo adipose tissues of LV-miR-125a or LV-miR-483 group, we found that miR-125a-3p and miR-483-5p expression was significantly higher than miR-125a-5p and miR-483-3p expression (Fig. 6C). [score:5]
To generate hsa-miR-125a and hsa-miR-483 lentiviral expression plasmids, 268-bp and 273-bp sequences containing pre-hsa-miR-125a or pre-hsa-miR-483 were synthesized and cloned into lentiviral expression vector pGC-FU (GeneChem, Shanghai, China), respectively. [score:5]
Our results demonstrated that miR-483-5p was also gradually upregulated during adipogenesis and promoted adipogenesis. [score:4]
It is unclear why upregulation of miR-483-5p decreased T-p-ERK1/2 but not T-ERK1/2 during adipogenesis. [score:4]
In addition, miR-320 regulates insulin resistance in adipocytes 35; miR-140 promotes adipogenesis 36 and miR-483-3p inhibits 3T3-L1 adipogenesis and gradually decreases during differentiation 22. [score:4]
In this study, we discovered that 18 miRs were upregulated in the SAT of MSL patients and that miR-125a-3p or miR-483-5p significantly promoted adipogenesis via the RhoA/ROCK1/ERK1/2 pathway (Fig. 7). [score:4]
These results clearly demonstrated that RhoA and ERK1 are the direct target genes of miR-125a-3p and miR-483-5p, respectively. [score:4]
To investigate the expression tendency of miR-125a-3p and miR-483-5p during hADSC differentiation, we used real-time PCR to detect the miR-125a-3p and miR-483-5p expression at days 0, 6, and 12 during the induction to mature adipocytes. [score:3]
RhoA and ERK1 are the target genes of miR-125a-3p and miR-483-5p, respectively. [score:3]
The miR-125a-3p and miR-483-5p expression levels were detected by quantitative real-time PCR at days 0, 6, and 12. [score:3]
RhoA and ERK1 are the respective target genes of miR-125a-3p and miR-483-5p. [score:3]
Next, we transfected hADSCs with the miR-125a-3p or miR-483-5p mimic or inhibitor for 72 h and determined the protein levels of RhoA or ERK1/2 by immunoblotting. [score:3]
To further support previous observations 18 27, we designed different mutant site sequences in the 3′-UTR of RhoA and ERK1 and verified the targeting of RhoA and ERK1 by miR-125a-3p and miR-483-5p, respectively. [score:3]
miR-483-5p is located within the second intron of its host gene insulin-like growth factor 2 (IGF2) and was found to be coexpressed with IGF2 in 3T3-L1, Hepa1-6, and HepG2 cells 40 41. [score:3]
After 5 weeks of self-differentiation, (A) De novo adipose tissue formation was observed (n = 5); (B) The weights of the de novo adipose tissues were measured (n = 5); (C) The expression levels of miR-125a-3p/5p and miR-483-3p/5p in de novo adipose tissue were detected by real-time PCR (n = 5); (D) The de novo adipose tissue was stained to observe the histology (n = 5); (E) Adipoctye size were analyzed by ImageJ software (F) The protein expression levels of RhoA, ROCK1, total ERK1/2 (T-EKR1/2), and phosphorylated ERK1/2 (T-p-EKR1/2) were analyzed by western blot; and (G) Total nuclear ERK1/2 (n-T-ERK1/2) and p-ERK1/2 (n-p-ERK1/2) were analyzed by western blot. [score:3]
Conversely, inhibition of miR-125a-3p or miR-483-5p with the corresponding antagomir markedly decreased lipid droplet accumulation (Fig. 2A,B). [score:3]
How to cite this article: Chen, K. et al. miR-125a-3p and miR-483-5p promote adipogenesis via suppressing the RhoA/ROCK1/ERK1/2 pathway in multiple symmetric lipomatosis. [score:3]
The expression of miR-125a-3p and miR-483-5p are increased with the induction of hADSCs. [score:3]
Relative to day 0, approximately 3-4- and 4-6-fold increases of miR-125a-3p and miR-483-5p expression were observed at day 6 and day 12 (Fig. 4A), respectively. [score:3]
miR-125a-3p and miR-483-5p synergistically regulate the RhoA/ROCK1/ERK1/2 pathway. [score:2]
Our results suggest that miR-125a-3p and miR-483-5p may jointly promote adipogenesis in vivo through regulating the RhoA/ROCK1/ERK1/2 pathway, at least in part. [score:2]
In summary, we found that both miR-125a-3p and miR-483-5p are significantly increased in the SATs of MSL patients and that miR-125a-3p and miR-483-5p promote adipogenesis through regulating the RhoA/ROCK1/ERK1/2 pathway. [score:2]
These results suggested that miR-125a-3p and miR-483-5p might jointly regulate the activity of the RhoA/ROCK1/ERK1/2 signaling pathway. [score:2]
A proposed mo del of the regulation of adipogenesis by miR-125a-3p and miR-483-5p. [score:2]
miR-125a-3p and miR-483-5p regulate RhoA/ROCK1/ERK1/2 signaling and promote mouse de novo adipogenesis. [score:2]
miR-125a-3p and miR-483-5p jointly regulate the RhoA/ROCK1/ERK1/2 pathway. [score:2]
miR-125a-3p and miR-483-5p regulate adipogenesis in hADSCs. [score:2]
When the cells reached 70–80% confluence, the wild-type (WT) or mutation-type (MT) RhoA and ERK1 3′-UTR plasmids were cotransfected with miR-125a-3p or miR-483-5p mimics (100 nM) or negative control (NC) mimics with Lipofectamine 2000. [score:2]
Thus, miR-125a-3p and miR-483-5p regulate the activity of the RhoA/ROCK1/ERK1/2 pathway in vivo. [score:2]
At the same time, miR-483-5p directly decreases T-ERK1/2 and T-p-ERK1/2 in the cytoplasm, and n-T-ERK1/2 and n-p-ERK1/2 in the nucleus. [score:2]
Previous studies have shown that miR-125a-3p and miR-483-5p target RhoA and ERK1, respectively 17 26, which was further supported by our dual-luciferase assay. [score:2]
These data further supported the conclusions that miR-125a-3p affects the T-ERK1/2 and p-ERK1/2 levels in the nucleus and that miR-125a-3p and miR-483-5p may jointly regulate the RhoA/ROCK1/ERK1/2 pathway. [score:2]
We found that LV-miR-125a, LV-miR-483, and especially LV-miR-125a in combination with LV-miR-483 significantly increased cells size and promoted de novo fat formation in vivo and de novo adipose tissue weight gain. [score:1]
We found that transfection with miR-125a-3p or miR-483-5p significantly promoted lipid droplet accumulation in hADSCs that were induced to mature adipocytes. [score:1]
These results demonstrated that miR-125a-3p and miR-483-5p promote adipogenesis in hADSCs. [score:1]
Similar results were observed in miR-483-5p and ERK1 (Fig. 3B). [score:1]
In addition, adipose tissue staining showed cell size of miR-125a or miR-483 was bigger than Con or LV-NC group, but smaller than cotransfection group (Fig. 6D,E). [score:1]
hADSCs were transfected with a lentiviral vector containing pre-miRs of miR-125a (LV-miR-125a), miR-483 (LV-miR-483), or negative control miR (LV-NC) and transplanted to the back subcutaneous tissues of nude mice with the transfected hADSCs or non-tranfected hADSC as control group (Con) or injection of PBS. [score:1]
miR-125a-3p and miR-483-5p significantly promote adipogenesis in hADSCs. [score:1]
To induce de novo adipose tissue, hADSCs were transfected with one of the following lentiviruses: negative control miR (LV-NC), hsa-miR-125a, hsa-miR-483, or hsa-miR-125a +483. [score:1]
Importantly, we found that miR-125a-3p and miR-483-5p promoted de novo adipose tissue formation in nude mice. [score:1]
These results imply that miR-125a-3p and miR-483-5p may play an important role in MSL adipogenesis. [score:1]
The de novo adipose tissue formation in LV-miR-125a, LV-miR-483 and cotransfection group were much larger than that of the Con or LV-NC groups, especially in cotransfection group (Fig. 6A,B). [score:1]
These data suggest that miR-125a-3p and-5p as well as miR-483-3p and-5p may play reverse roles during adipogenesis, at least in adipogenesis of MSL patients. [score:1]
The hADSCs were transfected with the miR-125a-3p or miR-483-5p agomir, agomir-NC (100 nM), antagomir-NC, or antagomir (200 nM), respectively. [score:1]
De novo adipogenesis in vivoTo induce de novo adipose tissue, hADSCs were transfected with one of the following lentiviruses: negative control miR (LV-NC), hsa-miR-125a, hsa-miR-483, or hsa-miR-125a +483. [score:1]
Interestingly, capsular de novo adipose tissues were found in the LV-miR-125a, LV-miR-483, and cotransfection group; however, no capsular formation was seen in the Con or LV-NC groups. [score:1]
miR-125a-3p and miR-483-5p promote de novo adipose tissue formation in nude mice. [score:1]
Indeed, the miR-125a-3p and miR-483-5p agomir apparently promoted adipogenesis, while their antigomir significantly prevented adipogenesis under either induction or self-differentiation conditions. [score:1]
[1 to 20 of 58 sentences]
4
[+] score: 154
Our current results showed that miR-483-3p is up-regulated in the non-recurrent group of patients and downregulated in the recurrence group, thus acting as a tumor-suppressor, at least in HCC. [score:9]
In order to try to elucidate the possible mechanisms behind the heterogeneous expression of miR-483-3p in HCC, we studied the IHC expression of IGF2, a wi dely recognized up-regulated gene in HCC [34]. [score:8]
This means that a down-regulation of miR-483-3p implies a risk of tumor recurrence, while an up-regulation seems to be a protective factor, and it seems to be applicable in both resected and transplanted cases. [score:7]
Figure 3 The blue line (no recurrence cases) refers to the 11 cases with a mean miR-483-3p fold increase of 5.94 (miR-483-3p up-regulation), while the green line (4 recurrence cases) refers to the 9 cases with a mean miR-483-3p fold increase of 0.21 (down-regulation). [score:7]
miR-483-3p expression is heterogeneous across human malignancies, acting as tumorigenic or a tumor-suppressor according to the target [22, 30]. [score:7]
Moreover, from a review of the literature, we saw that both miR-483-3p and miR-548e have a broad range of targets (respectively 377 targets and 934 targets, miRDB - miRSearch V3.0), although there is missing evidence in the literature concerning their role in human cancers, especially for miR-548e. [score:7]
The blue line (no recurrence cases) refers to the 11 cases with a mean miR-483-3p fold increase of 5.94 (miR-483-3p up-regulation), while the green line (4 recurrence cases) refers to the 9 cases with a mean miR-483-3p fold increase of 0.21 (down-regulation). [score:7]
The validation on the prospective group C showed that with a miR-483-3p up-regulation (mean fold increase 5.94) no HCC recurrences were recorded; conversely, with a miR-483-3p down-regulation (mean fold increase 0.21) 44% of cases experienced local recurrence after surgery. [score:7]
The IGF2 locus harbors the mir-483 locus within its second intron, and indeed the upregulation of miR-483-3p has been related to IGF2 expression [22]. [score:6]
In order to assess the deregulated expression of miR-483-3p, we chose a pool of normal liver tissues to avoid confounding factors related with the heterogeneous expression of cirrhotic tissue. [score:6]
Here, for the first time, we report a possible role of miR-548e downregulation in HCC recurrence, with a tumor-suppressor function (like miR-483-3p). [score:6]
The mean miR-483-3p ΔΔCT of the 14 cases with preserved expression of tissue IGF2 was -0.71±2.92, corresponding to a 1.62 fold increase (up-regulation). [score:6]
In the attempt to shed light on the mechanism behind the prognostic impact of miR-483-3p, we performed IHC for IGF2, an important growth factor co-expressed with miR-483-3p [22], on the 20 prospective HCC from Group C. We found a loss of cytoplasmic positivity for IGF2 in 6 (30%) HCC, while the IHC expression was preserved (i. e. of the same intensity as in non-neoplastic liver) in the remaining cases (Figure 4). [score:5]
Unfortunately, the recurrence-free survival curve in relation to miR-548e expression was not significant as for miR-483-3p: further prospective studies are needed to validate the expression of miR-548e as a single predictive variable. [score:5]
In the attempt to shed light on the mechanism behind the prognostic impact of miR-483-3p, we performed IHC for IGF2, an important growth factor co-expressed with miR-483-3p [22], on the 20 prospective HCC from Group C. We found a loss of cytoplasmic positivity for IGF2 in 6 (30%) HCC, while the IHC expression was preserved (i. e. of the same intensity as in non-neoplastic liver) in the remaining cases (Figure 4). [score:5]
The actual meaning of “normal liver” is somewhat indefinite due the incidence of chronic liver diseases in the population that might represent the only reason for miR-483-3p deregulation in our series of patients apart from HCC. [score:4]
Interestingly, the mean miR-483-3p ΔΔCT of the 6 cases with loss of tissue IGF2 was 0.82±2.14, corresponding to a 0.57 fold increase (down-regulation). [score:4]
Second, the up-regulation of miR-483-3p was assessed after comparison with a pool of normal liver tissues. [score:4]
This difference does not reach statistical significance (P=0.274, ANOVA), probably due to the small sample size, but the co -expression of miR-483-3p and IGF2 is likely to be maintained also in our study. [score:3]
From the miRNA card analysis and the subsequent validation with, two promising miRNAs emerged, with a significant difference in expression between group A (free from recurrence at 5 years) and group B (recurrence after resection): miR-483-3p and miR-548e. [score:3]
Expression of miR-483-3p-related proteins: immunohistochemistry for IGF2. [score:3]
Of note, no differences were found in miRNA expression between transplanted and resected HCC from group C: the mean fold increase of miR-483-3p was 6.87±15.36 and 4.63±11.73 in transplanted and resected HCC respectively (p=0.065); the mean fold increase of miR-548(e) was 9.91±27.80 and 38.83±85.99 in transplanted and resected HCC respectively (p=0.165). [score:3]
In particular, no cases of local HCC recurrence were observed with a miR-483-3p ΔΔCT above the cut-off: this was observed in 11/20 cases with a mean miR-483-3p ΔΔCT value of -2.57±2.66, corresponding to a mean fold increase of 5.94 of miR-483-3p expression. [score:3]
Based on the statistical analysis performed on the arrays with the ExpressionSuite Software, we selected two promising miRNAs for the validation phase: miR-483-3p and miR-548(e) (also named miR-548e-3p). [score:3]
miR-483-3p was significantly down-regulated in recurrent HCC (22 cases) compared to non-recurrent HCC (32 cases), with mean fold-increase values of 0.53±0.91 and 15.04±54.06 respectively (p=0.025, Wilcoxon-matched pairs test). [score:3]
Being co-expressed in the majority of cases, we can hypothesize that miR-483-3p and IGF2 might be activated by the same mechanisms, although dedicated studies are needed to confirm this hypothesis. [score:3]
Kaplan-Meier’s recurrence-free survival curve of the 20 prospective patients of group C according to the expression of miR-483-3p. [score:3]
In order to study the significance of miR-483-3p and miR-548e expression in recurrence-free survival of the 20 prospectively enrolled patients of group C, we elaborated an ROC curve to find a cut-off value. [score:3]
miR-483-3p is known to be deregulated in different tumors including Wilms' tumors, colon, breast and liver cancers [22]. [score:2]
We therefore decided to validate the expression of these two miRNAs on the whole series (54 patients) by performing single PCR assays to quantify miR-483-3p and miR-548(e) levels. [score:2]
Our preliminary data confirm a co-regulation of IGF2 and miR-483-3p in neoplastic hepatocytes. [score:2]
Finally, the mechanistic association between miR-483-3p and IGF-2 expression in HCC is beyond the scope of this study and should be investigated by in vitro dedicated studies. [score:1]
miR-483-3p is known for its anti-apoptotic function and it was previously associated with HCC recurrence in resected HCC in patients within the Milan criteria [24]. [score:1]
For miR-483-3p the area under the curve (AUC) was 0.771, and with a ΔΔCT value of -0.075we found an 80% sensitivity and 64% specificity towards HCC recurrence. [score:1]
Single PCR assays confirmed the significant differential expression of miR-483-3p (fold increase 8.18±3.04; p=0.012, Wilcoxon-matched pairs test) and miR-548(e) (fold increase 9.17±39.66; p<0.001) in HCC tissue compared to controls. [score:1]
Of note, we chose to enroll both resected and transplanted patients in group C, in order to evaluate the feasibility of the miRNA study on both mo dels: as a result, tissue miR-483-3p expression seems to be applicable in both mo dels. [score:1]
If our data are confirmed by others, miR-483-3p would become one of the few miRNAs - the first in HCC- with actual biomarker validation. [score:1]
Conversely, a miR-483-3p ΔΔCT below the cut-off was observed in 9/20 cases, with 4 local HCC recurrences (44.4%); in this group the mean miR-483-3p ΔΔCT value was 2.27±1.56, corresponding to a mean fold increase of 0.21. [score:1]
Quantitative real-time polymerase chain reaction (qRT-PCR) validation for miR-483-3p and miR-548(e). [score:1]
[1 to 20 of 39 sentences]
5
[+] score: 91
Since we found the upregulation of Egr1 in HMGA1P7 overexpressing MEFs performing RNA-seq analysis [1], we tested whether it could be responsible for the miR-483-5p and miR-675-5p upregulation. [score:9]
The results reported in Figure 1 confirm the overexpression of miR-483-5p, miR-483-3p, miR-675-5p, miR-21-3p, and the downregulation of miR-187-3p in HMGA1P7 overexpressing MEFs in comparison with the WT ones. [score:8]
These results suggest that Egr1 could regulate miR-483 and miR-675 expression by upregulating H19 and Igf2 genes. [score:7]
Then, we converged our studies on the miR-483-5p and miR-675-5p, which showed the most upregulated fold-change in HMGA1P7 overexpressing MEFs by miRNA-seq analyses. [score:6]
Moreover, as expected from previous results, qRT-PCR showed upregulation of miR-483-5p and miR-675-5p following HMGA1P7 pseudogene overexpression in NIH3T3 cells (Figure 4A). [score:6]
Moreover, it has been reported that overexpression of miR-483-3p overcomes miR-145/TP53 pro-apoptotic loop in hepatocellular carcinoma and that it mediates its oncofunction by suppressing DLC-1 in colorectal cancer [32, 33]. [score:5]
These evidences are coherent with the conclusion that HMGA1P7 requires mature miRNAs to regulate Egr1 levels and then upregulates miR-483-5p and miR-675-5p. [score:5]
Here, we demonstrate that HMGA1P7 upregulates miR-483 and miR-675 through the activation of Egr1 by a ceRNA mechanism. [score:4]
As expected from previous data, qRT-PCR analysis showed that miR-483-5p and miR-675-5p were also upregulated in heart and spleen from HMGA1P7 adult transgenic mice (Figure 2). [score:4]
Taken together, these data deeply endorse the assumption that HMGA1P7 could act as ceRNA for Egr1, which in turn upregulates miR-483-5p and miR-675-5p. [score:4]
3.2. miR-483-5p and miR-675-5p are Upregulated in HMGA1P7 Mouse Tissues. [score:4]
Song Q. Xu Y. Yang C. Chen Z. Jia C. Chen J. Zhang Y. Lai P. Fan X. Zhou X. miR-483-5p promotes invasion and metastasis of lung adenocarcinoma by targeting RhoGDI1 and ALCAMCancer Res. [score:3]
For example, miR-483-5p has been identified as predictor of poor prognosis in adrenocortical cancer and it has been demonstrated to promote invasion and metastasis of lung adenocarcinoma by targeting RhoGDI1 and ALCAM [30, 31]. [score:3]
Among them, we focused our attention on two of the most overexpressed miRNAs: miR-483 and miR-675. [score:3]
Yang Z. G. Ma X. D. He Z. H. Guo Y. X. miR-483-5p promotes prostate cancer cell proliferation and invasion by targeting RBM5Int. [score:3]
Intriguingly, it has been extensively demonstrated that miR-483 and miR-675 are two oncomiRs since they have been found overexpressed in many tumours such as prostate [18], gastric [19], Wilms’ [20], adrenocortical [21], esophageal [22], breast [23], colon [24], and lung tumours [25]. [score:3]
HMGA1P7 Pseudogene Sustains miR-483-5p and miR-675-5p Expression via a ceRNA Mechanism with Egr1. [score:3]
It has been reported that early growth response protein 1 (Egr1) controls the expression of H19 [40] and Igf2 [41] and that, intriguingly, miR-483 is located within the second intron of Igf2 gene [42] and miR-675 is encoded by the first exon of H19 gene [40]. [score:3]
In this study, we focused on miR-483-5p and miR-675-5p since they are involved in carcinogenesis and they belong to the H19/ Igf2 locus, which has been already linked to HMGA1P7 ceRNA network [1, 40, 42]. [score:1]
Soon P. S. Tacon L. J. Gill A. J. Bambach C. P. Sywak M. S. Campbell P. R. Yeh M. W. Wong S. G. Clifton-Bligh R. J. Robinson B. G. miR-195 and miR-483-5p Identified as Predictors of Poor Prognosis in Adrenocortical CancerClin. [score:1]
Liu M. Roth A. Yu M. Morris R. Bersani F. Rivera M. N. Lu J. Shioda T. Vasudevan S. Ramaswamy S. The IGF2 intronic miR-483 selectively enhances transcription from IGF2 fetal promoters and enhances tumorigenesisGenes Dev. [score:1]
Indeed, Egr1 controls the transcription of H19 and Igf2 whose mRNAs maturation generates miR-483-5p and miR-675-5p [40, 41]. [score:1]
Wu K. Ma L. Zhu J. miR-483-5p promotes growth, invasion and self-renewal of gastric cancer stem cells by Wnt/β-catenin signalingMol. [score:1]
Chabre O. Libé R. Assie G. Barreau O. Bertherat J. Bertagna X. Feige J. J. Cherradi N. Serum miR-483-5p and miR-195 are predictive of recurrence risk in adrenocortical cancer patientsEndocr. [score:1]
Consequently, H19 and Igf2 mRNAs increase and, with them, so do miR-483-5p and miR-675-5p amounts. [score:1]
Veronese A. Lupini L. Consiglio J. Visone R. Ferracin M. Fornari F. Zanesi N. Alder H. D’Elia G. Gramantieri L. Oncogenic role of miR-483-3p at the IGF2/483 locusCancer Res. [score:1]
[1 to 20 of 26 sentences]
6
[+] score: 85
miR-320a target genes are shown in white boxes, miR-483-5p target genes in grey boxes and the black box shows a common target gene for both miRNAs The present study is focused on the identification of miRNAs with altered expression in osteoporotic bone. [score:9]
miR-320a target genes are shown in white boxes, miR-483-5p target genes in grey boxes and the black box shows a common target gene for both miRNAs The anthropometric features of the OP and Control groups were shown in Table  1. Using the Mann–Whitney U test, no statistical differences in these variables were observed between the two groups. [score:7]
miR-320a is known to target CTNNB1 and predicted to regulate RUNX2 and LEPR, while miR-483-5p down-regulates IGF2. [score:7]
Since miRNA miR-483-5p is located within intron 2 of IGF2, the expression of this gene was assessed by qPCR to assess its co -expression with miR-483-5p. [score:5]
Genes belonging to the mentioned pathways which are targeted by these two miRNAs are shown in Fig.   6. Fig. 6 Schematic pathway involving miR320a and miR483-5p target genes. [score:5]
In the analysis of differential expression between osteoporotic and control samples, 82 miRNAs reached significance, and after qPCR validation, two miRNAs were significantly over-expressed in osteoporotic samples (miR-320a and miR-483-5p). [score:5]
In agreement with these data from the murine system, when we tested IGF2 mRNA levels in the osteoporotic bone samples, in which miR-483-5p was up-regulated, we observed a trend of reduction relative to controls (see Fig.   4). [score:4]
Thus, IGF2 did not show the over -expression found for miR-483-5p in the OP group, instead showing a trend in the opposite direction. [score:4]
Liu et al. [26] demonstrated that miR-483-5p binds to the 5’-UTR of the major foetal IGF2 promoter transcript, enhancing the association of the RNA helicase DHX9 to the IGF2 mRNA and leading to its up-regulation. [score:4]
In mouse Hepa1-6 cells, Ma et al. [27] determined that miR-483-5p is transcriptionally co-expressed with its host gene, Igf2, and negatively regulates it. [score:4]
Cell proliferation factors such as SRF and MAPK3 (mirTArBase) are validated targets for the less-studied miR-483-5p. [score:3]
Eight hsa-miRNAs underwent validation in the discovery samples by qPCR (miR-675-5p, miR-30c-1-3p, miR-483-5p, miR-542-5p, miR-142-3p, miR-223-3p, miR-32-3p, and miR-320a) according to the following criteria: available Exiqon probes, the best hits in bone array (signal intensity and significant differences between the groups), and predicted to target genes involved in bone metabolism. [score:3]
Regarding the 82 miRNAs differentially expressed between control and OP samples, 46 were also detected in the osteoblast array, including miR-320a and miR-483-5p. [score:3]
Relative expression levels of miR-320a and miR-483-5p at the validation stage in patients with osteoporotic fracture (n = 5) and controls (n = 6). [score:3]
KEGG pathways involving miR-483-5p target genes are mainly ECM-receptor interaction (0.00114789) and N-Glycan biosynthesis (5.118433e-07), as well as PI3K-Akt signalling (0.01153999) and focal adhesion (0.002081914) (DIANA-mirPath). [score:3]
However, miR-483-5p does not act on promoters that drive adult IGF2 expression. [score:3]
The intersection pathways involving genes targeted by miR-320a and miR-483-5p are mainly prostate cancer (4.496403e-14), PI3K-Akt signalling (5.614388e-08), and focal adhesion (6.000918e-07). [score:3]
When the intersection of the pathways targeted by miR-320a and miR-483-5p were explored, prostate cancer, PI3K-Akt signalling, and focal adhesion emerged as the most significant. [score:3]
The same pattern of regulation was observed in cartilage samples from old mice and murine osteoarthritic cartilage, in which there were higher levels of miR-483 (orthologous to hsa-miR-483-5p) and lower mRNA levels of Igf2 [28]. [score:2]
miR-483-5p has been associated with several pathological conditions, including tumours such as adrenocortical and ovarian serous carcinoma [21, 22], cartilage -associated pathologies such as multiple osteochondroma [23] and osteoarthritic chondrocytes [24]. [score:1]
The miR-320a (p = 0.005) and miR-483-5p (p = 0.036) still showed significant differences between biological groups. [score:1]
After validation, three miRNAs –miR-30c-1-3p, miR-320a, and miR-483-5p– showed significant differences between the OP and control groups (Table  2). [score:1]
The pre-miRNA generates two mature miRNAs, miR-483-5p and miR-483-3p, both of them present in the bone and hOB profiles of this study, although only miR-483-5p showed significant differences between the control and OP groups. [score:1]
However, only miR-320a and miR-483-5p withstood BH multiple-testing correction (Fig.   3). [score:1]
[1 to 20 of 24 sentences]
7
[+] score: 68
Amongst these 7 human miRNAs, 1 was up-regulated in OA chondrocytes (hsa-miR-483-5p) and 6 were up-regulated in normal chondrocytes (hsa-miR-149*, hsa-miR-582-3p, hsa-miR-1227, hsa-miR-634, hsa-miR-576-5p and hsa-miR-641). [score:7]
In this regard, hsa-miR-576-5p was down-regulated in OA chondrocyte pellets with the highest fold (4.74) whereas hsa-miR-483-5p was up-regulated in OA chondrocyte pellets with 2.44 fold. [score:7]
The number of transcription proteins obtained as putative mRNA targets regulated by hsa-miR-145, hsa-miR-576-5p and hsa-miR-1227 were also high (18% to 19%), whereas secretory, membrane, surface or receptor proteins as predicted targets regulated by hsa-miR-149, hsa-miR-483-5p, hsa-miR-582-3p, hsa-miR-634 and hsa-miR-641 were also elevated (15 to 19%). [score:7]
Of the 7 miRNAs differentially expressed, and the hsa-miR-145, the largest number of predicted putative targets included binding proteins (21 to 25%) except for the hsa-miR-483-5p whose largest number of putative targets included enzymes (18%). [score:7]
Amongst these 7 human miRNAs, 1 was up-regulated in OA chondrocytes (hsa-miR-483-5p) and 6 were up-regulated in normal chondrocytes in comparison to OA chondrocytes (hsa-miR-149*, hsa-miR-582-3p, hsa-miR-1227, hsa-miR-634, hsa-miR-576-5p and hsa-miR-641) (Figure 2 B and C). [score:7]
Because hsa-miR-145 showed elevated expression in OA chondrocytes, although it was not statistically significant, and it was previously published in the literature to be upregulated, together with hsa-miR-483, in osteochondromas compared to normal cartilage [40], we decided to select it for qPCR verification. [score:5]
These authors found that hsa-miR-483-5p was upregulated in OA cartilage, not only by analysis but also by qPCR techniques. [score:4]
Of particular interest was the finding that hsa-miR-483-5p was up-regulated in OA chondrocyte micropellets as previously described Iliopoulus et al., [15]. [score:4]
In this regard, hsa-miR-145 and hsa-miR-483-5p were also up-regulated in OA chondrocyte micropellets, in particular 4.4 and 8.45 fold respectively, according with the results obtained in the analysis. [score:4]
These findings are in agreement with our and qPCR results since we observed an upregulation of hsa-miR-483-5p in OA chondrocyte micropellets with the highest fold (8.45) obtained by qPCR. [score:4]
On the other hand, Zuntini et al. [40] also verified that hsa-miR-145 and hsa-miR-483 are both upregulated in osteochondromas when they are compared to normal cartilage. [score:3]
We selected the hsa-miR-149, hsa-miR-483-5p, hsa-miR-582-3p, hsa-miR-634 and hsa-miR-641 differentially expressed for further quantification using quantitative PCR techniques (Figure 4). [score:3]
A recent study postulated that aberrant expression miR-483-5p together with miR-195 allow the identification of a subset of poorer prognosis adrenocortical carcinomas [49]. [score:3]
PCR amplification of microRNAs (hsa-miR-145, hsa-miR-149, hsa-miR-483-5p, hsa-miR-582-3p, hsa-miR-634 and hsa-miR-641; as annotated in the miRBase ver 10.0 and 11.0) was carried out on the LightCycler® 480 Instrument (Roche, Mannheim, Germany) using miRCURY LNA [TM] microRNA PCR System (Exiqon, Vedbaek, Denmark). [score:1]
Moreover, Patterson et al. [50] found that the high expression of miR-483-5p appears to be a defining characteristic of adrenocortical malignancies, indicating that it can thus be used to accurately distinguish between benign and malignant adrenocortical tumors. [score:1]
Some of these selected miRNAs (e. g. hsa-miR-145 and hsa-miR-483-5p) have already been described in the literature [15, 40, 48]. [score:1]
[1 to 20 of 16 sentences]
8
[+] score: 53
The expression of miR-223, miR-483-3p (p-value = 0.01), 146b, 205 (p-value = 0.001), 221, 21 (p-value = 0.023), 195, 34c and miR-26a (p-value = 0.0078) were significantly upregulated, whereas the expression of miR-216, miR-141, miR-217, Let-7b (p-value = 0.001), and Let-150 (p-value = 0.01) were significantly downregulated in human PC tissues as compared to the cancer-adjacent normal tissues (Figure 3E). [score:10]
At 40 weeks of age, the expression of miR-216, miR-217, miR-223, miR-141, miR-483-3p (p-value = 0.031), miR-195, Let-7b (p-value = 0.063) and miR-96 were significantly downregulated; on the other hand, the expression of miR-21, miR-205, miR-146b (p-value = 0.031), and miR-34c (p-value = 0.063) were upregulated in KC mice compared to the control animals (Figure 2C). [score:10]
The panel of differentially expressed miRNAs were validated by real-time PCR using TaqMan assays, and the results were consistent with the data that showed up-regulation of miR-21, miR-221, miR-100 and miR-26a and down-regulation of miR-26b, miR-141, miR-96, miR483-3p, miR-216, and miR-217 in the KC compared to control mice (Figure 1A). [score:7]
Furthermore, they showed that ectopic expression of miR-483-3p significantly inhibited the expression of DPC4/Smad4 protein in PC cell lines, leading to increased cell proliferation and colony formation in vitro [53, 54]. [score:7]
We have shown that in tumor samples compared to normal samples, the majority of miRNAs (miR-216, miR-217, miR-100, miR-345, miR-141, miR-483-3p, miR-26b, miR-150, Let-7b, Let-195 and miR-96) were downregulated, and few were upregulated (miR-146b, miR-205, miR-31, miR-192, miR-194 21, miR-379, miR-431, miR-541, and miR-199b). [score:6]
A decreased expression of miR-483-3p was observed during the progression of mouse PC, whereas it is overexpressed in human PC (Figure 2A– 2D and 3E). [score:5]
Further, at 50 weeks of age, the expression of miR-216, miR-217, miR-345, miR-141, miR-483-3p, miR-26b, miR-96, Let-7b (p-value = 0.01), miR-100, miR-26a and miR-150 (p-value = 0.094) were further downregulated in KC animals compared to control mice (Figure 2D). [score:5]
These results are in agreement with previous reports that show miR-483-3p upregulation in PC tissue compared to the cancer adjacent normal tissue [53, 54]. [score:3]
[1 to 20 of 8 sentences]
9
[+] score: 47
The overexpression of miR-483-5p suppressed glioma cell proliferation and induced a G0/G1 arrest, whereas miR-483-5p inhibition promoted cell proliferation, suggesting that miR-483-5p serves as a tumour suppressor [22]. [score:9]
Among the fifteen miRNAs in the top group, two miRNAs were highly likely to be upregulated, i. e., hsa-miR-24and hsa-miR-885-5p, whereas thirteen miRNAs were highly likely to be downregulated, i. e., hsa-miR-26b, hsa-let-7b, hsa-miR-185, hsa-miR-142-3p, hsa-miR-29b, hsa-miR-483-5p, hsa-miR-144*, hsa-miR-145*, hsa-miR-629*, hsa-miR-222*, hsa-miR-497, hsa-miR-675 and hsa-miR-106b*, in the eutopic endometrium of patients with endometriosis compared with the controls (Table 2). [score:6]
It has been demonstrated that IGF2 promoted angiogenesis through the IGF2 receptor (IGF2R) system in vascular endothelial cells, and miR-483-5p overexpression in endothelial cells blocked angiogenesis, while the inhibition of miR-483-5p increased this process [21]. [score:5]
The obtained results also suggest that lower levels of hsa-miR-483-5p and hsa-miR-629* expression in the proliferative eutopic endometrium contribute to or result from the elevated biological activity of advanced disease. [score:5]
Validation using real-time PCR showed that hsa-miR-483-5p (p = 0.012) and hsa-miR-629* (p = 0.02) are significantly downregulated in patients with endometriosis. [score:4]
Recently, it was shown that miR-483-5p was significantly downregulated in gliomas. [score:4]
Because the eutopic endometrium of patients with endometriosis shows features of increased angiogenesis [23], it cannot be excluded that the inhibition of miR-483-5p might lead to the subsequent augmentation of new vessel formation in the ectopic lesion. [score:3]
It was previously revealed that miR-483-5p could be coexpressed with its host gene, therefore playing a biological role as a functional partner of IGF2 [20]. [score:3]
Specifically, hsa-miR-483-5p (p = 0.012) and hsa-miR-629* (p = 0.02) were downregulated, as shown after the initial analysis of cards A and B in patients with endometriosis, showing 1.39 (0.19-7.6) and 1.58 (0.44-3.35), respectively, for the two miRNAs compared with the controls, showing 2.4 (0.15-16.2) and 2.02 (1.4-52), respectively. [score:3]
In the present study, we demonstrated that two miRNAs, i. e., hsa-miR-483-5p and hsa-miR-629*, showed lower expression in the eutopic endometrium of women with advanced ovarian endometriosis compared with control subjects. [score:2]
Recently, miR-483-5p, a conserved sequence encoded by intron 2 of IGF2 (insulin growth factor), was identified [17]. [score:1]
The expression of this miRNA has been characterised in different tissues [18, 19], but there are few reports concerning miR-483-5p function. [score:1]
573.031.6153.125.430.60.56−1.66−1.767hsa-miR-29b0.960.6466.849.341.730.9655.895.780.550.59−1.79−1.688hsa-miR-483-5p0.750.5876.8022.551.340.7656.758.290.560.43−1.77−2. [score:1]
[1 to 20 of 13 sentences]
10
[+] score: 45
Two further studies on circulating microRNAs in unfractionated serum samples from adrenocortical tumor patients have been reported to date 8, 9. Overexpressed circulating hsa-miR-483-5p in ACC has been confirmed in both, along with overexpressed hsa-miR-34a [9] and underexpressed hsa-miR-195 [8]. [score:7]
In our previous study on unfractionated plasma samples, we have found significant overexpression of 5 circulating miRNAs (hsa-miR-483-5p, hsa-miR-100, hsa-miR-181b, hsa-miR-184, hsa-miR-210) in ACC relative to ACA [10]. [score:3]
Hsa-miR-101 was expressed in 1 of 6 ACA and 5 of 6 ACC samples, whereas hsa-miR-483-5p in 2 of 6 ACA and in all ACC samples. [score:3]
Among these, the overexpression of hsa-miR-483-5p has been described both in tissue and in blood of patients suffering from ACC 7– 9, 34, 35. [score:3]
The significant overexpression of hsa-miR-483-5p relative to cel-miR-39 in ACC has been also confirmed by testing EVs isolated by differential ultracentrifugation, confirming the EV-association of this miRNA. [score:3]
We have found significant overexpression of hsa-miR-101 (Fig.   4a) and hsa-miR-483-5p (Fig.   4b) and in ACC relative to ACA plasma EV samples (p < 0.0001 and p < 0.0052, respectively). [score:3]
We have found significanty higher expression of hsa-miR-483-5p in exosomes in ACC relative to ACA (p = 0.0221, Fig.   6). [score:3]
Furthermore, circulating hsa-miR-483-5p could represent not only a diagnostic marker, but a prognostic marker, too, since its expression predicts poor prognosis and cancer reccurence [8]. [score:3]
The overexpression of hsa-miR-483-5p and hsa-miR-101 in ACC has been confirmed in the validation cohort. [score:3]
In a previous study, we demonstrated that the expression of circulating hsa-miR-483-5p was not influenced by treatments with dexamethasone or adrenocorticotropin confirming that it could be potentially used in the preoperative diagnostic of ACC [36]. [score:3]
By using Fisher’s exact test, we evaluated miRNAs which were not expressed in all samples of a group and we found 2 miRNAs showing a tendency being different between ACA and ACC samples: hsa-miR-101 and hsa-miR-483–5p. [score:1]
Showing the highest AUC, specificity and sensitivity values, exosomal hsa-miR-483-5p could be a potential biomarker of adrenal malignancy using cel-miR-39 as reference gene. [score:1]
Raw and normalized qRT-PCR data are presented in Supplementary Dataset files  2 and 3. Figure 4Results of RT-qPCR validation of hsa-miR-101 (a) and hsa-miR-483-5p (b) normalized to the housekeeping cel-miR-39, (mean ± SD, **p < 0.01, ***p < 0.001; unpaired t-test; n = 18 ACA, n = 16 ACC. [score:1]
Soon PSH miR-195 and miR-483-5p Identified as Predictors of Poor Prognosis in Adrenocortical CancerClin. [score:1]
We have evaluated the expression of hsa-miR-483-5p in vesicles isolated by ultracentrifugation, as well. [score:1]
The dCT [hsa-miR-483-5p] relative to cel-miR-39 showed the highest area under curve (AUC) value (0.965). [score:1]
We have evaluated the expression of hsa-miR-483-5p in ACA and ACC patients relative to cel-miR-39 as reference. [score:1]
The best results reported by Chabre et al. for circulating hsa-miR-483-5p could only be used to differentiate aggressive and non-aggressive ACC [8]. [score:1]
Among these, hsa-miR-101 (002253) and hsa-miR-483-5p (002338) were selected for validation by real-time RT-qPCR on altogether 34 samples (18 ACA and 16 ACC patients). [score:1]
Both, hsa-miR-101 and hsa-miR-483-5p, relative to spike-in control cel-miR-39 have been analyzed by ROC analysis. [score:1]
Figure 6Results of ultracentrifugation with RT-qPCR of hsa-miR-483-5p normalized to the spike-in control cel-miR-39. [score:1]
[1 to 20 of 21 sentences]
11
[+] score: 42
We previously reported that LBW is associated with increased levels of miR-483-3p, which may lead to decreased adipocyte expandability through down-regulation of growth differentiation factor-3. This may contribute to insulin resistance through decreased lipid storage capacity resulting in increased circulating lipids and ectopic lipid storage [9]. [score:4]
However, the importance of miR-103, miR-143 and miR-483-3p in human glucose and lipid metabolism, and the relative impact of genetic and environmental factors in the regulation of their expression, are undisclosed. [score:4]
The level of IGF2, the host gene of miR-483-3p, is known to decline with age [19] and in accordance with this we observed decreased expression of miR-483-3p with increasing age. [score:3]
2008-0298 19324969 9. Ferland-McCollough D. Fernandez-Twinn D. S. Cannell I. G. David H. Warner M. Vaag A. A. Bork-Jensen J. Brons C. Gant T. W. Willis A. E. Programming of adipose tissue miR-483–3p and GDF-3 expression by maternal diet in type 2 diabetes Cell Death Differ. [score:3]
Figure 1Multivariate analyses were performed to study the association between (A) age, birth weight, BMI and sex and miR-103, miR-143 and miR-483-3p expression in adipose tissue from elderly twins and the association between (B) miR-103, miR-143 and miR-483-3p and 2 h glucose values after an oral glucose tolerance test, hemoglobin A1c (HbA1c), homeostatic mo del assessment of insulin resistance (HOMA-IR) and triglycerides shown for all subjects (black), dizygotic (DZ) twins (blue) and monozygotic (MZ) twins (orange). [score:3]
Using SAT biopsies from a unique cohort of 244 elderly MZ and DZ twins, we estimated the genetic influence on the expression of miR-483-3p, miR-103 and miR-143, and found low heritability estimates. [score:3]
In conclusion, we have demonstrated that the expression levels of miR-483-3p, miR-103 and miR-143 in SAT are mainly influenced by age, obesity and birth weight in a non-genetic manner. [score:3]
We also found elevated expression levels of miR-483-3p in adipose tissue from young men born with low birth weight (LBW) [9] who have a pre-diabetic phenotype [10, 11]. [score:3]
We have previously demonstrated involvement of miR-483-3p in adipocyte development and storage capability in vitro. [score:2]
Thus, miR-483-3p could be an important link between poor intrauterine environment and later development of T2D. [score:2]
miR-483-3p: An increase of one SD (~10%) in miR-483-3p levels was borderline significantly associated with a 1% increase in HbA1c (p = 0.06). [score:1]
Birth weight: We found a trend towards an association between miR-483-3p levels; a ~450 g increase in birth weight was associated with a 24% decrease in miR-483-3p levels. [score:1]
We evaluated the associations between age, sex, birth weight and BMI; and the expression levels of miR-483-3p, miR-103 and miR-143 (Figure 1A). [score:1]
This may indicate a role in glucose metabolism, but as we did not find the expected association between miR-483-3p expression levels and HOMA-IR as a measure of insulin resistance, further studies will be needed to understand the specific role of this miRNA in human metabolism. [score:1]
There were no differences or associations between zygosity and miR-143 or mir-483-3p levels. [score:1]
In our current study of elderly twins, we found the same trend in the association between miR-483-3p and birth weight although it did not reach statistical significance. [score:1]
miR-483-3p was not statistically significantly associated with 2 h glucose levels, triglycerides or HOMA-IR in the total cohort. [score:1]
The interclass correlations for MZ and DZ twins were not significantly different for any of the miRNAs and all heritability estimates were low (0.21, 0.12 and ~0 for miR-483-3p, miR-143 and miR-103 respectively). [score:1]
In the MZ twins, increased miR-483-3p levels were associated with increased HbA1c values. [score:1]
We evaluated the associations between glucose metabolism (2-hour (2 h) glucose from an OGTT and hemoglobin A1c (HbA1c)), insulin resistance (HOMA-IR) and lipid metabolism (triglyceride levels); and miR-483-3p, miR-103 and miR-143 expression levels (Figure 1B). [score:1]
Age: We found that a ~5 year increase in age was associated with a ~33% decrease in miR-483-3p levels (p = 0.05) and with a 77% increase in miR-143 levels (p = 0.02). [score:1]
Importantly, using twins gives us a unique opportunity to explore the relative influence of genetic versus environmental factors on the levels of miR-483-3p, miR-103 and miR-143 in human SAT. [score:1]
[1 to 20 of 22 sentences]
12
[+] score: 39
Thus, we selected these five miRNAs for further confirmation (Table  1) and found that expression of hsa-miR-337-3p and miR-508-5p was four times greater in the primary cancer tissues compared to the metastatic gastric cancer tissues, while miR-483-5p expression was 2.6 times greater, miR-30c expression was 2.14 times greater, and miR-134 expression was 4.9 times greater in the primary cancer tissues compared to the metastatic gastric cancer tissues (Table  1). [score:7]
For example, Patterson et al. showed that altered expression of miR-483-5p is associated with malignant pheochromocytoma after analyzing miRNA expression in benign and malignant pheochromocytoma tumor samples [18]. [score:5]
Taqman gene expression assays (Applied Biosystems) were used to assess expression levels of hsa-miR-508-5p, hsa-miR-337-3p, hsa-miR-30c, hsa-miR-483-5p, hsa-miR-134, and U6 in tissues or cultured cells by the 7900HT fast real-time PCR system (Applied Biosystems, Darmstadt, Germany). [score:4]
Among these five confirmed differentially expressed miRNAs, only miR-483-5p had been previously reported to be associated with human cancer development. [score:4]
Our data showed differential expression of hsa-miR-508-5p, hsa-miR-483-5p, hsa-miR-134, hsa-miR-30c, and hsa-miR-337-3p in these 16 paired samples (Figure  1), while expression levels of hsa-miR-337-3p and hsa-miR-134 were significantly reduced in the metastatic tissues compared to the primary gastric cancer tissues (Table  1). [score:4]
Among these five miRNAs (i. e., hsa-miR-508-5p, hsa-miR-30c, hsa-miR-337-3p, hsa-miR-483-5p, and hsa-miR-134), expression of hsa-miR-337-3p and hsa-miR-134 was significantly downregulated in these 16 lymph node metastatic tissues compared to their primary tumor tissues (P<0.05) and in nine gastric cancer cell lines compared to the nonmalignant GES cell line. [score:4]
Using microarray analysis, qPCR confirmation, and Kaplan-Meier analysis, upregulation of miR-483-5p was found to be significant between adrenocortical carcinomas and adrenocortical adenomas [19]. [score:4]
Specifically, expression of hsa-miR-508-5p, hsa-miR-483-5p, hsa-miR-134, hsa-miR-30c, and hsa-miR-337-3p was reduced in all three metastatic cancer tissues. [score:3]
Differential expression of hsa-miR-508-5p (A), hsa-miR-483-5p (B), hsa-miR-134 (C), hsa-miR-30c (D), and hsa-miR-337-3p (E) in 16 paired samples of primary gastric cancer (GC) and the corresponding metastatic lymph node tissues (LN) as determined by qRT-PCR. [score:3]
Figure 1 hsa-miR-508-5p, hsa-miR-483-5p, hsa-miR-134, hsa-miR-30c, and hsa-miR-337-3p in primary gastric cancer and the corresponding metastatic lymph node tissue. [score:1]
[1 to 20 of 10 sentences]
13
[+] score: 30
Other miRNAs from this paper: hsa-mir-493
Using well studied oncogenes MYC and EVI-1, which exhibit strong recombination- and mutation-prone functions (which are often associated with human malignancies) as examples, we demonstrated that pTTS, TFBS, and miRNA targets and several other regulatory elements could be synergistically involved in co-modulation of the promoter regions of MYC and EVI-1. TTS mapping reveals that a high-complementary evolutionarily conserved polypurine and polypyrimidine motif pair linked by the non-conserved short sequence, form miR-483 precursor. [score:5]
We suggest that R-Y TTS pair forming a natural DNA -RNA triplex within precursor mir-483 transcribing from the second intron of IGF2 gene might be an important target for endogenous regulation of the functions of this ncRNA in the human cells. [score:4]
However, the possibility of mir-483 to form triplex structures (RNA-DNA-DNA or DNA-DNA-DNA) and the possibility of CRD-BP/IMP1 protein to interact with mRNA of IGF2 gene might play an important role in our understanding of the specific control of IGF2 and mir-483 precursor expression. [score:3]
Additionally, TTS mapping exhibits trimethylation of hystone 3 lysine in the position 27 (H3K27met3) and an absent of trimethylation of hystone 3 lysine in position 4 (H3K4met3) of IGF2 gene region observed in several cancer cell types, which suggests that transcription of the both IGF2 gene and mir-483 is suppressed. [score:3]
In particular, TTS Mapping reveals complex structural-functional regulatory module of gene IGF2 including TF MZF1 binding site and ncRNA precursor mir-483 formed by the high-complementary and evolutionarily conserved polypurine- and polypyrimidine-rich DNA pair. [score:2]
Predictions of miR-483, in addition to human, rat and mouse, also were made for dog, cow, horse and rabbit http://people. [score:1]
For instance, figure 9A shows an overlapping between miRNA precursor, hsa-mir-483, located in intron 2 of short isoform of IGF2 gene. [score:1]
Figure 9B also shows the location of transcript polypurine or polypyrimidine sequences in intron 2 on the secondary structure of the siRNA derived from intron 2. DNA sequence TTCCATCACG, the linker between polypurine (GAGGGGGAAGACGGGAGGAAAGAAGGGAGTGG) and polypyrimidine (CTCTCCTCTTCTGCCCTCCTCTCCTCACTCCTCC) sequences of mir-483 precursor, forms a non-complimentary head of the RNA harping loop (UUCCAUCACG). [score:1]
So, miR-483 DNA precursor is strongly conserved across many mammals and contains a high-complementary polypurine and polypyrimidine motif pair linked by a short low-conserved sequence forming hairpin loop of secondary structure of this ncRNA. [score:1]
Figure 9B shows secondary structure of miRNA precursor (hsa-mir-483) which includes polypurine and polypyrimidine sequences within a region of the mature siRNA. [score:1]
A: Mapping on primary miRNA (hsa-mir-483) and pTFO on the evolutionally conserve intronic region of IGF2 gene. [score:1]
For instance, the TTS-rich regions included into intron 2 of IGF2 gene covers the mir-483 precursor region. [score:1]
B: secondary structure of primary miRNA (hsa-mir-483). [score:1]
In addition, miR-483 was annotated in mouse and rat by sequence similarity in mirBase [38, 39]. [score:1]
Hsa-miR-483 was also detected by RNAz but was not in the input set for EvoFold [41]. [score:1]
TTS mapping reveals that a high-complementary and evolutionarily conserved polypurine and polypyrimidine DNA sequence pair linked by a non-conserved short DNA sequence can form miR-483 transcribed from intron 2 of IGF2 gene and bound double-strand nucleic acid TTSs forming natural triplex structures. [score:1]
Originally, miRNA hsa-miR-483 was located in chromosome 11 and was identified by [37] in fetal liver in human. [score:1]
Data on negative nucleosome occupancy of evolutionarily conserved TTSs in the mir-483 precursor region (Figure 9), exhibited in USCS viewer, support our hypothesis. [score:1]
[1 to 20 of 18 sentences]
14
[+] score: 30
According to our results that miR-483-3p upregulated in the chronic group compared to in the control group and that there was no expression in the acute group is remarkable. [score:5]
One increased miRNA (miR-885-5p) that targets genes of immunologically effective pathways is shown in Fig 2. Other increased miRNAs (miR-483-3p and miR-328) that target genes of immunologically effective pathways are shown in Figs 3 and 4, respectively. [score:5]
The predicted target genes of miRNAs that uniquely expressed in the chronic cases, including miR-885-5p, miR-483-3p, and miR-328, were analysed. [score:5]
Ni et al. showed that miR-483-3p is identified as a critical regulator of the expression of Insulin-like growth factor 1 (IGF-1) in natural killer cells [65]. [score:4]
Among the 28 miRNAs, the miR-483-3p upregulated in the chronic group in comparison to the control group. [score:4]
These findings indicate that miR-483-3p is a regulator of natural killer cell functions [65]. [score:2]
High miR-483-3p levels blockade IGF-1 and reduce natural killer cell cytotoxicity. [score:1]
Pathway analysis of miR-483-3p according to KEGG function annotations. [score:1]
0198659.g004 Fig 4 The results showed that 165 predicted genes were annotated by miR-483-3p. [score:1]
The results showed that about 312 predicted genes were annotated by miR-483-3p. [score:1]
0198659.g004 Fig 4The results showed that 165 predicted genes were annotated by miR-483-3p. [score:1]
[1 to 20 of 11 sentences]
15
[+] score: 29
This effect could be reinforced by the downregulation of mmu-miR-672, which potentially targets PHB2, a factor that restrains estrogen action and its activating pathway [65] and by repression of mmu-miR-483 that could be responsible for the observed upregulation of GMNN, an inhibitor of HOX -dependent transcriptional activity [66]. [score:11]
The expression of mmu-miR-483 and -672 was downregulated at ST as compared to the PBS -treated mice while the levels of mmu-miR-223 and -146b were increased. [score:5]
GMNN, which negatively regulates cell cycle, and MKI67, which is an endogenous marker of proliferative cells, are putative targets of mmu-miR-483. [score:4]
To our knowledge, only miR-483 has been previously associated to a specific disease or a physiological state and was found to be significantly correlated with cardiac hypertrophy [52]. [score:3]
Transient transfection analysis for luciferase reporter expression with Arid4b, Il-6 or Lpin2 3′UTR in the presence of miR-223; with Gmnn, Nola2 or Ube2c 3′UTR in the presence of miR-483; with Dera or Nusap1 3′UTR in the presence of miR-574-5p; with Cd3g or Phb2 3′UTR in the presence of miR-672; and with Fst, Ctse or Cdca8 3′UTR in the presence of miR-690. [score:3]
These modulations could result from the simultaneous regulation of the levels mmu-miR-483 (see Figure 5), -672 and -146b. [score:2]
Among the 17 others miRNA-mRNA pairs that were evaluated (Figure 4E-H and Figure 5), significant inhibition was observed in 10 experimental conditions (miR-29c and Ctsk; miR-146b and Scube2; miR-483 and Nola2 or Ube2c; miR-672 and Phb2; miR-223 and Il6 or Lpin2 or Arid4b; miR-690 Fst or Ctse). [score:1]
[1 to 20 of 7 sentences]
16
[+] score: 25
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
Moreover, the pony serum specific miR-483, also significantly upregulated in ponies (FDR = 4.15e-8), has been shown to be upregulated in patients with adrenocortical cancer [48, 49]. [score:7]
Interestingly, among these serum-specific miRNAs expressed solely in ponies was eca-miR-483 that was expressed at >100 cpm on average (Table  1, Additional file 3: Table S2). [score:5]
The increased expression of eca-miR-483 in ponies relative to Warmblood suggested an increased predisposition to metabolic diseases in ponies. [score:5]
A total of 50 miRNAs in serum proved to be potential biomarkers to differentiate specific breed types, of which miR-122, miR-200, miR-483 were over-expressed and miR-328 was under-expressed in ponies compared to Warmbloods. [score:4]
This may suggest that eca-miR-483 might potentially increase the predisposition to metabolic diseases in ponies. [score:3]
For instance, miR-208, miR-302 (a-d), miR-367 were not detected (at >10 cpm on average) in the heart tissue; miR-134 and miR-208a were not detected in skeletal muscles; miR-483 in liver; or miR-483 and miR-377 in bone [36]. [score:1]
[1 to 20 of 6 sentences]
17
[+] score: 20
S1 Table Functional gene ontology (GO) annotation study for biological process conducted on the list of putative targets obtained for miRNAs de-regulated in DC after Mtb infection, namely miR-155-5p, miR-155-3p, miR-29b-1-5p, miR-150-5p, miR-146a-5p, miR-212-5p and miR483-5p. [score:4]
Functional gene ontology (GO) annotation study for biological process conducted on the list of putative targets obtained for miRNAs de-regulated in DC after Mtb infection, namely miR-155-5p, miR-155-3p, miR-29b-1-5p, miR-150-5p, miR-146a-5p, miR-212-5p and miR483-5p. [score:4]
Gene Ontology annotation for the list of putative targets of miR-155, miR-155*, miR-29b-1*, miR-150, miR-146a, miR-212 and miR-483-5p was obtained from miRWalk (http://www. [score:3]
In addition to miR-155, we identified several others miRNAs induced in Mtb infected DC, as miR-155*, miR-29b-1*, miR-150, miR-146a, miR-212 and miR-483-5p, whose expression was also found altered in patients affected by pulmonary TB [14– 28]. [score:3]
Interestingly, among miRNAs de-regulated in TB patients and validated by real time PCR or similar techniques [14– 28], seven miRNAs—namely miR-155, miR-155*, miR-29b-1*, miR-150, miR-146a, miR-212 and miR-483-5p –were found altered in Mtb-infected DC (Figs 1 and 2A). [score:2]
In particular, by taking advantage of the performed GO analysis, we noticed that, while miR-29b-1*, miR-150, miR-212 and miR-483-5p showed an enrichment in GO terms important for host-response to Mtb infection such as ubiquitin, proteasome degradation and endocytosis, only miR-155, miR-155* and miR-146a displayed a significant enrichment in biological processes linked to autophagy, a process deeply implicated in Mtb infection control [29, 30] (S2 Table). [score:1]
On the contrary, although miR-29b-1*, miR-150, miR-212 and miR-483-5p induction was confirmed by q-PCR experiments, their kinetic of induction does not perfectly mirror that showed by microarray analysis (Figs 1 and 2). [score:1]
Furthermore, microarray data indicated that Mtb induced miR-29b-1*, miR-150, miR-212 and miR-483-5p at early time points (3 and 8 hours) (Figs 1 and 2A). [score:1]
MiR-150 and miR-212 induction was maintained over time, while 24 hour post-infection, miR-29b-1* decreased and miR-483-5p peaked (Fig 2A). [score:1]
[1 to 20 of 9 sentences]
18
[+] score: 19
The finding of increased miRNA-483-5p in OA chondrocytes is in line with the results of Iliopoulos et al., who reported that miRNA-483 appeared to be up-regulated in diseased cartilage derived from OA patients [70]. [score:6]
A microarray -based, large-scale analysis identified the signatures of six miRNA, of which levels are increased in normal chondrocytes of human origin relative to OA chondrocytes (miRNA-1227, miRNA-576-5p, miRNA-149*, miRNA-634, miRNA-641, and miRNA-582-3p) and a single miRNA, namely miRNA-483-5p, which is selectively up-regulated in OA chondrocytes [108]. [score:4]
Qi Y. Ma N. Yan F. Yu Z. Wu G. Qiao Y. Han D. Xiang Y. Li F. Wang W. The expression of intronic miRNAs, miR-483 and miR-483*, and their host gene, IGF2, in murine osteoarthritis cartilage Int. [score:3]
Intriguingly, a negative correlation among miRNA-483 and the expression of TGF-β, as well as those of the TGF-β superfamily member bone morphogenic protein 7 (BMP7) in murine experimental OA, has been reported. [score:3]
Elevated expression of miRNA-483 was demonstrated to be another characteristic feature of OA, which was validated using Northern blotting [70]. [score:1]
The levels of both miRNA-483 and miRNA-483*, which reside within an intronic region of the insulin-like growth factor 2 (IGF2) locus, undergo an increase upon surgical intervention in an animal mo del of OA, and, hence, they are thought to be pathogenetically implicated in OA, irrespective of IGF2 [104]. [score:1]
On the contrary, a positive correlation among miRNA-483 and MMP-13 in an experimental mouse mo del of OA has been found, implying the role of miRNA-483 in OA pathogenesis [104]. [score:1]
[1 to 20 of 7 sentences]
19
[+] score: 18
There were no microRNAs regulated after 1 hour in culture, however after 4 hours in culture miR-491-3p, miR-34b, miR-595, miR-328 miR-1281 and miR-483-3p were significantly upregulated, with none being downregulated. [score:8]
However, after 4 hours in culture, significant upregulation was seen for miR-491-3p, miR-34b, miR-595, miR-328, miR-1281 and miR-483-3p, with no microRNAs being significantly downregulated. [score:7]
It is also interesting to note that the anti-apoptotic BCL-2 family member Mcl-1, which plays a significant role in regulating neutrophil lifespan, contained 1 binding site for miR-483-3p. [score:2]
MiR-328 is in intron 12 on the opposite strand of the ELMO3 gene, miR-483-3p is within the 3′UTR on the opposite strand of IGF2, while miR-595 is in intron 1 of PTRN2. [score:1]
[1 to 20 of 4 sentences]
20
[+] score: 17
Ten miRNAs were used for further in silico validation: one predicted by using above programs with elevated expression in microarray analysis (hsa-miR-574-3p; miRBase accession number: MIMAT0003239) and nine up-regulated in microarray analysis but not predicted by the algorithms used (hsa-miR-122, hsa-miR-199a-3p, hsa-miR-140-3p, hsa-miR-320a, hsa-miR-320b, hsa-miR-320c, hsa-miR-320d, hsa-miR-483-5p, hsa-miR-574-5p; miRBase accession numbers: MIMAT0000421, MIMAT0000232, MIMAT0004597, MIMAT0000510, MIMAT0005792, MIMAT0005793, MIMAT0006764, MIMAT0004761, MIMAT0004795, respectively). [score:6]
Other up-regulated and in silico validated miRNAs were miR-199a, four members of miR-320 family and miR-483. [score:4]
Free-energy of binding and flanking regions (RNA22, RNAfold) was calculated for 10 up-regulated miRNAs from microarray analysis (miR-122, miR-320a/b/c/d, miR-574-3p/-5p, miR-199a, miR-140, and miR-483), and nine miRNAs deregulated from microarray analysis were used for validation with qPCR (miR -21, miR-122, miR-126, miR-1, miR-133, miR-125a/b, and miR-98). [score:3]
miR-483 was described as in vitro regulator of angiogenesis through serum response factor [31]. [score:2]
2−4.7−9.865-86partially (1–4) −23.7−8.2−8.2687-708no −21.8−9.1−11.9123-144partially (1–6) miR-320c−19.1−8.00.3800-819no −24.0−12.4−8.2689-708no −21.1−11.4−9.2650-669no miR-320d−23.4−13.2−8.2690-708no −24.3−12.2−9.0709-727partially (1–4, 6–7) miR-483-5p−23.8−13.1−9.0705-726no −21.8−4.7−8.563-84no −22.7−9.1−9. [score:1]
1−12.3−11.4508-526partially (1–4, 7–8) −19.2−6.4−5.3714-732no miR-483-5p−24.7−9.8−6.8122-143no −24.1−7.6−6.3708-729no miR-574-3p−27.8−8.6−5.3725-746yes −32.5−7.3−9.737-58partially (2–5, 7–13) miR-574-5p−22.7−7.3−11.0465-487yes −25.6−14.5−14.1664-686no −30.2−12.5−0.3740-762no −22.9−8.0−12.3413-435no −21.6−7.8−11. [score:1]
[1 to 20 of 6 sentences]
21
[+] score: 15
H19 is maternally expressed while IGF2 is paternally-expressed and harbors miR-483 within intron 2. Steck et al also reported elevated IGF2 levels in OA cartilage while levels of miR-483 were not described in this study. [score:5]
In our studies, we detected miR-483-5p expression in human embryonic chondrocytes, but only miR-483-3p was found to be differentially-expressed in precursor and differentiated chondrocytes when compared to hypertrophic chondrocytes (Tables 3 and 4 ). [score:4]
Also, expression levels of the 5p and 3p strands of miR-483 in PC and DC regions were similar suggesting that both mature strands are functional in chondrocytes. [score:3]
It will be interesting to further dissect how regulation of chondrocytes by H19/miR-675 and IGF2/miR-483 affects cartilage matrix production and maintenance. [score:2]
However, other studies have reported increased levels of miR-483-5p in OA cartilage [34], [86]. [score:1]
[1 to 20 of 5 sentences]
22
[+] score: 14
[14, 15] MiR-135a*, miR-188-5p, miR-663 and miR-483-5p were downregulated in plasma cell leukemia. [score:4]
Moreover, we report tumor suppressor functions of miR-198, miR-135a*, miR-200c, miR-663 and miR-483-5p in myeloma, that they reduced cell viability, migration and colony formation. [score:3]
[16] Moreover, miR-483-5p, miR-663 and miR-630 had been reported to have tumor suppressor properties in other cancers. [score:3]
MiR-155, miR-198, miR-200c, miR-483-5p and miR-663 significantly suppressed colony formation in MM cells (Figure 3B). [score:3]
At the same time, many other miRNAs were unmasked, including miR-125a-3p, miR-155, miR-135a*, miR-198, miR-200c, miR-188-5p, miR-630, miR-663 and miR-483-5p. [score:1]
[1 to 20 of 5 sentences]
23
[+] score: 13
Disease Origin References of iPSC lines Phenotype of iPSC-derived neurons miRNAs of interest Fragile X syndrome Loss of function of FMRP (FMR1 gene) Urbach et al. (2010), Sheridan et al. (2011) Hyper-excitability of glutamatergic synapses DICER and AGO-1 complexes Rett’s syndrome Loss of function of MeCP2 transcriptional repressor Marchetto et al. (2010), Kim et al. (2011c), Cheung et al. (2012) Decreased soma size, neurite atrophy, decreased efficiency of glutamatergic synapses miR-132, miR-184, miR-483-5p, miR-212 Schizophrenia Multifactorial Urbach et al. (2010); Brennand et al. (2011), Paulsen Bda et al. (2012), Robicsek et al. (2013) Diminished neuronal connectivity miR-17-5p, miR-34a, miR-107, miR-122, miR-132, miR-134, miR-137 Down’s syndrome Additional copy of chromosome 21 Briggs et al. (2013), Weick et al. (2013) Reduced synaptic activity, increased sensitivity to oxidative stress miR-99a, miR-125b, miR-155, miR-802, Ret 7c Micro -RNAs, as fine regulators of protein translation, influence directly the level of gene expression. [score:9]
Disruption of MeCP2 gene in mice leads to the dysregulation of a set of miRNA potentially of influence in neurogenesis including miR-132, miR-184, miR-483-5p, and miR-212 (Nomura et al., 2008; Im et al., 2010; Urdinguio et al., 2010; Han et al., 2013). [score:2]
Human-specific regulation of MeCP2 levels in fetal brains by microRNA miR-483-5p. [score:2]
[1 to 20 of 3 sentences]
24
[+] score: 11
In our previous studies, to find candidate regulators of the IGF-1 gene in human NK cells, we assessed miRNA expression in human primary lymphocytes (dNK, cNK, pNK, NKT, and T cells) with miRNA microarray analysis, and found that miR-483-3p functions as a critical regulator of human NK cell cytotoxicity by directly targeting IGF-1 29. [score:8]
These stringent criteria were met by 7 miRNAs that were specifically up-regulated in NK cells compared to NKT and T cells (miR-340-3p, miR-210, miR-199a-3p, miR-483-3p, miR-130a-3p, miR-199b-5p, and miR-362-5p) (Fig. 1e). [score:3]
[1 to 20 of 2 sentences]
25
[+] score: 11
The study found a ratio of upregulated miR-122 and downregulated miR-483-3p to reliably predict hepatotoxicity. [score:7]
The figure presents serum levels, based on normalized sequencing reads, of significantly altered miRNAs in APAP, HBV, LC, T2DM an HC for miR-122-5p, miR-192-5p, miR-483-5p and miR-194-5p (A) and miR-221-5pp, miR-222-3p, miR-375 and miR-885-5p (B). [score:1]
Among these the liver -associated miRNAs miR-122-5p, miR-192-5p, miR-483-5p and miR-194-5p were strongly elevated in the serum of APAP patients (Fig 4A). [score:1]
However, in our study, the serum levels of miR-483-3p were not affected by APAP -induced liver injury, while miR-483-3p was significantly decreased in the serum of subjects with T2DM. [score:1]
0177928.g004 Fig 4 The figure presents serum levels, based on normalized sequencing reads, of significantly altered miRNAs in APAP, HBV, LC, T2DM an HC for miR-122-5p, miR-192-5p, miR-483-5p and miR-194-5p (A) and miR-221-5pp, miR-222-3p, miR-375 and miR-885-5p (B). [score:1]
[1 to 20 of 5 sentences]
26
[+] score: 10
We identified 3 significantly down-regulated miRNAs (miR-378-3p, miR-483-5p and miR-497-5p) and 1 up-regulated miRNA (miR-222-3p) (Figure 1B), which had > 2-fold differences of expression levels between angiosarcoma and hemangioma (Figure 1B). [score:9]
Among them, 5 selected tumor relevant miRNAs (miR-378-3p, miR-483-5p and miR-497-5p, miR-222-3p and miR-126-3p) were validated with semiquantitative RT-PCR in all 27 angiosarcoma and 15 hemangioma samples. [score:1]
[1 to 20 of 2 sentences]
27
[+] score: 10
In agreement with the deep-sequencing findings, Q-PCR results confirmed the down-regulation of miR-133a, miR-378a-3p and miR-378a-5p, as well as the over -expression of miR-483-3p and miR-503-5p in the RMS tumour tissues (see Additional file 2: Figure S1A) and cells (see Additional file 2: Figure S1B). [score:6]
MiR-133a, miR-378a-3p, miR-378a-5p, miR-483-3p and miR-503-5p were selected as candidates to validate miRNA expression levels in Q-PCR using the eight deep-sequencing-analysed RMSs, seven additional tumour samples (3 ARMSs and 4 ERMSs) along with four different RMS cell lines (RH4 and RH30 ARMS cell lines; and RD and RD18 ERMS cell lines). [score:3]
Histograms indicate the mean value ± SD of independent samples (ARMS1-2-3-4-7-36-37 and ERMS1-2-3-4-12-21-23-27); (B) Relative fold change of miR-378a-3p, miR-378a-5p, miR-483-3p and miR-503-5p in RMS cell lines in comparison to NSM. [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 10
The most highly connected microRNAs in the network included miR-638, miR-18a-3p, miR-483-3p, miR-181d, and miR-30c, which had greater than 50 positively or negatively correlated predicted targets, suggesting that these microRNAs may be important regulators of gene expression associated with emphysema severity. [score:6]
Five of these microRNAs (miR-638, miR-181d, miR-18a-3p, miR-30c, and miR-483-3p) were correlated with ≥50 of their predicted targets, suggesting that these microRNAs may play a key role in gene regulation in emphysema. [score:4]
[1 to 20 of 2 sentences]
29
[+] score: 10
Fig.  3Human MECP2 3′-UTR The MREs for miR-483-5p (green) and miR-132-3p (red) and their locations in the 3′-UTR of MECP2 are marked (Color figure online) To predict miR-132-3p-regulated pathways, we extended our dataset to include proteins which could potentially be affected by miR-132-3p in an indirect manner. [score:3]
In this case (Han et al. 2013), miR-483-5p regulates specifically the long but not the short 3′-UTR variant of MECP2, and a miR-483-5p MRE is found only in the human variant. [score:2]
To examine a possible interaction between miR-132-3p and miR-483-5p regulation on MECP2, we checked the MREs of both miR-132-3p and miR-483-5p in the MECP2 3′-UTR, and found that they are distant enough to ensure that they are unlikely to compete with each other (the 3′-UTR sequence and MREs are presented in Fig.   3). [score:2]
Intriguingly, the MECP2 transcript was further found to be subject to regulation by the human-specific miR-483-5p. [score:2]
Furthermore, even when a predicted competition emerges with another miRNA, such as in the case of the MECP2 gene and miR-483, the spatial difference between the locations of the corresponding MREs makes such competition unlikely. [score:1]
[1 to 20 of 5 sentences]
30
[+] score: 10
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
control Expression in case group 1 hsa-mir-1290 0.26 down 2 hsa-mir-342-5p 0.22 down 3 hsa-mir-1224-5p 0.23 down 4 hsa-mir-345 0.38 down 5 hsa-mir-1228 0.38 down 6 hsa-mir-1249 0.32 down 7 hsa-mir-1826 0.26 down 8 hsa-miR-1306 0.38 down 9 hsa-miR-188-5p 0.43 down 10 hsa-miR-320a 0.48 down 11 hsa-miR-320c 0.26 down 12 hsa-miR-365 0.31 down 13 hsa-miR-423-5p 0.35 down 14 hsa-miR-483-5p 0.25 down 15 hsa-miR-634 0.31 down 16 hsa-miR-671-5p 0.23 down 17 hsa-miR-939 0.24 down 18 hsa-miR-1246 2.22 up 19 hsa-miR-150 10.41 up 20 hsa-miR-574-5p 8.04 up Table 3 MiRNAs Target Gene Symbol hsa-miR-345PUM2, PPP2R3A, BCAT1, ZFHX4, CHSY3, ARNT, SHE, SLC7A5, SOS1,. [score:5]
[1 to 20 of 2 sentences]
31
[+] score: 9
Of the 186 miRNAs the expression of which was altered, nine were up-regulated at both time points (miR-125a-3p, miR-297c, miR-421, miR-452, miR-483, miR-574-3p, miR-574-5p, miR-669a, miR-720) and 11 were down-regulated at both time points (let-7g, miR-107, miR-10a, miR-15a, miR-15b, miR-199b*, miR-26a, miR-29c, miR-324-5p, miR-331-3p, miR-342-3p). [score:9]
[1 to 20 of 1 sentences]
32
[+] score: 9
Treatment with 2-deoxy-D-glucose (2-DG), a glucose -mimic inhibitor of glycolysis, reduces miR-483-3p expression and increases sensitivity to 5-FU -induced apoptosis. [score:5]
In this sense, Pepe et al. showed in HepG2 hepatoblastoma cells that OGT stabilizes the transcriptional complex β-catenin/upstream stimulatory factor 1 (USF1) at the promoter of miR-483-3p, a microRNA responsible for transcription downregulation of PUMA [160]. [score:4]
[1 to 20 of 2 sentences]
33
[+] score: 9
Other miRNAs from this paper: hsa-let-7b, hsa-mir-15a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-100, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-221, hsa-mir-1-2, hsa-mir-15b, hsa-mir-30b, hsa-mir-122, hsa-mir-132, hsa-mir-141, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-195, hsa-mir-200c, hsa-mir-1-1, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-371a, hsa-mir-372, hsa-mir-373, hsa-mir-375, hsa-mir-151a, hsa-mir-429, hsa-mir-449a, hsa-mir-193b, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320b-2, hsa-mir-891a, hsa-mir-935, hsa-mir-1233-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-1275, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1973, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-1233-2, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Finally, hsa-miR-19b [47, 54] and hsa-miR-483-5p [47, 53], which are upregulated, and hsa-miR-28-5p [47, 53], hsa-miR-19a [48, 53] and hsa-miR-1973 [48, 51], which are downregulated, are expressed in spermatozoa, but they have not been associated with spermatogenesis or related processes. [score:9]
[1 to 20 of 1 sentences]
34
[+] score: 9
Both miR-483-5p and IGF are overexpressed in Wilms' tumours and sarcomas, and ectopic expression of miR-483-5p in sarcoma cells and mouse xenographs enhances tumourigenesis [132]. [score:5]
DHX9 cooperates with the miRNA miR-483-5p to induce IGF2 expression. [score:3]
It has been found to bind both the insulin-like growth factor 2 (IGF2) mRNA and miR-483p, a microRNA that enhances IGF2 transcription, promoting the miR-483-5p -mediated induction of IGF2 mRNA [132]. [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-28, hsa-mir-29a, hsa-mir-93, hsa-mir-100, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-34a, hsa-mir-181c, hsa-mir-182, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-217, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-134, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-106b, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-372, hsa-mir-382, hsa-mir-148b, hsa-mir-196b, hsa-mir-424, hsa-mir-448, hsa-mir-449a, hsa-mir-491, hsa-mir-501, hsa-mir-503, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320c-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320c-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Up-regulation of miR- 21, and some other miRNAs like miR-134, miR-320c, and miR-483-5p has been shown to inhibit the NF-κB and PI3K-Akt pathways thereby suppressing anti-viral effect in HCV-infected patients [63, 64]. [score:8]
[1 to 20 of 1 sentences]
36
[+] score: 8
In our own previous study we used different technique, based on TaqMan miRNA microfluidic cards and validated by TaqMan real-time PCR, and we found in similar samples that out of 667 miRNAs there are eventually two, that is, hsa-miR-483-5p and hsa-miR-629 [∗], which are significantly downregulated in patients with endometriosis [11]. [score:4]
In our recent study we also showed that, out of 667 miRNAs, two molecules, namely, hsa-miR-483-5p and hsa-miR-629 [∗], are significantly downregulated in eutopic endometrium of patients with ovarian endometriosis, which could be a consequence of an early defect in the physiological activity of the proliferative endometrium [11]. [score:4]
[1 to 20 of 2 sentences]
37
[+] score: 8
Importantly, the expression of miR-483-5p rescues abnormal dendritic spine phenotype of neurons overexpressing MeCP2. [score:5]
An intragenic miRNA of the imprinted IGF2 (miR-483-5p) regulates MeCP2 levels through a human-specific binding site in the MECP2 long 3'-UTR. [score:2]
There is an inverse correlation of miR-483-5p and MeCP2 levels in developing human brains and fibroblasts from BWS patients. [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 8
Other miRNAs from this paper: hsa-mir-21, hsa-mir-222, hsa-mir-122, hsa-mir-145
Additionally, it has been reported that IGF2 gene is a “carrier” for miR-483, an intronic micro -RNA (miRNA), which is able to stimulate cell proliferation in HCC, through the downregulation of its target Socs3 (suppressor of cytokine signaling 3) [95]. [score:8]
[1 to 20 of 1 sentences]
39
[+] score: 7
MiR-483-3p was shown to control skin keratinocyte growth arrest at the final steps of reepithelialization [47], miR-210 upregulation by hypoxia decreased keratinocyte proliferation and impaired the wound closure [48], and miR-205 affected corneal keratinocyte migration by downregulating lipid phosphatase SHIP2, which contributes to epithelial wound healing [27]. [score:7]
[1 to 20 of 1 sentences]
40
[+] score: 7
The upregulateds included miR-3180-5p, miR-3189-3p, miR-369-5p, miR-4283, miR-4287, miR-4323, miR-483-3p, miR-501-5p, and miR-552-3p (Table 1), and the downregulateds included miR-106b-5p, miR-17-3p, miR-374c-5p, and miR-543 (Table 1). [score:7]
[1 to 20 of 1 sentences]
41
[+] score: 7
Altered expression of miRNA-365, miRNA-483-5p, miRNA-22, miRNA-29c, miRNA-101, and miRNA-320 are reported in tuberculosis and affect the mitogen-activated protein kinases (MAPK) and transforming growth factor beta (TGF-β) signaling to develop tuberculosis infection (Zhang et al., 2013). [score:3]
MiRNA-378 and miRNA-101 target the MAPA1 signaling while miRNA-483-5p, miRNA-320, miRNA-22 affect AKT-3, and BCL9L signaling to develop tuberculosis infection (Zhang et al., 2013). [score:3]
Alteration in miRNA-378, miRNA-483-5p, miRNA-22, miRNA-29c, miRNA-101, and miRNA-320 are specific for pulmonary tuberculosis and non-tuberculosis infections. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
In another study, it has been found that two miRNAs, miR-132 and miR-320, were expressed at significantly lower levels in the follicular fluid of women with PCOS than in a group of healthy women, as can be seen in Figure 3. In addition, it has been evidenced that miR-132, miR-320, miR-520c-3p, miR-24, and miR-222 that are present in the follicular fluid regulate estradiol concentrations and miR-24, miR-193b, and miR-483-5p progesterone concentrations [52]. [score:4]
Moreover, Notch3 and MAPK3, the members of Notch signaling and ERK-MAPK pathway, were found to be directly regulated by miR-483-5p. [score:3]
[1 to 20 of 2 sentences]
43
[+] score: 7
At 6-hour post-infection, it was found that miR-483-3p was up-regulated (>3-fold, p<0.05) in H5N1 infected cells while miR-663 was found to be up-regulated (>1.5-fold, p<0.05) in H1N1 infected cells. [score:7]
[1 to 20 of 1 sentences]
44
[+] score: 7
Next, we selected representative miRNAs for secondary screening: those that activated the reporter in the -TNF screen (miR-517a, miR-517c), inhibited the reporter in the +TNF screen (miR-210, miR-375), or activated the reporter in both screens (miR-483). [score:3]
Two of these, miR-483 and miR-452*, were hits in both screens. [score:1]
Lastly, miR-483 potentiated signaling in both the -TNF (36-fold, P = 0.004) and +TNF (3.5-fold, P = 0.007) conditions relative to the respective negative controls (Figure 3, A and B). [score:1]
Interestingly, none of the validated hits from our +TNF secondary screen (miR-210, miR-375 or miR-483) were hits in the Keklikoglou et al. study. [score:1]
However, none of the activators confirmed in our secondary screen (miR-483, miR-517a and miR-517c) were hits in the Lu et al. study. [score:1]
[1 to 20 of 5 sentences]
45
[+] score: 7
For top 10 upregulated microRNAs (hsa-miR-197-3p, hsa-miR-574-3p, hsa-miR-885-5p, hsa-miR-483-3p, hsa-miR-1281, hsa-miR-328, hsa-miR-4254, hsa-miR-4290, hsa-miR-1825, hsa-miR-766-3p), we included those have been shown to be deregulated in cancer, and have either expression data or functional studies in stem cells. [score:7]
[1 to 20 of 1 sentences]
46
[+] score: 7
They have identified miR-483, miR-877, miR-337-5p, miR-546, and miR-494 as being upregulated, and miR-770-5p, miR-487b, miR-220, miR-212, and miR-712 as downregulated by adenosine signaling in MΦs. [score:7]
[1 to 20 of 1 sentences]
47
[+] score: 7
In addition, adult rats from LP dams displayed elevated miRNA-483-3p expression levels that may reduce the capacity of lipid storage contributing to limit adipocyte hypertrophy (Ferland-McCollough et al., 2012). [score:3]
Programming of adipose tissue miR-483-3p and GDF-3 expression by maternal diet in type 2 diabetes. [score:3]
A similar LP diet applied to rat dams leads to higher miRNA-483-3p levels, known to reduce adipose tissue expandability in rat offspring (Ferland-McCollough et al., 2012). [score:1]
[1 to 20 of 3 sentences]
48
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-197, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-205, hsa-mir-210, hsa-mir-221, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-125b-2, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-130b, hsa-mir-26a-2, hsa-mir-361, hsa-mir-362, hsa-mir-363, hsa-mir-376c, hsa-mir-371a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-342, hsa-mir-151a, hsa-mir-324, hsa-mir-335, hsa-mir-345, hsa-mir-423, hsa-mir-486-1, hsa-mir-146b, hsa-mir-202, hsa-mir-432, hsa-mir-494, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-455, hsa-mir-545, hsa-mir-376a-2, hsa-mir-487b, hsa-mir-551a, hsa-mir-571, hsa-mir-574, hsa-mir-576, hsa-mir-606, hsa-mir-628, hsa-mir-629, hsa-mir-411, hsa-mir-671, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-889, hsa-mir-876, hsa-mir-744, hsa-mir-885, hsa-mir-920, hsa-mir-937, hsa-mir-297, hsa-mir-1233-1, hsa-mir-1260a, hsa-mir-664a, hsa-mir-320c-2, hsa-mir-2861, hsa-mir-378b, hsa-mir-1260b, hsa-mir-378c, hsa-mir-1233-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-664b, hsa-mir-378j, hsa-mir-486-2
Considering other miRNA species, miR-571 has been associated with HCV-related cirrhosis progression (201); miR-20a and miR-92a serum levels were elevated in HCV-infected fibrosis patients, and miR–92a expression was significantly reduced after infection resolution (202); circulating serum miR-320c, miR-134, and miR-483-5p were shown to be significantly increased in expression for HCV-infected patients when compared to HC (203). [score:4]
The first study (151) showed that six circulating serum miRNAs (miR-378, miR-483-5p, miR-22, miR-29c, miR-101, and miR-320b) could serve as a distinct biosignature of pulmonary TB compared to HC, and importantly, groups of pneumonia, lung cancer, and chronic obstructive pulmonary disease patients. [score:2]
[1 to 20 of 2 sentences]
49
[+] score: 6
Other miRNAs from this paper: hsa-mir-223, hsa-mir-362
This approach has led to the discovery of the inhibitory miRNA miR-483-3p (16) and the activated miRNA miR-362-5p (17) in human NK cells (Table 1). [score:3]
Microarray analyses have been used to screen miRNAs in different NK cells from different tissues and shown that miR-483-3p decreases the cytotoxicity of NK cells due to inhibition of activated signal transducer and activator of transcription 5 by insulin-like growth factor 1 (16). [score:3]
[1 to 20 of 2 sentences]
50
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-99a, hsa-mir-100, hsa-mir-101-1, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-10a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-215, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-194-1, hsa-mir-195, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-130b, hsa-mir-302c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-324, hsa-mir-451a, hsa-mir-484, hsa-mir-486-1, hsa-mir-500a, hsa-mir-92b, hsa-mir-595, hsa-mir-596, hsa-mir-421, hsa-mir-378d-2, hsa-mir-744, hsa-mir-885, hsa-mir-939, hsa-mir-940, hsa-mir-1229, hsa-mir-1233-1, hsa-mir-1290, hsa-mir-1246, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-4286, hsa-mir-500b, hsa-mir-1233-2, hsa-mir-3935, hsa-mir-642b, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j, hsa-mir-486-2
Abue M. Yokoyama M. Shibuya R. Tamai K. Yamaguchi K. Sato I. Tanaka N. Hamada S. Shimosegawa T. Sugamura K. Circulating miR-483-3p and miR-21 is highly expressed in plasma of pancreatic cancer Int. [score:3]
Zhang Z. Ge S. Wang X. Yuan Q. Yan Q. Ye H. Che Y. Lin Y. Zhang J. Liu P. Serum miR-483-5p as a potential biomarker to detect hepatocellular carcinoma Hepatol. [score:1]
Similarly, other groups have identified several circulating miRNAs as non-invasive diagnostic biomarkers, such as miR-21, miR-122, miR-223, miR-15b, miR-130b, miR-101, miR-483, miR-125, miR-143, miR-215, miR-200, miR-939, and miR-595 [44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56]. [score:1]
Several circulating miRNAs, such as miR-27a, miR-642b, miR-885-5p, miR-22, miR-21, miR-483, miR-1246, miR-4644, miR-3976, and miR-4306, have been identified as novel diagnostic markers with acceptable availability in PCa patients [70, 71, 72, 73]. [score:1]
[1 to 20 of 4 sentences]
51
[+] score: 6
For example, the level of miR-483-5p in HeLa cells was upregulated by TNFα treatment (Figure S3, lower panel). [score:4]
With the increased percentage of Ago2 -associated miR-483-5p, the resistance of the miR-483-5p in the MVs to RNaseA was accordingly increased (Figure S4B). [score:1]
We also tested the level of miR-483-5p and its association with Ago2 in MVs, and the data indicated that the levels of miR-483-5p associated with or without Ago2 in MVs were increased (Figure S4A). [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 6
They identified a set of 15 differentially expressed miRNAs and a subset of six; namely, miR-378, miR-483-5p, miR-22, miR-29c, miR-101, and miR-320b classified the TB patients study group. [score:3]
miR-483-5p and miR-22 were also regulated concordantly in the study by Fu et al. whereas miR-101 was not different [20]. [score:2]
miR-22, miR-25, miR-197, miR-365, miR-483-5p, miR-590-5p, and miR-885-5p are yet the most promising candidates since these miRNAs were validated for discrimination of TB and healthy controls in two studies (see Table  2). [score:1]
[1 to 20 of 3 sentences]
53
[+] score: 6
According to our data, the expression of IGF2 and miR-483-5p are highly correlated (rho = 0.7). [score:3]
Accordingly, a recent report has uncovered a positive feedback between IGF2 and its intragenic mir-483, where the mature miR-483-5p molecule binds to the 5’UTR of IGF2 mRNA, promoting IGF2 transcription by facilitating the association of the helicase DHX9 (24). [score:1]
Figure 3. A summary of the main information presented in miRIAD for the intragenic mir-483 and its host gene IGF2. [score:1]
Figure 3 exemplifies the use of this information for mir-483 and its host IGF2. [score:1]
[1 to 20 of 4 sentences]
54
[+] score: 6
On the contrary, the miRNAs up-regulated in FF, especially let-7b-5p, miR-15b-5p, miR-24-3p, miR-130b-3p, miR-146b-5p, miR-212-3p, miR-222-3p, miR-223-3p, miR-339-3p and miR-483-5p, with fold change values higher than 100-fold, could be transcribed in somatic follicular cells and move to oocytes by means of exosomes. [score:4]
Interestingly, let-7b-5p, miR-15b-5p, miR-24-3p, miR-130b-3p, miR-146b-5p, miR-212-3p, miR-222-3p, miR-223-3p, miR-339-3p and miR-483-5p showed expression fold changes higher than 100-fold (ln RQ > 4.7) compared to oocytes (Figure 3B and Supplementary Table S1). [score:2]
[1 to 20 of 2 sentences]
55
[+] score: 6
MiR-483-5p was significantly down-regulated in gliomas and directly targeted ERK1 (alias MAPK3) transcript [109]. [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
Among the 1,205 sets of human miRNAs covered by the array, five (miR-503, miR-542-3p, miR-155, miR-145* and miR-424) were significantly down-regulated upon decidualization (<0.5-fold) (Table 1A), whereas a single miRNA (miR-483-3p) increased in expression (>2-fold) (Table 1B) in all three decidualizing primary HESC cultures (Fig. 1A and Table 1A and B). [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 5
Twelve of 116 TS miRNAs (miR-1, miR-126, miR-208, miR-128a, miR-133a, miR-133b, miR-134, miR-146a, miR-377, miR-483, miR-92a and miR-95) were specifically expressed in two tissues; whereas, the remaining TS miRNAs were specifically expressed in only one tissue. [score:5]
[1 to 20 of 1 sentences]
58
[+] score: 5
Examples include miR-483 that binds to the promoter of IGF2 to increase its expression in Wilms’ tumors [59] and miR-558 that binds to the promoter of heparanase (HPSE) to enhance its expression, resulting in enhanced tumor growth in neuroblastoma cells [44] (Table  2). [score:5]
[1 to 20 of 1 sentences]
59
[+] score: 5
Human-specific regulation of MeCP2 levels in fetal brains by microRNA miR-483-5p. [score:2]
Interestingly, miR-483-5p also regulates transcript levels of other MeCP2 protein interacting partners (Han et al., 2013). [score:2]
For example, the predominant MeCP2 isoform in human fetal brain contains an unusually long 3′UTR (Coy et al., 1999; Balmer et al., 2003) which harbors functional binding sites for miR-483-5p, a fetal brain-enriched miRNA that post-transcriptionally represses MeCP2 in this tissue (Han et al., 2013). [score:1]
[1 to 20 of 3 sentences]
60
[+] score: 5
The miR-483 (p = 0.0004) is a pineal miRNA and was shown in rats to target melatonin expression [22]. [score:5]
[1 to 20 of 1 sentences]
61
[+] score: 5
Other miRNAs from this paper: hsa-mir-615, hsa-mir-1207, hsa-mir-1266
In addition, two of the miRNA hairpin inhibitors, targeting miR-483-3p and miR-615-3p, also dramatically increased endogenous hTERT mRNA levels and telomerase activity in HeLa cells (Fig.   1h, i). [score:5]
[1 to 20 of 1 sentences]
62
[+] score: 5
The post-transcriptional activity of β-catenin is inhibited by miR-483-3p [26] and bioinformatic analysis shows that miR-125 and miR-214 might be miRNAs that putatively target β-catenin. [score:5]
[1 to 20 of 1 sentences]
63
[+] score: 5
In humans, miR-483-3p has been validated as a negative regulator of human NK cell development and cytotoxicity by targeting IGF-1 [13]. [score:5]
[1 to 20 of 1 sentences]
64
[+] score: 5
Normalization with let-7d/g/i revealed significant upregulation of miR-25, miR-214, miR-223 and miR-483-5p in serum from cancer patients compared with normal controls (Figure 5B). [score:3]
However, normalization with U6 or miR-191 revealed no significant differences in miR-25, miR-214, miR-223 or miR-483-5p levels in serum from cancer patients versus controls (Figure 5B). [score:1]
Furthermore, we selected endogenous miR-25, miR-214, miR-223 and miR-483-5p as targets because they are well-characterized oncogenic miRNAs that have been shown to be elevated in sera from cancer patients [5, 35, 37]. [score:1]
[1 to 20 of 3 sentences]
65
[+] score: 5
For example expression of the microRNA, miR-483-5p, decreased MeCP2 mRNA levels through the human-specific binding site in the MeCP2 long 3′ UTR (Han et al., 2013). [score:3]
Human-specific regulation of MeCP2 levels in fetal brains by microRNA miR-483-5p. [score:2]
[1 to 20 of 2 sentences]
66
[+] score: 4
Conversely, 15 miRNAs resulted downregulated in activated B cells: mir-483, mir-95, mir-326, mir-135a, mir-184, mir-185, mir-516-3p, mir-30b, mir-203, mir-216, mir-150, mir-182*, mir-141 and mir-211 (Table 3). [score:4]
[1 to 20 of 1 sentences]
67
[+] score: 4
Amongst the 7 miRNAs (miR-483-5p, miR-149, miR-582-3p, miR-1227, miR-634, miR-576-5p, and miR-641) detected by Silvia Díaz-Prado1 et al., 6 miRNAs were down-regulated in OA chondrocytes, and miR-634 is one of the six miRNAs 16. [score:4]
[1 to 20 of 1 sentences]
68
[+] score: 4
The expression of miRNA-483-5p was increased in PCOS cumulus granulosa cells, and Notch3 and mitogen-activated protein kinase (MAPK)3 were demonstrated to be regulated by miRNA-483-5p [30]. [score:4]
[1 to 20 of 1 sentences]
69
[+] score: 3
83 *** hsa-mir-346 7.13 *** 69.13 *** hsa-mir-361-3p 4.51 *** 9.6 *** hsa-mir-483-3p 3.56 *** 68.61 *** hsa-mir-486-5p 2.85 *** 34.48 *** hsa-mir-574-3p 2.61 *** 43.22 *** hsa-mir-629* 16.62 *** 67.23 *** hsa-mir-885-5p 4.75 *** 43.73 *** Inhibited differentiation & high cell count hsa-mir-193b 38.04 *** 102.74 * Hits of functional screen Relative percentage of myotubes 1, % of control p value, Mann Whitney test Relative cell count 2, % of control p value, Mann Whitney test hsa-mir-369-3p 61.75 *** 103.6 * hsa-mir-381 61.75 *** 105.31 * hsa-mir-886-5p 38.04 *** 112.86 *** hsa-mir-940 21.37 *** 112.35 *** Enhanced differentiation hsa-mir-98 104.51 * 87.82 *** High cell count hsa-mir-631 92.63 ** 103.43 *** 1see Material and Methods; 2 *: p<0.05; **: p<0.01; *** p<0.005; − = not significant. [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
Other miRNAs from this paper: mmu-mir-483, mmu-mir-675, hsa-mir-675
The targets of the Mir483 and Mir675 miRNAs are unknown. [score:3]
[1 to 20 of 1 sentences]
71
[+] score: 3
Smad4, however, is targeted by miR-130a, miR-182, miR-205 and miR-483 (Hao et al. 2011, Geraldo et al. 2012, Egawa et al. 2016). [score:3]
[1 to 20 of 1 sentences]
72
[+] score: 3
Other miRNAs from this paper: mmu-mir-483, mmu-mir-675, hsa-mir-675
Bi-maternal misexpression of one or more of these transcripts (too much H19 or Mir675 or missing Igf2as, Mir483 or Ins2) or other, yet unidentied ICR-controlled transcripts, by strict biallelic insulation must contribute to the death of +/(mChβGI) [2] pups. [score:2]
These transcripts, H19 microRNA (Mir675) [75], Igf2 antisense RNAs (Igf2as) [76], [77] and Mir483 within an intron of Igf2 [78] could be also misregulated by biallelic insulation. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 3
The largest increases in expression occurred in miR-149-3p, miR-486-5p, miR-483-3p, miR-34b-5p, miR-99b-3p and miR-140-5p at 5.925, 1.968, 1.965, 1.628, 1.503 and 1.488 fold of the control level, respectively. [score:3]
[1 to 20 of 1 sentences]
74
[+] score: 3
MiR-483 was validated as DE expressed between the young and old OA samples in both dependent and independent cohorts. [score:2]
Additionally, a number of the DE miRNAs in this contrast had previously been identified in the pathogenesis of OA including miR-27b [38], miR-483 [39], miR-146 [40], miR-145 [41], and miR-675 [42]. [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 3
Mohan R. Mao Y. Zhang S. Zhang Y. W. Xu C. R. Gradwohl G. Tang X. Differentially expressed microRNA-483 confers distinct functions in pancreatic beta- and alpha-cellsJ. [score:3]
[1 to 20 of 1 sentences]
76
[+] score: 3
Song Q. Xu Y. Yang C. Chen Z. Jia C. Chen J. Zhang Y. Lai P. Fan X. Zhou X. miR-483-5p promotes invasion and metastasis of lung adenocarcinoma by targeting RhoGDI1 and ALCAM Cancer Res. [score:3]
[1 to 20 of 1 sentences]
77
[+] score: 3
Other miRNAs from this paper: mmu-mir-483
More recently, it was found that serum miRNA-483-5P is significantly elevated in MM patients, and high expression of miRNA-483-5P is associated with shorter progression-free survival [40]. [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
34 hsa-miR-335 −0.35hsa-miR-345 [44], [53], [71] 1.16 hsa-miR-363 0.99 hsa-miR-371-5p 0.55 hsa-miR-421 0.50 hsa-miR-483-5p 1.33 hsa-miR-494 0.87 hsa-miR-505* −0.40 hsa-miR-513a-5p 1.06 hsa-miR-513b 1.19 hsa-miR-513c 1.22 hsa-miR-551b −0.40 hsa-miR-574-5p 0.97hsa-miR-630 [68], [73] 0.96 hsa-miR-769-5p −0.34 hsa-miR-801 0.66 hsa-miR-873 −0.64 hsa-miR-877* 0.72 hsa-miR-923 0.89 hsa-miR-940 0.49 hsa-miR-95 −0.44 hsa-miR-99a −0.64Irradiated and non-irradiated PBL of the same donors were incubated in static gravity (1 g) for 4 and 24 h, and miRNA expression profile was analyzed at the end of each incubation time. [score:3]
[1 to 20 of 1 sentences]
79
[+] score: 3
miR-483-5p was used as endogenous control, since this miRNA had the smallest standard deviation among samples and showed no statistical differences in its expression levels between patients and healthy controls. [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
Other miRNAs such as miR-192, miR-139-5p, miR-483-5p, miR-142-3p, miR-142-5p, or miR-375 have not been previously described to be expressed in HSCs. [score:3]
[1 to 20 of 1 sentences]
81
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
1Proliferation, Invasion, Tumor suppression [63– 66] miR-344 ↓2.0 ↓3.2 NA miR-346 ↓2.4Proliferation [67, 68] miR-362 ↓2.3Proliferation, Invasion, Apoptosis [69– 76] miR-369 ↓2.8 ↓2.6 ↓2.1Aerobic glycolysis [77] miR-374 ↑3.0 ↓2.2 NA miR-449 ↑2.7 ↑2.4Proliferation [78– 81] miR-463 ↓2.7 NAmiR-466 [°] ↑2.4 ↑2.1 ↓3.5 NA miR-483 ↓3.2Apoptosis [82] miR-493 ↑2.1 ↓2.2Proliferation [83– 85] miR-499a ↓5.0 ↑2.3Proliferation [86] miR-504 ↓2.6 ↑2.0Proliferation, Apoptosis [87, 88] miR-579 ↑2.8 NAmiR-582 [^] ↑2.4Proliferation [89] miR-615 ↓2.1Proliferation, Invasion [90, 91] miR-652 ↑2.4Proliferation, EMT [92, 93] miR-669b ↓2.1 NA miR-669h ↓3.6 ↑2.3 NA miR-669i ↓2.3 NA miR-669k ↓7.2 ↓5. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
List of the most highly expressed human microRNAs in salivary microvesicles are: hsa-let-7b, hsa-let-7c*, hsa-miR-128, hsa-miR-150*, hsa-miR-17, hsa-miR-1908, hsa-miR-212, hsa-miR-27b*, hsa-miR-29b, hsa-miR-29c, hsa-miR-335, hsa-miR-379*, hsa-miR-433, hsa-miR-454, hsa-miR-483-3p, hsa-miR-584, hsa-miR-621, hsa-miR-652, hsa-miR-760 and hsa-miR-888* [9]. [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
IGF2-derived miR-483 mediated oncofunction by suppressing DLC-1 and associated with colorectal cancer. [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Moreover, a significant reduction of melatonin in miR-483 -transfected pinealocytes and repression of arylalkylamine N-acetyltransferase expression, an enzyme converting serotonin to N-acetylserotonin, was observed. [score:3]
[1 to 20 of 1 sentences]
85
[+] score: 3
For patient stratification at first presentation to hospital miR-122-5p is the lead miRNA candidate for clinical development, possibly in combination with miR-483-3p. [score:2]
Interestingly, combining miR-122-5p with miR-483-3p resulted in an increase in predictive accuracy (as judged by the largest area under the ROC curve). [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 2
Meanwhile, it has been reported that miR-483-5p modulates the protein level of TBL1X, which is one of the Methyl CpG -binding protein 2 (MeCP2)-interacting corepressor complexes during human fetal development [50]. [score:2]
[1 to 20 of 1 sentences]
87
[+] score: 2
Human-specific regulation of MeCP2 levels in fetal brains by microRNA miR-483-5p. [score:2]
[1 to 20 of 1 sentences]
88
[+] score: 2
The heat map indicates the high enrichment of the e. g. miR-483 in RNA degradation, miR-4271 in lysine degradation or miR-4716 in spliceosome (Fig 2b). [score:1]
We found: miR-4290, miR-1281, miR-4716-5p, miR-483-3p and miR-877-3p containing almost only UC nucleotides and miR-6124, miR-483-5p, miR-4271, miR-4644, miR-4716-3p and miR-1234-5p purine-rich. [score:1]
[1 to 20 of 2 sentences]
89
[+] score: 2
Following co-culture with LGG or LGG with B. caccae grown under anaerobic conditions, miRNA profiling highlighted differential regulation of a vast number of miRNAs (mir483-3p, mir1229-3p, mir92b, mir1915, mir30b-5p, mir4521, mir193a-5p, mir125a-5p and mir141-3p) linked to colorectal cancer (Fig. 6). [score:2]
[1 to 20 of 1 sentences]
90
[+] score: 2
In accordance with this only one out of 23 miRNAs (miR-483-5p) identified in a previous functional screen using the CRC cell line DLD1 [17] was significantly dys-regulated in the CRC samples in the present study. [score:2]
[1 to 20 of 1 sentences]
91
[+] score: 2
Two other, specific, microRNAs were also predicted to be significantly regulated namely let-7a-5p and mir-483-3p. [score:2]
[1 to 20 of 1 sentences]
92
[+] score: 2
Work by our group and others has identified numerous miRNAs, including miR-675, miR-145, let-7a, miR-377 and miR-483, that influence events in early pregnancy 15, and can either positively or negatively regulate CTB proliferation in explants of human placental tissue 16- 19. [score:2]
[1 to 20 of 1 sentences]
93
[+] score: 2
In Figure 2B, RE-miR pair of hsa-miR-483- 3p (P < 0.01) and hsa-miR-151-3p (P < 0.04) showed improved predictive power (P < 0.0001). [score:1]
There were 8 common miRs (hsa-miR-429, hsa-miR-221, hsa-miR- 499-5p, hsa-miR-888, hsa-miR-770-5p, hsa-miR-545, hsa-miR-541, hsa-miR-483-3p) between the two sets of survival -associated miRs (Figure S2). [score:1]
[1 to 20 of 2 sentences]
94
[+] score: 2
Other miRNAs from this paper: hsa-mir-362
We previously reported that miR-483-3p plays a critical role in the cytotoxic activity of human NK cells [11], and identified miR-362-5p as an essential regulator of NK cell global function via miRNA array analysis [12]. [score:2]
[1 to 20 of 1 sentences]
95
[+] score: 2
Moreover, Veronese et al. [26] observed the same cellular mechanism described by Lin et al. for β-catenin negative regulator miR-483-3p. [score:2]
[1 to 20 of 1 sentences]
96
[+] score: 2
Another recent study found 7 abnormally expressed miRNAs (miR-145, miR-224, miR-150, miR-483-5p, miR-513-5p, miR-516a-5p, and miR-629) in SLE T cells compared to healthy controls. [score:2]
[1 to 20 of 1 sentences]
97
[+] score: 2
06 hsa-miR-595 5.29 hsa-miR-92b −9.97 hsa-miR-601 5.88 hsa-miR-765 4.47 hsa-miR-98 5.05 hsa-miR-99a 6.41 TGF-β -treated hsa-miR-20b −1.29 hsa-let-7a 1.38 hsa-miR-221 −1.25 hsa-let-7d 1.43 hsa-miR-605 −4.64 hsa-let-7e 2 hsa-miR-638 −1.40 hsa-miR-125a-5p 2.87 hsa-miR-663 −2.06 hsa-miR-146a 2.72 hsa-miR-720 −2.40 hsa-miR-21 1.14 hsa-miR-23a 1.20 hsa-miR-23b 1.14 hsa-miR-30c 1.89 hsa-miR-483-5p 1.38 hsa-miR-574-5p 2.23 hsa-miR-99b 1.63 10.1371/journal. [score:1]
06 hsa-miR-595 5.29 hsa-miR-92b −9.97 hsa-miR-601 5.88 hsa-miR-765 4.47 hsa-miR-98 5.05 hsa-miR-99a 6.41 TGF-β -treated hsa-miR-20b −1.29 hsa-let-7a 1.38 hsa-miR-221 −1.25 hsa-let-7d 1.43 hsa-miR-605 −4.64 hsa-let-7e 2 hsa-miR-638 −1.40 hsa-miR-125a-5p 2.87 hsa-miR-663 −2.06 hsa-miR-146a 2.72 hsa-miR-720 −2.40 hsa-miR-21 1.14 hsa-miR-23a 1.20 hsa-miR-23b 1.14 hsa-miR-30c 1.89 hsa-miR-483-5p 1.38 hsa-miR-574-5p 2.23 hsa-miR-99b 1.63 10.1371/journal. [score:1]
[1 to 20 of 2 sentences]
98
[+] score: 1
Serum miR-483-5p and are predictive of recurrence risk in adrenocortical cancer patients. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
01720Xhsa-miR-652-3p0.1640.00214Xhsa-miR-1273 g-3p0.3820.005491hsa-miR-21-5p0.1650.0005917hsa-miR-4668-5p0.3860.000139hsa-miR-142-5p0.1750.0005617hsa-miR-20b-3p0.3900.01073Xhsa-miR-36530.1780.0011722hsa-miR-148a-3p0.3910.000757hsa-miR-27b-3p0.1880.001339hsa-miR-483-3p0.3921.4E-0511hsa-miR-299-3p0.1910.0011214hsa-miR-44500.3930.000684hsa-miR-1260a0.1937.5E-0514hsa-miR-93-5p0.4000.007367hsa-miR-4445-5p0.2028.2E-053hsa-miR-56840.4050. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
In NSCLC, the effectiveness of the 5-miRNA panel (miR-193a-3p, miR-483-5p, miR-214, miR-25, and miR-7) in discriminating cancer patients from normal subjects was confirmed in a multiethnic and multicentric study in which 438 participants from both China and America were enrolled (221 NSCLC patients, 161 normal controls, and 56 benign nodules) [55]. [score:1]
[1 to 20 of 1 sentences]