sort by

12 publications mentioning dre-mir-23b

Open access articles that are associated with the species Danio rerio and mention the gene name mir-23b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 125
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-92a-1, hsa-mir-92a-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-23b, mmu-mir-27b, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-140, mmu-mir-24-1, hsa-mir-196a-1, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, hsa-mir-30c-2, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-200b, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-140, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-196a-1, mmu-mir-196a-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-20a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-92a-2, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-17, mmu-mir-19a, mmu-mir-200c, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-92a-1, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-301a, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-196b, mmu-mir-196b, dre-mir-196a-1, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, hsa-mir-18b, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-15a-1, dre-mir-15a-2, dre-mir-15b, dre-mir-17a-1, dre-mir-17a-2, dre-mir-18a, dre-mir-18b, dre-mir-18c, dre-mir-19a, dre-mir-20a, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-27a, dre-mir-27b, dre-mir-27c, dre-mir-27d, dre-mir-27e, dre-mir-30c, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-130a, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-140, dre-mir-196a-2, dre-mir-196b, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-301a, dre-let-7j, hsa-mir-92b, mmu-mir-666, mmu-mir-18b, mmu-mir-92b, mmu-mir-1b, dre-mir-196c, dre-mir-196d, mmu-mir-3074-1, mmu-mir-3074-2, hsa-mir-3074, mmu-mir-133c, mmu-let-7j, mmu-let-7k, dre-mir-24b
As previously described for many clustered miRNAs (Lagos-Quintana et al., 2003; Lim et al., 2003), Mir24.1 had an expression pattern similar to that observed for Mir23b, including expression in the nasal epithelium (Supplemental Figures 3A– C), tongue (Supplemental Figures 3E,F,H,I) and maxillary process epithelium (Supplemental Figure 3D), though expression in the palatal shelf mesenchyme and overlying epithelium (Supplemental Figures 3D,F,H,I) and trigeminal ganglia (Supplemental Figure 3G) was weak. [score:7]
Our analysis of expression and function in zebrafish suggest that mir23b is expressed in the pharyngeal arch mesenchyme and potentially functions to promote proliferation of chondrocytes, such that when overexpressed, ectopic cartilage arises. [score:7]
Potential Mir23b and Mir133b functions and targetsHere we have shown that Mir23b is expressed in the developing face of mouse embryos and in the head of zebrafish embryos and that its overexpression in zebrafish embryos results in ectopic cartilage structures in the viscerocranium. [score:6]
To examine whether the pattern of expression of mir23b and mir133b was also conserved between mouse and zebrafish embryos, we examined expression of both miRNAs in 30–72 hpf embryos. [score:5]
mir23b and mir133b overexpression results in viscerocranial and neurocranial defects in zebrafishTwo potential methods for assessing function of genes in zebrafish are over -expression and gene inactivation. [score:5]
At 30 hpf, mir133b expression was also observed in the head region (around the eye and portions of the brain; Figure 6A), though expression was weaker than that of mir23b. [score:5]
One of the interesting aspects our data analysis (Figure 1) is that Mir27b expression is also present in the developing midface, with its expression mirroring that of Mir23b. [score:5]
miRNA Embryonic age Expression profile mir15a 48 and 72 hpf Midbrain, MHB, notochord mir15b 48 and 72 hpf Midbrain, neurocranium, notochord mir23b 30, 48, and 72 hpf Somites, lens, pharyngeal arches, notochord mir27b 48 and 72 hpf mir30c 48 and 72 hpf Brain, neurocranium, eye, heart mir130a 48 and 72 hpf Brain, gut tube, heart, eye mir133b 30, 48, and 72 hpf Notochord mir301a 48 and 72 hpf Forming cartilage Midbrain, neurocranium, eye, trigeminal ganglia Figure 5 Expression of mir23b in zebrafish embryos. [score:5]
miRNA Embryonic age Expression profile mir15a 48 and 72 hpf Midbrain, MHB, notochord mir15b 48 and 72 hpf Midbrain, neurocranium, notochord mir23b 30, 48, and 72 hpf Somites, lens, pharyngeal arches, notochord mir27b 48 and 72 hpf mir30c 48 and 72 hpf Brain, neurocranium, eye, heart mir130a 48 and 72 hpf Brain, gut tube, heart, eye mir133b 30, 48, and 72 hpf Notochord mir301a 48 and 72 hpf Forming cartilage Midbrain, neurocranium, eye, trigeminal ganglia Figure 5 Expression of mir23b in zebrafish embryos. [score:5]
mir23b and mir27b are separated by less than 200 bp, though it is not clear that their expression is co-regulated. [score:4]
Expression of mir23b and mir133b is conserved in zebrafish facial structuresBased on analysis of mir140 action, miRNA function during facial development is also present in zebrafish embryos. [score:4]
In the fetal mouse liver, the Mir23b cluster regulates cell fate switch between hepatocytes and bile duct cells by regulating expression of Smad3, 4, and 5 and thereby repressing TGF-β signaling (Rogler et al., 2009). [score:4]
Overall, the expression pattern of MiR23b supported our analysis (Figure 1), though it was difficult to assess the qualitative differences in expression between prominences compared to the quantitative differences of miRNA-seq. [score:4]
Here we have shown that Mir23b is expressed in the developing face of mouse embryos and in the head of zebrafish embryos and that its overexpression in zebrafish embryos results in ectopic cartilage structures in the viscerocranium. [score:4]
Further, like the comparison between MiR23b and MiR24.1, expression of MiR206 was much weaker than the expression observed for MiR133b. [score:4]
Our in situ hybridization and overexpression analyses provide evidence that Mir23b and Mir133b are important regulators of craniofacial development. [score:4]
We initially examined miRNA expression in E12.5 mouse embryo using whole mount ISH and LNA probes against Mir23b, Mir24.1, and Mir666 (Supplemental Figure 1). [score:3]
In addition, we have shown that over -expression of mir23b and mir133b results in changes in craniofacial cartilage morphogenesis. [score:3]
MicroRNA-23b cluster microRNAs regulate transforming growth factor-beta/bone morphogenetic protein signaling and liver stem cell differentiation by targeting Smads. [score:3]
Expression of mir23b and mir133b is conserved in zebrafish facial structures. [score:3]
Expression of mir23b was detected in the head and pharyngeal arch mesenchyme (Figure 5A) and in the somitic mesoderm (Figure 5D) at 30 hpf. [score:3]
This is especially true for Mir23b and Mir27b, as while both work concurrently to drive cardiomyocyte development from ES cells in vitro, Mir23b subsequently controls the later beating phenotype of differentiated cells while Mir27b functions to inhibit this event (Chinchilla et al., 2011; Wang et al., 2012). [score:3]
mir23b and mir133b overexpression results in viscerocranial and neurocranial defects in zebrafish. [score:3]
At 48 hpf, mir23b expression was still present in the head and pharyngeal arch mesenchyme while also appearing in the otic vesicle (Figure 5B). [score:3]
The arrow in (F) denotes the epithelium where Mir23b expression begins. [score:2]
In addition, MiR23b was expressed along the palatal shelf epithelium, again starting at the midline of the shelf and continuing on the oral side (Figures 3H,I). [score:2]
Like Mir23b, Mir133b exists in a cluster with Mir206, which had a similar pattern of expression to that of Mir133b. [score:2]
Like MiR23b, MiR133b was also strongly expressed in the craniofacial region at E12.5. [score:2]
When using LNA probes against Mir23b and Mir133b, robust expression was present in a variety of facial structures, though overall background staining on the sections was high (Supplemental Figure 2). [score:2]
Expression of MiR23b and MiR133b in mouse facial structures at E12.5. [score:2]
Potential Mir23b and Mir133b functions and targets. [score:2]
Figure 3Expression of Mir23b in mouse facial structures at E12.5. [score:2]
Thirty-three micrometers of MiR23b duplex (5′—3′), 6.25 μM of MiR133b (5′—3′), and 33 μM of standard control miRNA (5′- CTTACCTCAGTTACAATTTATA -3 duplexed with 5′- TAAATTGTAACTGAGGTAAGAG-3′) were injected into single cell zebrafish embryos and allowed to grow for 6 dpf. [score:1]
In zebrafish, this corresponds to mir23b, mir27d, and mir24.1. [score:1]
Whole-mount in situ hybridization analysis with a digoxigenin-labeled probe against the mir23b transcript at 30–72 hpf. [score:1]
This may indicate roles for Mir23b in regulating either patterning of the NCC-derived mesenchyme or later chondrogenesis. [score:1]
In the viscerocranium, MiR23b duplex injection resulted in aberrant development of Meckel's cartilage and the ceratohyal (Figure 7B). [score:1]
In mouse, Mir23b is part of a miRNA cluster that includes Mir23b, Mir27b, Mir3074.1, and Mir24.1. [score:1]
While Crispr-Cas9 -mediated gene inactivation is underway, we began our analysis of potential function by injecting 1–2 cell zebrafish embryos with duplex RNA for MiR23b and MiR133b examining cartilage development at 6 dpf. [score:1]
[1 to 20 of 39 sentences]
2
[+] score: 22
The miRNA with the least dysregulated targets was hsa-miR-211 (52 targets) while hsa-miR-23b was the miRNA with the most dysregulated targets (115). [score:9]
MiRTrail identified several deregulated miRNAs that target deregulated mRNAs including miRNAs hsa-miR-23b and hsa-miR-223, which target the highest numbers of deregulated mRNAs and regulate the pathway "basal cell carcinoma". [score:9]
For this analysis, we decided to use the eight miRNAs having more than 80 dysregulated targets (miR-23b [50], miR-223, miR-193b [51], miR-424, miR-20a [52], miR-98, miR-891a, and miR-566), see Figure 2. We left the custom degree constraint at the default of 1 for the subsequent ORA. [score:4]
[1 to 20 of 3 sentences]
3
[+] score: 6
In particular miR-23b, miR-199a, and miR-15a displayed increased expression during early AVC development and characterization of target genes suggests that they are involved in regulating epithelial-mesenchymal transition (EMT) signaling pathways [106]. [score:5]
Bonet F. Duenas A. Lopez-Sanchez C. Garcia-Martinez V. Aranega A. E. Franco D. Mir-23b and mir-199a impair epithelial-to-mesenchymal transition during atrioventricular endocardial cushion formation Dev. [score:1]
[1 to 20 of 2 sentences]
4
[+] score: 5
Posttranscriptional regulation of mouse of μ-opioid receptor (MOR1) via its 3’ unstranslated region: a row for microRNA23b. [score:3]
Longterm morphine treatment decreases the association of mu-opioid receptor (MOR1) mRNA with polysomes through miRNA23b. [score:1]
miR-let-7. miR-23b. [score:1]
[1 to 20 of 3 sentences]
5
[+] score: 5
They showed that miR-23a–27a–24-2 cluster members were enriched in ECs and highly vascularized tissues, and inhibition of miR-23/27 repressed sprouting angiogenesis by targeting Sprouty2 and Sema6A proteins [15]. [score:5]
[1 to 20 of 1 sentences]
6
[+] score: 5
Since miR-23 (JX994633), miR-218 (JX994383) and miR-338 (JX994406) are present in the elephant shark, these conserved miRNAs are likely to be involved in the regulation of Runx2 expression in elephant shark, possibly during chondrogenic differentiation through mechanisms similar to that in other jawed vertebrates. [score:4]
Of these, binding sites for miR-23, miR-218 and miR-338 were found conserved in the 3′UTR of elephant shark Runx2, while only that for miR-28 is present in zebrafish and fugu Runx2 (Fig. 8B). [score:1]
[1 to 20 of 2 sentences]
7
[+] score: 5
Moreover, miR-23b binding to the MOR 3'-untranslated region (3'UTR) suppresses MOR-protein production [20]. [score:5]
[1 to 20 of 1 sentences]
8
[+] score: 3
MicroRNA-23 restricts cardiac valve formation by inhibiting Has2 and extracellular hyaluronic acid production. [score:2]
In a zebrafish dicer mutant lacking mature miRNAs, endocardial cushion formation was excessive, prompting the observation that miRNA-23 is necessary to restrict the number of cells that differentiate into endocardial cushion cells (Lagendijk et al., 2011). [score:1]
[1 to 20 of 2 sentences]
9
[+] score: 2
Several other miRNA clusters including miR-126, miR-218, miR-23/27 clusters are documented in the regulation of angiogenesis [39, 42– 44], whether, all these families of miRNAs function independently or in concert are unclear. [score:2]
[1 to 20 of 1 sentences]
10
[+] score: 2
However, several additional miRNAs were identified including miR-23b and miR-133b. [score:1]
MicroRNA profiling during craniofacial development: potential roles for Mir23b and Mir133b. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 1
The resulting strain named MIR23 carrying the integrated construct risIs[Pbcat-1::bcat-1::gfp+unc119] has been used for experiments. [score:1]
[1 to 20 of 1 sentences]
12
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7e, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-221, hsa-mir-23b, hsa-mir-27b, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-200c, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-30e, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-10b-1, dre-mir-181b-1, dre-mir-181b-2, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-203a, dre-mir-204-1, dre-mir-181a-1, dre-mir-221, dre-mir-222a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7e, dre-mir-7a-3, dre-mir-10b-2, dre-mir-20a, dre-mir-21-1, dre-mir-21-2, dre-mir-23a-1, dre-mir-23a-2, dre-mir-23a-3, dre-mir-24-4, dre-mir-24-2, dre-mir-24-3, dre-mir-24-1, dre-mir-26b, dre-mir-27a, dre-mir-27b, dre-mir-29b-1, dre-mir-29b-2, dre-mir-29a, dre-mir-30e-2, dre-mir-101b, dre-mir-103, dre-mir-128-1, dre-mir-128-2, dre-mir-132-1, dre-mir-132-2, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-148, dre-mir-181c, dre-mir-200a, dre-mir-200c, dre-mir-203b, dre-mir-204-2, dre-mir-338-1, dre-mir-338-2, dre-mir-454b, hsa-mir-181d, dre-mir-212, dre-mir-181a-2, hsa-mir-551a, hsa-mir-551b, dre-mir-31, dre-mir-722, dre-mir-724, dre-mir-725, dre-mir-735, dre-mir-740, hsa-mir-103b-1, hsa-mir-103b-2, dre-mir-2184, hsa-mir-203b, dre-mir-7146, dre-mir-181a-4, dre-mir-181a-3, dre-mir-181a-5, dre-mir-181b-3, dre-mir-181d, dre-mir-204-3, dre-mir-24b, dre-mir-7133, dre-mir-128-3, dre-mir-7132, dre-mir-338-3
Although zebrafish miRNAs have been examined in numerous studies [25, 27, 41– 43], our analysis revealed novel paralogs of 18 miRNAs that do not currently have zebrafish records in miRBase (version 21), including miR-181a, miR-20a, miR-23b, miR-24, miR-29a, miR-103, miR-128, miR-148, miR-181b, miR-199, miR-204, miR-212, miR-221, miR-338, miR-724, miR-2184, let-7b and let-7e. [score:1]
[1 to 20 of 1 sentences]