sort by

56 publications mentioning hsa-mir-409

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-409. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 224
Other miRNAs from this paper: mmu-mir-409
miR-409-3p functions as a tumor suppressor by inhibiting the development and metastasis of CRC, suggesting that miR-409-3p is expected to become a novel diagnostic marker and a new target of the treatment of CRC. [score:8]
Our results suggest that miR-409-3p functions as a tumor suppressor by inhibiting the development and metastasis of CRC, suggesting that miR-409-3p is expected to become a new diagnostic marker and a new target of the treatment of CRC. [score:8]
It has been reported that miR-409-3p targets PHF10, radixin and c-Met [8, 9, 11, 19] Here, we found that NLK could be a potential target of miR-409-3p since NLK would be the potential target in the CRC scenario. [score:7]
In this study, we analyzed the down-regulation expression of miR-409-3p in CRC tissues compared with patient-matched normal tissues, and determined that the expression level of miR-409-3p was closely correlated with the clinicopathologic variables of CRC. [score:7]
The expression of miR-409-3p is down-regulated in CRC and correlated with tumor size, and local invasion. [score:6]
In these studies, the expression levels of miR-409-3p was significantly lower in cancer tissues compared with corresponding non-tumor tissues, and it inhibits proliferation, invasion and tumorigenesis in vitro or in vivo, suggesting that it may serve as a tumor suppressor. [score:6]
We also show that miR-409-3p may function as an tumor suppressor by directly targeting NLK. [score:6]
Ectopic expression of miR-409-3p inhibits proliferation, invasion and metastasis of CRC cells, reduces the tumorigenic ability of CRC cells in nude mice. [score:5]
Ectopic expression of miRNA mimics suggested that miR-409-3p could inhibits the abilities of proliferation, wound healing, metastasis and invasion in CRC cells. [score:5]
We searched miR-409-3p’s putative targets using online search tools (e. g. TargetScan, Microrna. [score:5]
Given that miR-409-3p inhibits metastasis of CRC cells in vitro, we next tested whether ectopic expression of miR-409-3p could influence the tumor growth and metastasis of CRC cells in vivo. [score:5]
The results showed that overexpression of miR-409-3p led to significantly inhibited migration and invasion of CRC cells. [score:5]
Ectopic expression of miR-409-3p mimics suggested that miR-409-3p could inhibits the abilities of proliferation, wound healing, metastasis and invasion in CRC cells. [score:5]
The results showed that the average expression level of miR-409-3p was significantly down-regulated in tumor tissues compared to the adjacent non-tumor tissues (Figure  1a, b). [score:5]
The results are mean ± SD, * P < 0.05. miR-409-3p targets the 3′-UTR of NLKTo identify how miR-409-3p functions in CRC cells, computational prediction of miR-409-3p targets was performed. [score:5]
The transcriptional regulation of miR-409-3p has been implicated in some diseases [32, 33]. [score:4]
In conclusion, our data showed that miR-409-3p was frequently down-regulated in CRC. [score:4]
d miR-409-3p mimics down-regulated luciferase activities controlled by wild-type NLK 3′UTR (* P < 0.01), but did not affect luciferase activity controlled by mutant NLK 3′UTR. [score:4]
miR-409-3p inhibits peritoneal spreading CRC cells in nude mice in vivo. [score:3]
This result is consistent with the expression profile of miR-409-3p in our study. [score:3]
These findings indicate that miR-409-3p inhibits the proliferation and colony forming ability of CRC cells. [score:3]
miR-409-3p inhibits migration and invasion of CRC cells in vitro. [score:3]
miR-409-3p inhibits CRC cells proliferation and clonogenicity of CRC cells in vitro. [score:3]
of clinical cases revealed that low miR-409-3p expression had inclinations towards lager tumor size and local invasion. [score:3]
In the present study, statistical analysis of clinical cases revealed that low miR-409-3p expression had inclinations towards lager tumor size and local invasion. [score:3]
showed that the low expression of miR-409-3p was significantly correlated with tumor size and local invasion (* P < 0.05). [score:3]
The results supported that miR-409-3p could be a potential therapeutic target. [score:3]
b Expression levels of miR-409-3p in 45 CRC patients were analyzed by qRT-PCR. [score:3]
To identify how miR-409-3p functions in CRC cells, computational prediction of miR-409-3p targets was performed. [score:3]
Aberrant miR-409-3p expression has been reported in several cancers. [score:3]
The peritoneal spreading nude mice assay confirmed that miR-409-3p could inhibits the ability of metastasis in CRC cells in vivo, which is an important aspect of tumor development. [score:3]
Thus, these results indicate that miR-409-3p could suppress metastasis of CRC cells in vivo. [score:3]
Notably, we found the NLK could be a potential target of miR-409-3p. [score:3]
To explore the expression levels of miR-409-3p in CRC tissues and adjacent non-tumor tissues, qRT-PCR analysis was performed. [score:3]
miR-409-3p expression levels were determined in 45 pairs of primary CRC and their corresponding adjacent non-tumor tissues by qPCR. [score:3]
miR-409-3p inhibits scratch wound healing ability of CRC cells. [score:3]
Table 1 Relationship between miR-409-3p expression levels and clinicopathological variables in 62 CRC patients Clinicopathologic parameters No. [score:3]
Thus, our results suggest that miR-409-3p is a potential diagnostic marker and therapeutic target of CRC. [score:3]
Therefore, we next determined whether overexpression of miR-409-3p in CRC cells could affect cell proliferation. [score:3]
By wound distance analysis, the movement ability of CRC cells was inhibited by miR-409-3p. [score:3]
miR-409-3p targets the 3′-UTR of NLK. [score:3]
Furthermore, we elucidated the correlation between miR-409-3p expression and clinicopathologic factors. [score:3]
As a negative regulator of NLK, miR-409-3p has a naturally potential value in personalized medicine. [score:2]
c Schematic graph of the putative binding sites of miR-409-3p in the NLK 3′UTR and the mutation in miR-409-3p -binding sites. [score:2]
The results showed that cell growth was inhibited in cells transfected with miR-409-3p mimics compared with the cells transfected with control mimics (Figure  2a, b). [score:2]
The genes predicted by all the used programs were considered candidate targets of miR-409-3p. [score:2]
a Relative expression of miR-409-3p in 45 CRC patients tumor tissues compared with adjacent non-tumor tissues. [score:2]
In pervious studies, dysregulation of miR-409-3p has been reported in many cancers, including gastric cancer [8, 9], prostate cancer [10] and bladder cancer [11]. [score:2]
The results were shown in Figure  3a, miR-409-3p overexpression cell lines SW480 [miR-409-3p] restoration slowly closed the scratch wounds compared with the control 48 h after scratching, in contrast to the control SW480 [NC mimics] cells which were significantly efficient in wound healing. [score:2]
The relative luciferase activity of the NLK-3′UTR [wt] reporter was markedly suppressed by miR-409-3p mimics compared with that of NLK-3′UTR [mut] in a miR-409-3p dependent manner (Figure  7d). [score:2]
This result strongly indicates that 3′UTR of NLK carries the direct binding seed of miR-409-3p. [score:2]
Strikingly, the peritoneal nodules were significantly inhibited in miR-409-3p mimics transfected group compared with control group (Figure  6). [score:2]
The results suggested that the functions of miR-409-3p in CRC were worthy to study further. [score:1]
The number of colonies from SW480 [miR-409-3p] and SW1116 [miR-409-3p] cells was fewer than that from the control groups (SW480 [NC mimics] and SW1116 [NC mimics], * P < 0.05, Figure  2e, f). [score:1]
miRNA-409-3p mimics and negative control mimics were purchased from GenePharma (Shanghai, China). [score:1]
In order to further assess the influence of miR-409-3p on CRC cells, we further explored its effects on cell migration and invasion, a key ability of tumor progression and metastasis. [score:1]
miR-409-3p mimics or control mimics oligos were transfected into CRC cells respectively. [score:1]
a Representative histograms depicting apoptosis of SW480 cells transfected with miR-409-3p mimics or control. [score:1]
b Representative histograms depicting apoptosis of SW1116 cells transfected with miR-409-3p mimics or control. [score:1]
a Representative photographs of migratory or invasive SW480 [NC mimics] and SW480 [miR-409-3p] cells on the membrane (magnification, ×100). [score:1]
c Representative photographs of migratory or invasive SW1116 [NC mimics] and SW1116 [miR-409-3p] cells on the membrane (magnification, ×100). [score:1]
To confirm the contribution of miR-409-3p in vivo, we carried out peritoneal spreading in mice mo dels. [score:1]
Luciferase reporters were constructed containing either a wild-type NLK 3′UTR sequence containing the miR-409-3p binding site (NLK-3′UTR [wt]), or a mutated 3′UTR (NLK-3′UTR [mut]) (Figure  7c). [score:1]
The results showed that the number of colonies from CRC cells transfected with miR-409-3p mimics was significantly fewer than that from the control group (Figure  2c, d). [score:1]
However, the clinical significance and functions of miR-409-3p in human CRC were not entirely clear. [score:1]
b Average number of migratory or invasive SW480 [NC mimics] and SW480 [miR-409-3p] cells. [score:1]
d Average number of migratory or invasive SW1116 [NC mimics] and SW1116 [miR-409-3p] cells (* P < 0.05, ** P < 0.01). [score:1]
d SW1116 cells were transfected with miR-409-3p mimics or NC mimics then seeded onto 6-well plates. [score:1]
miR-409-3p CRC NLK Tumorigenesis Colorectal carcinoma (CRC) is one of the prevalent cancer types, ranking the third of all cancer-related deaths worldwide. [score:1]
A recent investigation on a large cohort of over 2,000 CRC patients indicated that NLK might promote the aggressiveness of CRC, which is consistent with the expression profile of miR-409-3p in the present study. [score:1]
Therefore, the mechanism underlying the control of miR-409-3p level in colorectal cells is expected to be addressed in the future study. [score:1]
SW480 cells were transfected with miR-409-3p mimics or NC mimics then seeded onto 6-well plates. [score:1]
We then performed luciferase reporter assays to verify a direct interaction between miR-409-3p and the 3′UTR of NLK. [score:1]
To investigate the mechanism of miR-409-3p on CRC cell proliferation inhibitory effects, we performed apoptosis analysis by flow cytometry. [score:1]
A recent study demonstrated that miR-409-3p could be used for early detection of CRC [12]. [score:1]
miR-409-3p has not yet been well explained in CRC. [score:1]
Whereas, miR-409-3p level was not associated with other clinicopathologic features, including age, sex (P > 0.05). [score:1]
a The putative binding sites of miR-409-3p in NLK 3′-UTR region were predicted. [score:1]
miR-409-3p induces CRC cells apoptosis. [score:1]
As shown in Figure  3, the number of migratory and invasive SW480 cells transfected with miR-409-3p mimics was significantly less than the control group (* P < 0.05. [score:1]
Figure 2The effect of miR-409-3p on the proliferation of CRC cells. [score:1]
The transportation of miR-409-3p was implicated in early CRC detection [12]. [score:1]
CRC cells transfected with miR-409 mimics or control mimics were selected and intraperitoneally injected into nude mice, These mice were euthanized 8 weeks after the injection, and the tumor lesions in the peritoneal cavity were counted. [score:1]
MicroRNA-409 dysregulation has been detected in many cancers, including gastric cancer [8, 9], prostate cancer [10] and bladder cancer [11]. [score:1]
[1 to 20 of 84 sentences]
2
[+] score: 80
Also, miRNAs miR-485-5p and miR-409-5p are down-regulated in KSHV-infected cells and this directly correlates with the up-regulation of their predicted target, MDM2, which mediates the degradation of p53 [57, 58], an inducer of apoptosis. [score:10]
Additionally, transfection of miR-409-5p in SLKK cells led to a significant decrease in the expression of its predicted target, the p53 -inhibitor MDM2. [score:7]
Amongst the most significantly down-regulated miRNAs with high read counts were miR-224-5p, miR-410, miR-409-3p and-5p, whilst the most up-regulated miRNAs were miR-3614-5p, miR-708-3p and-5p. [score:7]
miR-409-3p, a miRNA down-regulated in our sequencing data, is known to target fibrinogen beta (FGB) and pro-metastasis gene radixin (RDX) [41, 42]. [score:6]
Of note, while both arms of the miR-409 stem-loop were down-regulated, miR-409-3p had a higher relative abundance than miR-409-5p. [score:4]
Interestingly, miR-409-5p, miR-299-3p, and miR-381-3p are all located in the 14q32 cluster that is broadly down-regulated in SLKK cells as well as PEL cells [33]. [score:4]
In an effort to correlate the expression levels of miRNAs to their respective target genes, we investigated known and predicted target mRNAs for three miRNAs validated by Taqman assay (miR-409-3p, miR-409-5p, and miR-708-5p). [score:4]
We further validated the down-regulation of 14q32 miRNAs miR-409-3p, miR-409-5p, and miR-410 by qRT-PCR. [score:4]
The other arm, miR-409-5p, which is also down-regulated in SLKK vs. [score:4]
Also, miR-409-5p showed a trend for down-regulation, while miR-410 did not significantly change. [score:4]
At 5 days post infection (5dpi), we found that 2 of these 4 miRNAs (miR-224-5p and miR-409-3p) were similarly down-regulated (n = 3) (Fig 3B). [score:4]
In order to further investigate whether the changes in mRNA targets in SLKK cells could be a result of differential miRNA expression, we carried out transfection assays to re-express miRNAs that were decreased in either SLKK cells (miR-409-3p and-5p) or SLK cells (mir-708-5p), as compared to their counterparts. [score:3]
miR-409-5p is predicted to target MDM2. [score:3]
Transfection of miR-409-3p in SLKK cells led to a decrease in two of its known targets, fibrinogen beta and radixin. [score:3]
We further transfected 3 miRNAs that were decreased in SLK or SLKK cells and examined changes in 5 respective mRNA targets, including 2 novel mRNAs (LIF for miR-708-5p and MDM2 for miR-409-5p). [score:3]
This is the first report providing experimental evidence that miR-409-5p targets MDM2. [score:3]
miR-409-3p targets fibrinogen beta (FGB) and radixin (RDX). [score:3]
For miRNA expression, stem-loop qPCR was performed using TaqMan Universal master mix (Applied Biosystems) and the following microRNA assays: 000512 for miR-210-3p, 001274 for miR-410-3p, 002099 for miR-224-5p, 002331 for miR-409-5p, 002332 for miR-409-3p, 002341 for miR-708-5p, 002342 for miR-708-3p and 461775 for miR-3614-5p. [score:2]
Scramble control (miR-scramble) and miRNA mimics for miR-409-3p, miR-409-5p and miR-708-5p were transfected in either SLK or SLKK cells. [score:1]
For example, 14q32 miRNAs, miR-410, miR-409-5p and-3p, were significantly repressed -6 log [2] FC upon KSHV infection (Fig 2C). [score:1]
[1 to 20 of 20 sentences]
3
[+] score: 34
Among these upregulated miRNAs were miR-10a, which is a candidate tumor suppressor and suppresses apoptosis in leukemia [39], miR-409 that suppresses tumor cell invasion and metastasis in gastric cancer [40], and miR-206 and miR-345, which are frequently downregulated in various types of cancers and are believed to act as tumor suppressors [41], [42]. [score:15]
As shown in Figure 9C, there was excellent concordance in the data from the miRNA profiling and qPCR, the expression of miR-21, miR-26a, miR-24, miR-30b and miR-29a was down-regulated by EF24 treatment both in vitro and in vivo, while the expression of miR-345, miR-409, miR-10a and miR-206 was upregulated by EF24 treatment. [score:11]
Only four miRNAs (miR-10a, miR-409, miR-206 and miR-345) were upregulated both in vitro and in vivo, which reportedly act as tumor suppressors or inhibitors of cell cycle progression. [score:8]
[1 to 20 of 3 sentences]
4
[+] score: 24
The quantitative RT-PCR results showed that miR-409-3p was upregulated 2.04 times, miR-103a-3p was downregulated 1.85 times, miR-200b-3p was downregulated 2.22 times and miR-107 was downregulated 2.13 times in the oridonin treatment group compared with the control (Figure  2), which correlated well with the microarray results in Table  1. Figure 2 qPCR validation of a subset of miRNA microarray data. [score:12]
miR-409-3p also suppresses the migration and invasion of bladder cancer T24 and 5,637 cells via targeting c-Met [39] and regulates cell proliferation and apoptosis by targeting PHF10 in SGC-7901 gastric cancer cells [40]. [score:8]
It has been reported that epigenetic silencing of miR-107 can regulate the expression of cyclin -dependent kinase 6 in pancreatic cancer [15]; while interfering miR-409-3p promotes tumour growth, the epithelial-to-mesenchymal transition (EMT) and bone metastasis [38]. [score:4]
[1 to 20 of 3 sentences]
5
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Uptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
OsmoticUptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
[1 to 20 of 2 sentences]
6
[+] score: 17
Other miRNAs from this paper: hsa-mir-708
Correlation of miRNA expression levels to their respective mRNA target genes using TaqMan assay indicated up-regulation of miR-708-5p, leading to the down-regulation of caspase-2 and leukemia inhibitory factor (LIF), as well as down-regulation of miR-409-5p, a miRNA associated with an increase in the p53 -inhibitor MDM2 [104]. [score:17]
[1 to 20 of 1 sentences]
7
[+] score: 16
However, miR-409-3p, Let-7i and miR-30c already exhibited a significant down-regulation while miR-148b was the only up-regulated miRNA in hippocampus at this age (Fig 3C). [score:7]
Interestingly, miR-9 maintained its down-regulation in older mice and miR-409-3p was the only miRNA to be consistently down-regulated in APP23 from a very young age right through to older animals. [score:7]
Individual TaqMan assays (Applied Biosystems) were used to analyse the expression of the following mature mouse miRNAs: miR-181c, miR-9, miR-20b, miR-21, miR-30c, miR-148b, miR-361, miR-409-3p and Let-7i. [score:2]
[1 to 20 of 3 sentences]
8
[+] score: 14
The asterisks indicate the statistically significant difference Fig. 6The predicted targets of hsa-miR-138 and hsa-miR-409 were reduced examined by real-time PCR. [score:3]
Of all miRNA-mRNA pairs, we also selected hsa-miR-409-5p, which played roles in cell proliferation and apoptosis [16], along with its predicted target genes, SMARCC1 and EFNB1, and another two miRNAs, hsa-miR-19-3p and hsa-miR-204-5p to validate the microarray results. [score:3]
The expression of hsa-miR-138, hsa-miR-409 and hsa-miR-19 showed significant difference between two groups. [score:3]
The expression of hsa-miR-138 (a), hsa-miR-409 (b), hsa-miR-19 (c) and hsa-miR-204 (d) were tested in fetal hippocampus tissues of DS and control group. [score:3]
The expression of hsa-miR-138 and hsa-miR-409 were obviously increased in DS group compared to control group. [score:2]
[1 to 20 of 5 sentences]
9
[+] score: 14
Of particular interest, up-regulated miRNAs miR-494 and miR-495 were predicted to target CTNND2, while up-regulated miR-376c and miR-409-3p were predicted to target NR2F2, which were both down-regulated in primary MB specimens relative to CD133+ NSCs (Table S4). [score:14]
[1 to 20 of 1 sentences]
10
[+] score: 13
Another study revealed a potential tumor suppressor miRNA, miR-409-3p that downregulated angiogenin expression levels leading to cell death and tumor regression (Weng et al., 2012). [score:8]
miR-409-3p inhibits HT1080 cell proliferation, vascularization and metastasis by targeting angiogenin. [score:5]
[1 to 20 of 2 sentences]
11
[+] score: 12
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCCmiRNAs regulate gene expression at the post-transcriptional level. [score:6]
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCC miRNAs regulate gene expression at the post-transcriptional level. [score:6]
[1 to 20 of 2 sentences]
12
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
Among the miRNAs examined, 79 miRNAs (24%) responded to the hyperandrogenic condition and interestingly, 80% of which were upregulated compared to the control group supporting the notion that hyperandrogenic condition down-regulates androgen receptors in the granulosa cells [35] which could be mediated by these upregulated miRNAs (rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p). [score:9]
A list of differentially expressed miRNAs (Fold change ≥ 2 and their corresponding P value) is presented in Figure  4. Beside this group, miRNAs which were also highly abundant in DHT -treated ovaries are rno-miR-221, rno-miR-222, rno-miR-25, rno-miR-26b, rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p. [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 11
The expression of miR-409-3p, which belongs to the same cluster as miR-379 does, is also down-regulated in OS. [score:6]
A recent study highlighted that miR-409-3p may play a role in the inhibition of OS cell invasion and migration through targetting catenin-δ1 [14]. [score:5]
[1 to 20 of 2 sentences]
14
[+] score: 11
Tumor growth continued due to miR-409-directed inhibition of RSU1 and STAG2 tumor suppressors. [score:6]
The expression of miR-409 by CAF was associated with prostatic tumor epithelial expansion and EMT (Josson et al. 2015). [score:3]
2005.01.014) 15766527 Josson S Gururajan M Sung SY Hu P Shao C Zhau HE Liu C Lichterman J Duan P Li Q 2015 Stromal fibroblast-derived miR-409 promotes epithelial-to-mesenchymal transition and prostate tumorigenesis. [score:1]
The surrounding prostate epithelia seemed to take up the miR-409, leading to increased tumor migration and invasion. [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 10
Amongst the miRNAs with the greatest fold-change between ccRCC and normal kidney cortex were the upregulated miRNAs miR-122-5p, miR-224-5p, miR-210-5p, the downregulated miR409-3p, and the upregulated miR-21-3p. [score:10]
[1 to 20 of 1 sentences]
16
[+] score: 10
MiR-409-3p is reported to be downregulated in bladder cancer and ectopic miR-409-3p expression significantly reduced bladder cancer cell migration and invasion [30]. [score:6]
C-Met is a direct target of miR-409-3p and mediates the biological function of miR-409–3p in bladder cancer [30]. [score:4]
[1 to 20 of 2 sentences]
17
[+] score: 9
MiRNA target site/Species Human Mouse Cow Dog Chicken FrogTargeting Twist2 miR-15b-3p + − + + − − − miR-33-5p + + + + − + − miR-137-3p + + + + − + − miR-145a-5p + + + + − − + miR-151-5p + + + + − + − miR-214-5p + + + + − − − miR-326-3p + + + + − − − miR-337-3p + + + + − + − miR-361-5p + + + + − − − miR-378a-5p + + + + − − − miR-381-3p + + + + − + − miR-409-3p + + + + − − − miR-450b-5p + + + + − + − miR-508-3p + + + + − − − miR-543-3p + + + + − − − miR-576-5p + + + + − − − miR-580 + + + + − − − miR-591 + + + + − − − MicroRNAs underlined were tested in this study. [score:5]
The following miRNAs were tested for their potential to repress Twist1 translation in the human lung carcinoma cell line H1299: miR-33, miR-145a, miR-151, miR-326, miR-337, miR-361, miR-378a, miR-381, miR-409 and miR-543 (Fig. 1). [score:3]
The miRBase accession numbers for miRNAs are: mmu-miR-33 (MI0000707), mmu-miR-145a (MI0000169), mmu-miR-151 (MI0000173), mmu-miR-326 (MI0000598), mmu-miR-337 (MI0000615), mmu-miR-361 (MI0000761), mmu-miR-378a (MI0000795), mmu-miR-381 (MI0000798), mmu-miR-409 (MI0001160) and mmu-miR-543 (MI0003519). [score:1]
[1 to 20 of 3 sentences]
18
[+] score: 8
The analysis of miRNA expression data suggest that the age -associated abundance changes observed for three candidate proteins (DNAJC3, DDX3X, CALM1) are caused by post-transcriptional regulation through corresponding miRNAs, i. e. miR-107, miR-29c, miR-181a and miR-409-3p, which may target the transcripts of these proteins and showed an inverse expression pattern compared to these proteins in our fibroblast cultures. [score:7]
DNAJC3, DDX3X and CALM1 exhibited an anti-correlation with miR-107, miR-29c as well as with miR181a and miR-409-3p, respectively. [score:1]
[1 to 20 of 2 sentences]
19
[+] score: 8
Haller et al. revealed the deregulation of miRNA-329, miR-370, miR-376c and miR409 expression based on the location of the tumor in gastrointestinal stromal tumors (GISTs); higher expression occurred in intestinal compared to gastric tumors [46]. [score:5]
MicroRNA-154, miR-379 and miR-409 were highly expressed in metastatic prostate cancer cells [44]. [score:3]
[1 to 20 of 2 sentences]
20
[+] score: 7
miR-409–3p is a metastatic suppressor, and endogenous expression analysis revealed post-transcriptional inhibition of the onco-protein GAB1 is one of the mechanisms of action of this miRNA in CRC cells [11]. [score:7]
[1 to 20 of 1 sentences]
21
[+] score: 6
In contrast, hsa-miR-221-3p, hsa-miR-409-5p, hsa-miR-1290, hsa-miR-155-5p, hsa-miR-31-3p, hsa-miR-7-5p, hsa-miR-362-5p, hsa-miR-493-5p, hsa-miR-296-5p, and hsa-miR-199b-5p were statistically downregulated in human Sertoli cells of SCOS patients compared to OA patients (Figure 3B). [score:3]
B. Real-time PCR further revealed that human miR-221-3p, miR-409-5p, miR-1290, miR-155-5p, miR-31-3p, miR-7-5p, miR-362-5p, miR-493-5p, miR-296-5p, and miR-199b-5p were statistically expressed at lower levels in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
[1 to 20 of 2 sentences]
22
[+] score: 5
Zhang G. Liu Z. Xu H. Yang Q. miR-409-3p suppresses breast cancer cell growth and invasion by targeting Akt1Biochem. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 5
Figure 1C shows some examples of miRNAs exhibiting good correlations between miRNA gene expression scores and actual miRNA expression values in this independent test set, such as hsa-miR-10b, hsa-miR-199b-5p, and hsa-miR-409-3p. [score:5]
[1 to 20 of 1 sentences]
24
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Analyses of 238 intermediate-risk cytogenetic AML patients showed that reduced expression of miR-135a and miR-409-3p is associated with a higher risk of relapse [106], while higher miR-142 expression was associated with a better overall survival in these same patients [111]. [score:5]
[1 to 20 of 1 sentences]
25
[+] score: 5
Our previous studies have identified various miRNAs functioning as tumor suppressors in bladder cancer, including miR-101, miR-124-3p, miR-320c, miR-433, miR-409-3p, miR-490-5p, and miR-576-3p, which regulate the proliferation, migration and invasion of bladder cancer cells by down -regulating various oncogenes [17– 23]. [score:5]
[1 to 20 of 1 sentences]
26
[+] score: 4
The patients with down-regulated miR-409-3p [60] and miR-221 [61] could be prone to suffer from lymph node metastasis. [score:4]
[1 to 20 of 1 sentences]
27
[+] score: 4
Differential expression analysis between this new group and healthy controls confirmed that three of the four original miRNAs (miR-370-3p, miR-409-3p, miR-432-5p) were significantly dysregulated. [score:4]
[1 to 20 of 1 sentences]
28
[+] score: 4
miR-409-3p and miR-605were down-regulated exclusively in G361 cells. [score:4]
[1 to 20 of 1 sentences]
29
[+] score: 4
A group of miRNAs, including miR-218, miR-21, miR-132, miR-134, miR-155, and miR-409-5p, were reported to be overexpressed by three times as much in GBM compared with oligodendrogliomas, while miR-128 expression in oligodendrogliomas is four times higher than that in GBM. [score:4]
[1 to 20 of 1 sentences]
30
[+] score: 4
Oncogenic miRNAs like hsa-miR-339-5p, hsa-miR-143-5p, hsa-miR-409-3p, hsa-miR-153-3p and hsa-miR-145-5p have been reported to be downregulated in breast cancer [31– 35]. [score:4]
[1 to 20 of 1 sentences]
31
[+] score: 3
Our studies also showed that miR-127 and miR-409-3p were strongly expressed at all stages of human embryonic chondrocyte differentiation. [score:3]
[1 to 20 of 1 sentences]
32
[+] score: 3
Likewise, miR-93-5p and miR-409-5p were 38- and 85-fold more highly expressed, respectively, in MIN6 cells than in human beta cells (Fig. 3A). [score:3]
[1 to 20 of 1 sentences]
33
[+] score: 3
The cells were transiently cotransfected for 24 h with reporter plasmids (200 ng) and 100 nM of miR-409-3p mimics or inhibitor and harvested in reporter lysis buffer. [score:3]
[1 to 20 of 1 sentences]
34
[+] score: 3
Other miRNAs from this paper: hsa-mir-28, hsa-mir-625
Among these differentially expressed miRNAs, several have been reported in previous studies, such as miRlet-7, miR409, miR-28-5p, miR-625, etc. [score:3]
[1 to 20 of 1 sentences]
35
[+] score: 3
Moreover, a recent report indicates that the expression profile of a set of seven miRNAs (miR-21, miR-128, miR-132, miR-134, miR-155, miR-210, and miR-409-5p) allows to discriminate between oligodendroglioma and glioblastoma [42]. [score:3]
[1 to 20 of 1 sentences]
36
[+] score: 3
miR-409-3p was predicted to target α2 only. [score:3]
[1 to 20 of 1 sentences]
37
[+] score: 3
Thus, of 54 mouse and 47 human miRNAs expressed in all TECs, 22 were common to both species, whereas the overlap in cTEC-specific miRNAs was confined to miR-409–5p. [score:3]
[1 to 20 of 1 sentences]
38
[+] score: 3
Li C., et al. (2012) MicroRNA-409-3p regulates cell proliferation and apoptosis by targeting PHF10 in gastric cancer. [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 2
In addition, miR-495, miR-134, miR-409-3p, miR-496, miR-379, miR-369-3p in the cluster are linked to the tumor invasion depth in gastric cancer [104, 106]. [score:1]
Nine of those 11 miRNAs including miR-433, miR-127, miR-381, miR-377, miR-299-3p, miR-409-3p, miR-154, miR-382, and miR-376c are associated with OS. [score:1]
[1 to 20 of 2 sentences]
40
[+] score: 2
For other miRNA transcripts, such as miR-409-5p and miR-183-5p, the high degree of islet-specificity may point to novel roles in the development and maintenance of islet cellular phenotype. [score:2]
[1 to 20 of 1 sentences]
41
[+] score: 2
In a study of intermediate-risk cytogenetic AML (IR-AML), increased miR-196b or miR-644 were linked to shorter overall survival times, while reduced miR-135a and miR-409-3p were linked increased risk of relapse [98]. [score:1]
miR-135a, miR-196b, miR-409-3p, and mir-644 were identified as prognostic markers for IR-AML, while miR-122, miR-133b, miR-148a, and miR-409-3p were found to be be valuable in prognosis of AML and linked to adverse outcomes for older CN-AML patients [8]. [score:1]
[1 to 20 of 2 sentences]
42
[+] score: 2
Twenty of the 26 miRNAs belonged exclusively to the sporadic DT group, 5 miRNAs (miR-409-3p, miR-601, miR-542-5p, miR-487b and miR-4707-5p) were present in both tumor types, while miR-497-5p was detected only in Gardner's syndrome samples (Figure 1A and 1B). [score:1]
Five out the 101 miRNAs (miR-409-3p, miR-487b, miR-601, miR-542-5p and miR-4707-5p) were shared by both tumor types, 3 miRNAs (miR-320e, miR-497-5p and miR-2276) were specific to FAP -associated DTs and 93 were specific for sporadic DTs. [score:1]
[1 to 20 of 2 sentences]
43
[+] score: 2
Many miRNAs were reported to be associated with GC development in the past decade, including miR-146a (Yao et al., 2013), miR-204-5p (Zhang et al., 2015), miR-486 (Oh et al., 2011), miR-192 (Jin et al., 2011), miR-215 (Jin et al., 2011), miR-34b/c (Suzuki et al., 2010), miR-29a (Cui et al., 2011), miR-409-3p (Li et al., 2012a), and miR-296-5p (Li et al., 2014). [score:2]
[1 to 20 of 1 sentences]
44
[+] score: 2
Member(s) of the hsa-miR-181 14 and hsa-miR-29 families 15 exhibit both anticancer and pro-cancer regulation under different clinical conditions, while members of hsa-miR-126 16, hsa-miR-129 17, hsa-miR-136 18, hsa-miR-204 19, hsa-miR-663 20, hsa-miR-99 21, hsa-miR-378 22, hsa-miR-92 23, and hsa-miR-409 24 families are recognized as having anticancer properties under different clinical conditions. [score:2]
[1 to 20 of 1 sentences]
45
[+] score: 2
We found that four miRNAs (miR-134, miR-410, miR-409-3p and miR-494) from C14MC were significantly associated with IDH mutation. [score:2]
[1 to 20 of 1 sentences]
46
[+] score: 1
73(12) hsa-miR-377* 14q32.2 −2.72 hsa-miR-7 15q25.3/19p13.3/9q21.32 −2.72(12, 14) hsa-miR-124 20p23.1/8q12.3/8p23.1 −2.71(12, 14, 29, 48, 49) hsa-miR-323-5p 14q32.31 −2.69(12) hsa-miR-873 9p21.1 −2.65 hsa-miR-129* 11p11.2/7q32.1 −2.63 hsa-miR-338-5p 17q25.3 −2.61(14) hsa-miR-409-5p 14q32.2 −2.61 hsa-miR-874 5q31.2 −2.46 hsa-miR-495 14q32.2 −2.46(52) hsa-miR-885-5p 3p25.3 −2.45 hsa-miR-376c 14q32.2 −2.43(52) hsa-miR-299-5p 14q32.2 −2.41 hsa-miR-539 14q32. [score:1]
[1 to 20 of 1 sentences]
47
[+] score: 1
Combination of miR-148b, miR-409-3p, and miR-801 discriminated powerfully between breast cancer cases and healthy controls [80]. [score:1]
[1 to 20 of 1 sentences]
48
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-335, hsa-mir-133b, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
A separate study performed by gavage of alcohol by a gastrostomy tube found that ethanol increased miR-21, miR-34a, miR-137, miR-409-5p, miR-509-3p, and miR-882 and decreased levels of let-7 family members (let-7a, -7b, and -7g), miR-122, miR-127, miR-181a, miR-181b, miR-192, and miR-871 [62]. [score:1]
[1 to 20 of 1 sentences]
49
[+] score: 1
html) for the first 789 bp 3’UTR of PDCD4 MicroRNA Fold change miR-372 4.82 miR-499 2.89 miR-18a 2.82 miR-200c 2.69 miR-130a 2.59 miR-21 2.29 miR-30d 2.21 miR-409-5p 2.14 miR-20a 2.12 let-7c 0.45 miR-198 0.40 The array data were then confirmed by QRT-PCR of 4 representative miRNAs using ten tumour and adjacent normal samples. [score:1]
[1 to 20 of 1 sentences]
50
[+] score: 1
In a study conducted by Wang et al. (2015), miR-7 was identified as one of three miRNAs (along with miR-93 and miR-409-3p) from an array of 723 human miRNAs, which were found to be powerful predictors of CRC. [score:1]
[1 to 20 of 1 sentences]
51
[+] score: 1
Meanwhile, another important study from Josson S et al. proved that stromal fibroblast-derived exosomes that carry abundant miR-409 can induce EMT of the adjacent epithelia in the tumor compartment of prostate cancer [177]. [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
Other miRNAs from this paper: hsa-mir-1246, hsa-mir-711
For example, Josson et al. demonstrated that miR-409-3p was significantly elevated in the stroma of patients with a high (>7) versus low Gleason score (<7) [168]. [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
miRNAlog [2]FoldChange P-value Corrected P-value hsa-mir-577 −3,28 1,46E-10 3,87E-08 hsa-mir-182-5p −2,70 6,50E-15 3,44E-12 hsa-mir-485-5p −2,12 8,79E-05 8,45E-03 hsa-mir-124-3p −1,83 1,05E-05 1,85E-03 hsa-mir-218-5p −1,68 1,54E-04 1,16E-02 hsa-mir-183-5p −1,62 3,14E-04 2,08E-02 hsa-mir-873-5p −1,58 9,80E-04 3,25E-02 hsa-mir-133a −1,53 6,05E-04 2,29E-02 hsa-mir-487b −1,45 1,56E-03 4,59E-02 hsa-mir-219-5p −1,44 9,55E-04 3,25E-02 hsa-mir-409-3p −1,34 1,12E-03 3,48E-02 hsa-mir-889 −1,23 5,71E-04 2,29E-02 hsa-mir-136-3p −1,15 1,75E-03 4,87E-02 hsa-mir-410 −1,12 4,02E-04 2,29E-02 hsa-mir-127-3p −0,95 5,61E-04 2,29E-02 hsa-mir-148a-3p 1,23 4,99E-04 2,29E-02 hsa-mir-155-5p 1,82 9,56E-05 8,45E-03 hsa-mir-221-3p 2,10 4,82E-04 2,29E-02For each differently expressed miRNA we report the standard name according to MirBase database, the log [2] fold-change, the P-value and the corresponding corrected P-value as calculated by DESeq. [score:1]
[1 to 20 of 1 sentences]
54
[+] score: 1
In whole blood samples of healthy controls we found nine miRNAs (hsa-miR-130b*, hsa-miR-182, hsa-miR-183, hsa-miR-3180-3p, hsa-miR-3200-5p, hsa-miR-409-3p, hsa-miR-4318, hsa-miR-501-5p, hsa-miR-942) that were detected in all whole blood samples but not in any of the separated leukocyte subsets of healthy controls. [score:1]
[1 to 20 of 1 sentences]
55
[+] score: 1
Josson S miR-409-3p/-5p promotes tumorigenesis, epithelial-to-mesenchymal transition, and bone metastasis of human prostate cancerClin. [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
Among the 24 specific miRNAs, 13 of them, such as miR-182/196a/381/499a/99a [6], miR-183 [6, 23], miR-409 [23], miR-146b [6, 24], miR-143 [6, 24], miR-148a [24, 25], miR-204 [5], and miR-9 [6], have been reported to involve in T2D process in mouse or rat. [score:1]
[1 to 20 of 1 sentences]