sort by

9 publications mentioning dre-mir-26a-3

Open access articles that are associated with the species Danio rerio and mention the gene name mir-26a-3. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 218
Other miRNAs from this paper: hsa-mir-26a-1, hsa-mir-26a-2, dre-mir-26a-1, dre-mir-26a-2
MiR-26a-5p is upregulated in preeclampsia and targets podocyte VEGF-A. The functional and ultrastructural correlates of glomerular changes seen after miR-26a-5p overexpression in zebrafish with proteinuria, edema, glomerular endotheliosis and podocyte effacement highly resembled the finding in human preeclampsia. [score:8]
Interestingly, overexpression of miR-26a-5p in cultured human podocytes resulted in a 5-fold downregulation of VEGF-A mRNA expression compared to miR control (miR-CTRL) transfected cells (Fig.   1C). [score:7]
However, we also could demonstrate that podocytes express miR-26a-5p and we could detect a downregulation of VEGF-A due to miR-26a-5p in cultured human podocytes. [score:6]
Chai ZT microRNA-26a suppresses recruitment of macrophages by down -regulating macrophage colony-stimulating factor expression through the PI3K/Akt pathway in hepatocellular carcinomaJ. [score:6]
Chai and co-workers detected that expression of VEGF-A was inversely correlated with miR-26a-5p expression in hepatocellular carcinoma and that miR-26a-5p modulated angiogenesis of hepatocellular carcinoma through the PIK3C2α/Akt/HIF-1α/VEGFA pathway [21]. [score:5]
These data indicate that the effect of miR-26a-5p on modulating VEGF-A expression is again indirectly regulated via the PIK3C2α/Akt/HIF-1α/VEGFA pathway as previously described in HCC 21– 23. [score:5]
Thus, miR-26a-5p has a regulatory function on the local VEGF-A in the glomerulus, where podocytes are the major source of VEGF-A. Moreover, MiR-26a-5p expression also effected the actin cytoskeleton of cultured podocytes directly (Fig.   1F). [score:5]
As miR-26a-5p was increased in our pilot study in urines from patients with preeclampsia and podocyturia, this miR might have the potential to serve as a promising non-invasive biomarker or potential therapeutic target to antagonize the reduction of VEGF-levels in the disease. [score:5]
We also used U6 snRNA as an endogenous normalization for our urinary miR data and confirmed upregulation of miR-26a-5p in preeclampsia (Fig.   7C). [score:4]
We looked for miR-26a-5p expression in urine samples from preeclamptic patients with proteinuria and podocyturia and compared the expression levels with those in urine samples from healthy on-pregnant controls as well as healthy pregnant controls in a small pilot study. [score:4]
By generating fold changes in urinary miR-26a-5p expression in patients with preeclampsia compared to non-pregnant and pregnant healthy controls we could show that miR-26a-5p expression was significantly elevated in urines from preeclamptic women with ongoing podocyte damage (Fig.   7B). [score:4]
Figure  7D summarizes the pathway how miR-26a-5p downregulates VEGF-A though PIK3C2α. [score:4]
In another context, miR-26a-5p has also been described to regulate VEGF-A expression in hepatocellular carcinoma [21]. [score:4]
Downregulation of VEGF-A protein 72 h after transfection with a miR-26a-5p mimic could be demonstrated with western blot technique (Fig.   1D,E). [score:4]
Only 16% of zebrafish showed P3 or P4 edema after a co-injection of the miR-26a-5p mimic together with the Vegf-Aa protein, indicating that vegf-Aa downregulation was the causative factor for inducing proteinuria in 48 hpf developed zebrafish larvae as well (Fig.   5B,C; n = 80). [score:4]
The analysis with a zebrafish specific vegf-Aa antibody confirmed that Vegf-Aa protein was downregulated after vegf-Aa-MO and miR-26a-5p mimic injection (Fig.   4A). [score:4]
With the cloning of wild-type human PIK3C2α 3′UTR to a luciferase reporter construct, we could emphasize that miR-26a-5p directly targets PIK3C2α 3′UTR (supplementary Fig.   1D). [score:4]
To rule out impairments in angiogenesis or glomerular development as potential confounder in our zebrafish mo del, we overexpressed miR-26a-5p at a time when angiogenesis and glomerular function is considered largely established. [score:3]
PIK3C2α is an upstream protein in the VEGF-A signaling pathway and the effect of miR-26a-5p on modulating VEGF-A expression through the PIK3C2α/Akt/HIF-1α/VEGFA pathway was previously described and is well documented 21– 23. [score:3]
We demonstrated that exogenous miR-26a-5p decreases VEGF-A expression in cultured human podocytes. [score:3]
Still, urinary miR-26a-5p expression in preeclampsia has to be confirmed larger patient cohorts. [score:3]
MiR-26a-5p was upregulated in placentas and plasma from preeclamptic women [20]. [score:3]
Endogenous normalization methods revealed that miR-26a-5p was upregulated in urine samples from patients with preeclampsia compared to healthy non-pregnant and healthy pregnant controls. [score:3]
Therefore, it is conceivable that local overexpression of miR-26a-5p by podocytes together with circulating miR-26a-5p derived from the placenta contribute to the reduced glomerular VEGF-A level in preeclampsia. [score:3]
Therefore, we conclude that regulation of VEGF-A through miR-26a-5p is most likely indirect via PIK3C2α. [score:3]
We examined the expression of miR-26a-5p in cultured human glomerular endothelial cells (h. GECs) and human podocytes (h. PODs). [score:3]
Phosphatidylinositol-4-phosphate 3-kinase C2 domain-containing alpha polypeptide (PIK3C2α) is another potential target of miR-26a-5p with even two binding sites. [score:3]
Figure 5Vegf-Aa knockdown by miR-26a-5p causes proteinuria and edema in afore healthy zebrafish (A): Pictures of tail vessels (a), glomeruli fusing at zebrafish midline (b) and eye vessel plexus (c) of 48 h old zebrafish shows proper vascular development as well as glomerular fusion. [score:3]
Overexpression of miR-26a-5p in zebrafish by microinjection of a specific miR-26a-5p mimic was sufficient to resemble glomerular changes of preeclampsia [1] with proteinuria, edema, glomerular endotheliosis with endothelial cell swelling, loss of glomerular endothelial fenestration and podocyte foot process effacement. [score:3]
Therefore, we hypothesize that miR-26a-5p is involved in glomerular pathology seen in preeclampsia and base our observation on the following lines of evidence: In the glomerulus, miR-26a-5p is predominantly expressed by podocytes 44, 45. [score:3]
Using target prediction tools (FindTar3) we first identified the potential binding site of miR-26a-5p in the 3′UTR region of VEGF-A (supplementary Fig.   1A). [score:3]
We used the zebrafish mo del to study functional and ultrastructural abnormalities of the glomerular filtration barrier due to miR-26a-5p overexpression. [score:3]
MiR-26a-5p was described to be upregulated in plasma and placental tissues of women with severe preeclampsia in another study [60]. [score:3]
Overexpression of miR-26a-5p by injection of a specific miR-26a-5p mimic at the one to four cell stage was still detectable at 120 hpf. [score:3]
To validate VEGF-A as a target of miR-26a-5p we transfected cultured human podocytes with a miR-26a-5p mimic. [score:3]
Impairments in tail vessel sprouting after vegf-Aa knockdown by MO resembled those after miR-26a-5p mimic injection (Fig.   4C). [score:2]
MiR-26a-5p targets VEGF-A in cultured human podocytes trough PIK3C2α. [score:2]
We could demonstrate that the miR-26a-5p mimic was still detectable at 120 hpf and the expression levels of miR-26a-5p were 4 times higher compared to control at that time (Fig.   2C). [score:2]
Vegf-Aa knockdown by miR-26a-5p causes proteinuria and edema in 48 hpf developed zebrafish. [score:2]
Figure 3Vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic causes loss of plasma proteins in zebrafish larvae. [score:2]
In this study we wanted to investigate whether miR-26a-5p has a direct impact on glomerular VEGF expression and leads to impairment of the filtration barrier function. [score:2]
Even though there is a predicted direct binding side of miR-26a-5p to VEGF-A a reporter luciferase assay for the functional assessment of this interaction could not prove a direct binding. [score:2]
Vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic leads to glomerular endotheliosis and podocyte effacement that can be rescued by recombinant zebrafish Vegf-Aa protein. [score:2]
After transfection of cultured human podocytes with a miR-26a-5p mimic PIK3C2α mRNA was down regulated (Fig.   1H). [score:2]
Figure 6 Vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic causes glomerular endotheliosis and podocyte effacement that can be rescued by Vegf-Aa protein. [score:2]
Figure 2Vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic leads to edema and loss of plasma proteins. [score:2]
A recombinant zebrafish Vegf-Aa protein was able to rescue the phenotype caused by vegf-Aa-MO or miR-26a-5p mimic but was not able to significantly rescue vegf-Ab knockdown. [score:2]
Vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic induces loss of plasma proteins in zebrafish. [score:2]
Figure 4Vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic cause impairments in intersegmental tail vessel sprouting. [score:2]
Vegf-A knockdown by injection of either a vegf-Aa-MO, a vegf-Ab-MO or a miR-26a-5p mimic at one to four cell stages caused a significant loss of plasma proteins at 96 hpf. [score:2]
Transmission electron microscopy pictures showing glomerular endotheliosis and podocyte effacement vegf-Aa knockdown by injection of a vegf-Aa morpholino (vegf-Aa-MO) or a miR-26a-5p mimic (miR-26a-5p). [score:2]
Impaired intersegmental tail vessel sprouting after vegf-Aa knockdown by vegf-Aa-MO or miR-26a-5p mimic in zebrafish. [score:2]
The above described effects on the zebrafish vasculature could also indicate developmental defects in vegf-Aa-MO and miR-26a-5p mimic injected zebrafish. [score:2]
MiR-26a-5p is expressed in urine samples from preeclamptic patients with podocyturia. [score:2]
Next, we looked for miR-26a-5p expression in urine samples from patients with preeclampsia compared to healthy non-pregnant women and healthy pregnant controls. [score:2]
Vegf-Aa knockdown by either injection of a vegf-Aa-MO or a miR-26a-5p mimic led to a swollen endothelium with loss of glomerular endothelial cell-specific fenestration and podocyte effacement. [score:2]
Therefore, miR-26a-5p detected in the urine from patients with preeclampsia might have been derived from the placenta, been delivered to the circulation and been filtered into the urine in the glomerulus. [score:1]
An injection of a miR-26a-5p mimic in the c. v. of the zebrafish at 48 hpf caused proteinuria and edema which could be rescued if the miR-26a-5p mimic was co -injected with a recombinant zebrafish Vegf-Aa protein. [score:1]
Zebrafish were injected with a control morpholino (CTRL-MO), a vegf-Aa morpholino (vegf-Aa-MO), a recombinant zebrafish Vegf-Aa protein (Vegf-Aa protein), a miR-26a-5p mimic (miR-26a-5p), a control miR mimic (miR-CTRL) or a combination of vegf-Aa-MO and recombinant Vegf-Aa protein (vegf-Aa-MO + Vegf-Aa) a. e a combination of miR-26a mimic and zebrafish Vegf-Aa protein (miR-26a-5p + Vegf-Aa) as indicated at one to four cell stages or at 48 hpf (c. v. miR-26a, c. v. miR-26a-5p + Vegf-Aa). [score:1]
Again, these findings could be rescued if the miR-26a-5p mimic was co -injected with a recombinant zebrafish Vegf-Aa protein in the c. v. at 48 hpf. [score:1]
To accomplish this we performed an injection of a miR-26a-5p mimic in the cardinal vein (c. v. ) of anesthetized zebrafish at 48 hours post fertilization (hpf). [score:1]
63% of vegf-Aa-MO and 65% of miR-26a-5p mimic injected fish did not develop intersegmental tail vessels. [score:1]
Furthermore, urinary miR-26a-5p was detectable together with podocyturia in urines from preeclamptic women with ongoing podocyte damage. [score:1]
Seven days differentiated cultured human podocytes were transfected with 100 pM miR-26a-5p mimic/miR-CTRL for 4 h using Lipofectamin and Opti-MEM Medium (Thermo Fisher scientific, Waltham, MA) according to manufactures protocol. [score:1]
Injection of a Vegf-Aa specific morpholino or a miR-26a-5p mimic leads to generalized edema in zebrafish. [score:1]
Zebrafish Vegf-Aa protein was able to ameliorate glomerular damage induced by vegf-Aa-MO and miR-26a-5p mimic (Fig.   6). [score:1]
The edemous phenotype was categorized in 4 groups: P1 = no edema, P2 = mild edema, P3 = severe edema, P4 = very severe edema, Dead fish are those found dead between 72 hpf and 96 hpf; CTRL-MO n = 15, vegf-Aa-MO n = 20, vegf-Aa-MO + Vegf-Aa n = 21, vegf-Ab-MO n = 16, vegf-Ab-MO + Vegf-Aa n = 16, miR-CTRL n = 16, miR-26a-5p n = 14, miR-26a-5p + Vegf-Aa n = 24, WT + Vegf-Aa n = 17, WT n = 18, total n = 177. [score:1]
When we closely examined the tail vessels we could detect significant blood pooling in zebrafish injected with the vegf-Aa-MO or miR-26a-5p mimic. [score:1]
Arrow heads illustrate defects in sprouting of intersegmental vessel in vegf-Aa-MO and miR-26a-5p mimic injected fish. [score:1]
From our data in zebrafish it is tempting to posit that miR-26a-5p is involved in glomerular pathology seen in preeclampsia. [score:1]
Zebrafish were injected with either a recombinant zebrafish Vegf-Aa protein (Vegf-Aa protein), a control morpholino (CTRL-MO), a vegf-Aa morpholino (vegf-Aa-MO), a control miR mimic (miR-CTRL) or a miR-26a-5p mimic (miR-26a) at the one to four cell stages. [score:1]
At this time the tail vasculature, glomerular fusion and retinal vessel formation was already formed; c. v. miR-CTRL n = 10, c. v. miR-26a-5p n = 17, miR-26a-5p + Vegf-Aa n = 13, WT + Vegf-Aa n = 8, total n = 48. [score:1]
We used the mirVana® miRNA mimic has-miR-26a-5p (miR-26a-5p mimic, Life Technologies, Carlsbad, CA, Catalog # 4464066) and mirVana® miRNA mimic negative control #1 (miR-CTRL mimic, Life Technologies, Carlsbad, CA Catalog #4464058) for cell culture experiments in human podocytes. [score:1]
A recombinant zebrafish Vegf-Aa could reduce edema formation when it was co -injected with the vegf-Aa-MO or the miR-26a-5p mimic. [score:1]
Transfection of miR-26a-5p in cultured human podocytes. [score:1]
a) Survival of zebrafish injected with a vegf-Aa morpholino (vegf-Aa-MO) in black versus co-injection of a vegf-Aa morpholino and a Vegf-Aa protein (vegf-Aa-MO + Vegf-Aa protein) in red; n = 64. b) Survival of zebrafish injected with a vegf-Ab morpholino (vegf-Ab-MO) in black versus co-injection of a vegf-Ab morpholino and a Vegf-Aa protein (vegf-Ab-MO + Vegf-Aa protein) in red; n = 62. c) Survival of zebrafish injected with a miR-26a-5p mimic (miR-26a-5p) in black versus co-injection of a miR-26a-5p mimic and a Vegf-Aa protein (miR-26a-5p + Vegf-Aa protein) in red; n = 69. [score:1]
Co-injection of the recombinant zebrafish Vegf-Aa was able to rescue the loss of plasma proteins caused by vegf-Aa-MO and miR-26a-5p mimic but was not able to significantly decrease the proteinuria caused by vegf-Ab-MO (Fig.   3B; n = 177). [score:1]
Interestingly, co-injection of the vegf-Aa-MO or the miR-26a-5p mimic with recombinant Vegf-Aa protein significantly increased the survival of zebrafish (62% survival in the vegf-Aa-MO group versus 77% survival in the vegf-Aa-MO + Vegf-A protein group and 40% survival in the miR-26a-5p mimic group versus 94% in the miR-26a-5p mimic + Vegf-A protein group at 120 hpf). [score:1]
Cultured human podocytes were grown on cover slides and transfected with miR-26a-5p mimic or CTRL -mimic as described above. [score:1]
These impairments could be ameliorated by a co-injection of a zebrafish Vegf-Aa protein (64% normal intersegmental vessel sprouting in vegf-Aa-MO/Vegf-Aa protein co -injected zebrafish and 53% normal intersegmental vessel sprouting in miR-26a-5p -mimic/Vegf-Aa protein co -injected zebrafish) (Fig.   4C,D). [score:1]
MiR-26a-5p mimic (30 nM, 50 nM and 100 nM), pmiR-report-3′-UTR and beta-Gal normalizing plasmid (20 ng) were transfected to HEK293 cells. [score:1]
We controlled for successful transfection of the miR mimic by performing TaqMan qPCR for miR-26a-5p in the transfected cells 72 h after transfection (Fig.   1B). [score:1]
Zebrafish were either injected with control morpholino (CTRL-MO), a vegf-Aa morpholino (vegf-Aa-MO), a vegf-Ab morpholino (vegf-Ab-MO), a control miR mimic (miR-CTRL) or a miR-26a-5p mimic (miR-26a-5p) alone (−) or as co-injection with a recombinant zebrafish Vegf-Aa protein (Vegf-Aa) (+) at one to four cell stages. [score:1]
Full-length blots are presented in supplementary Fig.   3. (B) Phenotype pictures of zebrafish show blood pooling in tail region (arrow heads) in zebrafish that were injected with a vegf-Aa morpholino (vegf-Aa-MO) or a miR-26a-5p mimic (miR-26a-5p) were as control injected fish (CTRL-MO and miR-CTRL) appeared normal. [score:1]
Indeed, we detected impairments in intersegmental tail vessel sprouting when we injected a vegf-Aa-MO or miR-26a-5p mimic in zebrafish at the one to four cell stages. [score:1]
A control miR mimic (miR-CTRL), a miR-26a-5p mimic (miR-26a-5p) or the combination of miR-26a-5p and Vegf-Aa protein were injected in the cardinal vein at 48 hpf. [score:1]
Injection of miR mimics (mirVana® miRNA mimic has-miR-26a-5p (miR-26a-5p mimic, Life Technologies, Carlsbad, CA, Catalog # 4464066) and mirVana® miRNA mimic negative control #1 (miR-CTRL mimic, Life Technologies, Carlsbad, CA Catalog #4464058) in a concentration of 25 µM was done by microinjection in zebrafish eggs at one to two cell stages or in the cardinal vein of the fish at 48 hpf as previously described [25]. [score:1]
Zebrafish were injected with either a control morpholino (CTRL-MO), a vegf-Aa morpholino (vegf-Aa-MO) a miR-26a-5p mimic (miR-26a-5p), a control miR mimic (miR-CTRL) alone (−) or together with a recombinant zebrafish Vegf-Aa protein (Vegf-Aa) (+) at the one to four cell stages. [score:1]
To confirm that Vegf-Aa protein level was reduced in the zebrafish after both vegf-Aa-MO and miR-26a-5p mimic injection, we performed western blot analysis of whole zebrafish larvae (10 per group) at 96 hpf. [score:1]
Transfection of cultured human podocytes with a miR-26a-5p mimic caused a reorganization of the actin cytoskeleton that was time dependent (Fig.   1F). [score:1]
However, luciferase assay revealed only a marginal effect and did not prove a direct binding of miR-26a-5p to VEGF-A in two different concentration used for miR-26a-5p mimic transfection (supplementary Fig.   1B,C). [score:1]
Only 3% of vegf-Aa-MO and 7% of miR-26a-5p mimic injected fish showed complete intersegmental tail vessel sprouting. [score:1]
Similar to earlier experiments, injection of a miR-26a-5p mimic in the zebrafish larvae at this later time point led to loss of plasma proteins and edemous phenotype. [score:1]
Higher levels of miR-26a-5p were previously detected in placentas and plasma from preeclamptic women [20]. [score:1]
Levels of miR-26a-5p were significantly higher in cultured human podocytes (Fig.   1A). [score:1]
[1 to 20 of 95 sentences]
2
[+] score: 16
The E2-regulated miR-30c has been reported to be a tumor suppressor in endometrial cancer [34], miR-107 functions as a tumor-suppressor gene in head and neck squamous cell carcinoma and was shown to mediate p53 tumor-suppressor function in human colon cancer cells [35, 36], and miR-26a strongly inhibited estrogen-stimulated breast cancer cells and tumor growth [6, 37]. [score:10]
Tan S. Ding K. Li R. Zhang W. Li G. Kong X. Qian P. Lobie P. E. Zhu T. Identification of miR-26 as a key mediator of estrogen stimulated cell proliferation by targeting CHD1, GREB1 and KPNA2Breast Cancer Res. [score:3]
Noticeably, several of the estrogen-repressed miRNAs (miR-26, miR-107, miR-126 and miR-145) were also reduced by the physiological estrogen levels of vitellogenic females [8]. [score:1]
As shown in Figure 1A, an overlap was observed between the lists of E2-repressed miRNAs of the different experimental mo dels, where miR-26a was included in all three of them (Table S1). [score:1]
Furthermore, eight of the E2-repressed miRNAs also contained the AGGGU motif in their terminal loop (let-7 family members, miR-26a and miR-125a), whereas this motif does not exist in any of the control miRNA terminal loop sequences (Table S2). [score:1]
[1 to 20 of 5 sentences]
3
[+] score: 14
It remains unclear how mono-uridylation blocks miRNA target repressive ability or how miR-26 and the several other miRNAs targeted by Zcchc11 and Zcchc6 are specified, but mature miRNA uridylation consistently fails to alter the steady-state levels of mature miRNAs and instead likely acts through changes in target specificity, RISC loading or other mechanisms (8). [score:7]
Interestingly Zcchc11 was independently shown to uridylate the 3′ end of mature miR-26 and thereby attenuate its activity toward target mRNAs involved in the inflammatory response (6). [score:3]
Indeed, we found miR-26 family members to undergo TUTase -dependent uridylation as reported previously even in the absence of the sequence motif, indicating that there are other levels of specificity that remain unknown. [score:1]
We also tested the intrinsic preference of Zcchc11 toward miR-26a, a miRNA with reported Zcchc11 -dependent uridylation in cells, but found that it did not support strong uridylation similar to let-7 or miR-10 (6). [score:1]
Consistent with previous work showing similar activity between the two proteins, we found Zcchc6 to have a similarly strong preference for let-7 guide and miR-10a guide over let-7 passenger and miR-26 as for Zcchc11 (Figure 4b). [score:1]
RNA oligo Sequence let-7g guide UGAGGUAGUAGUUUGUACAGUU let-7g passenger CUGUACAGGCCACUGCCUUGC GL2 guide UCGAAGUAUUCCGCGUACGUU GL2 passenger CGUACGCGGAAUACUUCGAUU let-7i guide UGAGGUAGUAGUUUGUGCUGUU let-7i passenger CUGCGCAAGCUACUGCCUUGCU let-7i domains 1/2 mut UAGUCGCUGCAUUUGUGCUGUU let-7i domains 2/3 mut UGAGGUAUGCAGCCUAGCUGUU let-7i guide 1/2/3 mut UAGUCGCUGCAGCCUAGCUGUU let-7i delG UUACAUACUAAUUUCUACUCUU GL2 with let-7 motif UCGAAGUGUAGUUUGUACGUU miR-10a guide UACCCUGUAGAUCCGAAUUUGUG miR-26a guide UUCAAGUAAUCCAGGAUAGGC miR-10a double mut UACCCUUGCAAUCCGAAGCCUAG let-7g+A guide UGAGGUAGUAGUUUGUACAGUUA let-7g+U guide UGAGGUAGUAGUUUGUACAGUUU Human Zcchc11 cDNA region encoding amino acids 225–1384 was subcloned into a modified pET-24 plasmid (Novagen) containing an N-terminal His6-Trx (thioredoxin) tag with a cleavage sequence for TEV (tobacco etch virus) protease. [score:1]
[1 to 20 of 6 sentences]
4
[+] score: 10
Other miRNAs from this paper: dre-mir-10a, dre-mir-10b-1, dre-mir-204-1, dre-mir-181a-1, dre-mir-214, dre-mir-222a, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-25, dre-mir-26a-1, dre-mir-26a-2, dre-mir-30d, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-100-1, dre-mir-100-2, dre-mir-125a-1, dre-mir-125a-2, dre-mir-125b-1, dre-mir-125b-2, dre-mir-125b-3, dre-mir-125c, dre-mir-126a, dre-mir-143, dre-mir-146a, dre-mir-462, dre-mir-202, dre-mir-204-2, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, dre-mir-181a-2, dre-mir-1388, dre-mir-222b, dre-mir-126b, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-204-3
In our study, we observed that the miRNAs abundant in 3 wpf gonads generally maintained steady levels of expression throughout the gonadal development, and had putative functions in repressing stem cell differentiation, notably: miR-10b-5p, miR-222a-3p, and miR-26a-3p (Figs 4 and 5). [score:4]
In the olive flounder, miR-26a-5p targets empty spiracles homeobox 2 (emx2) 41; in mice, Emx2 is required to trigger germ cell differentiation 42. [score:3]
Regardless, the frequency of uracil-to-guanine substitutions was striking, particularly in ovary at 9 wpf, where in the case of miR-26a-5p it exceeded 25% of the miRNAs’ reads (Fig. 5). [score:1]
miR-462-5p and miR-26a-5p were abundant at 9 and 24 wpf, respectively (Fig. 6b,d). [score:1]
miR-222a-3p was the only miRNA with no significant change in abundance over time, while miR-10a-5p, miR-10c-5p, miR-125a-5p, miR26a-5p, and miR-92b-3p showed no significant change in abundance from 3 to 12 wpf. [score:1]
[1 to 20 of 5 sentences]
5
[+] score: 9
Specifically, tumor suppressor miRNAs, such as miR-23a, miR-26a/b, miR-29a/b and miR-101a, were found upregulated, whereas oncogenic miRNAs, like miR-7a and members of the miR cluster 17∼92, were downregulated [34]. [score:9]
[1 to 20 of 1 sentences]
6
[+] score: 6
The relative expression of miR-142a-3p was normalized to miR-26a [44]. [score:3]
The relative expression of miR-142a-3p was normalized to miR-26a. [score:3]
[1 to 20 of 2 sentences]
7
[+] score: 4
Recent research has demonstrated that miRs are able to regulate the expression of key genes involved in lipid homeostasis, including miR-122, miR-33, miR-106, miR-758, miR-26, miR-370, miR-378, let-7, miR-27, miR-143, miR-34a, and miR-335 [7, 8, 9, 10, 11, 12, 13]. [score:4]
[1 to 20 of 1 sentences]
8
[+] score: 3
Expression values were normalized to miR-26a. [score:3]
[1 to 20 of 1 sentences]
9
[+] score: 1
Gapdh or miR-26a were used as internal control. [score:1]
[1 to 20 of 1 sentences]