sort by

14 publications mentioning dre-mir-206-1

Open access articles that are associated with the species Danio rerio and mention the gene name mir-206-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 384
Other miRNAs from this paper: dre-mir-1-2, dre-mir-1-1, dre-mir-206-2
Therefore, the use of miR-206 overexpression as a tumour suppressor through regulating EMT/MET supports our findings because miR-206 overexpression favours MET which results in epithelialization of boundary cells to form normal boundary, while miR-206 knockdown favours EMT which results in failure of epithelialization of boundary cells and forms a defective boundary. [score:9]
In the miR-206-knockdown, rtn4al-overexpression and cxcr4a-knockdown embryos, however, thbs3a was expressed at a relatively high level in the newly forming somites with pronounced expression in mature somites (figure 5 f–h). [score:9]
When zebrafish embryos were treated with knockdown of miR-206, overexpression of rtn4a, knockdown of cxcr4a, or overexpression of thbs3a, defective somite boundaries were observed at early (20 hpf) and late (48 hpf) developmental stages. [score:8]
However, we further found that Rtn4a expression is specifically inhibited by miR-206, not miR-1. Based on this evidence, we concluded that the regulatory pathway related to somite boundary formation is miR-206-specific, which is strongly supported by the hypothesis proposed by Lin et al. [5], who demonstrated that miR-1 and miR-206 target different genes and play different roles during zebrafish embryogenesis. [score:8]
4.4. miR-206 does not directly affect the expressional changes of cxcr4a or thbs3aWe analysed two individual microarrays obtained from miR-206-knockdown embryos and rtn4a -overexpressed embryos. [score:7]
The cxcr4a expression level was reduced in the somites of (b) miR-206-MO -injected embryos and (c) rtn4al-mRNA -injected embryos, while (d) cxcr4a expression was not affected by overexpression of Thbs3a. [score:7]
Genes that were predominantly impacted by both miR-206-knockdown and rtn4al-overexpression in the somite of embryosTo discover potential regulatory factors mediating the effect of miR-206/rtn4al axis in somites, we employed another transgenic line, Tg(myf5 : GFP), in which the GFP reporter is driven by an upstream 80 kb of zebrafish myf5 such that GFP is expressed in the developing PSM and somite [29]. [score:7]
This line of evidence suggested that the epithelial cells of miR-206-knockdown embryos, rtn4al-overexpression embryos, cxcr4a-knockdown embryos and thbs3a-overexpression embryos do not undergo epithelialization at somite boundaries. [score:7]
In order to exclude the off-target effect of MO injection, we knocked down endogenous miR-206 by injection of miR-206-MO which specifically inhibits both miR-206-1 and miR-206-2 in zebrafish embryos without affecting the production of miR-1 with the same seed sequence as that of miR-206 [5]. [score:6]
Either knockdown of miR-206 or overexpression of rtn4al causes defective somite boundary in embryosTo determine if any change of miR-206 and its target gene might cause a corresponding defect in embryos, we employed zebrafish transgenic line Tg(α-actin:RFP), in which muscle cells are tagged with red fluorescent protein (RFP) [30]. [score:6]
As shown in the electronic supplementary material, figure S3, the expression patterns of these segmentation decision genes were not significantly altered in either miR-206-knockdown or Rtn4al-overexpression embryos. [score:6]
Thus we suggested that either knockdown of miR-206 or overexpression of each isoform of Rtn4a caused the observed defective phenotype, but did not disturb the arrangement of actin or muscle fibre development. [score:5]
Knockdown of miR-206 increases rtn4al mRNA and Rtn4al protein in zebrafish embryosUsing qPCR, we quantified rtn4al mRNA expression level in zebrafish embryos injected with miR-206-MO to specifically knock down endogenous miR-206. [score:5]
On the other hand, thbs3a expression level was increased in the somites of (f) miR-206-MO -injected embryos and (g) rtn4al mRNA -injected embryos, while (h) thbs3a expression was also increased in cxcr4a-MO -injected embryos. [score:5]
The reduced expression of Rtn4a, as mediated by miR-206, increased the expression of downstream cxcr4a, a gene well known to be involved in somite boundary formation [28], particularly in the newly forming somites of embryonic trunk. [score:5]
In the miR-206-knockdown and rtn4al-overexpression embryos, cxcr4a was reduced in newly forming somites (figure 5 b, c), suggesting that crcx4a is negatively regulated by rtn4a. [score:5]
Additionally, miR-206 represses the translation of mRNA encoding vascular endothelial growth factor Aa, resulting in inhibiting the angiogenesis of zebrafish embryos at 24–72 hpf [5, 46]. [score:5]
Interestingly, we demonstrated that the somite boundary formation defect caused by miR-206-knockdown, rtn4al-overexpression and cxcr4a-knockdown could be rescued by reduction of Thbs3a (figure 5 l). [score:5]
As shown in figure 4 s, we demonstrated that defective formation of somite boundary caused by abnormal expression of cxcr4a and thbs3a was completely congruent with that caused by abnormal expression of miR-206 and rtn4al. [score:5]
However, neither cxcr4a nor thbs3a was included in the 117 putative target genes listed in the miR-206 LAMP assay, suggesting that neither gene was a direct target of miR-206. [score:5]
Somite boundary formation defect caused by abnormal expression of cxcr4a and thbs3a is similar to that caused by abnormal expression of miR-206 and rtn4alThe somite boundary was normally developed in WT embryos at 20 hpf (figure 4 a–c), while was incompletely formed in embryos injected with miR-206-MO (figure 4 d–f), miR-206- 5-mis-MO (figure 4 g–i), rtn4al mRNA (figure 4 j–l), cxcr4a-MO (figure 4 m–o) and thbs3a mRNA (figure 4 p–r). [score:5]
Somite boundary formation defect caused by abnormal expression of cxcr4a and thbs3a is similar to that caused by abnormal expression of miR-206 and rtn4al. [score:5]
For example, overexpression of miR-206 was used to treat breast cancer cells to inhibit the downstream genes of transforming growth factor (TGF)- β, such as NRP1 and SMAD2, to reduce the migration and invasion of breast cancer cells [51]. [score:5]
Meanwhile, miR-206 is present in PSM and somites (electronic electronic supplementary material, figure S2), and it is able to repress Rtn4al, resulting in the higher expression of Cxcr4a, which, in turn, prevents excessive expression of Thbs3a in newly forming somites, leading to normal formation of somite boundaries during somitogenesis. [score:5]
However, because rtn4a-3′UTR showed more obvious inhibition by miR-206, we focused on target gene rtn4a for further study. [score:5]
4.3. miR-206 affects somite boundary formation by regulating METAs a therapeutic agent, miR-206 has been used to treat drug-resistant cells and cancer cells based on its ability to suppress EMT. [score:4]
8233) 52 Chen QY, Jiao DM, Wang J, Hu H, Tang X, Chen J, Mou H, Lu W 2016 miR-206 regulates cisplatin resistance and EMT in human lung adenocarcinoma cells partly by targeting MET. [score:4]
Using qPCR, we quantified rtn4al mRNA expression level in zebrafish embryos injected with miR-206-MO to specifically knock down endogenous miR-206. [score:4]
Therefore, based on the data obtained from the rescue experiment, as shown in the electronic supplementary material, table S2, it was concluded that either knockdown of miR-206 or overexpression of each isoform of Rtn4a in embryos causes the observed defective phenotype. [score:4]
In miR-206-knockdown and rtn4a-overexpression embryos, we found that fibronectin and p-FAK did not accumulate correctly in the border cells of embryos as early as 20 hpf (figures  4 and 7). [score:4]
Furthermore, using frozen sections, we observed that both miR-206 and rtn4al were expressed in the fast muscle of trunk at 24 hpf (electronic supplementary material, figure S1), suggesting a tight, possibly regulatory, relationship between miR-206 and rtn4al in the zebrafish somite. [score:4]
Based on this line of evidence, it can be concluded that the expressions of cxcr4a and thbs3a in somites are not directly affected by miR-206. [score:4]
However, somite boundary of recipient embryos transplanted with cells from embryos injected with either Dextran combined with miR-206-MO (figure 3 m–p) (n = 21) or rtn4al mRNA (figure 3 q–t) (n = 24) appeared defective (ectopic or loss) by 23.8 and 33.3%, respectively, indicating that the number of somite boundary defects caused by knockdown of miR-206 and overexpression of Rtn4al had increased. [score:4]
miR-206 does not directly affect the expressional changes of cxcr4a or thbs3a. [score:4]
Screening of the target genes for miR-206Although miR-206 could be detected in the one-cell stage of zebrafish embryos [3], it was significantly increased in somites during developmental stages between 12 and 16 hpf [4, 5]. [score:4]
Genes that were predominantly impacted by both miR-206-knockdown and rtn4al-overexpression in the somite of embryos. [score:4]
Searching for the putative target genes of miR-206To search for the putative target genes of miR-206, we performed LAMP assay [6] with some modifications. [score:4]
These somite boundary formation defects can be rescued either by overexpression of mature miR-206 RNA or knockdown of rtn4a. [score:4]
To discover potential regulatory factors mediating the effect of miR-206/rtn4al axis in somites, we employed another transgenic line, Tg(myf5 : GFP), in which the GFP reporter is driven by an upstream 80 kb of zebrafish myf5 such that GFP is expressed in the developing PSM and somite [29]. [score:4]
Either knockdown of miR-206 or overexpression of rtn4al causes defective somite boundary in embryos. [score:4]
This quantitation experiment strongly suggests that either knockdown of miR-206 or overexpression of Rtn4al results in defective formation of the somite boundary, indicating it is an example of a community effect. [score:4]
This line of evidence suggested that miR-206 and rtn4al do not regulate thbs3a expression in cxcr4a morphants. [score:4]
We analysed two individual microarrays obtained from miR-206-knockdown embryos and rtn4a -overexpressed embryos. [score:4]
As shown in figure 5 k, when cxcr4a was knocked down in embryos, thbs3a expression was increased, irrespective of whether miR-206 or rtn4al was increased or decreased. [score:4]
Finally, these putative cDNAs for miR-206 -targeting were further combined with Zebrafish Whole Genome Microarray (Agilent). [score:3]
Furthermore, we also employed qPCR to quantify the level of thbs3a mRNA expression in embryos injected either cxcr4a-MO alone or cxcr4a-MO combined with miR-206-MO, miR-206 RNA, rtn4al-MO or rtn4al mRNA. [score:3]
Interestingly, in this study we reveal another biological function of miR-206 during embryogenesis, namely that miR-206 can repress the expression of rtn4a and thus play a role in the formation of the somite boundary during somitogenesis of zebrafish embryos at 16–20 hpf. [score:3]
The complete 3′UTR segments of cited3, gadd45ab, znf142 and rtn4a, which are four putative target genes for miR-206, were individually ligated into the downstream of the luc reporter gene and driven by thymidine kinase (TK) promoter in plasmid phRG-TK. [score:3]
Figure 6. Change of expression levels of miR-206, Rtn4al, Cxcr4a or Thbs3a fails to epithelialize somites in zebrafish embryos. [score:3]
Overexpression of miR-206 was also used to treat lung adenocarcinoma cisplatin-resistant cells to enhance MET protein level and, in turn, restrict the migration and invasion of lung cancer cells [52]. [score:3]
To further confirm whether cited3, gadd45ab, znf142 and rtn4a were the target gene(s) of miR-206, we cloned their 3′ UTRs and fused them downstream of reporter cDNA encoding Renilla luc and driven by herpes simplex virus thymidine kinase promoter (TK). [score:3]
miR-206 was unable to silence reporter gene expression driven by mutated 3′UTR of rtn4a. [score:3]
Taken together, it was plausible to conclude that miR-206 silences the translation of reporter gene through binding rtn4a-3′UTR at 1422 ∼ 1444 nt. [score:3]
Since luc activity was greatly inhibited by miR-206 in both non-muscle and muscle cell lines transfected with phRG-TK- cited3-3′UTR and phRG-TK- rtn4a-3′UTR, we chose only cited3 and rtn4a for further in vivo experiments. [score:3]
Specifically, we confirm that miR-206 plays a role in somite boundary formation at the early stage through silencing rtn4a expression. [score:3]
In this study, we observed that knockdown of miR-206 affects somite boundary formation in embryonic development through disturbance of somite boundary epithelial cells undergoing MET. [score:3]
To further confirm whether Cxcr4a and Thbs3a are downstream effectors of the miR-206/rtn4al axis, we individually injected miR-206-MO, rtn4al mRNA and thbs3a mRNA into one-cell zebrafish embryos, followed by detection of the expression level of cxcr4a mRNA at 20 hpf. [score:3]
Cross-filled box: miR-206-target mutated sequences on rtn4a-3′UTR. [score:3]
In total, 117 putative target genes for miR-206 were screened (electronic supplementary material, table S1). [score:3]
Therefore, we employed the labelled microRNA pull-down (LAMP) assay [6] of mRNAs extracted from 16-hpf zebrafish embryos and found that reticulon 4a (rtn4a) is a target gene for miR-206 at this developmental stage. [score:3]
Importantly, miR-206 can be detected at the one-cell stage of zebrafish embryos [3], and its expression increases in somites between 12 and 16 hpf [4, 5]. [score:3]
Screening of the target genes for miR-206. [score:3]
Additionally, injection of miR-206-MO, rtn4al mRNA or cxcr4a-MO combined with thbs3a-MO in embryos resulted in the reduction of thbs3a expression. [score:3]
As a therapeutic agent, miR-206 has been used to treat drug-resistant cells and cancer cells based on its ability to suppress EMT. [score:3]
On the other hand, we individually injected miR-206-MO, rtn4al mRNA and cxcr4a-MO into one-cell zebrafish embryos, followed by detection of the expression level of thbs3a mRNA at 20 hpf. [score:3]
To determine if any change of miR-206 and its target gene might cause a corresponding defect in embryos, we employed zebrafish transgenic line Tg(α-actin:RFP), in which muscle cells are tagged with red fluorescent protein (RFP) [30]. [score:3]
Figure 1. miR-206 silences the expression of luc reporter through binding the 3′UTR from rtn4a. [score:3]
Searching for the putative target genes of miR-206. [score:3]
Cxcr4a and Thbs3a are downstream effectors of the miR-206/rtn4al axisTo further confirm whether Cxcr4a and Thbs3a are downstream effectors of the miR-206/rtn4al axis, we individually injected miR-206-MO, rtn4al mRNA and thbs3a mRNA into one-cell zebrafish embryos, followed by detection of the expression level of cxcr4a mRNA at 20 hpf. [score:3]
We found 33 and 60 genes greatly increased and decreased, respectively, in both miR-206-knockdown embryos and the rtn4al-overexpression embryos compared with the untreated embryos (electronic supplementary material, figure S4). [score:3]
Both miR-1 and miR-206 are known to share common expression in the skeletal muscle of organisms, ranging from Caenorhabditis elegans to humans [47, 48]. [score:3]
3.2. miR-206 was unable to silence reporter gene expression driven by mutated 3′UTR of rtn4aThe F indT ar, RNA22 and RNA hybrid software programs were used to analyse the 3′UTR of zebrafish rtn4a, and three putative binding sequences for miR-206 in rtn4a-3′UTR were found. [score:3]
Figure 7. Change of the expression levels of miR-206, Rtn4al, Cxcr4a and Thbs3a resulted in the failure of p-FAK to concentrate at the intersomitic boundary of defective boundary cells. [score:3]
However, the protein level of Rtn4al remained unchanged in the embryos injected with miR-1-MO (figure 2 j, lane 2), which shares an identical seed sequences with miR-206 and whose antisense oligonucleotide sequence were previously described by Lin et al. [5], indicating that the amount of Rtn4al protein is specifically regulated by miR-206, not miR-1, thus confirming our speculation. [score:2]
In particular, microRNA-206 (miR-206) has been reported as a regulator of muscle proliferation and differentiation, but its function in the mesoderm and somite cells of embryos remains unclear. [score:2]
Skeletal muscle-specific miR-206 is known to regulate the differentiation of muscle cells [45]. [score:2]
Figure 2. Knockdown of endogenous miR-206 increases the level of Rtn4al protein, causing abnormal transverse actin filaments across the somite boundary. [score:2]
Validation of miR-206 -targeting genes by luc activity assay. [score:2]
Novel miR-206/rtn4a/cxcr4a/thbs3 pathway was found in newly forming somites to maintain and stabilize somite boundary formationSkeletal muscle-specific miR-206 is known to regulate the differentiation of muscle cells [45]. [score:2]
By contrast, knockdown of miR-206 favours cells undergoing EMT. [score:2]
Knockdown of miR-206 increases rtn4al mRNA and Rtn4al protein in zebrafish embryos. [score:2]
To understand the functions of miR-206 at that particular stage, we searched for the target genes of miR-206 at 16 hpf through LAMP assay. [score:2]
Based on this foundation, we provide further insight into the molecular regulatory pathway that underlies the involvement of miR-206 in the somite boundary formation of zebrafish embryos. [score:2]
Instead, they are regulated by Rtn4a, which is mediated by miR-206, as determined in our results. [score:2]
miR-206 affects somite boundary formation by regulating MET. [score:2]
These findings allowed us to propose a novel miR-206/rtn4a/cxcr4a/thbs3a regulatory cascade that mediates the formation of normal somite boundary. [score:2]
Although miR-206 could be detected in the one-cell stage of zebrafish embryos [3], it was significantly increased in somites during developmental stages between 12 and 16 hpf [4, 5]. [score:2]
To search for the putative target genes of miR-206, we performed LAMP assay [6] with some modifications. [score:2]
Therefore, we propose a novel regulatory pathway, miR-206/rtn4a/cxcr4a/thbs3a, which modulates somite boundary formation in zebrafish embryos. [score:2]
This evidence indicated that injection of phRL-Myf5- rtn4a-3′UTR-mt2 abolishes the silencing effect of miR-206. [score:1]
Validation of miR-206 -targeting genes by luc activity assayDual luc reporter assay (Promega) was carried out in cell lines HEK-293T and C2C12 and zebrafish embryos by following the method described previously [5] with some modifications. [score:1]
As control-MO, we used miR-206- 5-mis-MO, as described previously [5]. [score:1]
We co -transfected 40 ng of plasmid pGL3-TK, which served as an internal control, 200 ng of each examined plasmid, including phRG-TK, phRG-TK- cited3-3′UTR, phRG-TK- gadd45ab-3′UTR, phRG-TK- znf142-3′UTR and phRG-TK- rtn4a-3′UTR, and 2 µg of plasmid pCS2- miR-206. [score:1]
However, unlike WT embryos, in the embryos injected with miR-206-MO (figure 7 d–f), rtn4al mRNA (figure 7 g–i), cxcr4a-MO (figure 7 j–l) and thbs3a mRNA (figure 7 m–o), the p-FAK signal did not present a high accumulation pattern towards the intersomitic position (white arrows), indicating that these defective boundary cells were unable to process epithelialization by the absence of intracellular p-FAK accumulation in the somite boundaries. [score:1]
However, in the miR-206-MO -injected embryos (figure 6 c, c′), rtn4al-mRNA -injected embryos (figure 6 d, d′), cxcr4a-MO -injected embryos (figure 6 e, e′) or thbs3a-mRNA -injected embryos (figure 6 f, f′), the epithelial cells of the somite boundary presented a circular shape, and centrosomes did not localize apically (figure 6 b′ –f′, arrowhead). [score:1]
Additionally, when cells from WT embryos were transplanted into either miR-206-MO- (figure 3 e–h) (n = 20) or rtn4al-mRNA -injected recipients (figure 3 i–l) (n = 18), no somite boundary defect was observed. [score:1]
Thus, we detected p-FAK signal in WT embryos and embryos injected with miR-206-MO, rtn4al-mRNA, cxcr4a-MO and thbs3a-mRNA. [score:1]
The percentages of embryos exhibiting defective formation of the somite boundary among examined embryos were 0% (n = 46) in the WT group, 52.1% (n = 48) in the miR-206-MO-injection group, 0% (n = 30) in the miR-206- 5-mis-MO-injection group, 56.4% (n = 55) in the rtn4al-mRNA-injection group, 59.2% (n = 49) in the cxc4a-MO -injected group, and 54.1% (n = 37) in the thbs3a-mRNA-injection group. [score:1]
Therefore, we detected the distribution pattern of p-FAK to confirm its concentration at the intersomitic boundary of embryos injected with miR-206-MO and rtn4al mRNA, and results showed the absence of intracellular accumulation of p-FAK in boundary cells. [score:1]
The resultant RNAs were diluted with distilled water for final molecular mass of microinjection into one embryo as follows: pre- miR-206 RNA, 200 pg; pre- miR-1 RNA, 200 pg; cited3 mRNA, 200 pg; rtn4al mRNA, 200 pg; rtn4am mRNA, 200 pg; rtn4an mRNA, 200 pg; and thbs3a mRNA, 400 pg. [score:1]
The miR-206/rtn4a/cxcr4a/thbs3a cascade plays a role in the MET of epithelial cells to form thesomite boundaryDuring somite boundary formation, the epithelial cells of the somite boundary become columnar in shape, undergo MET, and exhibit cell polarity which makes centrosomes localize apically [23, 36, 41]. [score:1]
Cxcr4a and Thbs3a are downstream effectors of the miR-206/rtn4al axis. [score:1]
Then, using bioinformatics analysis, no corresponding sequences specific for miR-206 binding were located at the 3′UTRs of cxcr4a and thbs3a. [score:1]
In zebrafish embryos, we co -injected 5 ng µl [−1] of pGL3-TK, which also served as an internal control, 5 ng µl [−1] of each examined plasmid, including phRL-Myf5, phRL-Myf5- cited3-3′UTR, phRL-Myf5- gadd45ab-3′UTR, phRL- znf142-3′UTR and phRL-Myf5- rtn4a-3′UTR, and 200 pg of synthesized pre- miR-206 or pre- miR-1 RNA. [score:1]
The 22-nt antisense sequences of miR-206 (EXIQON) [5] and the cDNA coding for rtn4al (NM001079912), cxcr4a (NM131882), thbs3a (NM173225), fgf8 (NM131281), deltad (NM130955), her1 (NM131078), tbx6 (NM153666), mespa (NM131551), mespb (NM131552), dgcr8 (NM001122749), pomt1 (NM001048067), nkiras2 (NM001003433), zgc56251 (BC046025), sall4 (NM001080609) or sdc4 (NM001048149) were used as probes. [score:1]
This evidence indicates that miR-206 is involved in balancing the EMT/MET biological process. [score:1]
The pre- miR-206 was labelled with biotin and then mixed with cell extracts. [score:1]
The amount of rtn4al mRNA in the untreated WT embryos at 20 hpf was normalized as 1, and the amount of rtn4al mRNA in embryos injected with miR-206-MO was 1.52 ± 0.31 (n = 3) (figure 2 h), which represents an approximately 52% increase. [score:1]
These constructs were separately co -transfected with pCS2- miR-206 into cell lines HEK-293T and C2C12 (figure 1 b). [score:1]
Using WISH, we found that miR-206 was detectable in somites and PSM as early as at 12 hpf, while rtn4al was detectable in somites at 16 hpf (electronic supplementary material, figure S1). [score:1]
Embryos classified as donor groups received injection of the green fluorescent dye Dextran alone or injection of Dextran combined with either miR-206-MO or rtn4al mRNA in Tg(α-actin:RFP). [score:1]
These data suggested that the effect of the miR-206/rtn4al axis on somite boundary formation is independent of the effect on somite formation, giving reason to hypothesize that it might be mediated through some unknown downstream effectors. [score:1]
The somite boundary was normally developed in WT embryos at 20 hpf (figure 4 a–c), while was incompletely formed in embryos injected with miR-206-MO (figure 4 d–f), miR-206- 5-mis-MO (figure 4 g–i), rtn4al mRNA (figure 4 j–l), cxcr4a-MO (figure 4 m–o) and thbs3a mRNA (figure 4 p–r). [score:1]
When embryos were injected with miR-206-MO, rtn4al mRNA, cxcr4a-MO and thbs3a mRNA, the somite boundary formation from the sixth to 20th somite of the embryos was examined at 20 and 48 hpf. [score:1]
These constructs were co -injected with either pre- miR-1 RNA or pre- miR-206 RNA into one-cell zebrafish embryos. [score:1]
The miR-206/rtn4a/cxcr4a/thbs3a cascade plays a role in the MET of epithelial cells to form thesomite boundary. [score:1]
The F indT ar, RNA22 and RNA hybrid software programs were used to analyse the 3′UTR of zebrafish rtn4a, and three putative binding sequences for miR-206 in rtn4a-3′UTR were found. [score:1]
After we injected miR-206-MO and rtn4al mRNAs separately into Tg(myf5:GFP) embryos, cells were dissociated from embryos at 20 hpf. [score:1]
This qPCR result was consistent with WISH detection in embryonic somites, which demonstrated that the rtn4al mRNA signal shown in miR-206-MO -injected embryos was stronger than that of WT (electronic supplementary material, figure S2). [score:1]
Thus, for the first time, we have demonstrated that a miR-206/rtn4a/cxcr4a/thbs3a axis is also importantly involved in controlling somite boundary formation during somitogenesis of zebrafish embryos. [score:1]
Briefly, the miR-206-MO -injected and rtn4al-mRNA -injected embryos from Tg(myf5:GFP) at 20 hpf were incubated with trypsin (Sigma; 59427C) for 20 min at room temperature. [score:1]
Figure 3. Transplantation of cells derived from either miR-206-MO- or rtn4al-mRNA -injected embryos causes recipient embryos to generate somite boundary defects. [score:1]
The sequence and injected amount of each MO were as follows: miR-1-MO (AATACATACTTCTTTACATTCCA, 8 ng) [5], miR206-MO (GATCTCACTGAAGCCACACACTTCC, 8 ng) [5], miR206- 5-mis-MO (GAT ATCA ATGAA CCCA AACA ATTCC, 8 ng) (the mismatched nucleotides are underlined) [5], rtn4a-MO (GAAAACAAACAAACCTTGAGCGAGT, 2 ng), cxcr4a-MO (AGAAGTCTTTTAGAGATGGCTTAT, 8 ng) [34], and thbs3a-MO (AGTAAAAGGCGAAAGATTTGTGCGT, 1 ng). [score:1]
Novel miR-206/rtn4a/cxcr4a/thbs3 pathway was found in newly forming somites to maintain and stabilize somite boundary formation. [score:1]
They share identical C-terminal sequence and 3′UTR, including 1422 ∼ 1444 nt, which was bound by miR-206 in the experiment described above (figure 2 a). [score:1]
This evidence indicated that miR-206 can only specifically silence the reporter gene through cited3- and rtn4a-3′UTR, even though miR-1 and miR-206 have identical seed sequences. [score:1]
Although somite patterning and somite boundary formation genes, such as fgf8, deltad, her1, tbx6, mespa, and mespb, were not significantly different from those of the control group (electronic supplementary material, figure S3), we observed that the ECM, consisting of fibronectin and laminin, was not correctly organized in the somite boundary of embryos at 20 hpf (figure 4) and 48 hpf (electronic supplementary material, figure S6; table S2) when embryos were injected with either miR-206-MO or rtn4al mRNA. [score:1]
Locations of the rtn4a-MO binding sequence (red line), miR-206 binding site at the 3′UTR of rtn4a mRNA (yellow box), and recognized region of antibody against Rtn4a protein (green line) were indicated. [score:1]
[1 to 20 of 128 sentences]
2
[+] score: 69
At the same time, however, miR-206 can also silence the expression of tissue inhibitor of metalloproteinase 3 (TIMP3), which inhibits TNFαfrom downregulating the process of differentiation. [score:10]
Therefore, similar to miR-206, which plays different functional roles in embryogenesis through its target genes, we concluded that miR-3906 inhibits the expression of either dkk3a or homer-1b at different developmental stages to ensure normal muscle development during myogenesis in embryos by facilitating specification or differentiation, respectively. [score:9]
Since, for example, it has been shown that miR-206 has different target genes at different stages of mouse embryonic development [4], we hypothesized that miR-3906 might also target specific genes affecting muscle development during embryonic development. [score:8]
Additionally, knockdown of miR-206 increases both the mRNA level and protein level of Pax3, suggesting that the expression of pax3 is negatively correlated with that of miR-206 and that miR-206 can control pax3 gene expression at the posttranscriptional level. [score:6]
Similar to miR-206, Different Target Genes of miR-3906 Play Unique Roles at each Stage of Embryonic DevelopmentIn responding to different developmental stages, miRNA plays a unique role in the dynamic process of embryo development. [score:6]
For example, the main function of miR-1, miR-133 and miR-206 is inhibition of their target genes in order to promote differentiation of muscle cells [7]– [9]. [score:5]
Similar to miR-206, Different Target Genes of miR-3906 Play Unique Roles at each Stage of Embryonic Development. [score:4]
It has also been shown that miR206 is involved in TGF-β signaling which inhibits muscle cells from further differentiation. [score:3]
Since TIMP3 is decreased by miR-206, the release of TNFαis increased, which results in enhancing the phosphorylation of p38 and expression of the muscle structural proteins Myogenin and MHCs. [score:3]
The expressions of miR-1, miR-133, miR-206 and miR-208 in muscle cells are mainly controlled by MRFs, serum response factor (SRF) and MEF2 [12]– [15]. [score:3]
In contrast, while miR-206 expression increases in limbs at HH24, it decreases at HH28. [score:3]
Thus, it appears that the expression of both pax3 and miR-206 in mouse limbs is dynamic and stage -dependent. [score:3]
Therefore, silencing of pax3 by miR-206 at the early somatic muscle developmental stage causes decreased specification and proliferation of muscle cells which, in turn, favors further differentiation of muscle cells. [score:2]
When muscle cells begin to differentiate, miR-206 silences HDAC4, allowing cells to differentiate and produce muscle regulatory protein MEF2 and muscle structure protein MHC [56]. [score:2]
WISH followed the method described previously by Lee et al. [26], except that anti-sense sequences of miR-3906 (AAAATCTGCATTCAAAATGCTTT), miR-206 (CCACACACTTCCTTACATTCCT) and control 22 nt (CGGAACGGTGCGTA- GCACAATT) (EXIQON) [17] were used. [score:1]
To illustrate this phenomenon, miR-206 has been shown to impact the function of transcription factor Pax3 in muscle cells. [score:1]
[1 to 20 of 16 sentences]
3
[+] score: 37
Situation Reference Translational regulation of utrophin:, related to Duchenne muscular dystrophy, mediates the repression, and confirms repression of miR-206Basu et al. (2011) Formation of homologue clusters with miR-206: dysregulation roleNohata et al. (2012) Upregulation during late stages of human, fetal muscle developmentKoutsoulidou et al. (2011) When downregulated, may have important implications in pathogenesis of essential hypertensionYu et al. (2011a) Co-regulation of with miR-206, novel biomarkers of Th 17-type immune reactionsHaas et al. (2011) Desregulation of is associated with overall survival and metastasis in colorectal cancerAkcakaya et al. (2011) Increase of in mouse pectoralis muscle: regulation by myostatinRachagani et al. (2010) Upregulated in mouse liver by tyrosine hormoneDong et al. (2010) MiR-133b is upregulated on head and neck cancerLiu et al. (2009) Mir-133b is regulated by endurance exercise in human skeletal muscleNielsen et al. (2010) Mir-133b is a biomarker of myocardial infectionD’Alessandra et al. (2010) MiR-133b targets prosurvival molecules MCL-1 and BCL262 in lung cancerCrawford et al. (2009) Table 2 Downregulation of in different cancers. [score:27]
Expression of miR-1, miR-133a, and miR-206 increases during development of human skeletal muscle. [score:4]
Expression of and miR-206 in the Il17a/f locus is co-regulated with IL-17 production in alphabeta and gamma delta T cells. [score:4]
microRNA-1/133a and microRNA-206/133b clusters: dysregulation and functional roles in human cancers. [score:2]
[1 to 20 of 4 sentences]
4
[+] score: 15
The 3 ng/embryo of control mimic (5’-UCACAACCUCCUAGAAAGAGUAGA-3’), 1.5 and 3 ng/embryo miR-145 mimic (5’-GUCCAGUUUUCCCAGGAAUCCCU-3’), 3 ng/embryo miR-9 mimic (5’-UCUUUGGUUAUCUAGCUGUAUGA-3’), 0.03ng/embryo miR-206 mimic (5′-UGGAAUGUAAGGAAGUGUGUGG-3’), 3 ng/embryo miR-731 mimic (5’-AAUGACACGUUUUCUCCCGGAUCG-3’), 3 ng/embryo miR-217 mimic (5’-UACUGCAUCAGGAACUGAUUGG-3’) and 1.5 and 3 ng/embryo miR-145 inhibitor (Dharmacon, Thermo) were injected into one-cell stage embryos. [score:3]
From miRNAs prediction of GrnA, miR-9, miR-206, miR-731, and miR-217 on 3’ UTR were predicted by TargetScan (http://www. [score:3]
The EGFP expression of Tg (fabp10: EGFP) fish showed no significantly changes in liver size in miR-9 mimic-, miR-206 mimic-, miR-731 mimic- and miR-217 mimic -injected fish, but the miR-145 mimic -injected fish has a smaller liver size (Fig 1B). [score:3]
Because the 3’UTR of GrnA is 487 nucleotides in size, there are only putative four miRNAs, including miR-9, miR-206, miR-731 and miR-217 predicted by TargetScan. [score:3]
Liver morphology at 4 dpf was observed after injecting control mimic, miR-145 mimic, miR-9 mimic, miR-206 mimic, miR-731 mimic and miR-217 mimic in Tg(fabp10: EGFP) embryos. [score:1]
The miRNA predictions of GrnA included miR-9, miR-206, miR-731, miR-217 on 3’UTR and miR-145 on CDS region (Fig 1A). [score:1]
The miR-206 is a muscle specific miRNA participating in myogenesis [32]. [score:1]
[1 to 20 of 7 sentences]
5
[+] score: 15
Other miRNAs from this paper: dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-205, dre-mir-214, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-7a-3, dre-mir-30c, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-140, dre-mir-206-2, dre-mir-375-1, dre-mir-375-2, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j
In contrast to the data obtained for endogenous miR-206, there was no decrease observed in the amount of injected miR-206 in the morpholino -injected embryos (Figure 1D) (endogenous miR-206 is not yet expressed at this stage). [score:3]
These morpholinos were injected under similar conditions as described for miR-206 and compared to the morpholino targeting mature miR-205. [score:2]
We could still detect miR-206, indicating that there is no effect of the morpholino on the RNA isolation procedure (Figure 1D). [score:1]
To examine the effect of a morpholino on the isolation of a mature miRNA, we incubated a mature miR-206 duplex and a control duplex (miR-205) with a morpholino against miR-206 in vitro. [score:1]
Co -injected miR-206 serves as an injection and loading control. [score:1]
Therefore, we injected a mature miR-206 and a control duplex (miR-205) together with a morpholino against miR-206 in the embryo. [score:1]
After incubation for 8 h, RNA was isolated and subjected to Northern blot analysis to probe for injected miR-206 and injected miR-205. [score:1]
Co -injected miR-206 serves as a loading and injection control. [score:1]
After isolation, samples were analyzed by Northern blotting for the presence of miR-206 and miR-205. [score:1]
Figure 1 (A) Northern blot for miR-206 in wild-type and MO miR-206–injected embryos at 24, 48, and 72 hpf. [score:1]
However, when morpholino and miRNA duplex were incubated together in vitro and loaded on a denaturing gel without isolation, we observed a decrease in the signal for miR-206, indicating that the morpholino can bind to the miRNA in vitro and still does so in the denaturing gel. [score:1]
We injected 1 nl of 600 μM morpholino solution with a morpholino complementary to the mature miR-206 in one- or two-cell–stage embryos. [score:1]
[1 to 20 of 12 sentences]
6
[+] score: 13
The dre-miR-206 is a member of zebrafish miR-1 family, which control angiogenesis by regulating VegfA expression during embryonic development [38] and abundantly expressed throughout all eight stages (Figure  5C). [score:7]
To verify the expression profiles of known miRNAs, we selected four miRNAs (dre-miR-456, dre-miR-22a, dre-miR-206, and dre-miR-192) from the last group based on their known or potential roles in zebrafish early development. [score:4]
Quantitative real-time PCR (qRT-PCR) assays (miScript Reverse Transcription Kit and miScript SYBR Green PCR Kit, Qiagen) were performed to determine the expression levels of four known miRNAs (dre-miR-456, dre-miR-22a, dre-miR-206 and dre-miR-192). [score:2]
[1 to 20 of 3 sentences]
7
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
MIR-206 regulates connexin43 expression during skeletal muscle development. [score:5]
Further, like the comparison between MiR23b and MiR24.1, expression of MiR206 was much weaker than the expression observed for MiR133b. [score:4]
Like Mir23b, Mir133b exists in a cluster with Mir206, which had a similar pattern of expression to that of Mir133b. [score:2]
Muscle-specific microRNA miR-206 promotes muscle differentiation. [score:1]
[1 to 20 of 4 sentences]
8
[+] score: 6
As major outcomes we show that (1) miR-208 was unexpectedly absent in cartilaginous and ray-finned fish genomes whereas it still exist in other vertebrate groups; (2) miR-499 was intergenic in medaka and stickleback conversely to other vertebrates where this miRNA is intronic; (3) the zebrafish genome is the unique harboring two extra paralogous copies of miR-499 and their host gene (Myh7b); (4) a rare deletion event of the intergenic and bicistronic cluster miR-1-1/133a-2 took place only into Tetraodontiformes genomes (pufferfish and spotted green puffer); (5) the zebrafish genome experienced a duplication event of miR-206/-133b; and (6) miR-214 was specifically duplicated in species belonging to superorder Acanthopterygii. [score:1]
We also can propose that the miR-206/-133 cluster was just recently duplicated in zebrafish, because extra copies of this locus were not detected in any other vertebrate genome. [score:1]
The miR-206/-133b cluster presented higher synteny at downstream than at upstream genes (Figure  1C). [score:1]
Looking at miRNAs location we found that miR-1-1/133a-2, miR-1-2/133a-1 and miR-206/133b form bicistronic clusters in fish, exactly as in the genome of mammals [32, 33]. [score:1]
Zebrafish was the unique species carrying two miR-206/-133b clusters, each at chromosomes 17 and 20. [score:1]
Then, this extra copy of the miR-1/-133a cluster probably acquired a function and was maintained in Chondrichthyes, whereas it was converted into a novel miR-206/-133b cluster retained in the genome of the remaining vertebrate groups over evolution [36]. [score:1]
[1 to 20 of 6 sentences]
9
[+] score: 6
A third paralogous gene cluster encodes the miR-206/miR-133b pair, which is only expressed in the skeletal muscle. [score:3]
The first report of an equivalent reprogramming event used an ‘educated guess’ approach to test the individual and combined effects of six miRs with reported cardiac functions (miR-1; miR-126-3p; miR-133a; miR-138, miR-206; miR-208a) to induce fibroblast trans-differentiation [90]. [score:1]
Strikingly, the association between GATA-4 and the miR-206/133b gene cluster was lost during mammalian evolution, although it is still retained in all other vertebrates. [score:1]
One of the miR-1 paralogs was later converted into the skeletal muscle specific miR-206, roughly at the time of the teleost divergence [110]. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, there were seven miRNAs that were only expressed at high levels in one neural tissue, for example let-7b, miR-16, miR-22, miR-206, and miR-143 specifically expressed in olfactory bulb (Fig. 3b). [score:5]
Olfactory bulb let-7b, let-7c-1, let-7c-2, miR-10a, miR-16, miR-17, miR-21, miR-22, miR-28, miR-29c, miR-124a-1, miR-124a-3, miR-128a, miR-135b, miR-143, miR-148b, miR-150, miR-199a, miR-206, miR-217, miR-223, miR-29b-1, miR-329, miR-331, miR-429, miR-451. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 4
Expression of miR-1, miR-133a, miR-133b and miR-206 increases during development of human skeletal muscle. [score:4]
[1 to 20 of 1 sentences]
12
[+] score: 3
Fig. 2 miR-1 and miR-206 silence different target genes and play opposing roles in zebrafish angiogenesis. [score:3]
[1 to 20 of 1 sentences]
13
[+] score: 2
microRNA-1 and microRNA-206 regulate skeletal muscle satellite cell proliferation and differentiation by repressing Pax7. [score:2]
[1 to 20 of 1 sentences]
14
[+] score: 1
In the short term, we will standardize the tRF-IDs such that a given ID will identify tRFs with the same sequence in different species, much like mmu-miR-206 and hsa-miR-206, which identify microRNAs with the same sequence in mouse and human, respectively. [score:1]
[1 to 20 of 1 sentences]