sort by

7 publications mentioning ssc-mir-205

Open access articles that are associated with the species Sus scrofa and mention the gene name mir-205. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 10
And previous report demonstrated that miR-205 can inhibit the expression of FAK in renal cancer [46]. [score:5]
MiR-205, miR-214, miR-200c, miR-181c, miR-149, miR-23b, miR-320 and miR-31, which belong to category A, showed the higher expression levels on day 15 of gestation. [score:3]
Eleven miRNAs (miR-205, miR-222, miR-200c, miR-23b, miR-411, miR-17, miR-31, miR-149, miR-320, miR-181c and miR-214) were chosen for validation by RT-qPCR. [score:1]
Category A includes 46 miRNAs, such as miR-205, miR-31, miR-200c, miR-214, miR-320 and miR-494. [score:1]
[1 to 20 of 4 sentences]
2
[+] score: 10
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
MiRNAs name Normalized expression level Mature sequences WF BF Goat-miR-146b-5p 186,997.77 158,761.10 ugagaacugaauuccauaggcugu Goat-miR-27b-3p 79,872.78 72,800.46 uucacaguggcuaaguucugc Goat-miR-205-5p 20,575.80 19,911.95 uccuucauuccaccggagucug Goat-miR-181a-2-5p 21,177.16 16,613.29 aacauucaacgcugucggugagu Goat-miR-181a-1-5p 21,176.79 16,613.08 aacauucaacgcugucggugagu Goat-miR-92a-3p 19,003.38 17,003.44 uauugcacuugucccggccugu Goat-miR-182-5p 14,218.79 13,630.30 uuuggcaaugguagaacucacacu Goat-miR-26a-1-5p 14,855.58 12,171.42 uucaaguaauccaggauaggcu Goat-miR-26a-2-5p 14,837.64 12,152.12 uucaaguaauccaggauaggcu Goat-let-7f-5p 10,685.28 8870.12 ugagguaguagauuguauaguu ijms-15-09531-t002_Table 2 Table 2 The five most abundantly expressed novel miRNAs in goat hair follicels. [score:5]
[1 to 20 of 2 sentences]
3
[+] score: 8
For example, hsa-miR-133a, hsa-miR-200b, hsa-miR-206, and hsa-miR-218 were considered as tooth tissue-specific miRNAs [4]; eight differentially expressed miRNAs were expressed during morphogenesis and seven were expressed in the incisor cervical loop containing the stem cell niche [1]; the three most highly expressed microRNAs in dental epithelium were identified as mmu-miR-24, mmu-miR-200c, and mmu-miR-205, while mmu-miR-199a-3p and mmu-miR-705 were found in dental mesenchyme [2]; and miR-200 was suggested to play an important role in the formation of incisor cervical loop during stem cell–fueled incisor growth [5]. [score:8]
[1 to 20 of 1 sentences]
4
[+] score: 6
In both pig breeds, 14 miRNAs were identically up-regulated after sexual maturity (Supplementary Table S14); the relative expression fold-change of miR-145-5p, miR-205, miR-34c, miR-9, miR-9-1 and miR-9-2 at 200 days old were more notable, especially that of miR-34c, which were consistent with the findings of Lian 30 (Fig. 3). [score:6]
[1 to 20 of 1 sentences]
5
[+] score: 4
ssc-miR-205* was identified in this study; however, it was not found in the miRBase database (Additional file 5). [score:1]
On the other hand, it cannot be excluded that these isomiRs could have been generated by the digestion of miR-205. [score:1]
Here, the length of ssc-miR-205 varied from 18 to 23 nucleotides. [score:1]
As an example, the size of ssc-miR-205 in our library was 23 bp (read number was 4453), while the size of ssc-miR-205 in miRBase is 22 bp (read number is 3477). [score:1]
[1 to 20 of 4 sentences]
6
[+] score: 3
In addition, expression patterns of miR-574-3p, miR-574-5p, miR-744*, miR-30a, miR-30d, miR-205 and miR-532-3p are also inconsistent with our results 29. [score:3]
[1 to 20 of 1 sentences]
7
[+] score: 2
Using miRNA microarray analysis and RT-PCR, some researchers have found that miR-24, miR-31, miR-140, miR-141, miR-205, miR-200c, miR-875-5p, miR-455, miR-689, miR-711, and miR-720 may regulate tooth epithelial stem cell differentiation [6], [7]; others identified miR-133a, miR-200b, miR-206, and miR-218 as tooth-specific miRNAs, and that miR-141, miR-199b*, miR-200a, miR-200b, miR-200c, and miR-429 likely play a role in the renewal and differentiation of adult stem cells during stem cell-fueled incisor growth [8], [9]. [score:2]
[1 to 20 of 1 sentences]