1 |
[+]
score:
61
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR529, zma-MIR390b
The up-regulation of miR396 in HKI-1532 suppressed the expression of its target, GRF1, whereas the up-regulation of miR396 in V-372 led to neutral expression of its target.
[score:17]
The target distributions of miRNA families themselves were investigated, which showed that zma-miR166, zma-miR396, zma-miR529, zma-miR164, and zma-miR169 had the most targets, with 6, 6, 5, and 5 target mRNAs, respectively, while zma-miR160, zma-miR390, zma-miR393, and zma-miR2275 had the fewest target mRNAs, with a single target each (Figure 3).
[score:9]
Ectopic expression of miR396 suppresses GRF target gene expression and alters leaf growth in Arabidopsis.
[score:9]
Conversely, in V-372, members of 7 families—zma-miR164, zma-miR169, zma-miR393, zma-miR396, zma-miR399, zma-miR529, and zma-miR2275—were significantly up-regulated; and zma-miR156, zma-miR159, zma-miR166 and zma-miR395 families were significantly down-regulated.
[score:7]
In tolerant genotype HKI-1532, 16 miRNAs belonging to the zma-miR159, zma-miR160, zma-miR164, zma-miR166, zma-miR169, zma-miR390, zma-miR395, zma-miR396, and zma-miR399 families were significantly up-regulated.
[score:4]
Overexpression of miR168, miR171 and miR396 under hypersalinity, mannitol, and cold stress was reported in Arabidopsis (Liu et al., 2008).
[score:3]
m Growth -regulating factor 9 zma-miR396-c,d gnl|GNOMON|8836063.
[score:2]
m Growth -regulating factor 1 zma-miR396-c,d gnl|GNOMON|54764053.
[score:2]
m Growth -regulating factor 8 zma-miR396-c,d gnl|GNOMON|9726103.
[score:2]
m Growth -regulating factor 1 zma-miR396-c,d gnl|GNOMON|41140073.
[score:2]
m Growth -regulating factor 1-like zma-miR396-c,d gnl|GNOMON|74420063.
[score:2]
Similar results were obtained for miR396 in Arabidopsis (Liu et al., 2008) and tobacco (Frazier et al., 2011).
[score:1]
m Atpsulfurylase miR396 zma-miR396-c,d gnl|GNOMON|3258103.
[score:1]
[1 to 20 of 13 sentences]
|
2 |
[+]
score:
43
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, zma-MIR444a, zma-MIR444b
This family consists of 7 members that exhibit distinct expression profiles (Figure 4, Table S2) – miR396a/b/g shows elevated expression in the pollen, miR396c/d is highly expressed in the juvenile tissues but not adult tissues, while miR396e/f expression profile shows a peak in seedling tissues.
[score:9]
For example, the miR396 family is overall highly expressed in the juvenile root and seedling samples but only certain individual family members (miR396a, miR396b, and miR396g) are highly expressed in pollen (Figure 4).
[score:5]
The latter are also the only members of the miR396 family that target QLQ (glutamine-leucine-glutamine) and WRC (tryptophan-arginine-cysteine) domains that define the Growth-Regulating Factor (GRF) family of transcription factors [64].
[score:4]
1000716.g004 Figure 4 Solexa reads mapping to the miR396 family were counted and summed for each family member, showing tissue specificity of expression amongst members of the same family.
[score:3]
The same trend is observed in many other miRNA families including miR164, miR166, miR169, miR171, miR172, miR319 and miR396 as they target various families of transcription factors such as NAM (No Apical Meristem) proteins, bZIP (basic-leucine Zipper) genes, CBF (CCAAT binding factor), GRAS transcription factor, AP2 (APETALA2)-EREBP (Ethylene-Responsive Element Binding Proteins), CCCH type zinc finger protein and TCP (Teosinite branched, Cycloidea, and PCF), GRF transcription factor families respectively [12], [71], [85]– [87].
[score:3]
Solexa reads mapping to the miR396 family were counted and summed for each family member, showing tissue specificity of expression amongst members of the same family.
[score:3]
As seen in the miR396 gene family, tissue expression profiles are not necessarily conserved amongst miRNA genes of the same family.
[score:3]
In six of these cases the host genes were also the predicted target of the embedded miRNA gene, oriented either on the same strand (miR159c, miR319b, miR396a and miR397a) or opposite strand (miR169j and miR399d).
[score:3]
The miR156, miR164, miR168, miR393, miR395, miR396, miR398, and miR399 families had higher signatures in juvenile root and seedling tissues while miR172 demonstrated a higher expression level in reproductive tissues (tassel and ear).
[score:3]
Expression levels of miRNA genes from miR396 family across tissue types.
[score:3]
Therefore, miR396c/d could be acting as regulatorsr of GRF genes in juvenile tissues independently from the rest of the miR396 family.
[score:2]
Other members of the miR396 family are conserved in both monocots and dicots, but miR396c/d appear to be monocot specific (equivalent to osa-miR396d/e found in rice) [63].
[score:1]
These families are: miR156, miR160, miR164, miR166, miR167, miR172, miR396, and miR528.
[score:1]
[1 to 20 of 13 sentences]
|
3 |
[+]
score:
31
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR396b, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h
That is, they all (miR159 and its target with IAA; miR166, miR169, miR393, miR396, and their targets with ZR + iPA; miR159, miR396 and their targets with GA; miR396 and their targets with BR; miR159, miR396 and their targets with JA; miR160, miR164, miR166, miR169, miR172, and miR396 and their targets with ABA) showed a significant positive and/or negative correlation with the phytohormone levels.
[score:13]
For example, OsGRF4, a target of miR396, was found to positively regulate BR content through direct interaction with GSK2, the central negative regulator of brassinosteroid signaling in rice (Che et al., 2015).
[score:6]
OsGRF4, a target of miR396, reportedly regulates a CK dehydrogenase precursor gene and controls rice grain shape (Sun et al., 2016), while TCP14 and TCP15 TFs, which mediate CK responses, were found to cause excessive proliferation of the boundaries of the Arabidopsis gynoecium replum (Takei et al., 2001).
[score:4]
Eight known miRNAs (miR159, miR160, miR164, miR166, miR169, miR172, miR393, and miR396), four newly identified miRNAs, and 12 target genes were selected for qRT-PCR validation.
[score:3]
It should be noted that miR396 expression increased on the day of silking and thereafter decreased (Figure 3A).
[score:3]
Blocking miR396 increases rice yield by shaping inflorescence architecture.
[score:1]
43 −0.49−0.88 [**] T-miR166j (HB) AC187157.4_FGT005 −0.18−0.76 [*]−0.61 [*] −0.48 −0.53−0.89 [**] T-miR169p (NF-YA) GRMZM2G040349_T01,T02 0.06−0.66 [*]−0.71 [*] −0.52−0.64 [*]−0.70 [*] T-miR172e (AP2) GRMZM2G076602_T01 −0.48 −0.46 −0.24 −0.14 −0.20−0.87 [**] T-miR393b (AFB) GRMZM2G137451_T01, T02 0.22−0.80 [**]−0.83 [**] −0.61−0.64 [*] −0.46 T-miR396a (GRF) GRMZM2G033612_T02 0.18−0.84 [**]−0.85 [**]−0.74 [*]−0.
[score:1]
[1 to 20 of 7 sentences]
|
4 |
[+]
score:
30
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR162, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR396b, zma-MIR156j, zma-MIR168a, zma-MIR168b, zma-MIR172e, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR169o, zma-MIR393b, zma-MIR393c, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR408b
In the leaf primordia, miR396 expresses at low levels throughout the meristem, overlapping with the expression of its target, GRF2 [36].
[score:7]
The repression of zma-miR396 maybe leads to the steady expression amount of GRFs, and enhances the development of the corn kernel.
[score:4]
During the seed development process of wheat and rice, the expression amount of miR396 was weak too, some of them even less than 1 RPM [33, 34].
[score:4]
MicroRNA miR396 and RDR6 synergistically regulate leaf development.
[score:3]
Over -expression of miR396 was found to decrease the GRFs that has been shown to influence cell proliferation in the meristem and developing leaves [37].
[score:3]
In this study, the results showed that zma-miR396 increased in the endosperm at the four sampling times, but the expression level was weak, with values less than 30 RPM.
[score:3]
miR396 regulates growth -regulating factors (GRFs), which are transcription factors of the plant-specific family.
[score:3]
The qRT-PCR results revealed that GRF decreased a little with a slight increase of zma-miR396 (Fig 4).
[score:1]
Control of cell proliferation in Arabidopsis thaliana by microRNA miR396.
[score:1]
0125800.g002 Fig 2 Six novel maize miRNAs (miRt4, miRt13, miRt15, miRt17 and miRt21, miRt28) and six conserved miRNAs (miR156, miR162, miR172, miR393, miR396 and miR408) were chosen to verify the sequencing results via the qRT-PCR analysis.
[score:1]
[1 to 20 of 10 sentences]
|
5 |
[+]
score:
26
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR1432
Analyses of target genes indicated that the expression of four miRNA families (miR164, miR396, miR530, and miR1846) was positively or negatively correlated with that of their respective targets, genes that were associated with symptom development.
[score:8]
Only one target gene each was identified for miR156e and miR396a-5p, namely a SQUAMOSA promoter -binding (SPB) protein and a growth -regulating factor, respectively (Supplementary Table S5).
[score:4]
Three other miRNAs (miR156e, miR169i-p5, and miR396a-5p) were down-regulated (Fig. 2).
[score:4]
A total of 99 transcripts from 48 genes were identified for 10 known miRNAs (miR156e, miR169i-p5, miR169l-5p, miR319b-p3, miR319b-p3-1, miR319b-p3-Pt, miR396a-5p, miR408a, miR4366-p3, and miR8155) that exhibited at least two-fold change in expression and that had at least 10 reads per dataset.
[score:3]
miR396 is related to the regulation of stress responses (Liu et al., 2008) and pistil development in Arabidopsis (Liang et al., 2014), and to arsenate and arsenite stress responses in wild accessions of rice (Sharma et al., 2015).
[score:3]
Combined analyses indicated that the regulation of the miRNA families miR166, miR167, miR169, miR396, and miR399 might be involved in maize tissues and stress responses.
[score:2]
In the third group of miRNAs, members within five known miRNA families (miR166, miR167, miR169, miR396, and miR399) increased or decreased at the same time.
[score:1]
miR166, miR167, miR169, and miR396 also responded to RBSDV in rice leaves and roots (Sun et al., 2014).
[score:1]
[1 to 20 of 8 sentences]
|
6 |
[+]
score:
26
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR529
Among the target genes profiled in the ear leaves of the inbred line ELS-1, the gene expression trends were opposite those of miR171, miR172, miR159, and miR396, suggesting that these miRNA target genes were subjected to a negative regulation by the miRNAs, most likely through a target cleavage pathway.
[score:10]
n ≥ 3. [*], p < 0.1; [**], p < 0.01; [***], p < 0.001 Based on the profiles, almost all of the miRNAs were down-regulated in the ear leaves of the inbred line ELS-1, except miR396 and miR529, which had high expression levels on 30DAP and miR394, which had a low expression level on 10DAP.
[score:8]
n ≥ 3. [*], p < 0.1; [**], p < 0.01; [***], p < 0.001 Based on the profiles, almost all of the miRNAs were down-regulated in the ear leaves of the inbred line ELS-1, except miR396 and miR529, which had high expression levels on 30DAP and miR394, which had a low expression level on 10DAP.
[score:8]
[1 to 20 of 3 sentences]
|
7 |
[+]
score:
22
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR171d, zma-MIR171f, zma-MIR396b, zma-MIR156j, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h
Expression profiles were established based on stem-loop real-time RT-PCR analysis of six selected miRNAs, comprising miR156, miR164, miR167, miR168, miR169 and miR396, as well as real-time RT-PCR analysis of their target mRNAs.
[score:5]
Ectopic over -expression of miR396 represses expression of not only six GRF genes but also GIF1, which encodes a GRF-interacting transcription co-activator with a role in cell proliferation in the leaf [49].
[score:5]
Studies on the mo del plants rice and Arabidopsis indicate that growth regulating factors (GRFs) were the conserved target genes of miR396 in dicotyledon and monocotyledon plants [49]– [50].
[score:4]
It is clear that miR396 plays an important role in plant leaf growth and development, most likely by repression of GRF gene expression.
[score:4]
In maize, the targets of miR396 were also GRF genes, and our study showed that miR396 was over dominantly repressed.
[score:3]
Since GRFs might regulate cell division, it is possible that repression of miR396, which leads to inducement of GRFs, enhances cell division in Yuyu22 compared to that in the parental inbred lines.
[score:1]
[1 to 20 of 6 sentences]
|
8 |
[+]
score:
20
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR171d, zma-MIR171f, zma-MIR396b, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR156k, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR166n, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR827, zma-MIR444a, zma-MIR444b
The results indicated that miR156, miR171, miR396 and miR444, which respectively targeted to SPL, SCL, QQT and EDA genes, might differentially expressed in the seed development in two maize inbred lines, especially involved in flowering regulation and embryo development.
[score:8]
In this present study, the major targets of zma-miR396a,b-5p and zma-miR396c_L-1 were GRFs (3, 5 and 6), members of growth -regulating factors, involved in regulation of cell expansion in leaf and cotyledons tissues [52].
[score:5]
The results indicated that some miRNAs (e. g. miR156, miR171, miR396 and miR444) differentially expressed in the seed development between PH6WC and PH4CV maize inbred lines under different genetic backgrounds.
[score:4]
Besides, we found that QQT2 was another target of zma-miR396a,b-5p.
[score:3]
[1 to 20 of 4 sentences]
|
9 |
[+]
score:
15
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR394a, zma-MIR394b, zma-MIR396b, zma-MIR399e, zma-MIR156j, zma-MIR319a, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR156l, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR482, zma-MIR528a, zma-MIR529, zma-MIR827, zma-MIR1432
Compared with the expression of miRNAs in the 7 [th], 8 [th] and 9 [th] internodes of ‘Xun928’, miR156a-I, l, miR167a-d, miR169r and miR396c, d were all down-regulated in the corresponding internodes of ‘Xun9058’; however, miR396a, b were up-regulated in the corresponding internodes of ‘Xun9058’.
[score:8]
Most of the targets were found to be transcription factors (TFs), such as auxin response factors (miR160 and miR167), growth -regulating factor (miR396), N-acetylcysteine domain containing protein (miR164), SQUAMOSA promoter -binding protein-like (miR156) and nuclear TF Y (miR169).
[score:4]
The expression changes of miR164e, f, h, miR319a-d, miR393a, c, miR396a-d, miR399e, I, j and miR528a, b also showed similarities between the corresponding comparison groups of the 7 [th], 8 [th] and 9 [th] internode of ‘Xun9058’ and ‘Xun928’.
[score:3]
[1 to 20 of 3 sentences]
|
10 |
[+]
score:
11
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR396b, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR528a, zma-MIR528b, zma-MIR827, zma-MIR390b, zma-MIR444a, zma-MIR444b
MiR168, miR393, miR396 and miR398 were highly expressed in the endosperm at 15 DAP and 20 DAP, indicating their regulation function during middle and late development of the endosperm (Figure 3e).
[score:5]
miR396 can target growth -regulating factors (GRFs), which are involved in the control of grain size and yield in rice [15, 16, 17, 18].
[score:4]
Among them, miR166 was the most abundant family (17,602) followed by miR171 (11,988), miR827 (7686), miR167, miR396, miR528, miR156, miR408, miR160, miR390, miR159, miR444, miR319, miR398, miR168, miR394, miR164, miR393 and miR169 (Figure 3a).
[score:1]
Gao F. Wang K. Liu Y. Chen Y. Chen P. Shi Z. Luo J. Jiang D. Fan F. Zhu Y. Blocking miR396 increases rice yield by shaping inflorescence architectureNat.
[score:1]
[1 to 20 of 4 sentences]
|
11 |
[+]
score:
8
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR396b, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR156k, zma-MIR160f, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR1127a, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2275a, osa-MIR2275b, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, tae-MIR167b, hvu-MIR168, hvu-MIR169, tae-MIR169, hvu-MIR397a, tae-MIR398, tae-MIR171b, hvu-MIR166b, hvu-MIR166c, osa-MIR2275c, osa-MIR2275d, tae-MIR1122b, tae-MIR9653a, tae-MIR9654a, tae-MIR9656, tae-MIR9657a, tae-MIR9659, tae-MIR9660, tae-MIR1127b, tae-MIR9661, tae-MIR396, tae-MIR9665, tae-MIR2275, tae-MIR9667, tae-MIR167c, tae-MIR1120b, tae-MIR397, tae-MIR1130b, tae-MIR5384, tae-MIR9675, tae-MIR1120c, tae-MIR9679, tae-MIR9657b, hvu-MIR397b, hvu-MIR156b, tae-MIR9653b
Although low expression (976 RPM and 921 RPM, respectively) was observed for both miR164 and miR396 families, their expression level was still about 4 to 200 times greater than any of the 6 remaining highly conserved miRNA families (Table 2 and Additional file 2).
[score:5]
Of the 15 known miRNA families, 8 (miR396, miR168, miR156, miR172, miR159, miR398, miR1318 and miR167) showed different levels of preferential expression in wheat flag leaves, with the logarithm of the fold changes ranged from 0.5 to 5.2 as well as more than those in the developing seeds (Figure 3a, Table 2).
[score:3]
[1 to 20 of 2 sentences]
|
12 |
[+]
score:
8
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR528a, zma-MIR528b, zma-MIR827
In maize, however, the obvious down-regulation of miR166f/g/h and miR396a/b in GP compared with MP implies that their targets are probably involved in pollen tube growth.
[score:5]
Finally, miR396 mediates leaf development in Arabidopsis by controlling GROWTH-REGULATING FACTOR [46].
[score:3]
[1 to 20 of 2 sentences]
|
13 |
[+]
score:
8
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR396b, zma-MIR156j, zma-MIR166k, zma-MIR166j, zma-MIR166l, zma-MIR166m, zma-MIR156k, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR166n, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h
Bioinformatic analyses reveal that grf1 homologs in Arabidopsis and rice have complementary target sites for miR396, a relatively rare small RNA that is either expressed at very low levels or in a limited number of cells/tissues [83].
[score:5]
Zm-grf1 also harbors the conserved miR396 recognition motif, and thus represents an intriguing candidate gene for reverse genetic analyses of microRNA-regulated leaf development.
[score:3]
[1 to 20 of 2 sentences]
|
14 |
[+]
score:
7
Other miRNAs from this paper: osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR396e, zma-MIR396b, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, bra-MIR396
In previous studies, the over -expression of GRF genes in Arabidopsis was found to result in bigger organ size than the vector control [3, 7], while reduction of AtGRF gene expression by the overexpression of the microRNA miR396 in transgenic Arabidopsis caused narrow-leaf phenotypes due to a reduction in cell number [24– 26].
[score:7]
[1 to 20 of 1 sentences]
|
15 |
[+]
score:
7
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR396b, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR166l, zma-MIR166m, zma-MIR156k, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR398a, zma-MIR398b
For example, miR162 was not found in our research; miR156, miR164, miR167, and miR396 were not down-regulated in the roots, but in the leaves, miR164 showed a down-regulation.
[score:7]
[1 to 20 of 1 sentences]
|
16 |
[+]
score:
6
The effects on both cell proliferation and cell expansion were shown to be regulated by the overexpression of miR396 and may result in the repression of multiple GRF genes in these transgenic plants overexpressing miR396 [35].
[score:6]
[1 to 20 of 1 sentences]
|
17 |
[+]
score:
6
Other miRNAs from this paper: osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR169l, sbi-MIR396b, sbi-MIR396a, sbi-MIR396c, osa-MIR396e, zma-MIR396b, osa-MIR396f, zma-MIR396c, zma-MIR396d, sbi-MIR169l, sbi-MIR396d, sbi-MIR396e, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR169l, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h
For example, the sbi-miR396a detail page displayed the sequence of mature, precursor and secondary structures, as well as the expression bar chart (Figure 2D).
[score:3]
004G317000’s network, the pink line represented the gene targeted by the sbi-miR396 family.
[score:3]
[1 to 20 of 2 sentences]
|
18 |
[+]
score:
4
The endogenous miR396 h targeting sequence was replaced with TCTTATTCCTCTCCCCTCCTG and the endogenous star sequence replaced with CAGGAGGGCAGAGGAATAAGA.
[score:3]
An artificial microRNA was designed to silence specifically the Ms44 allele, using the scaffolding of the maize miR396 h pri‐miRNA as template.
[score:1]
[1 to 20 of 2 sentences]
|
19 |
[+]
score:
3
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR408a, zma-MIR156k, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b
In Arabidopsis, the expression of miR156, miR167, miR168, and miR396 increased 2 h to 24 h after exposure to high-salinity treatment.
[score:3]
[1 to 20 of 1 sentences]
|
20 |
[+]
score:
3
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR399a, zma-MIR399e, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169o, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR408b, zma-MIR528a, zma-MIR528b, zma-MIR827
In addition, we found miRNA408b* and miR396a*/b* had been accumulated to a level higher than their mature sequences.
[score:1]
Similarly, miRNA396a*/b* were also more sequenced (223 reads) than the mature miRNA (99 reads) in seeds.
[score:1]
The total reads of miR408b* and miR396a*/b* were greater than the corresponding mature sequences, and both showed higher abundance in young leaves.
[score:1]
[1 to 20 of 3 sentences]
|
21 |
[+]
score:
1
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR156j, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR408a, zma-MIR156k, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1432, zma-MIR156l, zma-MIR166n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR408b, zma-MIR482, zma-MIR1432, osa-MIR395x, osa-MIR395y
The abundance of the originally annotated miRNA* of zma-miR396a and zma-miR396b was much higher (31, 120, 199, 59 times in four sequenced libraries) than its annotated miRNA (only 16, 9, 38, 20 in the same sequenced libraries).
[score:1]
[1 to 20 of 1 sentences]
|
22 |
[+]
score:
1
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR171d, zma-MIR171f, zma-MIR396b, zma-MIR156j, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159j, zma-MIR166n, zma-MIR167j, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR398a, zma-MIR398b, zma-MIR408b, zma-MIR827, zma-MIR444a, zma-MIR444b
The nine families comprised miR156, miR166, miR167, miR171, miR396, miR398, miR408, miR444, and miR827.
[score:1]
[1 to 20 of 1 sentences]
|
23 |
[+]
score:
1
Other miRNAs from this paper: zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR160e, zma-MIR166a, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171f, zma-MIR396b, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR408a, zma-MIR160f, zma-MIR159e, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169n, zma-MIR169q, zma-MIR393c, zma-MIR395n, zma-MIR396g, zma-MIR396h, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR444a, zma-MIR444b
3 −28.38 0.740992167101828 zma-miR395n-5p Li_TCONS_00047896 156-179 −38.3 −28.38 0.740992167101828 zma-miR396b-3p:zma-miR396a-3p Li_TCONS_00019831 289-309 −32.9 −23.4 0.711246200607903 zma-miR396g-5p:zma-miR396h Boerner_Z27kG1_02332 1122-1144 −35.3 −23 0.651558073654391 zma-miR396g-5p:zma-miR396h Li_TCONS_00081264 211-233 −35.3 −23.78 0.673654390934844 zma-miR398b-3p:zma-miR398a-3p Li_TCONS_00081462 279-299 −45.3 −30.08 0.664017660044150 zma-miR399d-5p Li_TCONS_00097416 279-299 −44.2 −28.88 0.653393665158371 zma-miR399e-5p Boerner_Z27kG1_08283 467-487 −41.4 −30.6 0.739130434782609 zma-miR399e-5p Li_TCONS_00097327 326-349 −41.4 −27 0.652173913043478 zma-miR399g-5p Boerner_Z27kG1_13975 327-345 −49.4 −35.6 0.720647773279352 zma-miR444a:zma-miR444b Boerner_Z27kG1_21675 448-466 −35.7 −25.2 0.705882352941176 zma-miR482-3p Boerner_Z27kG1_19929 311-332 −35.2 −28.
[score:1]
[1 to 20 of 1 sentences]
|
24 |
[+]
score:
1
Other miRNAs from this paper: zma-MIR172a, zma-MIR396b, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR396c, zma-MIR396d, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h
Control of cell proliferation in Arabidopsis thaliana by microRNA miR396.
[score:1]
[1 to 20 of 1 sentences]
|
25 |
[+]
score:
1
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166a, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR529, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
Of these, 45 miRNAs aligned with 59 members of 21 maize miRNA families, while the others corresponded to members of miRNA families from three other plant species, including rice (osa-miR156/162/164/168/396/529) Arabidopsis (ath-miR156/164/167) and sorghum (sbi-miR396).
[score:1]
[1 to 20 of 1 sentences]
|