sort by

14 publications mentioning dre-mir-29b-1

Open access articles that are associated with the species Danio rerio and mention the gene name mir-29b-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 191
Specifically, in the heart, miR-29 family up-regulation is associated with cardiac development and growth regulation [59] whereas its down-regulation is involved in cardiac tissue remo deling after myocardial infarction [43]. [score:9]
Age -dependent miR-29 family up-regulation correlates with regulation of collagen and methylation levels in Nothobranchius furzeri heartMiR-29 family, one of the most upregulated miRNAs, was further evaluated for its well-known role during aging and cardiovascular diseases. [score:8]
Red dots show miR-29-sponge up-regulated genes, blue dots show Wild Type up-regulated genes. [score:7]
The increased expression levels of col1a1, col1a2 and col15a1, all known direct targets of miR-29, further confirmed an accumulation of collagen deposition in the miR-29-sponge heart (Fig.   6 panel C). [score:6]
In HCF derived from old donors, all miR-29 family members were upregulated (Figure  S1 panel A), with a parallel decrease of col3a1 expression (Figure  S1 panel B) and global 5mC level (Figure  S1 panel C). [score:6]
Consistently, the DNMT inhibitor RG108 exerted the same effect of miR-29a or miR-29b mimics (Fig.   9 panel C), further suggesting a potential role for miR-29 family in preventing hypoxia -dependent hypermethylation via down-regulation of DNMTs 66, 67. [score:6]
Specifically, miRNA-seq analysis identified 5 up-regulated cardiac specific miRNAs (miR-29a, miR-29b, miR-133, miR-193 and miR-223) previously identified for being regulators of cardiac development and homeostasis (Fig.   2). [score:6]
Interestingly, the analysis of miRNA expression performed in different Nfu organs, including brain, liver, heart and skin, revealed miR-29 family together with miR-27d as one of the only two consistently up-regulated miRNAs during aging in all the four tissues (Figure  S5) [34]. [score:6]
Age -dependent miR-29 family up-regulation correlates with regulation of collagen and methylation levels in Nothobranchius furzeri heart. [score:5]
Targetscan software [50] predicted about 51 common targets for miR-29a, miR-29b, miR-133, miR-193 and miR-223 (Fig.   2C, middle panel). [score:5]
Noteworthy, the ROS scavenger N-acetyl cysteine (NAC) counteracted the effect of H [2]O [2] on expression of miR-29 expression (Figure  S2 panel A and Fig.   4 panel A) suggesting a link between miR-29 and oxidative stress. [score:5]
To functionally analyze the role of miR-29 in the heart we generated a transgenic zebrafish mo del where miR-29 biological activity was antagonized by the stable expression of a competitive inhibitor (a 3′-UTR containing seven repeats of the miR-29 binding site: miR-29-sponge) under the control of the actin beta-2 promoter (actb2:eGFP-sponge-29) of Danio renio 35, 62. [score:5]
Full-length blot is presented in Supplementary Figure 6. (B) qRT-PCR mRNA analysis of hypoxia associated genes: erythropoietin alpha (epoa); hexokinase2 (hk2); heme oxygenase1a (hmox1a); lactate dehydrogenase A (ldha); cyclin -dependent kinase inhibitor 1B (p27) in Wild Type (black circles; n = 4) and miR-29-sponge (gray squares; n = 4) Zebrafish hearts expressed as fold-change versus Wild Type samples. [score:5]
miR-29 family knock-down changes global methylation level and collagen expression in Zebrafish. [score:4]
Of note, the knock-down of miR-29 family in zebrafish transgenic animal embryo by expression of a specific sponge (miR-29-sponge) [35] compromised cardiac function and morphology, enhancing both fibrosis and global DNA methylation. [score:4]
Genes regulated by miR-29 depletion ( ± 0.5 log2 fold change, basemean > 5, fdr < 0.05) derived from mRNASeq of zebrafish samples were imported into the Ingenuity Pathways Analysis Software (Qiagen - Version 39480507) to reveal top disease affected categories by genetic networks. [score:4]
Biological function gene ontology of up-regulated genes in miR-29-sponge Zebrafish hearts (red bars). [score:4]
Given the up-regulation of miR-29 during aging in multiple organs, this protective action could represent a general phenomenon. [score:4]
List of genes is provided also in supplemental table  5. (B) Volcano plot of differentially regulated genes expressed in the heart of Wild Type and miR-29-sponge Zebrafish. [score:4]
Figure 3Age -dependent miR-29 family up-regulation affects collagen and methylation levels in N. furzeri heart. [score:4]
Despite age -dependent upregulation, antagonism of miR-29 exacerbates brain aging indicating that miR-29 has a protective role in neurons [35]. [score:4]
Intriguingly, after treatment with H [2]O [2], the transcripts coding for miR-29 target genes, including col1a1, col11 and dnmt1, dnmt3a and dnmt3b, were down regulated while NAC partially restored their normal mRNA levels (Fig.   4 panels B and C). [score:4]
Moreover, gene ontology analysis of biological functions obtained by Gene set enrichment analysis (GSEA) pointed out an up-regulation of cellular response to stress and methylation (Fig.   7 panel D; red bar graph) as well as a down-modulation of response to oxidative stress and cardiac morphology and functions (Fig.   7 panel D; blue bar graph), which fully correlate with our experimental evidences on miR-29 sponge fish in comparison to Wild Type. [score:4]
Table  2, miR-29a, miR-29b, miR-133, miR-193 and miR-223 were selected among the 10 most up-regulated miRNAs associated to the aging heart 43, 47– 49. [score:4]
Myocardial infarction, in fact, induces a down-regulation of miR-29 which event, in turn, is partially responsible for fibrosis [43]. [score:4]
MiR-29 family, one of the most upregulated miRNAs, was further evaluated for its well-known role during aging and cardiovascular diseases. [score:4]
Interestingly, these miRNAs control the expression of collagen genes and are themselves controlled by TGF-β [44] suggesting for a direct link between miR-29 family and the progress of inflammatory responses. [score:4]
Figure 9Hypoxia affects miR-29 family and its related targets. [score:3]
Similarly, expression of miR-29 counteracts age -dependent oxidative damage in the brain [35]. [score:3]
Figure 4Oxidative stress affects miR-29 family and its targets. [score:3]
Of note, exogenous expression of miR-29a/b mimics rescued the hypoxic and fibrotic phenotype (Fig.   9 panel B) suggesting a possible protective role of miR-29 family to counteract hypoxia-related collagen deposition and consequently fibrosis. [score:3]
Noteworthy, transfection of miR-29a or miR-29b mimics or treatment with the DNMT inhibitor RG108 significantly protected cardiac cells from the detrimental effects of hypoxia. [score:3]
Oxidative stress induces expression of microRNA-29 family. [score:3]
Upon miR-29 knockdown, no significant changes were detected in terms of survival during the first year of age (data not shown). [score:2]
Ingenuity pathway analysis on genes regulated by miR-29 depletion ( ± 0.5 log2 fold change, basemean > 5, fdr < 0.05) revealed a predicted activation of the hypertrophic response in miR-29 sponge fish, perfectly fitting with the observed cardiac phenotype (Fig.   7 panel C). [score:2]
Interestingly, 350 transcripts were found up regulated in the miR-29-sponge compare to Wild type hearts (suppl. [score:2]
Taken altogether, these data suggested that miR-29 family is regulated by ROS. [score:2]
In the cardiovascular system, miR-29 family has multiple roles: i) is known to be involved in atrial fibrillation [69]; ii) may act as a negative regulator of fibrosis counteracting miR-21 function 43, 70, 71; iii) controls cardiomyocytes apoptosis and aortic aneurism formation 30, 72. [score:2]
In addition, miR-29 has been described to be up regulated during cardiac aging in mouse [30]. [score:2]
In the present study, by using human cardiac fibroblasts, we demonstrated for the first time that miR-29 family is regulated by oxidative stress level. [score:2]
To further explore the effect of miR-29 family depletion on the cardiac molecular phenotype, RNA sequencing (RNA-seq) was performed on the whole heart of wt and miR-29-sponge fish. [score:1]
Calibration bar = 1 mm (B) Representative echocardiography of Wild Type (left panels) and miR-29-sponge (right panels) Zebrafish hearts showing end-diastolic area (EDA; first and third panel) and end-systolic area (ESA; second and fourth panel) Calibration bar = 1 mm. [score:1]
Hence, we propose here that the physiological accumulation of oxidative stress during aging may control miR-29 family establishing a protective mechanism to limit cardiac fibrosis. [score:1]
Figure 8Hypoxic markers accumulate in miR-29-sponge Zebrafish hearts. [score:1]
This evidence prompted us to investigate miR-29 family expression in cardiac fibroblasts maintained in the presence of 1% O [2], the standard in vitro hypoxic condition. [score:1]
Specifically, miR-29 sponge fish showed a FAC of 16%, whereas control animals had values of about 30% (Fig.   5 panel D). [score:1]
For long RNA sequencing, RNA was isolated from 3 zebrafish hearts for each condition (wt and miR-29-sponge) using the miRNeasy micro Kit (Qiagen) combined with on-column DNase digestion (DNase-Free DNase Set, Qiagen) to avoid contamination by genomic DNA. [score:1]
In order to assess cardiac function in Wild type and miR-29-sponge zebrafish, animals were anesthetized with low-dose tricaine solution (0.04 mg/mL) and placed in a Petri dish filled with a custom-made sponge, with the ventral side upward. [score:1]
HCFs were transfected by Lipofectamine RNAiMAX Transfection Reagent (Life Technologies) according manufacture’s instruction with miRVana miRNA mimic for hsa-miR-29a-3p, hsa-miR-29b-3p or scramble (Ambion). [score:1]
In these experiments, we detected a transient down-modulation of miR-29a and miR-29b leading to collagen deposition and fibrosis, a molecular scenario similar to that observed in the heart of the miR-29-sponge transgenic fish. [score:1]
To investigate the effect of hypoxia on miR-29 family and its targets, HCFs were exposed to 1% O [2] concentration for 48 hours. [score:1]
The sensitivity of miR-29a and miR-29b to O [2] reduction was confirmed also by pri-miR-29 analysis. [score:1]
In this perspective, miR-29 family members are of particular interest for cardiac pathophysiology. [score:1]
miR-29 family resulted sensitive to 200 µM H [2]O [2] already after 24 h of treatment (Figure  S2 panel A and Fig.   4 panel A). [score:1]
Specifically, supplemental figure  S4 panel C shows a significant decrease of pri-miR-29a/b after hypoxia whereas the level of pri-miR-29b/c remained stable. [score:1]
Morphologically, we found a significant cardiac spherization in fish injected with miR-29-sponges detectable by 2D-echo analysis (Fig.   5 panel B) and visible hypertrophy that were confirmed by histological examinations (Fig.   5 panel E). [score:1]
Indeed, our results suggest that the miR-29 family strongly affects gene transcription possibly via age-associate DNA methylation changes in Nfu. [score:1]
Because of its biological relevance in cardiac pathophysiology, we focused our attention on miR-29 family. [score:1]
Moreover, miR-29 family play a role during DNA methylation / demethylation control [57] and cellular reprogramming [58]. [score:1]
Hematoxylin/eosine-stained sections were prepared to visualize ventricle of wt and miR-29-sponge zebrafish. [score:1]
To investigate the potential relationship between the accumulation of ROS in the heart (see Fig.   1 panels D and E) and the increase in miR-29 family member expression (Fig.   3 panel A), differentiated H9C2 rat cardiomyoblasts and human cardiac fibroblasts (HCF) were exposed to H [2]O [2] [46]. [score:1]
Hypoxia induces hypermethylation and fibrosis by miR-29 family down-modulation. [score:1]
Figure 7Identification of miR-29 associated cardiac transcriptome. [score:1]
Calibration bar = 25 µm (B) Collagen deposition quantification in sections derived from Wild Type (black circles; n = 8) and miR-29-sponge (gray squares; n = 8) Zebrafish hearts. [score:1]
[1 to 20 of 64 sentences]
2
[+] score: 124
We refined this list by focusing on target genes whose expression was inversely correlated with the miRNA expression (i. e. potentially downregulated), and using a Targetscan context + score of < −0.30 for at least one binding site, we identified five predicted gene targets for miR-29b and four for miR-223 (Table  4). [score:14]
Oligonucleotides containing either the putative binding site of miR-29b or miR-223 from the target gene 3’ UTRs (predicted by Targetscan Fish; Additional file 9: Table S6) were annealed and ligated using NheI and SalI restriction enzymes sites downstream of the luciferase reporter gene in pmirGLO Duel Luciferase miRNA target Expression Vector (Promega). [score:9]
In addition to indirectly reorganizing the cytoskeleton by modulating membrane signaling mechanisms, our data highlight ways in which miR-29b may directly target members of the intermediate filaments of the cytoskeleton, by regulating expression of internexin (ina) and neurofilament-medium homolog b (nefmb) [70]. [score:8]
We focused our subsequent investigation on two of the miRNAs over-expressed after nerve injury, miR-29b and miR-223, as their increased expression (16 and 55 % increase, respectively) is pertinent when considering the role of miRNAs is to negatively regulate their target genes [18], and unlike miR-21 [19], they have not been extensively studied in the brain. [score:6]
A list of genes in each GO category is in Additional file 7: Table S4 Table 4 Putative miR-29b and miR-223 targets downregulated after optic nerve crush Ensembl ID GenemRNA change [a] miRNAContext + score [b] No. [score:6]
These results suggest a propensity for miR-29b to target genes associated with DNA modification and extracellular matrix (ECM) activities (Fig.   5, Additional file 6: Table S3), in contrast to miR-223 whose putative targets appeared to fall into nucleoside catabolic processes (particularly purine metabolism) and GTPase regulators (Fig.   6, Additional file 7: Table S4). [score:6]
This restrained cell death may be associated with several downregulated genes in our dataset that we functionally validated for the first time as targets genes of miR-29b and miR-223, including eva1a, layna, si:ch211-51a6.2 (a homolog of prss12), smoc1 and es1-like homolog, sb:cb252. [score:6]
Fig. 5Gene ontology of miR-29b predicted targets from Targetscan Fish. [score:5]
Unfiltered enriched GO terms associated with miR-29b predicted target genes sourced from Targetscan Fish database. [score:5]
Microarray and corresponding expression of genes predicted to be targeted by miR-29b (a) or miR-223 (b). [score:5]
We then integrated the predicted gene list with our own differentially expressed gene set and this revealed 11 predicted target genes for miR-29b and 13 for miR-223. [score:5]
Luciferase results revealed significant inhibition of luciferase activity for miR-29b with all of its predicted gene targets (i. e., eva1a, layna, nefmb, ina and si:ch211-51a6.2). [score:5]
We focused on two of these, miR-29b and miR-223, and validated seven of their target genes that were under-expressed in our dataset. [score:5]
We focused on two over-expressed miRNAs (miR-29b and miR-223), and functionally validated seven of their predicted gene targets using and luciferase assays to confirm miRNA-mRNA binding. [score:4]
In this study, we show for the first time that miR-29b and miR-223, are significantly over-expressed after optic nerve crush. [score:3]
miR-29b and miR-223 target genes share common functions surrounding the HSPG, agrin. [score:3]
Validation of putative target genes of miR-223 and miR-29b. [score:3]
miR-29b has been associated with ECM remo deling, and shown to have both pro- and anti-apoptotic properties depending on the CNS injury/disease mo del [35– 38]. [score:3]
binding sites ENSDART00000087565 eva1a 0.61 miR-29b −0.46 1 (8mer) eva-1 homolog a (miR-223) [c] (−0.09) 1 (7mer-1A) ENSDART00000050945 layna 0.45 miR-29b −0.50 1 (8mer) Layilin a (miR-223) [c] (−0.16; −0.17) 2 (7mer-1A) ENSDART00000064163 nefmb 0.28 miR-29b −0.41 1 (8mer) Neurofilament, medium polypeptide, b ENSDART00000018351 ina (zgc:65851) 0.50 miR-29b −0.41; −0.05 2 (8mer; 7mer-1A) Internexin neuronal intermediate filament alpha (miR-223) [c] (−0.02; >0.03; >0.01) 3 (8mer; 7mer-m8; 7mer-1A) ENSDART00000021556 si:ch211-51a6.2 0.57 miR-29b −0.33 1 (7mer-m8) Homolog of prss12 miR-223 −0.32; −0.07 2 (7mer-m8; 7mer-1A) ENSDART00000126365 smoc1 0.41 miR-223 −0.39; > − 0.02 2 (8mer; 7mer-m8) SPARC related modular calcium binding 1 ENSDART00000124670 lrrn3 0.65 miR-223 −0.32 1 (8mer) Leucine rich repeat neuronal protein 3-like ENSDART00000081039 [d] sb:cb252 52.9 miR-223 −0.31 1 (7mer-m8) Homolog of es1-like [a]Fold change represents microarray expression. [score:3]
Sequence of miR-29b (a) and miR-223 (b) binding sites within 3’UTR of predicted target genes (nt, nucleotide position in 3’ UTR). [score:3]
Fig. 7Validation of miR-29b and miR-223 putative gene targets from integration analysis. [score:3]
This approach resulted in 427 and 505 unique putative Ensembl target genes for miR-29b and miR-223, respectively. [score:3]
Gene ontology analysis placed the miRNA-regulated genes (eva1a, layna, nefmb, ina, si:ch211-51a6.2, smoc1, sb:cb252) in key biological processes that included cell survival/apoptosis, ECM-cytoskeleton signaling, and heparan sulfate proteoglycan binding, Our results suggest a key role for miR-29b and miR-223 in zebrafish regeneration. [score:2]
Synthetic miRNA molecules (mirVana miRNA mimics) corresponding to miR-223 (Product ID: MC10903), miR-29b (Product ID: MC10432) and a negative control miRNA (miR-NC: Product ID 4464076) were obtained from Ambion (Life Technologies). [score:1]
Our results provide a basis from which to investigate the cellular processes required for central nervous system regeneration, and further studies will examine more extensively the complete repertoire of mRNA targets of miR-29b and miR-223 (e. g., using high-throughput sequencing of RNA isolated by crosslinking immunoprecipitation (HITS-CLIP) [80]). [score:1]
In zebrafish, miR-29b is part of the miR-29 family that comprises three intergenic members that map to chromosome 4 (miR-29a and miR-29b-2 located within 10Kb of each other; miR-29b-2 referred to as miR-29b herein), and chromosome 6 (miR-29b-1; [34]). [score:1]
The miRNAs: mir-29b and miR-223. [score:1]
Levels of miR-29 and miR-223 were normalized to U6 snRNA and relative fold change between control and crush tissue was determined using 2 [-ΔΔCt] method. [score:1]
The miR-29b target, si:ch211-51a6.2, is not characterised in zebrafish but is a homologue of the serine protease, neurotrypsin (prss12). [score:1]
HEK293 cells were transfected with either a wild type (WT) or mutated construct (MT), along with a miRNA mimic (miR-29/miR-223) or negative control (miR-NC). [score:1]
The role of miRNAs, including the miR-29 family, in modifying ECM-cell signaling has recently been highlighted [53]. [score:1]
Columns represent the luciferase activity of either WT or MT constructs with miR-29b (a) or miR-223 (b), relative to transfection with the same construct and miR-NC. [score:1]
[1 to 20 of 32 sentences]
3
[+] score: 87
e Heat maps profiles for change in expression of selected miRNAs Table 2 Cold shock -induced differential expression of known miRNAs miRNA Mature miRNA sequence Fold change Up-regulated miRNAs  Dre-mir-29b-1 UAGCACCAUUUGAAAUCAGUGU 3.90  Dre-mir-99-2 AACCCGUAGAUCCGAUCUUGUG 2.04  Dre-mir-99-1 AACCCGUAGAUCCGAUCUUGUG 1.79  Dre-mir-92a-2 UAUUGCACUUGUCCCGGCCUGU 1.75  Dre-mir-2184 AACAGUAAGAGUUUAUGUGCU 1.73 Down-regulated miRNAs  Dre-mir-737 AAUCAAAACCUAAAGAAAAUA −1.71  Dre-mir-9-2 UCUUUGGUUAUCUAGCUGUAUGA −1.75  Dre-mir-363 AAUUGCACGGUAUCCAUCUGUA −1.79  Dre-mir-125b-2 UCCCUGAGACCCUAACUUGUGA −1.91  Dre-mir-199-1 CCCAGUGUUCAGACUACCUGUUC −2.79 After eliminating miRNAs whose expression might be changed due to development process during incubation (control vs normal). [score:14]
Dre-mir-29b targets per2 mRNA and regulates its expression dynamically during cold treatmentThe increase in cold tolerance in per2 -overexpressing fish suggests a pivotal role of circadian clock genes against cold stress. [score:8]
To clarify the interaction between per2 and associated dre-mir-29b, we examined their dynamic expression during cold shock and found good correlations for dre-mir-29b to serve as an inhibitor of per2 expression. [score:7]
Core clock gene per2 plays a major role in regulating circadian rhythm and daily metabolism [34]; we found that dre-mir-29b (dre denotes Danio rerio) can target per2 in zebrafish larvae to possibly regulate cold shock response via modulating the expression of per2. [score:7]
Dre-mir-29b targets per2 mRNA and regulates its expression dynamically during cold treatment. [score:6]
The top 5 of 29 up- and 26 down-regulated known miRNAs (annotated in miRBase v18) are shown, along with their sequences and fold changes compared to the control groups We performed qPCR analysis to validate the changes of the cold-affected miRNAs (dre-mir-29b, the most up-regulated miRNA, and 9 other randomly selected miRNAs) and compared them to those observed in small RNA-seq results (Fig.   3a). [score:5]
The 3′ untranslated region (UTR) of per2 containing dre-mir-29b target site was amplified from the cDNA library by the forward (F) and reverse (R) primers of the following sequences. [score:4]
These results suggested that dre-mir-29b may act to control the per2 expression -induced by cold shock. [score:3]
This data suggests that dre-mir-29b MO can prohibit dre- mir-29b targeting per2 mRNAs. [score:3]
In contrast, the dre-mir-29b expression increased afterwards, but a sudden drop was observed at 24 hpi. [score:3]
a per2 is a predicted target of dre-mir-29b. [score:3]
b 1-cell embryos were injected 50 pg pEGFPC1 bearing 3′UTR of per2 target site in the presence or absence of 5 ng mir-29b MO and examined at 90% epiboly stage under epifluorescent microscopy using a FITC cube. [score:3]
We further validated the targeting of per2 by its associated miRNA, dre-mir-29b, which was also induced by cold shock. [score:3]
Dre-miR-29b is the top one cold -induced miRNA with a predicted target of per2. [score:3]
Reporter assay of dre-mir-29bThe 3′ untranslated region (UTR) of per2 containing dre-mir-29b target site was amplified from the cDNA library by the forward (F) and reverse (R) primers of the following sequences. [score:3]
It appeared that both dre-mir-29b and per2 expression was elevated at 4 hpi. [score:3]
A fragment of 3′ untranslated region (3′UTR) containing the complementary nucleotides of dre-mir-29b is shown. [score:3]
Plasmids were mixed with or without dre-mir-29b morpholino (5′ACACTGATTTCAAATGGTGCTAGAT3′). [score:1]
In addition, we validated the interaction of per2 with its associate miRNA, dre-mir-29b, which is also cold-inducible. [score:1]
We selected dre-miR-29b to illuminate how miRNA affect transcriptome plasticity during cold shock (Fig.   7a). [score:1]
c The percentages of EGFP - positive embryos injected without or with dre-mir-29b are shown. [score:1]
To address this, we injected pEGFPC1- per2 3′UTR with or without dre-mir-29b morpholino oligonucleotides (MO) (Fig.   7b). [score:1]
We further showed that the fine tuning of core clock gene per2 via its associated miRNA, dre-mir-29b, can enhance the cold tolerance of zebrafish larvae. [score:1]
[1 to 20 of 23 sentences]
4
[+] score: 20
Other miRNAs from this paper: dre-mir-10a, dre-mir-10b-1, dre-mir-183, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-mir-1-2, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-15a-1, dre-mir-15a-2, dre-mir-17a-1, dre-mir-17a-2, dre-mir-20a, dre-mir-29b-2, dre-mir-29a, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-101a, dre-mir-101b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-145, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-mir-499, ola-mir-430a-1, ola-mir-430c-1, ola-mir-430b-1, ola-mir-430c-2, ola-mir-430c-3, ola-mir-430d-1, ola-mir-430a-2, ola-mir-430c-4, ola-mir-430d-2, ola-mir-430a-3, ola-mir-430a-4, ola-mir-430c-5, ola-mir-430d-3, ola-mir-430b-2, ola-mir-430c-6, ola-mir-430c-7, ola-mir-20a-1, ola-mir-92a-2, ola-mir-9a-2, ola-mir-101a, ola-mir-9b-1, ola-mir-499, ola-let-7a-1, ola-mir-9a-3, ola-mir-183-1, ola-let-7a-2, ola-mir-29b-1, ola-mir-29a, ola-mir-124-1, ola-mir-124-2, ola-mir-9a-4, ola-mir-101b, ola-let-7a-4, ola-mir-10d, ola-mir-9a-1, ola-mir-92b, ola-mir-9b-2, ola-mir-1-2, ola-mir-124-3, ola-mir-15a, ola-mir-10b, ola-mir-92a-1, ola-mir-20a-2, ola-mir-17, ola-mir-29b-2, ola-mir-29c, ola-mir-183-2, ola-let-7a-3, ola-mir-9a-5, ola-mir-145, dre-mir-29b3
Mir-29 family members are up-regulated during aging in a variety of different tissues including muscle, skin, brain and aorta [2, 18, 46, 54, 56, 66] and appear to be key regulators of age -dependent gene expression [6, 51]. [score:6]
We found e. g., miR-10, miR-29 and miR-92 showing potential to be significantly involved in the down-regulation of genes in the aging brain of N. furzeri, like cell cycle regulators (ccne2 [22], nek6 [38], cdk13 [42]) or cancer related genes (mycn [8, 12], vav2 [13, 28]), both processes involved in aging. [score:5]
In O. latipes and T. rubripes, both miR-29 clusters are still present, whereas D. rerio seems to has lost one copy of the miR-29a gene. [score:1]
Whereas for D. rerio the mir-29a-2 gene seems to be lost, we assume that for G. aculeatus the whole second mir-29 cluster (dashed circles) is only missing, because of the low quality genome sequencing and assembly. [score:1]
Another example for an evolutionary conserved miRNA cluster is the miR-29 cluster depicted in Fig. 6d. [score:1]
As from RFAM (version 12.1) and miRBase (release 21), miR-29 genes are mainly identified in vertebrates as well as one Hemichordata and one Arthropoda, so we can only speculate that the original cluster duplication event arose in the early metazoa lineage. [score:1]
d After the ancestral duplication event, the mir-29 cluster is distinguished in the mir-29a/b-1 (filled red and blue dots) and the mir-29a/b-2 cluster (red and blue circles). [score:1]
For G. aculeatus, we were only able to identify one miR-29 cluster. [score:1]
Assuming a complete genome assembly, different scenarios could explain this finding: (1) both original miR-29 clusters were individually duplicated once more, and the fourth miR-29a gene was later lost, (2) one of the two clusters was duplicated as a whole, whereas in the other only miR-29b was copied or (3) both original clusters were duplicated during the same event, and again one of the miR-29a genes was later lost. [score:1]
This cluster consists of miR-29a (which is identical to the mammalian miR-29c) and its variant miR-29b and is duplicated at least once. [score:1]
Interestingly, in N. furzeri, we identified an additional miR-29a/b pair and a fourth single copy of miR-29b. [score:1]
[1 to 20 of 11 sentences]
5
[+] score: 14
Furthermore, miR-29 was found to suppress immune responses to Listeria monocytogenes and Mycobacterium tuberculosis by targeting IFN-γ [17]. [score:5]
Several of these miRNAs were commonly up-regulated by both of the infection conditions, including miR-21 (mature miRNA and its star sequence), miR-29a, miR-29b, miR-146a, and miR-146b (Figure 1A). [score:4]
By microarray analysis of miRNA expression in zebrafish we found that miRNAs of the miR-21, miR-29, and miR-146 families were commonly induced by infection of embryos with S. typhimurium and by infection of adult fish with M. marinum. [score:3]
The miR-146 family members were commonly induced during infections of embryos and adult fish, along with miRNAs of the miR-21 and miR-29 families, which also have been implicated in immunity and infection. [score:1]
The induction of members of the miR-21, miR-29, and miR-146 families was in line with earlier microarray studies, which reported these along with some other miRNAs, like miR-9, miR-132, miR-147, and miR-155 as infection-inducible [13, 26, 43, 44]. [score:1]
[1 to 20 of 5 sentences]
6
[+] score: 13
In particular, miR-29, which is down-regulated in response to cardiac injury, has been shown to inhibit the expression of fibrotic genes [148], while miR-21, which is upregulated in response to cardiac stress, has been proposed to promote it [149, 150], although a miR-21 KO mouse mo del raises questions on the essential nature of this response [151]. [score:11]
Van Rooij E. Sutherland L. B. Thatcher J. E. DiMaio J. M. Naseem R. H. Marshall W. S. Hill J. A. Olson E. N. Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis Proc. [score:2]
[1 to 20 of 2 sentences]
7
[+] score: 5
Other miRNAs from this paper: dre-mir-29b-2, dre-mir-29a, dre-mir-29b3
Polycomb Group member YY1 was found to be upregulated in RMS cell lines and primary tumors, thus leading to recruitment of EZH2 and HDAC1 to miR-29, silencing this microRNA, and thereby preventing muscle differentiation and facilitating tumor development [12]. [score:5]
[1 to 20 of 1 sentences]
8
[+] score: 3
Emerging evidence has revealed that miRNAs are also present in the CNS [32], [33], where cocaine administration alters the expression of many miRNAs (let-7d, miR-1, miR-124, miR-181a, miR-29b, miR-31, miR-382 and miR-212) in brain regions related to cocaine addiction (nucleus accumbens, ventral tegmental area, prefrontal cortex and dorsal striatum) [34], [35], [36]. [score:3]
[1 to 20 of 1 sentences]
9
[+] score: 3
The figure shows predicted binding alignment of miR-125a, miR-125b, miR-125c, miR-17a*, miR-20*, miR-210*, miR-29a, miR-29b and miR457a with predicted zebrafish lncRNA. [score:1]
The miRanda software identified potential binding sites of miR-125a, miR-125b, miR-125c, miR-17a*, miR-20a*, miR-210*, miR-2187, miR-29a, miR-29b and miR-457a in the predicted zebrafish 7sl lncRNA (Figure 2). [score:1]
0053823.g002 Figure 2 The figure shows predicted binding alignment of miR-125a, miR-125b, miR-125c, miR-17a*, miR-20*, miR-210*, miR-29a, miR-29b and miR457a with predicted zebrafish lncRNA. [score:1]
[1 to 20 of 3 sentences]
10
[+] score: 3
In this sense, it is known that different exogenous agents can induce the increase or decrease of specific miRNAs, for instance, cocaine administration alters the expression of many miRNAs (miR-1, miR-124, miR-181a, miR-29b, miR-31, miR-382, miR-212 and let-7d) in brain regions related to cocaine addiction (nucleus accumbens, ventral tegmental area, prefrontal cortex and dorsal striatum) [21], [64], [65]. [score:3]
[1 to 20 of 1 sentences]
11
[+] score: 2
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-23b, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-2, dre-mir-29a, dre-mir-30e-2, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, dre-mir-2184, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10. [score:1]
26 +2.14 miR-132 +1.83 (1.71e-3) +0.52 miR-2184 -2.63 (2.54e-5) -2.25 -2.50 miR-222a +1.54 (1.13e-2) +3.24 miR-24 -1.36 (1.9e-2) -1.41 -0.73 miR-454b +1.14 (4.93e-2) +0.14 miR-133a -1.72 (2.67e-3) -4.25 -5.07 miR-101b -2.52 (3.44e-5) -3.43 miR-338 -2.23 (1.90e-4) -2.90 -1.57 miR-26b -1.91 (1.84e-3) -3. 67 miR-204 -2.60 (4.76e-5) -0.57 -2.36 miR-203b -1.77 (3.45e3 -0.21 miR-10b -1.36 (2.90e-2) -1.78 miR-725 -1.29 (3.23e-2) -1.62 Zebrafish + Axolotl Zebrafish SymbolZebrafish log [2] Fold-change (p-value)Axolotl log [2] Fold-change SymbolZebrafish log [2] Fold-change (p-value) miR-27a +1.57 (7.96e-3) +2.15 miR-27b +1.38 (2.44e-2) miR-29b -2.05 (1.28e-2) -0.97 miR-143 +1.31 (2.89e-2) miR-30e +1.18 (4.80e-2) miR-200c -1.85 (1.72e-3) miR-200a -1.74 (3.66e-3) miR-23a -1.35 (2.05e-2) 10. [score:1]
[1 to 20 of 2 sentences]
12
[+] score: 2
Other miRNAs from this paper: hsa-mir-23a, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-205, hsa-mir-214, hsa-mir-221, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-184, hsa-mir-193a, hsa-mir-1-1, hsa-mir-29c, hsa-mir-133b, dre-mir-205, dre-mir-214, dre-mir-221, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-mir-1-2, dre-mir-1-1, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-29b-2, dre-mir-29a, dre-mir-107a, dre-mir-122, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-184-1, dre-mir-193a-1, dre-mir-193a-2, dre-mir-202, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-202, hsa-mir-499a, dre-mir-184-2, dre-mir-499, dre-mir-724, dre-mir-725, dre-mir-107b, dre-mir-2189, hsa-mir-499b, dre-mir-29b3
Fabbri M. Garzon R. Cimmino A. Liu Z. Zanesi N. Callegari E. Liu S. Alder H. Costinean S. Fernandez-Cymering C. MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3a and 3bEur. [score:2]
[1 to 20 of 1 sentences]
13
[+] score: 1
In another example shown by Wang et al. miR-29 is repressed by NF-kappaB acting through YY1 and the PcG-proteins [40]. [score:1]
[1 to 20 of 1 sentences]
14
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Olfactory bulb let-7b, let-7c-1, let-7c-2, miR-10a, miR-16, miR-17, miR-21, miR-22, miR-28, miR-29c, miR-124a-1, miR-124a-3, miR-128a, miR-135b, miR-143, miR-148b, miR-150, miR-199a, miR-206, miR-217, miR-223, miR-29b-1, miR-329, miR-331, miR-429, miR-451. [score:1]
[1 to 20 of 1 sentences]