sort by

9 publications mentioning ptc-MIR159a

Open access articles that are associated with the species Populus trichocarpa and mention the gene name MIR159a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 63
For example, the target genes of miR156 and miR1448 encoded plant disease resistance proteins (NBS-LRR proteins); two targets of miR164 encoded LRR defense proteins and TMV-resistance proteins; one target of miR398 and miR159 encoded two pathogenesis-related proteins, CSD and peroxidase (POD), respectively; and one target of miR159 encoded cytokinin oxidase (CKX) family proteins. [score:11]
The promoters of these three miRNAs are highly abundant in the MBS box, implicating MYB in their activation/repression; thus, evidence that miR159, miR164, and miR319 are positively regulated by the transcription factors they target suggests that the expression of these targets is modulated by a negative feedback loop that buffers small changes in the level of their mRNAs. [score:8]
Although experimental evidence for MYB involvement in plant disease stress is scarce, the ubiquitous distribution of MBS motifs in this study and the three fungal response miRNA (miR159, miR164, and miR319) targeting MYB TFs illustrate that MBS motifs are also tightly associated with plant disease response. [score:7]
For instance, the targets of miR156 and miR160 were genes encoding squamosa promoter -binding (SPB) proteins; the target genes of miR166 encoded a homeodomain-leucine zipper protein (HD-ZIP); and miR159, miR164, and miR319 targeted myeloblastic leukemia (MYB) factors. [score:7]
Poplar canker pathogen, B. dothidea, induced expression of miR159, miR164, and miR319, and these three miRNAs targeted MYB factors (Table S3), suggesting the miRNA -mediated regulation of MYB factors. [score:6]
For example, expression of miR156, miR160, miR164, miR166, miR168, miR398, and miR408 increases while miR159 shows reduced expression after UV-B radiation in P. tremula [10]. [score:5]
Plants always regulate disease defense through phytohormone signal transduction [54], and several miRNAs (miR159, miR160, miR164, and miR167) were induced by phytohormones [55], [56]. [score:4]
C_LG_I1252, miR408) and POD (eugene3.00280149, miR159) were selected to validate gene expression of the poplar stem canker-responsive miRNAs using real-time qPCR. [score:3]
In total, 15 qPCR validation reactions (designed for detecting the expression of miR156, miR159, miR160, miR164, miR166, miR168, miR172, miR319, miR398, miR408, miR1448, and miR1450) for the 41 fungi-response miRNAs tested were carried out. [score:3]
MiR156, miR159, miR160, miR164, miR168, miR172, and miR408 are significantly expressed in tension- and compression-stressed developing xylem of P. trichocarpa [12], and miR156, miR160, miR164, and miR168 also respond to cold stress in P. trichocarpa [4]. [score:3]
1482.1, miR159), HD-ZIP III protein (estExt_fgenesh4_pg. [score:1]
Group I included miR159, miR168, miR172, miR319 (miR319f-h), miR1450, and 13 members of miR166. [score:1]
These probes belong to 12 miRNA families (miR156, miR159, miR160, miR164, miR166, miR168, miR172, miR319, miR398, miR408, miR1448, and miR1450) and account for 17.52% of the 234 probes. [score:1]
V. 3546.1, miR159; eugene3.00110658, miR164), LRR transmembrane protein (eugene3.00141443, miR1450), NBS-LRR protein (eugene3.00190077, miR1448), Plastocyanin-like protein (estExt_fgenesh4_pg. [score:1]
Among these miRNAs, several also respond to pathogenic fungi in other plants, for example, miR156, miR159, miR160, and miR319 in galled loblolly pine stem infected with C. quercuum f. sp. [score:1]
fusiforme, miR156, miR159, miR164, and miR396 in wheat leaves infected with two powdery mildew pathogens of E. graminis f. sp. [score:1]
[1 to 20 of 16 sentences]
2
[+] score: 36
Other miRNAs from this paper: dme-mir-7, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-124-1, hsa-mir-124-2, mmu-mir-34a, osa-MIR169a, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, cel-mir-354, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR168a, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, mtr-MIR169a, mtr-MIR319a, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR168a, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, hsa-mir-519b, ppt-MIR319a, ppt-MIR319b, ppt-MIR319c, ppt-MIR319d, mtr-MIR169c, mtr-MIR169d, mtr-MIR169e, mtr-MIR169f, mtr-MIR319b, mtr-MIR168a, mtr-MIR169g, mtr-MIR169h, mtr-MIR169b, ppt-MIR319e, osa-MIR169r, mtr-MIR159a, mtr-MIR169k, mtr-MIR169j, mtr-MIR159b, ptc-MIR169ag, mtr-MIR169i, mtr-MIR319c, mtr-MIR319d, mtr-MIR169l
With an alignment-score cutoff of 4.5 and a P-value threshold of 0.2, we found small RNA cleavage products of seven mRNA genes targeted by six miRNA-like RNAs that we identified (miR159a. [score:3]
We also examined the target conservation of the miRNA-like RNAs on miR159a and miR319b precursors across Arabidopsis, a dicotyledonous plant, and rice, a monocotyledonous plant. [score:3]
miR159 and miR319 belong to the same MIR family based on their evolutionary origin [30, 44], playing important roles in plant development [47]. [score:2]
3 and miR159a. [score:1]
Importantly, a close inspection showed that many individual miRNA-like RNAs on the miR159 and miR319 precursors are also highly conserved at the sequence level. [score:1]
miRNA-like RNAs appeared in miR319 precursors in all of these five plants, and miRNA-like RNAs occurred in miR159 precursors in all of five bar moss. [score:1]
3 TAAAAAAGGATTTGGTTATA 6 miR159a. [score:1]
For example, the three miRNA-like RNAs on the miR159a precursor that passed our selection criteria are labeled as miR159a. [score:1]
This is consistent with the recent discovery that the DCL cleavage that produces mature miR159 and miR319 starts from the loop ends of their fold-back structures [45, 46]. [score:1]
2-5p is paired with miR159a. [score:1]
2, miR159a. [score:1]
Furthermore, four of these six miRNA-like RNAs (miR159a. [score:1]
Some of these miRNA-like RNAs from conserved miRNA families, that is, miR159 and miR319 in plants, are conserved at the sequence level (Figure 7), which adds another layer of evidence that these miRNA-like RNAs are potentially functionally important in plants. [score:1]
Examples include MIR159a, MIR319a and MIR319b in Figures 1a,c,d, respectively. [score:1]
Figures 1, 2, 3, and 4 show this type of phasing pattern on the precursors of miR159a, miR169 m, miR319a/b, miR447, miR822 and miR839. [score:1]
1/miR159a. [score:1]
1* GAGCTCCTTAAAGTTCAAACA 9 miR159a. [score:1]
2-5p AGCTGCTAAGCTATGGATCCC 36 2,7 miR159a. [score:1]
Following miRNA nomenclature [17, 18], we name these miRNA-like RNAs miR n. k, where integer n specifies a particular miRNA family and precursor (for example, 159a for miR159a) and integer k denotes a specific miRNA or miRNA-like RNA. [score:1]
Note that miRNA-miRNA* duplexes for miRNA-like RNAs, with approximately two-nucleotide 3'-end overhangs, appear on the miR159, miR169m and miR319b precursors. [score:1]
Both ath-miR159a. [score:1]
In the five plant species we studied, miRNA-like RNAs appeared in two well-conserved miRNA families, that is, miR159 and miR319 (Table 2). [score:1]
1* (that is, miR159a/miR159a*) in four plants, A. thaliana (ath), O. sativa (osa), P. patens (ppt) and M. truncatula (mtr). [score:1]
2-3p and miR159a. [score:1]
2-5p/miR159a. [score:1]
2-3p and osa-miR159a. [score:1]
2-3p ATTGCATATCTCAGGAGCTTT 9 1,2,7 At5g24620 miR159a. [score:1]
Figure 6a displays the miR159a precursors in Arabidopsis, rice, Medicago and Populus and Figure 6b shows the miR319b precursors in Arabidopsis, rice, moss and Medicago. [score:1]
2-5p, miR159a. [score:1]
2-5p, and miR159a. [score:1]
For example, miR159a. [score:1]
[1 to 20 of 31 sentences]
3
[+] score: 26
Other miRNAs from this paper: ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR164a, ptc-MIR164b, ptc-MIR164c, ptc-MIR164d, ptc-MIR164e, ptc-MIR164f, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR167a, ptc-MIR167b, ptc-MIR167c, ptc-MIR167d, ptc-MIR167e, ptc-MIR167f, ptc-MIR167g, ptc-MIR167h, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR397a, ptc-MIR397b, ptc-MIR397c, ptc-MIR472a, ptc-MIR472b, ptc-MIR1447, ptc-MIR6459a, ptc-MIR6462a, ptc-MIR6462b, ptc-MIR6462c, ptc-MIR6462d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR6462e, ptc-MIR6462f, ptc-MIR6459b
Consequently, we predicted 25 target genes for Pto-miR156, Pto-miR159, Pto-miR172 and Pto-miR319 that were different from the previously defined Populus miRNA targets (miRBase 19.0), and a total of 464 targets were identified for the 78 novel miRNAs (Table S3). [score:7]
Target Prediction for Pto-miR156, Pto-miR159, Pto-miR172 and Pto-miR319 and Novel miRNAs in Andromonoecious P. tomentosa To understand the functions of sex-specific flower development related miRNAs, the first step is to predict and experimentally validate their targets. [score:6]
In this study, miRNA159 and miRNA319 expression in female flower was 38.8-fold and 51.42-fold higher, respectively, than in male flower. [score:3]
Several miRNA families, such as miR156, miR159, miR169, miR319, miR396, and miR1447, had moderate expression levels (Table 2). [score:3]
Target Prediction for Pto-miR156, Pto-miR159, Pto-miR172 and Pto-miR319 and Novel miRNAs in Andromonoecious P. tomentosa. [score:3]
miRNA159 and miRNA319 also have been reported to act with miRNA164 and miRNA167 in specifying particular cell types during the later stages of flower development [28]. [score:2]
For example, three miRNA families (miR172, miR159/miR319 and miR156) are involved in flowering-time regulation [27]. [score:2]
[1 to 20 of 7 sentences]
4
[+] score: 22
Other miRNAs from this paper: ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR164a, ptc-MIR164b, ptc-MIR164c, ptc-MIR164d, ptc-MIR164e, ptc-MIR164f, ptc-MIR167a, ptc-MIR167b, ptc-MIR167c, ptc-MIR167d, ptc-MIR167e, ptc-MIR167f, ptc-MIR167g, ptc-MIR167h, ptc-MIR168a, ptc-MIR168b, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR394a, ptc-MIR394b, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR403a, ptc-MIR408, ptc-MIR472a, ptc-MIR472b, ptc-MIR482a, ptc-MIR171k, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1444a, ptc-MIR1444b, ptc-MIR1444c, ptc-MIR1446a, ptc-MIR482d, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c, ptc-MIR1444d, ptc-MIR1444e
As shown in Figure  3, the expression patterns of the sequencing and RT-qPCR results of drought-responsive miRNAs were consistent, both indicating that four miRNAs (Ptc-miR159a-c, Ptc-miR472a, Ptc-miR472b, and Ptc-miR473a) were upregulated after drought treatment, and that five miRNAs (Ptc-miR160a-d, Ptc-miR164a-e, Ptc-miR394a/b-5p, Ptc-miR408, and Ptc-miR1444b-c) were downregulated by drought stress [25]. [score:9]
Ptc-miR159 is another upregulated miRNA; its Arabidopsis homolog targets an MYB transcription factor. [score:6]
According to our degradome sequencing results, the Ptc-miR159 was confirmed to target a methionine sulfoxide reductase (MSR). [score:3]
Regulation of the MSR gene by Ptc-miR159 may occur through a homeostatic mechanism in response to drought stress in P. trichocarpa. [score:2]
MiR159 and miR164 have not yet found to be drought-responsive in Populus plants, except in this research. [score:1]
The ABA -induced accumulation of the miR159 homolog makes the MYB transcript degradation desensitize hormone signaling during seedling stress responses in Arabidopsis [40]. [score:1]
[1 to 20 of 6 sentences]
5
[+] score: 17
Other miRNAs from this paper: ath-MIR159a, ath-MIR162a, ath-MIR162b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR171a, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR162a, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR390a, ath-MIR390b, ath-MIR396a, ath-MIR396b, ath-MIR398a, ath-MIR398b, ath-MIR398c, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR398a, osa-MIR398b, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR159c, ath-MIR319c, osa-MIR156k, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR162b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR414, osa-MIR414, osa-MIR390, osa-MIR396e, ptc-MIR156k, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR162a, ptc-MIR162b, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR398b, ptc-MIR398c, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR408, ptc-MIR482a, ptc-MIR171k, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1448, osa-MIR396f, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR169ag, ptc-MIR482b, ptc-MIR482c, pde-MIR159, pde-MIR162, pde-MIR166a, pde-MIR166b, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR482a, pde-MIR482b, pde-MIR482c, pde-MIR482d, pde-MIR946, pde-MIR947, pde-MIR949a, pde-MIR950, pde-MIR951, pde-MIR952a, pde-MIR952b, pde-MIR952c, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR3701, pde-MIR3704a, pde-MIR3704b, pde-MIR3712
In order to obtain solid evidence to support the existence and expression of conserved miRNAs in P. densata, we examined the expression profiles of 10 mature miRNAs (pde-miR159a, pde-miR166a, pde-miR171a, pde-miR390a, pde-miR396a, pde-miR946, pde-miR950, pde-miR1311, pde-miR1313 and pde-miR1314b) in needles and stems of two-month-old seedlings, using real-time RT-PCR (Figure 4). [score:5]
The expression levels of 7 miRNAs, including pde-miR159a, pde-miR166a, pde-miR390a, pde-miR946, pde-miR1311, pde-miR1313 and pde-miR1314b, were more than 2-fold higher in needles than in stems, Intriguingly, miR166a, an important miRNA known for the functions in establishment of adaxial/abaxial (dorsoventral) leaf polarity, was expressed more than 9 times higher in needles than in stems [40]. [score:5]
In our study, pde-miR159 and pde-miR166a were found highly expressed in P. densata needles. [score:3]
It includes pde-miR159a, pde-miR169a, pde-miR396a, pde-miR482c, pde-miR482d, pde-miR949a, pde-miR950a, pde-miR952a, pde-miR952b, pde-miR952c, pde-miR1313, pde-miR1314a, pde-miR1448, pde-miR2118a, pde-miR2118b, pde-miR3701, pde-miR3704a, pde-miR3704b and pde-miR3712 (Table 1), of which 17 miRNAs were further validated by subcloning and sequencing except pde-miR396a and pde-miR482c. [score:1]
For example, the pde-MIR482 family has 4 members, whereas only one exists in 19 miRNA families (pde-MIR159, pde-MIR162, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396, pde-MIR783, pde-MIR946, pde-MIR947, pde-MIR950, pde-MIR951, pde-MIR1310, pde-MIR1311, pde-MIR1312, pde-MIR1313, pde-MIR1314, pde-MIR1448, pde-MIR3701 and pde-MIR3712). [score:1]
The accumulation of miR159 was observed to increase with the days post inoculation (dpi) of tomato leaf curl New Delhi virus (ToLCNDV) agroinfection in tomato cv Pusa Ruby [49]. [score:1]
It includes pde-MIR159, pde-MIR162, pde-MIR166, pde-MIR169, pde-MIR171, pde-MIR390, pde-MIR396 and pde-MIR399. [score:1]
[1 to 20 of 7 sentences]
6
[+] score: 11
Other miRNAs from this paper: ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR164a, ptc-MIR164b, ptc-MIR164c, ptc-MIR164d, ptc-MIR164e, ptc-MIR164f, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR167a, ptc-MIR167b, ptc-MIR167c, ptc-MIR167d, ptc-MIR167e, ptc-MIR167f, ptc-MIR167g, ptc-MIR167h, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR393a, ptc-MIR393b, ptc-MIR393c, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR398a, ptc-MIR398b, ptc-MIR398c, ptc-MIR171k, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, ptc-MIR1446a, ptc-MIR1446b, ptc-MIR1446c, ptc-MIR1446d, ptc-MIR1446e, ppe-MIR171f, ppe-MIR171h, ppe-MIR171a, ppe-MIR171e, ppe-MIR169e, ppe-MIR398a, ppe-MIR319a, ppe-MIR319b, ppe-MIR171g, ppe-MIR171b, ppe-MIR171c, ppe-MIR398b, ptc-MIR3627a, ptc-MIR156l, ptc-MIR169ag, ptc-MIR395k, ptc-MIR3627b, ppe-MIR156a, ppe-MIR156b, ppe-MIR156c, ppe-MIR156d, ppe-MIR156e, ppe-MIR156f, ppe-MIR156g, ppe-MIR156h, ppe-MIR156i, ppe-MIR159, ppe-MIR160a, ppe-MIR160b, ppe-MIR164a, ppe-MIR164b, ppe-MIR164c, ppe-MIR164d, ppe-MIR166a, ppe-MIR166b, ppe-MIR166c, ppe-MIR166d, ppe-MIR166e, ppe-MIR167a, ppe-MIR167b, ppe-MIR167c, ppe-MIR167d, ppe-MIR169a, ppe-MIR169b, ppe-MIR169c, ppe-MIR169d, ppe-MIR169f, ppe-MIR169g, ppe-MIR169h, ppe-MIR169i, ppe-MIR169j, ppe-MIR169k, ppe-MIR169l, ppe-MIR171d, ppe-MIR172a, ppe-MIR172b, ppe-MIR172c, ppe-MIR172d, ppe-MIR390, ppe-MIR393a, ppe-MIR393b, ppe-MIR395a, ppe-MIR395b, ppe-MIR395c, ppe-MIR395d, ppe-MIR395e, ppe-MIR395f, ppe-MIR395g, ppe-MIR395h, ppe-MIR395i, ppe-MIR395j, ppe-MIR395k, ppe-MIR395l, ppe-MIR395m, ppe-MIR395n, ppe-MIR395o, ppe-MIR396a, ppe-MIR396b, ppe-MIR3627
The ten most highly expressed miRNAs (miR156, miR157, miR159, miR164, miR167, miR172, miR393, miR396, miR414, miR2275, and miR5021) in buds and leaves are miRNAs regulating genes involved in flower and leaf development processes such as integument development, leaf morphogenesis, meristem initiation, maintenance, and growth, bilateral symmetry determination, organ morphogenesis, plant phase transition, shoot apical meristem identity, flower and fruit development, and plant architecture. [score:7]
miR156, miR159, miR166, miR172, miR390, miR396, and miR5021 are the most expressed families in bud tissues. [score:3]
Most of conserved families common to Arabidopsis and peach (miR156, miR159, miR160, miR164, miR166, miR171, miR172, miR319, miR390, miR395, and miR396) did not show significant size variation (Figure 4). [score:1]
[1 to 20 of 3 sentences]
7
[+] score: 5
Also, in Larix leptolepis, four miRNA families (miR159, miRNA169, miRNA171, and miRNA172) are all induced by abiotic stress and their targets regulate genes crucial to cell development, including MYB transcription factors (miR159), an NF-YA transcription factor (miR169), a scarecrow-like transcription factor (miR171) and apetala2 (miR172; Zhang et al., 2010). [score:5]
[1 to 20 of 1 sentences]
8
[+] score: 3
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR169a, osa-MIR171a, osa-MIR393a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR171h, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, osa-MIR418, osa-MIR419, osa-MIR426, osa-MIR435, osa-MIR390, osa-MIR396e, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR160a, ptc-MIR160b, ptc-MIR160c, ptc-MIR160d, ptc-MIR160e, ptc-MIR160f, ptc-MIR160g, ptc-MIR160h, ptc-MIR162a, ptc-MIR162b, ptc-MIR168a, ptc-MIR168b, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR390a, ptc-MIR390b, ptc-MIR390c, ptc-MIR390d, ptc-MIR393a, ptc-MIR393b, ptc-MIR393c, ptc-MIR396a, ptc-MIR396b, ptc-MIR396c, ptc-MIR396d, ptc-MIR396e, ptc-MIR396f, ptc-MIR396g, ptc-MIR397a, ptc-MIR397b, ptc-MIR397c, ptc-MIR403a, ptc-MIR403b, ptc-MIR408, ptc-MIR477e, ptc-MIR477f, ptc-MIR474a, ptc-MIR474b, ptc-MIR474c, ptc-MIR475a, ptc-MIR475b, ptc-MIR475c, ptc-MIR475d, ptc-MIR476a, ptc-MIR476b, ptc-MIR477a, ptc-MIR477b, ptc-MIR478a, ptc-MIR478b, ptc-MIR478c, ptc-MIR478d, ptc-MIR478e, ptc-MIR478f, ptc-MIR478h, ptc-MIR478i, ptc-MIR478j, ptc-MIR478k, ptc-MIR478l, ptc-MIR478m, ptc-MIR478o, ptc-MIR478p, ptc-MIR478q, ptc-MIR478r, ptc-MIR478s, ptc-MIR478n, ptc-MIR481a, ptc-MIR481b, ptc-MIR481c, ptc-MIR481d, ptc-MIR482a, ptc-MIR171k, ptc-MIR403c, osa-MIR169r, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR396f, osa-MIR396g, osa-MIR396h, osa-MIR396d, ptc-MIR482d, ptc-MIR477c, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR477d, ptc-MIR482c, ptc-MIR828a, ptc-MIR828b, ptc-MIR403d
miR156/157, miR159 and miR319 are represented by 22 and 38 members respectively and three other families (miR169, miR170/171, miR165/166) are represented by more than 20 members. [score:1]
Several Arabidopsis and rice families such as miR156/157, miR159/319, miR162, miR172, miR396, miR397, miR473, and miR475 are nearly double in size in Populus. [score:1]
For families miR156/157, miR159, miR319, miR162, miR172, miR396, miR397, miR473, miR475 and miR482, the number of members identified in this study was at least twice that reported previously [3, 26] (Fig. 2). [score:1]
[1 to 20 of 3 sentences]
9
[+] score: 1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR157a, ath-MIR157b, ath-MIR157c, ath-MIR157d, ath-MIR159a, ath-MIR165a, ath-MIR165b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR169a, ath-MIR170, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, ath-MIR319a, ath-MIR319b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR171a, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR401, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR319c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319a, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, ath-MIR413, ath-MIR414, ath-MIR415, ath-MIR416, ath-MIR417, osa-MIR413, osa-MIR414, osa-MIR415, osa-MIR416, osa-MIR417, ath-MIR426, osa-MIR426, osa-MIR438, osa-MIR444a, ptc-MIR156a, ptc-MIR156b, ptc-MIR156c, ptc-MIR156d, ptc-MIR156e, ptc-MIR156f, ptc-MIR156g, ptc-MIR156h, ptc-MIR156i, ptc-MIR156j, ptc-MIR156k, ptc-MIR159b, ptc-MIR159d, ptc-MIR159e, ptc-MIR159c, ptc-MIR166a, ptc-MIR166b, ptc-MIR166c, ptc-MIR166d, ptc-MIR166e, ptc-MIR166f, ptc-MIR166g, ptc-MIR166h, ptc-MIR166i, ptc-MIR166j, ptc-MIR166k, ptc-MIR166l, ptc-MIR166m, ptc-MIR166n, ptc-MIR166o, ptc-MIR166p, ptc-MIR166q, ptc-MIR169a, ptc-MIR169aa, ptc-MIR169ab, ptc-MIR169ac, ptc-MIR169ad, ptc-MIR169ae, ptc-MIR169af, ptc-MIR169b, ptc-MIR169c, ptc-MIR169d, ptc-MIR169e, ptc-MIR169f, ptc-MIR169g, ptc-MIR169h, ptc-MIR169i, ptc-MIR169j, ptc-MIR169k, ptc-MIR169l, ptc-MIR169m, ptc-MIR169n, ptc-MIR169o, ptc-MIR169p, ptc-MIR169q, ptc-MIR169r, ptc-MIR169s, ptc-MIR169t, ptc-MIR169u, ptc-MIR169v, ptc-MIR169w, ptc-MIR169x, ptc-MIR169y, ptc-MIR169z, ptc-MIR171a, ptc-MIR171b, ptc-MIR171c, ptc-MIR171d, ptc-MIR171e, ptc-MIR171f, ptc-MIR171g, ptc-MIR171h, ptc-MIR171i, ptc-MIR172a, ptc-MIR172b, ptc-MIR172c, ptc-MIR172d, ptc-MIR172e, ptc-MIR172f, ptc-MIR172g, ptc-MIR172h, ptc-MIR172i, ptc-MIR319a, ptc-MIR319b, ptc-MIR319c, ptc-MIR319d, ptc-MIR319e, ptc-MIR319f, ptc-MIR319g, ptc-MIR319h, ptc-MIR319i, ptc-MIR395a, ptc-MIR395b, ptc-MIR395c, ptc-MIR395d, ptc-MIR395e, ptc-MIR395f, ptc-MIR395g, ptc-MIR395h, ptc-MIR395i, ptc-MIR395j, ptc-MIR399a, ptc-MIR399b, ptc-MIR399d, ptc-MIR399f, ptc-MIR399g, ptc-MIR399h, ptc-MIR399i, ptc-MIR399j, ptc-MIR399c, ptc-MIR399e, ptc-MIR481a, ptc-MIR482a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ptc-MIR171k, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, ptc-MIR171l, ptc-MIR171m, ptc-MIR171j, osa-MIR395x, osa-MIR395y, ath-MIR156i, ath-MIR156j, ptc-MIR482d, ptc-MIR156l, ptc-MIR169ag, ptc-MIR482b, ptc-MIR395k, ptc-MIR482c
In Arabidopsis, only the miR171 family is divided in two families, and the following miRBase families are pairwise grouped together: MIR319–MIR159, MIR156–MIR157, MIR165–MIR166, and MIR170–MIR171. [score:1]
[1 to 20 of 1 sentences]