sort by

208 publications mentioning hsa-mir-20b (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-20b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 365
Interestingly, overexpression of miR-20b in ZR-75-30 and MCF-7 breast cancer cells did not significantly change the mRNA expression of PTEN, indicating that miR-20b regulates PTEN expression at the posttranscriptional level. [score:8]
Alteration of miR-20b expression changed PTEN protein level but not mRNA expression in ZR-75-30 and MCF-7 breast cancer cells, suggesting miR-20b regulates PTEN gene expression at the posttranscriptional level. [score:8]
MiR-20b could downregulate PTEN protein expression by directly targeting the 3′-UTR of PTEN. [score:8]
ZR-75-30 and MCF-7 breast cancer cells transfected with miR-20b mimics showed a significant increase in miR-20b expression (A), while the cells transfected with miR-20b inhibitor resulted in a significant decrease of miR-20b expression (B). [score:7]
Luciferase assays confirmed that miR-20b could directly bind to the 3′ untranslated region(UTR) of PTEN and suppress translation. [score:7]
In contrast, ZR-75-30 and MCF-7 cells transfected with 100 nM of miR-20b inhibitor dramatically decreased miR-20b expression level as compared with that of negative control (inhibitor-NC) transfected cells (Figure  3B). [score:6]
In addition, knockdown of miR-20b expression could suppress the cell cycle progression in MCF-7 breast cells. [score:6]
MiR-20b knockdown suppresses tumor growth in vivoIn the present study, we found that miR-20b was overexpressed in human breast cancer cells. [score:6]
In this study we also determined that miR-20b inhibited PTEN protein expression by directly binding to the 3′-UTR of PTEN in ZR-75-30 and MCF-7 breast cancer cells. [score:6]
Conversely, knockdown of miR-20b expression inhibited the growth of breast cancer cells in vitro and in vivo. [score:6]
Above all, these studies showed that miR-20b served as an important oncomir in promoting multiple cancer cells growth through regulating tumor suppressor PTEN expression. [score:6]
Dysregulation of miR-20b plays critical roles in the breast cancer tumorigenesis, at least in part via targeting the tumor suppressor PTEN. [score:6]
The present study also showed that miR-20b was upregulated in human breast cancer tissues, and a bioinformatics analysis predicted phosphatase and tensin homologue (PTEN) to be a potential target of miR-20b. [score:6]
To explore the molecular mechanism of miR-20b upon the growth of breast cancer cells, we confirmed that miR-20b could directly bind to the 3′-UTR of PTEN and suppress the translation. [score:6]
In this study, we observed that upregulation of miR-20b in human breast cancer was associated with PTEN protein expression level. [score:6]
MiR-20b function was expressed as a percent reduction in the luciferase activity of cells transfected with the reporter vector containing the miR-20b target sequences compared with cells transfected with the vector without the miR-20b target. [score:6]
Moreover, in the study of nude mice mo del, we validated that knockdown of miR-20b expression level could suppress the tumorigenesis of breast cancer cells in vivo. [score:6]
These data suggest that miR-20b can downregulate PTEN gene expression at the posttranscriptional level. [score:6]
Li et al. reported that miR-20b downregulated PTEN expression in HCC1806 cells [14]. [score:6]
Conversely, downregulation of miR-20b could significantly inhibit these processes in ZR-75-30 and MCF-7 cells. [score:6]
MiR-20b was also reported to involve regulation of VEGF expression by targeting HIF-1α and STAT3 in MCF-7 breast cancer cells [13]. [score:5]
Figure 6 Inhibition of miR-20b suppresses the proliferation of breast cancer cells. [score:5]
We identified PTEN, a well-known tumor suppressor, as the functional downstream target of miR-20b. [score:5]
A newly study also showed that miR-20b, −21, and -130b were involved in suppression of PTEN expression in colorectal cancer [28]. [score:5]
Additional file 1: Figure S1: PTEN protein expression is negatively correlated with miR-20b expression. [score:5]
ZR-75-30 and MCF-7 breast cancer cells transfected with miR-20b mimics or inhibitor did not affect PTEN mRNA expression. [score:5]
MiR-20b serves as an oncomir that plays an important role in the growth of breast cancer cells partly by targeting tumor suppressor PTEN at the posttranscriptional level. [score:5]
MiR-20b downregulates PTEN expression at the posttranscriptional level. [score:5]
Meanwhile, miR-20b inhibitor suppressed DNA synthesis in both ZR-75-30 and MCF-7 breast cancer cells. [score:5]
Compared with the normal mammary epithelial cell line (MCF-10A), miR-20b expression level was upregulated in all four examined breast cancer cell lines (MCF-7, ZR-75-30, T-47D and SK-BR-3) (Figure  1B). [score:5]
These results indicated that miR-20b knockdown could suppress the breast tumor growth in vivo. [score:4]
A newly-published study has shown that ionizing radiation, a potent tumor-causing agent, can induce miR-20b expression in rat mammary gland tissues, and the transcription factor early growth response-1 involves in the regulation of miR-20b in the breast cancer cell line HCC1806 [14]. [score:4]
Upregulation of miR-20b significantly promoted ZR-75-30 and MCF-7 breast cancer cells viability, colony formation, and led to enhancing DNA synthesis. [score:4]
Notably, knockdown of miR-20b expression displays anti-tumor effects both in vitro and in vivo. [score:4]
A study by Li et al. indicated that one of the most important facets underlying metastatic heterogeneity of breast cancer is the differential distribution of miR-20a and miR-20b and their regulation of target proteins, such as VEGF-A and HIF-1α [6]. [score:4]
Furthermore, upregulation of miR-20b significantly promoted the proliferation, colony formation and DNA synthesis of ZR-75-30 and MCF-7 breast cancer cells. [score:4]
Cascio et al. reported that miR-20b could regulate the expression of vascular endothelial growth factor (VEGF) in MCF-7 breast cancer cells under normoxic and hypoxia -mimicking conditions, which was mediated by hypoxia inducible factor 1 (HIF-1) and signal transducer and activator of transcription 3 (STAT3) [13]. [score:4]
However, miR-20b could significantly downregulate PTEN protein level in ZR-75-30 and MCF-7 breast cancer cells (Figure  3E and F). [score:4]
These results suggest that miR-20b functions as an oncomir by contributing to breast tumorigenesis partly via regulating PTEN expression at the posttranscriptional level. [score:4]
Figure 7 Knockdown of miR-20b inhibits tumorigenicity of breast cancer cells in vivo. [score:4]
Furthermore, upregulation of miR-20b in ZR-75-30 and MCF-7 breast cancer cells significantly enhanced their growth ability, as indicated by the increase in colony numbers (P < 0.05) (Figure  4B). [score:4]
It seems that knockdown of miR-20b expression resulted in cells that were blocked in G [0]/G [1] phase and could not enter into S phase for DNA synthesis. [score:4]
Whereas miR-20b inhibition dramatically restrained the cell viabilities of ZR-75-30 and MCF-7 at 48 h after transfection as compared with that of negative control (inhibitor-NC) transfected cells (P < 0.05) (Figure  4A). [score:4]
Moreover, miR-20b knockdown could suppress tumorigenicity of breast cancer cells in vivo. [score:4]
Figure 3 MiR-20b inhibits PTEN protein expression. [score:4]
Figure 5 Upregulation of miR-20b promotes breast cancer cell proliferation through enhancing DNA synthesis. [score:4]
The proportion of cells corresponding to the proportion of cells in the S and G [2]/M phase was lower in miR-20b inhibitor -transfected MCF-7 cells than that in control cells. [score:3]
MiR-20b knockdown suppresses tumor growth in vivo. [score:3]
Statistical and correlation analyses of PTEN protein level and miR-20b expression in ten freshly prepared normal human breast tissues and ten human breast cancer tissues. [score:3]
In the present study, we found that miR-20b was overexpressed in human breast cancer cells. [score:3]
To evaluate the effect of miR-20b on PTEN expression level, we transfected the breast cancer cell lines ZR-75-30 and MCF-7 with miR-20b mimics or inhibitor. [score:3]
The putative binding sites of miR-20b in the 3′-UTR of the human PTEN gene were predicted by combinatorial utilization of three different algorithms, including TargetScan (http://www. [score:3]
Therefore, miR-20b may be a novel diagnostic marker and potential therapeutic target in breast cancer. [score:3]
To explore the molecular mechanism of miR-20b in the growth of breast cancer cells, we used a bioinformatics analysis to search for putative protein-coding gene targets of miR-20b, especially for those that can affect cancer cell growth. [score:3]
Representative micrographs (200×) and quantification of EdU incorporating-cells after transfection with miR-20b inhibitor or negative control. [score:3]
The loss-of-function study was performed with miR-20b inhibitor (100 nM) and its negative control (100 nM) on the cell lines. [score:3]
Figure 1 Expression of miR-20b is associated with PTEN level. [score:3]
We subcloned PTEN 3′-UTR sequences containing the predicted target site (wild type, pGL3-wt) of miR-20b or mutated sequences (mutant type, pGL3-mut) into the pGL3-Control vector, respectively. [score:3]
After transfecting with miR-20b mimics or inhibitor, no significant difference in PTEN mRNA level was observed in the both breast cancer cells (Figure  3C and D). [score:3]
The present study uncovered an oncogenic function of miR-20b that was frequently overexpressed in breast cancer tissues and cell lines. [score:3]
Figure 2 MiR-20b directly targets the 3′-UTR of PTEN. [score:3]
MiR-20b mimics, miR-20b inhibitor, antagomir-20b and their negative control were synthesized by Ribobio (RiboBio Co. [score:3]
To correct for the transfection efficiency, a luciferase reporter vector (pRL-TK Vector, Promega) without miR-20b target was transfected in parallel. [score:3]
According to this rationale, PTEN was selected as the candidate target gene of miR-20b, which was highly conserved among different species and whose 3′-UTR of mRNA contained a complementary site for the seed region of miR-20b (Figure  2A). [score:3]
We further assessed the expression level of miR-20b in a panel of breast cancer cell lines. [score:3]
Cells were transfected with miR-20b mimics or miR-20b inhibitor in 96-well plates. [score:3]
These data indicate that the protein level of PTEN is negatively correlated with the miR-20b expression (Additional file 1). [score:3]
The results also showed that miR-20b expression level was significantly decreased in tumor tissues of antagomir-20b group (Figure  7C). [score:3]
The probability of survival was significantly lower in gastric cancer patients with high expression levels of miR-20b [11]. [score:3]
Furthermore, we performed a luciferase reporter assay to verify that miR-20b directly targets PTEN. [score:3]
We transfected miR-20b mimics into breast cancer cells ZR-75-30 and MCF-7, which showed that overexpression of miR-20b significantly increased the cell viabilities of both breast cancer cells at 48 h after transfection in comparison with that of negative control (miR-NC) transfected cells (P < 0.05) (Figure  4A). [score:3]
Li et al. reported that ionizing radiation, a known breast carcinogen, could trigger the differential expression of miR-20b in mammary tissues. [score:3]
We analyzed the expression level of miR-20b in 23 paired clinical breast cancer tissues and the adjacent normal breast tissues by miRNA qRT-PCR. [score:3]
The results showed that miR-20b overexpression enhanced DNA synthesis in both ZR-75-30 and MCF-7 breast cancer cells. [score:3]
These findings suggested that deregulation of miR-20b played an important role in promoting carcinogenesis and progression of breast cancer. [score:2]
The results showed that co-transfection of miR-20b mimics and pGL3-wt significantly decreased the luciferase activities in breast cancer cells (ZR-75-30 and MCF-7) but not that of the mutant reporter (Figure  2B), indicating that miR-20b binds directly to the 3′-UTR of PTEN. [score:2]
Recently, studies of miRNA profiles found several deregulated miRNAs in breast cancer, including miR-20b [6, 7]. [score:2]
ZR-75-30 cells (top-panel) and MCF-7 cells (below-panel) were transfected with miR-20b inhibitor or negative control; 48 hours after transfection, EdU labeling assays were performed. [score:2]
Compared with miR-20b mimic negative control (miR-NC), transfection with 50 nM of miR-20b mimics in ZR-75-30 and MCF-7 cells led to more than 1000-fold increase in miR-20b expression as detected by quantitative real-time PCR (Figure  3A). [score:2]
The percentage of EdU positive cells in miR-20b inhibitor transfected ZR-75-30 cells (35.51% ± 2.24%) and MCF-7 cells (25.79% ± 3.95%) were significantly decreased as compared with that of in negative control transfected ZR-75-30 cells (40.47% ± 4.73%) and MCF-7cells (30.88% ± 3.52%) (Figure  6; P < 0.05). [score:2]
Further analysis revealed that knockdown of miR-20b significantly decreased the proliferation index of MCF-7 cells (Additional file 2). [score:2]
In the present study, we showed that miR-20b was overexpressed in human breast cancer tissues and cell lines compared with paired adjacent normal tissues and normal cell lines, respectively. [score:2]
The average expression level of miR-20b was significantly increased in breast cancer tissues compared with paired normal adjacent tissues (Figure  1A; P < 0.001). [score:2]
We found that the G [0]/G [1] phase was increased in miR-20b inhibitor -transfected MCF-7 breast cells compared with control cells. [score:2]
To further investigate whether the downregulation of miR-20b can suppress tumorigenicity of breast cancer cells, ZR-75-30 breast cancer cells transfected with antagomir-20b or negative control (NC) were subcutaneously inoculated into BALB/c nude mice and their tumorignicity was investigated. [score:2]
Collectively, these results support the role of miR-20b in the promotion of breast cancer cell proliferation, suggesting that miR-20b has an oncogene function. [score:1]
The results obtained from gain-of-function and loss-of-function approaches showed that miR-20b could enhance the cell viability, colony formation and DNA synthesis of breast cancer cells in vitro. [score:1]
The aim of this study is to explicit the molecular mechanism of miR-20b underlying breast cancer tumorigenesis. [score:1]
Breast cancer MiR-20b PTEN Posttranscriptional regulation Breast cancer is the most frequently diagnosed malignancy and the leading cause of cancer death in women worldwide. [score:1]
The zinc finger transcription factor early growth response-1 (EGR1) is a crucial player in the transcriptional control of miR-20b, and miR-20b may in turn function as an oncogene by contributing to breast tumorigenesis [14]. [score:1]
The miR-20b gain-of-function study was performed using miR-20b mimics (50 nM) and its negative control (50 nM) on the breast cancer cell lines. [score:1]
Although miR-20b was reported to involve in the pathogenesis of breast cancer, the molecular mechanism has not been clearly elucidated. [score:1]
Inverse level of miR-20b and PTEN in breast cancer. [score:1]
The region complementary to the seven nucleotides of miR-20b is highly conserved among human, chimpanzee, mouse, rat, and xenopus. [score:1]
The “seed” sequence of miR-20b that is complementary to PTEN is shown in the box. [score:1]
MiR-20b binds directly to the 3′-UTR of PTEN. [score:1]
MiR-20b belongs to the miR-106a-363 cluster, together with miR-17-92 and miR-106b-25 clusters, form a large family of highly similar miRNAs called the miR-17 family [8]. [score:1]
Figure 4 Effects of miR-20b on proliferation of breast cancer cells. [score:1]
These studies suggested that miR-20b can serve as a potential oncogene. [score:1]
Representative micrographs (200×) and quantification of EdU incorporating-cells after transfection with miR-20b mimics or negative control. [score:1]
Cells were cotransfected with wt/mut 3′-UTR with miR-20b mimics or negative control as indicated. [score:1]
In this study, we aim to explicit the molecular mechanism of miR-20b underlying breast cancer tumorigenesis. [score:1]
[1 to 20 of 102 sentences]
2
[+] score: 176
Other miRNAs from this paper: hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-106a
Our conclusion is based on the following results: all three miRNAs had lower expression levels in all hematopoietic cells and trophoblasts differentiated from hESCs than their parent hESCs (Figure  3); only miR-20b mimics specifically decreased the activity of the TF-3′-UTR -driven luciferase reporter, but not the mutant TF-3′-UTR -driven reporter (Figure  4A,B) when they were analyzed in G-M cells or trophoblasts; only miR-20b mimics inhibited the TF expression in G-M cells and trophoblasts (Figure  4C); and miR-20b inhibitor increased the TF expression in G-M cells and trophoblasts (Figure  4D). [score:11]
We first found that TF was expressed only in trophoblasts and granulocyte–monocyte (G-M) cells differentiated from hESCs; and then demonstrated that miR-20b downregulated and Erk1/2 signaling pathway upregulated the TF expression in trophoblasts and G-M cells. [score:11]
Because bioinformatic analysis of the 3′-UTR of the TF transcript suggests that TF expression may be regulated by miR-19a, miR-20b, and miR-106a, we investigated the potential of these miRNAs to regulate TF expression in G-M cells and trophoblasts differentiated from hESCs and found that miR-20b mimics inhibited TF expression in these cells, but did not disturb the differentiation process because the expression of G-M cell-specific marker gene PU. [score:11]
Inhibiting Erk1/2 pathway activity did not block the upregulation of TF expression conveyed by introducing miR-20b inhibitor in G-M cells and trophoblasts (Figure  6). [score:10]
Interestingly, our data showed that introducing miR-20b inhibitor to increase the TF expression or inhibiting Erk1/2 pathway activity to decrease TF expression, or both, did not disturb the hematopoietic and trophoblastic differentiation of hESCs because either treatment to G-M cells or trophoblasts did not alter the G-M cell-specific marker PU. [score:9]
We found that miR-20b downregulated and the Erk1/2 signaling pathway upregulated TF expression in G-M cells and trophoblasts differentiated from hESCs. [score:9]
As shown in Figure  6, administration of U0126 only partially reduced the upregulated mRNA levels of TF in G-M cells and trophoblasts using miR-20b inhibitor. [score:6]
We here provided evidence showing that miR-20b may directly interact with the 3′-UTR of TF to suppress the expression of TF. [score:6]
For this purpose, we asked whether specifically blocking Erk1/2 pathway activity using U0126 could prevent the upregulated TF mRNA levels using miR-20b inhibitor. [score:6]
Finally, we found that miR-20b downregulated the TF expression independently of the Erk1/2 signaling pathway. [score:6]
miR-20b downregulated TF expression in G-M cells and trophoblasts but not through the Erk1/2 pathway. [score:6]
As shown in Figure  4D, TF mRNA was significantly increased in both trophoblasts and G-M cells when miR-20b inhibitor was administrated, while this administration did not affect the expression of the lineage-specific marker PU. [score:5]
To further confirm our observation above, we asked whether miR-20b inhibitor could increase the TF expression in G-M cells or trophoblasts. [score:5]
The suppression of miR-20b on TF-3′-UTR reporter was specific because miR-20b mimics could not inhibit the reporter activity driven by mutant TF-3′-UTR (Figure  4B). [score:5]
miR-20b inhibited TF expression in trophoblasts, and G-M cells differentiated from hESCs. [score:5]
We thus asked whether miR-20b inhibited TF expression via the Erk1/2 signaling pathway in these cells. [score:5]
Figure 4 miR-20b inhibited tissue factor expression. [score:5]
The miR-20b and Erk1/2 pathway independently regulate expression of TF in trophoblasts and G-M cells differentiated from hESCs. [score:4]
Our study did conclude that the Erk1/2 signaling pathway regulated the TF expression independent of miR-20b. [score:4]
These data suggest that miR-20b did not regulate TF expression through the Erk1/2 signaling pathway. [score:4]
miR-20b may regulate the expression of other genes related with Erk1/2 signaling pathway activity. [score:4]
Both miR-20b and the Erk1/2 signaling pathway regulated TF expression in G-M cells and trophoblasts. [score:4]
Figure 6 Erk1/2 signaling pathway and miR-20b regulate tissue factor expression in trophoblastic and hematopoietic differentiation of human embryonic stem cells. [score:4]
Granulocyte–macrophage (G-M) cells and trophoblasts were treated with both miR-20b inhibitor and Erk1/2-specific inhibitor U0126, simultaneously for 48 hours before harvesting for quantitative real-time polymerase chain reaction to measure the mRNA levels of PU. [score:3]
1, and CDX2 mRNA levels in G-M cells and trophoblasts transfected with miR-20b inhibitor were analyzed using quantitative real-time polymerase chain reaction and reported as the mean ± standard error of the percentage of the mRNA levels of their corresponding gene in control cells, respectively. [score:3]
Taken together, these data suggested that miR-20b decreased TF expression, while it did not disturb the trophoblastic or hematopoietic differentiation of hESCs. [score:3]
Figure 3 miR-19a, miR-20b, and miR-106a expression in hematopoietic cells and trophoblasts derived from human embryonic stem cells. [score:3]
miRNA mimics and inhibitors for miR-19a, miR-20b, and miR-106a were purchased from GenePharma Co. [score:3]
In contrast, HSPCs had the lowest levels of miR-20b among hESCs, G-M cells, and trophoblasts, but did not express TF (Figure  3). [score:3]
Similarly, reverse transcriptase PCR for TF mRNA and western blotting for TF protein also showed that TF expression in G-M cells or trophoblasts was reduced by miR-20b mimics, but not by miR-19a or miR-106a mimics (Figure  4C). [score:3]
Surprisingly, the expressions of miR-20b and miR-106a were significantly higher in hESCs than in HSPCs, G-M cells, and trophoblasts. [score:3]
Louis, Missouri, USA) and then transfected with 2 μg TF-3′-UTR or mutant plasmid DNA with 100 nM inhibitors or 100 nM mimics of miR-19a, miR-20b, or miR-106a mixed with Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. [score:3]
We therefore asked whether miR-19a, miR-20b or miR-106a mimics could alter TF expression in G-M cells and trophoblasts using the TF-3′-UTR reporter assay, TF mRNA, and TF protein analysis. [score:2]
In the 3′-UTR of TF mRNA, there are binding sites for miR-19a, miR-20b, and miR-106a (Figure  1). [score:1]
DNA analysis shows that there are miRNA -binding sites for miR-19a, miR-20b, and miR-106a in the 3′-UTR of the TF mRNA transcript. [score:1]
[1 to 20 of 35 sentences]
3
[+] score: 149
Although EGFR was not differentially expressed (Table 1), it was found to be targeted by miR-20b and was therefore also used for Western blotting. [score:5]
In contrast, with miR-20b mimic 31 of 43 differentially expressed miRNAs exhibited decreased expression (B). [score:5]
With miR-19a mimic transfectants (A) 46 of the 53 miRNAs exhibited significantly decreased expression, miR-19a, miR-19b, and miR-20b being among the seven mirNA with significantly increased expression. [score:5]
Figure 3 MicroRNAs differentially expressed in cultured human squamous carcinoma (E10) cells transfected with scrambled control, miR-19a -, miR-20b -, miR-92a, or miR-363-5p- mimic. [score:3]
One single mirNA, miR-423-5p, was found differentially expressed (decreased by about 50%) in transfectants for either miR-19a -, miR-20b -, or miR-363-5p mimic. [score:3]
The heat-map presented in Figure 3 resulted from hierarchical clustering of 53, 43, 61 and 29 miRNAs found differentially expressed (p ≤ 0.05) in E10 cells transfected with mimic for miR-19a (A), miR-20b (B), miR-92a (C), or miR-363-5p - (D), respectively. [score:3]
Results from microarrays (Figure 3) and qRT-PCR (Figure 7) suggested that levels of expression of all members of the miR-106b-25 cluster (miR-106b, miR-25, and miR-93) were decreased in cells transfected with miR-20b mimic or with miR-363-5p mimic (Figures 7A,B). [score:3]
These five mRNAs were predicted to be targeted by miR-20b or miR-363-5p using MicroCosm, IPA or SVMicro software. [score:3]
In cells transfected with miR-19a -, miR-20b -, or miR-92a mimic, the primary transcripts exhibited significantly increased levels of expression (Figure 9). [score:3]
For cells transfected with mimic for miR-19a, miR-20b, or miR-363-5p (Figure 3) differentially expressed miRNAs yielded highly significant associations to, e. g., “Cell Cycle,” “Cell Death,” and “Cellular Growth and Proliferation” (Figure 5). [score:3]
Preliminary mRNA profiling using microarrays (results not shown) had suggested that ATF1, KRT14, KRT15, PSMB6 were differentially expressed in miR-363-5p transfectants and AFT1 and PSMB6 in miR-20b transfectants. [score:3]
Effects of transfection cultured human squamous carcinoma cells with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic on expression of the primary transcripts pri-17-92, pri-106a-363, and pri-106b-25. [score:3]
The miRNAs (53, 43, 61 and 29) found differentially expressed following transfection with miR-19a - miR-20b -, miR-92a -, or miR-363-5p mimic were subjected to bioinformatic analysis using Ingenuity Pathways Analysis. [score:3]
Because overexpression of miR-17-92 - or miR-106a-363 cluster is associated with stimulated proliferation/cancer (Landais et al., 2007; Lu et al., 2007) the observed anti-proliferative effect found with miR-20b and 363-5p transfectants was unexpected. [score:3]
Results obtained using qRT-PCR showed that ATF1, KRT14, KRT15, and PSMB6 were differentially expressed in miR-363-5p transfectants and AFT1 and PSMB6 in miR-20b transfectants (Table 1). [score:3]
Whether the distinct populations of differentially expressed miRNAs found in transfectants for miR-19a -, miR-20b -, or miR-363-5p mimic (Figure 3) reflect different ant-proliferative mechanisms remains to be established. [score:3]
Only miR-423-5p was shared between the 30–50 differentially expressed miRNAs in cells transfected with mimic for miR-19a, miR-20b, or miR-363-5p. [score:3]
IPA and SVMicro also suggested EGFR as target for miR-20b. [score:3]
Figure 8 Levels of expression of the microRNAs encoded by the miR-106a-363 cluster in cultured, human squamous carcinoma cells (E10) following transfection with miR-19a, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
Figure 6 Levels of expression of the microRNAs encoded by the miR-17-92 cluster in cultured human squamous carcinoma cells (E10) following transfection with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
SVMicro (Liu et al., 2010) suggested ATF1, KRT14, KRT15, PSMB6 as potential targets for miR-20b and miR-363-5p. [score:3]
Figure 7 Levels of expression of the microRNAs encoded by the miR-106b-25 cluster in cultured human squamous carcinoma cells (E10) following transfection with miR-19a miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
Western blotting results, with proteins selected from among mirNA targets, can be regarded to verify this as all exhibited altered levels in cells transfected with mimic for miR-20b or miR-363-5p (Figure 4). [score:3]
The miRNAs, and seed sequences, associated with the various cellular functions are presented in Table 2. Figure 5 Bioinformatic analysis of miRNAs found differentially expressed in cultured human squamous carcinoma cells (E10) transfected with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
presented in Figure 6 also show levels of expression of the various miRNAs of the miR-17-92 cluster after transfection with mimics for miR-19a, miR-20b or miR-92a. [score:3]
As expected, high levels of expression of miR-19a/miR-19b, or miR-20b, or miR-363-5p were found in cells transfected with mimic for miR-19a, or miR-20b - or miR-363-5p, respectively. [score:3]
from microarrays (Figure 3) and qRT-PCR (Figure 7) suggested that levels of expression of all members of the miR-106b-25 cluster (miR-106b, miR-25, and miR-93) were decreased in cells transfected with miR-20b mimic or with miR-363-5p mimic (Figures 7A,B). [score:3]
Likewise, the more potent anti-proliferative miR-20b decreased expression miR-19a and miR-93 (Figures 6C, 7C) as well as increasing the level of miR-106a by about 60% (Figure 8C); changes consistent with an anti-proliferative effect (Qin et al., 2010; Fang et al., 2011). [score:3]
ANOVA (P ≤ 0.05) was used for the isolation of the 53 mirNA differentially expressed in transfectants with miR-19a mimic (A), 43 miRNAs in miR-20b transfectants (B), 61 miRNAs in miR-92a transfectants (C) and 29 miRNAs in transfectants with miR-363-5p mimic (D). [score:3]
Results presented in Figure 6 also show levels of expression of the various miRNAs of the miR-17-92 cluster after transfection with mimics for miR-19a, miR-20b or miR-92a. [score:3]
obtained using qRT-PCR showed that ATF1, KRT14, KRT15, and PSMB6 were differentially expressed in miR-363-5p transfectants and AFT1 and PSMB6 in miR-20b transfectants (Table 1). [score:3]
The miRNAs, and seed sequences, associated with the various cellular functions are presented in Table 2. Figure 5 Bioinformatic analysis of miRNAs found differentially expressed in cultured human squamous carcinoma cells (E10) transfected with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:3]
MiRNAs with significantly altered expression following transfection with mimics for miR-19a, miR-20b or miR-363-5p on miRNA were identified using human deoxyoligonucleotide microarrays for miRNA (OneArray® Microarray v2). [score:3]
Although transfectants for both miR-19a -and miR-20b -mimic exhibited diminished proliferation expression of only a few sibling miRNAs were now significantly changed, but in a manner conducive to diminished proliferation. [score:3]
Transfection with miR-20b mimic, however, significantly increased expression of pri-miR-17, while that of the pri-miR-92a-1 transcript was unaffected (Figure 9). [score:3]
presented in Figure 8 show relative levels of expression of the miRNAs encoded by the miR-106a-363 cluster after transfection of E10 cells with mimic for miR-19a-, miR-20b -, miR-92a -, or miR-363-5p. [score:3]
Results presented in Figure 8 show relative levels of expression of the miRNAs encoded by the miR-106a-363 cluster after transfection of E10 cells with mimic for miR-19a-, miR-20b -, miR-92a -, or miR-363-5p. [score:3]
Profiling of miRNAs which were differentially expressed in E10 cells transfected with miR-19a-, miR-20b-, miR-92a-, or miR-363-5p mimic. [score:3]
Transfections were carried out using 20 nM of miR-19a -, miR-20b -, or miR-92a -, or miR-363-3-p -, or miR-363-5-p mimic or Allstar scrambled control (Qiagen, Hilden, Germany), or with transfection reagent only (MOCK). [score:1]
The miR-17-92 cluster, located on human chromosome 13, encodes six miRNAs: miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1. The miR-106a-363 cluster, located on human chromosome X, encodes six miRNAs: miR-106a, miR-18b, miR-20b, miR-19b-2, miR-92-2, and miR-363. [score:1]
Only miR-19b, miR-20b, miR-92a, and miR-106a were detectable in these cells. [score:1]
Effects of transfection of cultured squamous carcinoma cells with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic on levels of miRNAs encoded by the miR-17-92 cluster. [score:1]
Fractions of RNA enriched with respect to microRNA were isolated from cultured human squamous carcinoma cells (E10) transfected with miR-363-5p (A), miR-92a - (B), miR-20b - (C), miR-19a - (D) or scrambled control. [score:1]
Effects of transfection with miR-18a, miR-19a-, miR-20b-, miR-92a-, miR-363-3p or miR-363-5p mimic on proliferation of cultured carcinoma cells. [score:1]
Effects of transfection of cultured squamous carcinoma cells with miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic on levels of miRNAs encoded by the miR-106a-363 or miR-106b-25 clusters. [score:1]
It may, however, be associated with the relatively low levels of miR-20b and miR-363-5p found in E10 cells (Figure 8). [score:1]
Cultured human squamous oral carcinoma cells (E10) exhibited both altered morphology and diminished proliferation at 72 h after transfection with mimic for either miR-20b, or miR-363-3p, or miR-363-5p. [score:1]
In cultures transfected with mimics for miR-20b or miR-363-5p the number of cells were about 55 and 75%, respectively, of that found in scrambled control (Figure 2A3). [score:1]
Searching the literature revealed no such findings as regards miR-20b and miR-363-5p. [score:1]
2014.00246/abstract Supplementary Figure 1 The Figure show micrographs of E10 cells transfected with scrambled control, miR-20b-, miR-363-3p or miR-363-5p mimic. [score:1]
Total RNA were isolated from cultured human squamous carcinoma cells (E10) transfected with miR-19a, miR-20b -, miR-92a - miR-363-5p mimic or scrambled control. [score:1]
The lower value (57%) was found with cells transfected with miR-20b mimic, also exhibiting the larger decline in cell density (Figure 2A3). [score:1]
Therefore, miR-20b and miR-106a may be the only mature microRNAs exclusively originating from the miR-106a-363 transcript. [score:1]
Fractions of RNA enriched with respect to microRNA were isolated from cultured human squamous carcinoma cells (E10) transfected with mimic for miR-363-5p (A), miR-92a - (B), miR-20b - (C), miR-19a - (D) mimic or scrambled control as shown in the Figure. [score:1]
The results for pri-miR-17-92 and pri-miR-106b-25 are presented in Figure 9. Figure 9 Levels of the miR-17-92 - and the miR-106b-25 primary transcript in cultured human squamous carcinoma cells (E10) following transfection with mimic for miR-19a, miR-20b, miR-92a, or miR-363-5p. [score:1]
Cells counts following transfection with scrambled control or with mimic for miR-20b, miR-92a, miR-363-3p, or miR-363-5p (means derived from three separate transfections with SD indicated, A3). [score:1]
The results for pri-miR-17-92 and pri-miR-106b-25 are presented in Figure 9. Figure 9 Levels of the miR-17-92 - and the miR-106b-25 primary transcript in cultured human squamous carcinoma cells (E10) following transfection with mimic for miR-19a, miR-20b, miR-92a, or miR-363-5p. [score:1]
Fractions of RNA enriched with respect to microRNA were isolated from cultured human squamous carcinoma cells (E10) transfected with miR-363-5p (A), miR-92a - (B), miR-20b - (C), miR-19a - (D) mimic or scrambled control shown in the Figure. [score:1]
Figure 4 Levels of selected proteins in cultured human squamous carcinoma cells (E10) transfected with miR-20b - or miR-363-5p mimic. [score:1]
Both miR-20b and miR-363-5p transfectants showed altered morphology; cells appeared larger and less elongate than scrambled control cells. [score:1]
This is exemplified by the selective 50-fold increase in the level of the anti-proliferative miR-20b in transfectants for miR-19a -mimic (Figure 8D), which also exhibited about 25% decrease in cell density (Figure 2A3). [score:1]
The levels of expression of hsa-pri-miR-17, hsa-pri-miR-92a-1, hsa-pri-miR-106b, hsa-pri-miR-25, hsa-pri-miR-106a, and hsa-pri-miR-92a-2 were measured in E10 cells after transfection with miR-19a, miR-20b -, miR-92a -, or miR-363-5p mimic. [score:1]
In all other transfected cells, including scrambled control, miR-20b was barely detectable. [score:1]
Figure 2Effects of transfection with mimic for miR-19a, miR-20b, miR-92a, miR-363-3p (miR-363), or miR-363-5p (miR-363 [*]) on cell densities of cultured human squamous carcinoma (E10) cells. [score:1]
Microarrays were used to profile miRNAs in cultured human oral squamous carcinoma cells (E10) 72 h after transfection with mimics for miR-19a -, miR-20b -, miR-92a -, or miR-363-5p mimic or with scrambled control. [score:1]
presented in Figure 2 suggest that the significantly decreased cell densities observed with transfectants for mimic of miR-19a, miR-20b -, mir-106a, miR-363-3p -, and miR-363-5p were caused by diminished proliferation. [score:1]
Transfection with miR-20b mimic led to 60% increase in the level of mirNA-106a (Figure 8C), while in cells transfected miR-19a mimic the level of miR-20b was increased 4-fold (Figure 8D) in agreement with microarray results (Figure 3). [score:1]
[1 to 20 of 67 sentences]
4
[+] score: 103
Among these 5 miRNAs, miR-20a and miR-20b were validated as regulatory miRNAs in hypoxia -induced VEGF expression, whereas the other three could be expressed for the regulation of other genes without over-repressing VEGF expression due to competitive action. [score:9]
The expression of COX2 was down-regulated by miR-15b, miR-16, and miR-20b, and c-MET was down-regulated by all three of these miRNAs plus miR-20a. [score:9]
Co-regulatory effect of miR-15b, miR-16, miR-20a, and miR-20b on angiogenic factors in CNE cellsWhen under hypoxia stimulation, VEGF is not the only angiogenic gene up-regulated, as other angiogenic factors have been reported to be up-regulated as well [22], [23]. [score:8]
In keeping with its antagonism of Myc, HIF-1α down-regulates c-Myc-activated genes such as hTERT, BRCA1 [31], [32], and might also down-regulate miR-20a and miR-20b, since both miR-20a and miR-20b may be c-Myc-activated genes. [score:7]
We also analyzed the effect of inhibiting endogenous miR-15b, miR-16, miR-20a, and miR-20b on VEGF expression. [score:5]
ELISA was used to detect the change in VEGF expression levels after endogenous miR-15b, miR-16, miR-20a, and miR-20b were inhibited. [score:5]
Up-regulation of miR-20b, a member of the miR-106a cluster located on X chromosome, was also consistently observed in the high c-Myc state and seven putative binding sites in the vicinity of the miR-106a cluster were also identified even though no direct binding between c-Myc and these binding sites has been reported [33]. [score:5]
MiR-20a and miR-20b may target c-MET, whereas miR-20b also targets COX2. [score:5]
Using the same transfection method, we introduced inhibitors of these miRNAs into normoxic CNE cells, which express low levels of VEGF and high levels of endogenous miR-15b, miR-16, miR-20a, and miR-20b. [score:5]
miR-15b, miR-16, miR-20a, and miR-20b were down-regulated in hypoxia induced CNE cells (C). [score:4]
In contrast to miR-15b and miR-16, the down-regulation of miR-20a and miR-20b may be related to hypoxia inducible factor-1α (HIF-1α). [score:4]
These data indicate that some of angiogenic factors expressed in CNE cells were specifically co-regulated by miR-15b, miR-16, miR-20a, and miR-20b. [score:4]
Taken together, the down-regulation of miR-15b, miR-16, miR-20a, and miR-20b in CNE cells might be mediated by the accumulation of p53 or the stabilization of HIF-1α during hypoxia. [score:4]
Transfection with miR-15b, miR-16, miR-20a, and miR-20b, but not the negative controls, resulted in a 26–51% decrease in VEGF expression at the protein level 30h after transfection (Fig. 3A). [score:3]
To investigate the putative effects of miR-15b, miR-16, miR-20a, and miR-20b, we determined the consequence of over -expressing these miRNAs on VEGF expression. [score:3]
The effect of miR-15b, miR-16, miR-20a, and miR-20b on VEGF expression was tested in CNE cells by transfection of the cells with siRNA duplexes homologous in sequence to the miRNAs. [score:3]
CNE cells were transfected with inhibitors of miR-15b, miR-16, miR-20a, and miR-20b. [score:3]
Among these 54 miRNAs, miR-16, miR-20a, miR-20b, let-7b, miR-17-5p, miR-27a, miR-106a, miR-106b, miR-107, miR-193a, miR-210, miR-320, and miR-361 were predicted to target VEGF. [score:3]
Hypoxia -induced CNE cells, which expressed high levels of VEGF but lacked miR-15b, miR-16, miR-20a, and miR-20b, were transfected with synthetic miRNA duplexes of these miRNAs and a set of controls. [score:3]
Computational predictions indicated that miR-20a, miR-20b, miR-17-5p, miR-106a, and miR-106b had binding sites in Construct I. With slightly relaxed criteria about free energy and conservation, miR-15b, miR-16, miR-17-5p, miR-20b, and miR-107 have computationally predicted target sites in Construct II reporters (Table 4). [score:3]
Co-regulatory effect of miR-15b, miR-16, miR-20a, and miR-20b on angiogenic factors in CNE cells. [score:2]
In this investigation, we found that miR-15b, miR-16, miR-20a, and miR-20b are sharply down-regulated in CNE cells after hypoxia treatment. [score:2]
This binding site is shared by 12 different miRNAs, according to the bioinformatics prediction, but only miR-17-5p, miR-20a, miR-20b, miR-106a, and miR-106b were detected in DFOM-untreated CNE cells. [score:1]
CNE cells were induced with or without DFOM (6–1), transfected with miR-15b, miR-16, miR-20a, or miR-20b (6–2) and transfected with Construct I or Construct II (6–3). [score:1]
These are miR-15b, miR-16, miR-20a, and miR-20b. [score:1]
0000116.g006 Figure 6CNE cells were induced with or without DFOM (6–1), transfected with miR-15b, miR-16, miR-20a, or miR-20b (6–2) and transfected with Construct I or Construct II (6–3). [score:1]
[1 to 20 of 26 sentences]
5
[+] score: 78
We showed that MAPK1 (ERK2, a potential target of miR-143), MAPK8 (JNK1, a demonstrated target of miR-455-3p), MAPK9 (JNK2, a demonstrated target of miR-17, miR-20b, and miR-106a), and p21 and RB (potential targets of miR-17 and miR-106a) were strongly upregulated at protein level upon inhibition of the miRNAs. [score:14]
Because the expression of the miR-17 family is directly controlled by the proto-oncogene MYC [32]– [34] and because we have recently demonstrated (7) that in human keratinocytes lacking p63, MYC expression is down regulated, the down-regulation of miR-17, miR-20, miR-106a, miR-143 and miR-455-3p genes we observed in keratinocytes lacking p63 could be due to MYC down-regulation. [score:13]
MAPK1, MAPK9 and p21 were up-regulated upon inhibition of miR-20b as well, suggesting that they could be a direct target of this miR, but LIMK1 and RB were not (Figure 4C, 4D). [score:9]
MAPK1, p21, and MAPK9 silencing resulted in K1 and K10 up-regulation in miR-20b -depleted cells as already observed in miR-17-knockdown cells, but the inhibition of LIMK1 and RB did not have any effect on K1 and K10 expression (Figure 5D). [score:9]
Using luciferase::3′UTR reporter constructs we further confirmed that MAPK9 was a direct target of miR-17, miR-20b, and miR-106a, since inhibitors of these miRNAs increased luciferase activity (Figure 4G), while mimic of the miR-17 family, on the contrary, inhibited the reporter activity (Figure S1B). [score:8]
We also demonstrated that LIMK1 was not a direct target of miR-17, miR-20b, or miR-106a (Figure 4H). [score:4]
0045761.g004 Figure 4(A, C, and E) Expression levels of miR-17 (A), miR-20b (C), and miR-106a (E) in double knockdown of miRNAs and of their targets was systematically measured by RT-qPCR. [score:4]
In contrast, miR-20b depletion did not change RB protein level (Figure 4D), and we did not observe any change in the expression of K1 or K10 in the miR-20b/RB double knockdown. [score:4]
We found that miR-17, miR-20b and miR-106a were strongly downregulated in keratinocytes lacking p63. [score:4]
Based on their level of expression in human primary keratinocytes in culture (data not shown) and their biological relevance, we chose several potential candidates from our list: miR-17, miR-18a, miR-20b, miR-30a, miR-106a, miR-143 and miR-455-3p. [score:3]
The following miRNA inhibitors (LNA) were obtained from Exiqon: hsa-miR-143 (138515-00), hsa-miR-455-3p (138667-00), hsa-miR-30a (138468-00), hsa-miR-17 (138461-00), hsa-miR-20b (138221-00), hsa-miR-106a (138477-00), and hsa-miR-18 (138462-00), and scramble miR (199002-04) was used as a negative control. [score:3]
In this study, we have characterized multiple miRNAs, including the mir-17 family (miR-17, miR-20b, miR-106a) and miR-30a, miR-143 and miR-455-3p, which are downregulated in p63-silenced keratinocytes, suggesting that they act downstream of p63. [score:2]
MiR-17, miR-20b and miR-106a belong to the miR-17 family. [score:1]
[1 to 20 of 13 sentences]
6
[+] score: 73
Coincidently, our target gene analysis showed that all the 4 up-regulated miRNAs (miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p) target TP53, cyclin -dependent kinase inhibitor 1A (CDKN1A) and cyclin -dependent kinase inhibitor 2A (CDKN2A). [score:12]
The up-regulated and down-regulated miRNAs (miR-20b, miR-92a-3p, miR-92b, miR-376c-3p, miR-150, miR-342-3p, and miR-663) may be involved in the regulation of transcription, DNA -dependent positive regulation of transcription from RNA polymerase II promoter, protein amino acid phosphorylation, and negative regulation of transcription from RNA polymerase II promoter. [score:10]
Moreover, the up-regulated miRNAs (miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p) target BH3-interacting domain (BID), TP53 and PTEN. [score:6]
Our study showed that high expression of miR-20b, miR-92a-3p, and miR-92b can down-regulate Fas -associated protein with death domain (FADD), which is known as an adaptor molecule that bridges the Fas-receptor [46] and is involved in apoptosis [47]. [score:6]
showed that the most significant biological processes targeted by at least two of various miRNAs (miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p) were regulation of transcription, DNA -dependent positive regulation of transcription from RNA polymerase II promoter, protein amino acid phosphorylation, negative regulation of transcription from RNA polymerase II promoter, and G1/S transition of mitotic cell cycle (Fig.   5a). [score:6]
d Main pathways influenced by genes targeted by two or more miRNAs from miR-19b, miR-101, and miR-199a-5p Pathway analysis showed that the predicted target genes related to miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p were involved in regulation of actin cytoskeleton, focal adhesion, MAPK signaling pathway, calcium signaling pathway, and axon guidance (Fig.   5c). [score:6]
d Main pathways influenced by genes targeted by two or more miRNAs from miR-19b, miR-101, and miR-199a-5p Pathway analysis showed that the predicted target genes related to miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p were involved in regulation of actin cytoskeleton, focal adhesion, MAPK signaling pathway, calcium signaling pathway, and axon guidance (Fig.   5c). [score:6]
Our data indicates that the unique 7 miRNAs (miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p and miR-92b) expression signature could be involved in the development of HBV- related HCC, suggesting interesting potential novel therapeutic options. [score:4]
a Relationship among target genes predicted by miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p. [score:3]
By miRNA expression profile, we found that miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p, and miR-92b are specifically altered in HBV-related HCC. [score:3]
a Main biological processes influenced by genes targeted by two or more miRNAs from miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p. [score:3]
c Main pathways influenced by genes targeted by two or more miRNAs from miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p. [score:3]
Eight miRNAs (miR-223, miR-98, miR-15b, miR-199a-5p, miR-19b, miR-22, miR-451, and miR-101) were involved in HBV-unrelated HCC, 5 miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) were involved in HBV infection, and 7 miRNAs (miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p and miR-92b) were specifically altered in HBV-related HCC. [score:1]
The identity of the 12 miRNAs is as follows: miR-21, miR-20b, miR-92a-3p, miR-92b, miR-376c-3p, miR-150, miR-451, miR-101, miR-424, miR-342-3p, miR-122a, and miR-663. [score:1]
In our study, a network that includes 6 of 7 selected miRNAs (miR-150, miR-342-3p, miR-20b, miR-92, miR-368, and miR-92b) was shown based on accepted databases of molecular interactions reported in the literature using IPA (Fig.   6). [score:1]
In our IPA results, the 6 selected miRNAs (miR-150, miR-342-3p, miR-20b, miR-92a-3p, miR-92b, and miR-376c-3p) are shown to comprise a network which linked themselves among AGO2, DICER1, BCL2L11, CCND1, CCND2, CCNE1, CDK7, E2F1, E2F3, TP53, and four other genes (Fig.   6). [score:1]
Ultimately, miR-20b, miR-92a-3p, miR-92b, miR-376c-3p, miR-150, miR-342-3p, and miR-663 were selected. [score:1]
[1 to 20 of 17 sentences]
7
[+] score: 46
We focused on three differentially expressed miRNA: miR-181C, miR-15a and miR-20b, which were found to be down-regulated in a diabetic-like environment and up-regulated after the addition of calcitriol. [score:9]
MiR-15a, miR-20b and miR-181C were found to be down-regulated in a diabetic-like environment and up-regulated after the addition of calcitriol; they were chosen for further investigation at the level of their gene targets, which have been shown to be involved in the modulation of endothelial function. [score:7]
MiR-126, miR-411, miR-20b, miR-15a and miR-181c were down-regulated under diabetic conditions and over-expressed after calcitriol was added. [score:6]
We found that genes targets from the Kruppel-like family, which are transcription factors that play key regulatory roles in cellular growth, differentiation, proliferation, apoptosis and angiogenesis [20, 21], take part as putative targets for miR-181C and miR-20b. [score:6]
MiR-20b was down-regulated in the plasma of diabetic patients [27] and similarly expressed in normal and diabetic dermatological tissue, but was significantly different from that of diabetic wounds during the course of healing [36]. [score:5]
TXNIP, a pro-apoptotic protein, which is known to regulate endothelial cell metabolism, growth, and inflammation [22, 23] and IL8, an inflammatory-related protein [24] are putative targets of miR-20b and miR-15a. [score:4]
In order to determine the potential genes involved in HUVEC exposed to a diabetic-like environment and calcitriol, we analyzed the predicted target genes of these 3 miRNA (miR-15a, miR-20b and miR-181c). [score:3]
Gene target and pathway analysis of miR-181C, miR-15a and miR-20b. [score:3]
In addition, 10 [-10] mol/l calcitriol was given to the cells 1 h after stimulation for an additional 23 h. The miRNA set that included (A) miR-659, (B) miR-510, (C) miR-181C, (D) miR-411, (E) miR-126, (F) miR-15a, and (G) miR-20b was validated using real time PCR. [score:1]
MiR-181c, miR-15a, miR-20b, miR-411, miR-659, miR-126 and miR-510 were selected for further analysis because they are known to be modified in DM and in other biological disorders. [score:1]
From the miRNA list presented in Table  1 and from the corresponding Venn diagram (Figure  1C), we validated several miRNA (marked in bold in Table  1) that are known to be modified in a diabetic environment (miR-510, miR-15a, miR-20b, miR-126, and miR-181C). [score:1]
[1 to 20 of 11 sentences]
8
[+] score: 45
Similarly, downregulation of miR-20a and miR-20b is consistent with previous observations suggesting that members of the miR-17-92 cluster are commonly downregulated in various senescence mo dels as well as in organismal aging [16]. [score:7]
High confidence targets were identified for miR-20a and miR-20b encoded by the miR-17-92 cluster which is known to synergize with Myc in cancer development [26], probably through repression of p21 [WAF1] expression at the post-transcriptional level [27]. [score:6]
Expression levels for miR-15a, miR-20a, miR-20b, miR-93, and miR-101 are shown in Figure  3, along with their established target mRNAs. [score:5]
In addition, the data suggest TIMP3, ETV1, B2M, IGFBP-3, and RRAS2 as potential targets for miR-20a (Figure  4A), and TGM2, CPE, RHOJ, and SERPING1 as potential targets for miR-20b (Figure  4B). [score:5]
Thereby, eight miRNAs (miR-15a, miR-17, miR-20a, miR-20b, miR-34, miR-93, miR-101, miR-155) were identified for which regulated mRNA targets were found with high confidence. [score:4]
E2F1 and Cyclin D1 are predicted targets for both miR-20a and miR-20b. [score:3]
of the bioinformatic analysis suggested several so far unreported potential targets for miR-20a and miR-20b in the context of UVB -induced senescence. [score:3]
Bioinformatic analysis of miRNA-mRNA networks was performed to identify new functional mRNA targets with high confidence for miR-15a, miR-20a, miR-20b, miR-93, and miR-101. [score:3]
miRNA expression levels for miR-20a, miR-20b, miR-15a, and miR-93 were determined by. [score:3]
In these experiments, data obtained by the miRNA array for miR-15a, miR-20a, miR-20b, miR-93, and miR-101 were confirmed (Figure  2); whereas miR-17, miR-34 and miR-155 were also regulated in UVB -treated cells in accordance with the miRNA array results, the observed differences did not reach statistical significance (data not shown). [score:2]
of the analysis are presented here for miR-20a (A), and miR-20b (B). [score:1]
In addition, 7 other microRNAs (hsa-miR-155, hsa-miR-15a, hsa-miR-17, hsa-miR-20a, hsa-miR-20b, hsa-miR-34a, hsa-miR-93) were chosen for qPCR confirmation of array data using the Taqman qPCR platform (Life Technologies). [score:1]
Thus, DRAM, IDS, NFAT5, EGR2, CCND2, and RARB were identified as potential high confidence interactions for both miR-20a and miR-20b (Figure  4A,B). [score:1]
Our analysis confirmed a high confidence interaction between both miR-20a and miR-20b with p21 [WAF1] (CDKN1A), p15 [INK4B] (CDKN2B), RUNX1, and vEGF-A (Figure  4A,B), thereby validating the analytical procedure. [score:1]
[1 to 20 of 14 sentences]
9
[+] score: 40
Although some miRNAs are upregulated at higher confluence, miRNAs miR-20b, miR-99b and let-7b have not been shown to be modulated by this effect, and furthermore, there was no consistent pattern of a single EC line, overexpressing a variety of miRNAs [27]. [score:6]
Putative targets of miR-20b include polycystic kidney disease 2 (PKD2), matrix metallopeptidase 3 (MMP3), syndecan 2 (SDC2) and fibroblast growth factor receptor substrate 2 (FRS2). [score:5]
We used the summation of the data to demonstrate a clear increase in miRNA binding sites for let-7b, miR-20b and miR-99b in genes that were variably expressed across EC types in this additional data set. [score:3]
MiRNAs 18b, and 19b had expression patterns similar to miR-20b. [score:3]
We identified 166 expressed miRNAs, of which 3 miRNAs (miR-99b, miR-20b and let-7b) differed significantly between EC types and predicted EC clustering. [score:3]
First, among the ECs, the chromosomal clusters for miRNAs, let-7b, miR-20b and miR-99b all had relative expression patterns that were consistent and supported by RT-PCR of primary transcripts for two clusters (Figure 1C, Additional file 2, Figure S1). [score:3]
However, we were able to identify three miRNAs, miR-99b, miR-20b and let-7b, which were modestly, but significantly variable among the EC lines by three different types of analysis: LIMMA, SAM and. [score:1]
Only 3 of these 59 miRNAs, let-7b, miR-20b and miR-99b, were also significantly different across all ECs as detected by the SAM algorithm, having 2.1, 1.6 and 1.8 fold variability respectively. [score:1]
In our Sylamer data, because multiple miRNAs can bind to the same consensus sequence, the data we present for miR-20b, miR-99b and let-7b could be data for other related miRNAs such as miR-17, miR-100 or another let-7 miRNA. [score:1]
As a direct measure of the regulation of a polycistronic cluster, we attempted to investigate the expression of the primary transcripts (pri-miRNAs) for the miR-99b, let-7a (containing let-7b) and miR106a (containing miR-20b) clusters that encode these miRNAs. [score:1]
Interestingly, the SAM significant miRNAs miR-99b, miR-20b and let-7b were identified 15 times in this group (Figure 3). [score:1]
RT-PCR data results for miR-20b, miR-99b and let-7b and pri-miRNA cluster data for let-7a and miR-99 clusters. [score:1]
No other collection of 3 miRNAs were identified 15 times in the data set, indicating highly significant (p < 0.0001) selection for binding sites for miRNAs miR-99b, miR-20b and let-7b. [score:1]
The three SAM significant miRNAs - miR-20b, miR-99b and let-7b - are located in miRNA clusters on chromosomes X, 19 and 22 respectively. [score:1]
Significant peak for miR-20b 8-mer seed in a comparison between HCECs and HUVECs. [score:1]
The 3' UTR miRNA binding site for miR-20b is GCACTTTG and is shared with miR-17. [score:1]
We identified 51, 98 and 571 genes under the peaks for miR-99b, miR-20b and let-7b respectively (Figure 3A). [score:1]
Having miRNAs miR-20b, miR-99b and let-7b represent 15 binding sites was significantly greater than chance (p < 0.0001). [score:1]
There is only limited information on the role of miRNAs let-7b, miR-20b and miR-99b in ECs, although this information is intriguing. [score:1]
Of these 162 sites, 15 were predicted 3' UTR binding sites for miRNAs miR-20b, miR-99b, and let-7b. [score:1]
MiR-20b is known to regulate estrogen receptor α (ERα), nuclear receptor coactivator 3 (NCOA3/AIB1) and hypoxia inducible factor 1α (HIF1α) [28, 29]. [score:1]
Also, most of the peaks we identified for miRNAs miR-99b, miR-20b and let-7b were not at the extreme edge of the graph (Figure 3). [score:1]
MiRNA-20b clusters with miR-18b, miR-92a-2, miR-19b, miR-363, and miR-106a. [score:1]
[1 to 20 of 23 sentences]
10
[+] score: 33
Inhibition of HIV Expression by the Silencing Exerted by miR-17-5p and miR-20 on PCAF (A), and Downregulation of This Inhibition by HIV (B). [score:10]
Triboulet et al. have reported that the infection of a lymphoid cell line by HIV-1 downregulates six miRNAs, including miR-17-5p and miR-20, and upregulates eleven others, including miR-122, -297, -370, and -373 [32]. [score:7]
Of note, two of the miRNAs downregulated during HIV infection are precisely miR-17-5p and miR-20, which target the Tat cofactor PCAF. [score:6]
For instance, the neutralization of miR-17 and miR-20 by specific inhibitors should release the inhibition exerted by these miRNAs on PCAF and hopefully trigger HIV replication in reservoir cells, resulting in the eradication of this population. [score:5]
Moreover, the cellular miR-17-5p and miR-20, through their repression of PCAF expression (Figure 3B), seem to exert the same effect [32]. [score:3]
Thus, by reducing the amount of miR-17-5p and miR-20 available, the virus alleviates the negative control exerted by the cell on PCAF, thereby facilitating its own transcription (Figure 3B). [score:1]
Triboulet et al. have shown that the cellular miRNAs miR-17-5p and miR-20 silence the mRNA encoding the histone acetylase PCAF. [score:1]
[1 to 20 of 7 sentences]
11
[+] score: 31
In addition, three miRNAs miR-20b, miR-363 and miR-30c that were all solely down-regulated in ccRCC also showed significant correlation with the expression levels of 23, 25 and 37 of their predicted target genes, respectively (Table S6). [score:8]
Notably, the correlated target genes of miR-20b were mainly implicated in the regulation of metabolic processes (adjusted P = 0.037) and three of the targets (JAK1, CCND2 and SPRED1) participate in regulating the JAK-STAT signaling pathway. [score:7]
Strikingly, the down-regulated targets of miR-20b have been mainly implicated in many metabolic processes (adjusted P = 0.037), which may, in part, account for the characteristic phenotype of ccRCC (global deregulation of multiple metabolic pathways in ccRCC as shown in Figure 2). [score:5]
Down-regulation of miR-20b may therefore lead to the activation of the JAK-STAT pathway, which has been documented in many cancer studies [69], [70], [71], [72]. [score:4]
In short, the aberrant expression of miR-19a/b and miR-20b may result in the alterations of many downstream activities, and they may therefore they may serve as the ideal candidates for future therapeutics development. [score:4]
Another miRNA worthy of notice is miR-20b in ccRCC, which targeted 3 genes (JAK1, CCND2 and SPRED1) participating in JAK-STAT signaling. [score:3]
[1 to 20 of 6 sentences]
12
[+] score: 24
Ten of these miRNAs had seed-region matches and six of these miRNAs, miR-150-5p, miR-196b-5p, miR-203a, miR-20b-5p, miR-501-3p, and miR-92a-3p, had negative beta coefficients between differentially expressed miRNA and mRNA, suggesting a greater likelihood for direct binding that would alter the gene expression. [score:6]
In our study both CTSK (cathepsin K) and CTSS (cathepsin S) were associated with miRNAs, however, only CTSS was directly associated given the likely binding of miR-20b-5p and miR-501-3p that could result in a decreased expression of CTSS in the presence of increased differential expression of these miRNAs. [score:6]
Increased miRNA expression of miR-124-3p, miR-145-3p, miR-193b-3p, and miR-934 in carcinomas was associated with worse survival while increased expression of other miRNAs (i. e. miR-17-5p, miR-19b-3p, miR-20a-5p, miR-20b-5p, miR-425-5p, miR-92a-3p, and miR-93-5p) in carcinoma tissue improved survival. [score:5]
Two miRNAs, miR-20b-5p, and miR-501-3p associated with CTSS had both a seed-region match and a negative beta coefficient between the differentially expressed gene and the differentially expressed miRNA. [score:5]
Several miRNAs were associated with multiple genes, including miR-150-5p with six genes (BIRC5, CSF2RF, TUBA1B, IRPR1, PIK3CD, and BCL2), miR-650 with five genes (BIRC5, CSF2RB, ITPR1, PIK3CD, and BCL2), miR-195-5p with three genes (BIRC5, TUB1B, and BCL2), and miR-20b-5p and miR-3124-5p each with two genes (miR-20b-5p with BIRC5 and CTSS and miR-3124-5p with TNFRSF10B and CSF2RB). [score:1]
MiR-20b-5p and miR-501-3p were associated with CTSS, miR-92a-5p was associated with CSF2RB, and miR-203a was inversely associated with BCL2. [score:1]
[1 to 20 of 6 sentences]
13
[+] score: 22
Note that hsa-miR-20b-5p and hsa-miR-17-5p share many target genes, suggesting that they modulate gene expression through a cooperative manner (Figure 5). [score:5]
Our finding indicates that miR-17-5p and miR-20b-5p may modulate the Wnt signaling pathway by regulating TCF7 expression, which in turn affects the activity of the c-Myc and cyclin D1 complex. [score:4]
Thus, under low-dose radiation, changes in the abundance of miR-17-5p and miR-20b-5p may influence the cell cycle via interaction with their target gene TCF7 and modulate the development of thyroid cancer [55, 56]. [score:4]
Three microRNAs, hsa-miR-20b-5p, hsa-miR-17-5p, and hsa-miR-185-5p, appear to regulate the highest number of radiation sensitive genes compared to the other differentially expressed microRNAs (Table 2). [score:3]
In addition, our analysis in Figure 4 suggests that miR-17-5p and miR-20b-5p may cooperate to exert regulatory effects on the TCF7 gene. [score:2]
Consequently, hsa-miR-20b-5p, hsa-miR-17-5p, and hsa-miR-185-5p may be involved in modulating genes underlying cell cycle control and the development of thyroid cancer and prostate cancer. [score:2]
From publicly available miRNA knowledge bases, we retrieved a list of genes that have been validated to interact with these miRNAs, namely, hsa-miR-185-5p, hsa-miR-107, hsa-miR-20b-5p, and hsa-miR-17-5p for the low radiation doses and hsa-miR-142, hsa-miR-223-3p, and hsa-miR-451a for the 5 Gy radiation exposure. [score:1]
In fact, miR-17-5p and miR-20b-5p are mature forms of the same precursor family. [score:1]
[1 to 20 of 8 sentences]
14
[+] score: 22
More specifically, experimentally has been shown, the suppression of RAS oncogene by let-7 [40]; the suppression of BCL-2 by miR-15a and miR-1 [51]; the regulation of transcription factor E2F1 activity by miR-17-5p and miR-20 [52]; the downregulation of the KIT oncogene by miR-221 and miR-222 [53], the inhibition of the expression of tumour-supressor LATS2 and the influence on p53 pathway by miR-372 and miR-373 [54], and finally, the downregulation of the proto-oncogene BCL6 by miR-127 [55]. [score:16]
Moreover, c-MYC regulates the transcription of miRNAs from miR-17 cluster and two of them (miR-17-5p and miR-20) regulate transcription factor E2F1 at the translational level [52], which is also transcriptionally activated by c-MYC [89]. [score:5]
-26.80 ERB B3 648 hsa-miR-20b. [score:1]
[1 to 20 of 3 sentences]
15
[+] score: 19
Finally, miR-20b exemplified the miRNAs upregulated in HPV -positive tonsillar tumors and downregulated in HPV -negative tonsillar tumors, and miR-210 exemplified those upregulated in tonsillar tumors of either etiology (Additional file 12: Figure S6). [score:10]
Expression values of miR-210 and miR-20b differentially expressed in tonsillar tumors of both etiologies on miRNA arrays. [score:5]
The deregulated expression of the other miRNAs was confirmed (miR-9 in 100 %, miR-141 in 59 %, miR-200a in 87 %, miR-125b-2* in 89 %, miR-335 in 54 %, miR-221 in 67 %, miR-20b in 93 % of HPV -positive tumors and in 87 % of HPV -negative tumors, and miR-210 in 100 % of tumors of both etiologies). [score:4]
[1 to 20 of 3 sentences]
16
[+] score: 18
When we searched in the sncRNA-Seq data for any member of this miR-17 family that was differentially expressed in testes after exposure to the mixture of EDCs, we only identified two down-regulated miRNAs: miR-18a-5p and miR-20b-5p. [score:6]
On the other hand, we found eight down-regulated miRNAs, some of them implicated in multiple processes such as cancer (miR20b-5p, miR-1291) 52, 53, organ injury in toxicity drug mo dels (miR-382-5p) [54], metabolic processes and steroidogenesis (miR-378b) [55], and tissue inflammation (miR-3085-3p) [56]. [score:4]
In conclusion, chronic exposure to a mixture of five EDCs induces changes in the expression profiles of specific miRNAs (such as miR-34b-5p, miR-7686-5p and miR-1291), along with alterations in the miRNAs/isomiRs association (in particular for miR-15b-5p, miR-18b-5p, miR-20b-5p, and miR-1981-5p) regulating mRNAs implicated in key biological process in the testes (Table  3). [score:4]
Interestingly, two isomiR variants of miR-18a-5p and one isomiR variant of miR-15b-5p, miR-20b-5p, miR-3085-3p, and miR-1981-5p were down-regulated due to the addition of an adenine at its 3′ end, similarly to the corresponding canonical miRNAs (Fig.   6A,B). [score:4]
[1 to 20 of 4 sentences]
17
[+] score: 17
Remarkably, 9 of the best ten miRNA biomarkers (90%) were significantly up-regulated in MS, while only one miRNA (hsa-miR-20b) was down-regulated. [score:7]
For the single down-regulated miRNA hsa-miR-20b, the bar plot is presented in Figure 2c. [score:4]
Among the ten most deregulated miRNAs, hsa-miR-145, hsa-miR-186, and hsa-miR-20b have been found to be deregulated in different types of cancer such as prostate cancer, pancreatic cancer or gastric cancer [13]– [15]. [score:3]
The ten miRNAs that were most significantly deregulated included hsa-miR-145 (1.46·10 [−7]), hsa-miR-186 (2.89·10 [−7]), hsa-miR-664 (5.25·10 [−5]), hsa-miR-20b (1.48·10 [−4]), hsa-miR-422a (1.48·10 [−4]), hsa-miR-142-3p (1.54·10 [−4]), hsa-miR-584 (1.56·10 [−4]), hsa-miR-223 (1.63·10 [−4]), hsa-miR-1275 (1.16·10 [−4]) and hsa-miR-491-5p (2.83·10 [−4]). [score:2]
Barplots detailing the intensity values for the miRNAs hsa-miR-145 (a), hsa-mir-186 (b), and hsa-miR-20b (c). [score:1]
[1 to 20 of 5 sentences]
18
[+] score: 17
Lei et al. identified a feedback loop regulating the adaptation of murine tumor cells to different oxygen concentrations in which hypoxia-inducible factor 1 alpha (HIF-1α) suppresses the expression of miR-20b, which in turn may regulate both HIF-1α and VEGFA expression [40]. [score:9]
Furthermore, we have shown that levels of miR-361-5p, but not those of the known VEGFA -regulating miRNAs miR-20b, -34a, -93, -126, and -205, inversely correlate with VEGFA expression in SCC compared to healthy skin samples, corresponding to previously reported findings [86]. [score:3]
In normal skin samples, the average expression levels of miR-20b (∼62-fold down) and miR-205 (∼51-fold up) strongly deviated from that of the reference RNA (RNU6B), while for all other miRNAs the difference stayed within an order of magnitude (Figure S4A). [score:3]
Next, we measured the expression of miR-361-5p and the known VEGFA -regulating miRNAs miR-20b, miR-34a, miR-93, miR-126 and miR-205. [score:2]
[1 to 20 of 4 sentences]
19
[+] score: 16
All six miRNAs were overexpressed in HCC when compared to the adjacent normal liver, with miR-17 and miR-106b (p value<0.001) being the most overexpressed and miR20-b being minimally overexpressed (p value=0.03) (Figure 1A). [score:6]
Notably, we confirmed that MYC regulates miR-17, but not miR-19 or miR-20 expression (Supplementary Figure 5), as has also been described by us previously [9]. [score:4]
Figure 1 A. of microRNA expression identifies six members of the miR-17 (miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR 106b) in normal liver and human HCC tumor tissue. [score:3]
A. of microRNA expression identifies six members of the miR-17 (miR-17, miR-20a, miR-20b, miR-93, miR-106a and miR 106b) in normal liver and human HCC tumor tissue. [score:3]
[1 to 20 of 4 sentences]
20
[+] score: 15
Other miRNAs from this paper: hsa-mir-93, hsa-mir-96, hsa-mir-155
In contrast to the study by Guo et al. [72], POLK transcript was not affected even though miR-20b was downregulated in the ovarian cancer cells, and a miR-20b mimic did not alter Pol η expression [72]. [score:6]
Overexpressing a miR-20b mimic reduces, while a miR-20b inhibitor elevates, Pol κ protein levels [71]. [score:5]
Guo J. Jiang Z. Li X. Wang X. I. Xiao Y. Mir-20b downregulates polymerases κ and θ in xp-v tumor cells Oncol. [score:3]
miR-20b is predicated to bind the 3′ UTR of both POLH and POLK transcripts, and the miR-20b binding site was confirmed to be functional for the POLK 3′UTR. [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 15
RES thus modulated miR-21, miR-20b, miR-27a, miR-9. Among these, there was a high upregulation of miR-21 expression in basal level controls with RES, which was considerably lowered in IR; miR-21 has been shown to regulate the ERK-MAPK signaling pathway in cardiac fibroblasts, which is involved in cardiac structure and remo deling [85]; miR-21 also regulated fibroblast metalloprotease 2 in a murine myocardial infarction mo del, with a specific localization in the infarct region of the IR heart [86]. [score:8]
Cascio S. D’Andrea A. Ferla R. Surmacz E. Gulotta E. Amodeo V. Bazan V. Gebbia N. Russo A. miR-20b modulates VEGF expression by targeting HIF-1 alpha and STAT3 in MCF-7 breast cancer cells J. Cell. [score:5]
The vascular endothelial growth factor (VEGF) has been reported to be modulated by miR-20b via the hypoxia-inducible factor 1-alpha (HIF1α) in response to hypoxia [87], whereas FoxO1 was regulated by miR-27a in cancer cells [88], and SIRT-1 by miR-9 in stem cells [89]. [score:2]
[1 to 20 of 3 sentences]
22
[+] score: 15
The down-regulated miRNAs miR-9, miR-30 and miR-20 were all strongly predicted to affect target genes involved in axonal guidance. [score:6]
The overlap between human AD and our in vitro and in vivo AD mo dels indicates that amongst the complex pathology in human AD brain, down-regulation of miR-9, miR-181c, miR-30c, miR-20b, miR-148b and Let-7i could be attributed at least in part to the presence of Aβ. [score:4]
Axon guidance was among the most significant pathways to be affected by the predicted target genes and was the top prediction for miR-9, miR-30 and miR-20. [score:3]
Individual TaqMan assays (Applied Biosystems) were used to analyse the expression of the following mature mouse miRNAs: miR-181c, miR-9, miR-20b, miR-21, miR-30c, miR-148b, miR-361, miR-409-3p and Let-7i. [score:2]
[1 to 20 of 4 sentences]
23
[+] score: 15
Down -expression of DDX5 was observed in 7 types of HCs, while, mir-20b, mir-21, mir-141 and mir-182 over-expressed in 3, 5, 3 and 4 HCs, respectively (Table 3 and Table 4). [score:5]
DDX5 is negatively regulated by mir-20b and mir-141, while DDX5 itself regulates mir-21 and mir-182. [score:3]
Our results showed that up regulation of mir-20b and mir-141 down regulates DDX5. [score:3]
This subnetwork comprises 5 entities including DDX5, mir-20b, mir-21, mir-141 and mir-182. [score:1]
Network is including mir-21, mir-182, -mir20b and mir-141. [score:1]
In these subnetworks, different RNAs are located on PCSRs including GAPDH, ZEB2, mir-20b, mir-21, mir-141 and mir-200c supporting the important effects of these RNAs and their regions in cancer. [score:1]
0096320.g002 Figure 2Network is including mir-21, mir-182, -mir20b and mir-141. [score:1]
[1 to 20 of 7 sentences]
24
[+] score: 15
We validated our microrray results by quantitative RT-PCR on CD5 [+], GC and CD5 [−] activated and resting B cell mRNA samples as shown in Supplementary Figure 3. In fact, we validated 10 different miRNAs: mir-150, mir-20b, mir-23a, mir-211, mir-15b, mir-21, mir-106a, mir-146a, mir-9* and mir-155 whose expression trends by quantitative RT-PCR highlighted the same expression trend shown by microarray analysis. [score:5]
The miRNAs profile comparison between resting and activated B cells showed the up-regulation of 19 miRNA in activated B cells: mir-98, mir-106a, mir-20a, mir-17-5p, mir-20b, mir-16-2, mir-18a, mir-155, mir-21, mir-181d, mir-425-5p, mir-148a, mir-15b, mir-15a, mir-181b mir-181c, mir-181a, mir-130b, mir-148b (Table 3). [score:4]
Considering all differentially expressed miRNAs, we detected miR-150, miR-361, miR-130b, miR-181b and members of miRNA clusters miR-17-5p, miR-106a, miR-20a and miR-20b as the most variable miRNAs (FDR = 0.0077) (Table 1). [score:3]
MiRNAs belonging to the cluster mir-17/92 and the paralogous clusters mir-25/106b and mir-106a/363 showed a similar trend of expression, i. e. mir-17-5p, mir-20a, mir-106a, mir-20b, mir-18a, mir-106a, mir-18b, mir-20b, mir-106b, mir-93 and mir-25 (Cluster 1, Figure 1). [score:3]
[1 to 20 of 4 sentences]
25
[+] score: 15
Other miRNAs from this paper: mmu-mir-301a, hsa-mir-301a, mmu-mir-20b, mmu-mir-208b, hsa-mir-208b
Of note, the two upregulated miRNAs, miR-1273g-3p suppressed apoptosis in HSCs, [28] and miR-20b promoted apoptosis in P19 cell lines. [score:6]
The expression levels of miR-1273g-3p and miR-20b were found to be consistently low in VAN group, and they were increased in siRNA MBD2 with VAN group. [score:3]
Previous results have shown that miR-1273g-3p was associated with suppression of apoptosis in HSCs, [27] whereas miR-20b was related with induction of apoptosis in P19 cell lines. [score:3]
The expression of miR-208b-3p, miR-301a-5p, miR-1273g-3p and miR-20b-3p was confirmed by real-time PCR (Figure 4c), which is consistent with microarray analysis. [score:3]
[1 to 20 of 4 sentences]
26
[+] score: 15
Sixteen of 359 miRNAs detected were differentially expressed between tumor and matched benign tissue (adjusted p < 0.05): 9 were upregulated (hsa-miR-19a; hsa-miR-512-3p; hsa-miR-27b; hsa-miR-20a; hsa-miR-28-3p; hsa-miR-200c; hsa-miR-151-3p; hsa-miR-223; hsa-miR-20b), and 7 downregulated (hsa-miR-22; hsa-miR-516-3p; hsa-miR-370; hsa-miR-139-5p; hsa-let-7e; hsa-miR-145-3p; hsa-miR-30c) in tumor tissue in comparison to matched benign tissue (Table 2). [score:9]
miRNA Expression Cancer association (Y/N) Upregulated (Y/N) hsa-miR-19a Common YY (10) hsa-miR-512-3p T and E only YN (11) hsa-miR-27b Common YY (12) and N (13) hsa-miR-20a Common YY (14) hsa-miR-28-3p Common YY (15) hsa-miR-200c Common YY (16) and N (17) hsa-miR-151-3p Common YY (18) hsa-miR-223 Common YY (19) and N (15) hsa-miR-20b Common YY (20) hsa-miR-22 T and E only YY (19, 21) and N (22) hsa-miR-516-3p T only N N/A hsa-miR-370 Common YY (23) hsa-miR-139-5p Common YN (24) hsa-let-7e Common YN (25) hsa-miR-145-3p T and E only YN (26) hsa-miR-30c Common YN (27) T, tumor; E, exosome. [score:6]
[1 to 20 of 2 sentences]
27
[+] score: 14
In this analysis, again hsa-miR-144* and hsa-miR-20b showed the strongest downregulation in diseases with AUC values of 0.771 (95% CI of 0.721–0.821) and 0.760 (95% CI of 0.71–0.811), respectively, while hsa-miR-194* was the most upregulated miRNA with an AUC value of 0.687. [score:9]
The miRNAs hsa-miR-144* and hsa-miR-20b were the most downregulated with an AUC of 0.751 (95% CI: 0.703–0.799), followed by miR-17 and miR-20a. [score:4]
Among those, we found substantially decreased levels of hsa-miR-144* and hsa-miR-20b with AUC of 0.751 (95% CI: 0.703–0.799), respectively. [score:1]
[1 to 20 of 3 sentences]
28
[+] score: 13
First, we extracted the set of 16 upregulated and 22 downregulated miRNAs in AD brains versus normal brains in the condition of p < 0.05 by Welch’s t-test and fold change greater than 3. In AD brains, upregulated miRNAs include miR-122-5p, 134, 188, 198, 206, 320a, 486-5p, 498, 572, 575, 601, 602, 617, 659-3p, 671-5p, and 765, while downregulated miRNAs include miR-20b-5p, 30e-3p, 30e-5p, 95, 101-3p, 148b-3p, 154-3p, 181c-5p, 186-5p, 219-5p, 301a-3p, 374a-5p, 376a-3p, 376c, 380-3p, 424-5p, 499a-5p, 551-3p, 580, 582-5p, 655, and 656. [score:13]
[1 to 20 of 1 sentences]
29
[+] score: 13
In contrast to no effect of p100 on expression of miR-17/miR-20, the results from using p100 knockdown and constitutive expression revealed that p100 was crucial for miR-302d expression. [score:8]
However, our results indicated that p100 deletion failed to affect expression of miR-17/miR-20 although p100 exhibited an inhibitory effect on cyclin d1 mRNA 3′-UTR activity. [score:5]
[1 to 20 of 2 sentences]
30
[+] score: 12
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCCmiRNAs regulate gene expression at the post-transcriptional level. [score:6]
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCC miRNAs regulate gene expression at the post-transcriptional level. [score:6]
[1 to 20 of 2 sentences]
31
[+] score: 12
Further, miR-20b and miR-363 show similar levels and are expressed from a common region on chromosome X. Direct comparison of dMMR with pMMR tumors by linear effects mixed mo del using the Bonferroni correction revealed that six miRNAs were differentially expressed, with high significance, between different tumor subtypes (Figure 2B; detailed statistics provided [see Additional file 5]). [score:6]
Further, miR-20b and miR-363 show similar levels and are expressed from a common region on chromosome X. miRNAs Show Striking Differences withDirect comparison of dMMR with pMMR tumors by linear effects mixed mo del using the Bonferroni correction revealed that six miRNAs were differentially expressed, with high significance, between different tumor subtypes (Figure 2B; detailed statistics provided [see Additional file 5]). [score:6]
[1 to 20 of 2 sentences]
32
[+] score: 12
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-155 HMDD hsa-mir-101 mir2Disease hsa-mir-19b HMDD hsa-mir-146a mir2Disease hsa-mir-21 HMDD hsa-mir-373 HMDD hsa-mir-92a HMDD hsa-mir-214 HMDD hsa-mir-9 HMDD hsa-mir-143 HMDD hsa-mir-451 HMDD hsa-mir-25 HMDD hsa-mir-125b HMDD hsa-mir-181b HMDD hsa-mir-24 HMDD hsa-mir-20b uncomfirmed hsa-mir-145 HMDD hsa-mir-32 HMDD hsa-mir-223 HMDD hsa-mir-16 HMDD 10.1371/journal. [score:5]
hsa-mir-25 HMDD hsa-mir-218 HMDD hsa-mir-1 HMDD hsa-mir-18a HMDD hsa-mir-223 HMDD hsa-mir-181b HMDD hsa-mir-34a HMDD hsa-mir-19a HMDD hsa-mir-372 unconfirmed hsa-mir-214 HMDD hsa-mir-19b HMDD hsa-mir-16 HMDD hsa-mir-133a HMDD hsa-mir-92a HMDD hsa-mir-143 HMDD hsa-mir-34b HMDD hsa-mir-218 HMDD hsa-mir-20b HMDD hsa-mir-18a HMDD hsa-mir-106b HMDD 10.1371/journal. [score:1]
hsa-mir-25 HMDD hsa-mir-218 HMDD hsa-mir-1 HMDD hsa-mir-18a HMDD hsa-mir-223 HMDD hsa-mir-181b HMDD hsa-mir-34a HMDD hsa-mir-19a HMDD hsa-mir-372 unconfirmed hsa-mir-214 HMDD hsa-mir-19b HMDD hsa-mir-16 HMDD hsa-mir-133a HMDD hsa-mir-92a HMDD hsa-mir-143 HMDD hsa-mir-34b HMDD hsa-mir-218 HMDD hsa-mir-20b HMDD hsa-mir-18a HMDD hsa-mir-106b HMDD 10.1371/journal. [score:1]
[1 to 20 of 4 sentences]
33
[+] score: 11
It has been found that, in chronic gastritis, the expression of miR-1 and miR-155 is upregulated, whereas the expression of miR-20, miR-26b, miR-202, miR-203, and miR-205 is downregulated. [score:11]
[1 to 20 of 1 sentences]
34
[+] score: 11
Second, TAL1 is a putative target of several miRNAs that are up-regulated in hematopoietic stem cells, such as hsa-miR-17-5p, hsa-miR-197, hsa-miR-106 and hsa-miR-20 [39], and of some that are down-regulated in differentiated megakaryocytes, such as hsa-miR-106 and hsa-miR-20 [40], suggesting that miRNAs might regulate TAL1 at different stages of hematopoietic development. [score:11]
[1 to 20 of 1 sentences]
35
[+] score: 11
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
Cell cycle and Neurotrophin signaling pathway were regulated by ssc-miR-20b, ssc-miR-128, ssc-miR-497, ssc-miR-195 and ssc-miR-371-5p through corresponding putative target genes. [score:4]
P53 signaling pathway was regulated by ssc-miR-20b, ssc-miR-497 and ssc-miR-195 through targeting CCNG2, CDKN1A, CASP8, GADD45G, CHEK1, SESN1 and CCNE1. [score:4]
Ssc-miR-106a, ssc-miR-363, ssc-miR-195, ssc-miR-497, ssc-miR-146b, ssc-miR-92b-5p, ssc-miR-20b and ssc-miR-935 were highly expressed in hpiPSCs than that in mpiPSCs (Fig 3A). [score:3]
[1 to 20 of 3 sentences]
36
[+] score: 11
Studies by several groups showed that miRNA-17 and miRNA-20 target p300/CBP associated factor (PCAF), a cellular cofactor of the HIV Tat protein (67). [score:3]
In addition to the ISGs, Poly I:C-stimulated IECs expressed HIV restriction miRNAs (Figure 4), including miRNA-17, miRNA-20, miRNA-28, miRNA-29 family members (miR-29a, 29b, and 29c), and miRNA-125b. [score:3]
Studies have shown that miRNA-17 and miRNA-20 target p300/CBP associated factor (PCAF), a cellular cofactor of the HIV Tat protein (51). [score:3]
We also found that the anti-HIV miRNAs: miRNA-17, miRNA-20, miRNA-28, miRNA-29 family members (miR-29a, 29b, and 29c) and miRNA-125b were increased in the exosomes (Figure 4B) from Poly I:C-stimulated IECs. [score:1]
We also observed that exosomes from Poly I:C-stimulated IECs were enriched with antiviral cellular ISGs and miRNAs (Figure 4), including miRNA-17, miRNA-20, miRNA-28, miRNA-29 family members (miR-29a, 29b, and 29c) and miRNA-125b. [score:1]
[1 to 20 of 5 sentences]
37
[+] score: 11
miR-20b expression levels have been reported to be altered in the prefrontal cortex of depressed suicide subjects [41]. [score:3]
The median expression of miR-20b (p [Skillings-Mack] < 0.05) showed two peaks: increasing from T1 (ΔCT = 2.74) to T5 (ΔCT = 2.11), then decreasing again to baseline at T8 (ΔCT = 2.74), showing a second and highest peak at T9 (ΔCT = 1.85; Table  3, Fig.   2). [score:3]
The ΔCT-values of miR-29a strongly correlate with miR-20b (r = 0.62, p < 0.001; Fig.   5E), miR-21 (r = 0.63, p < 0.001; Fig.   5F) and miR-26b (r = 0.71, p < 0.001; Fig.   5G), and weakly to moderately with miR-16 (r = 0.28, p < 0.01; Fig.   5D) and miR-134 (r = 0.33, p < 0.05; Fig.   5H). [score:1]
Of these, miR-20b, -21, and -26b showed significant changes in response to the TSST, while the changes in miR-16 and-134 were only close to significance (Table  3, Fig.   2). [score:1]
Even though changes in the concentration of salivary miR-20b were significant, significant correlations were only found with miR-29a. [score:1]
Of these, three miRNAs showed significant changes across the test procedure: miR-20b (p [Skillings-Mack] < 0,05), miR-21 (p [Friedman] < 0,05) and miR-26b (p [Skillings-Mack] > 0,001). [score:1]
In the study of Honda et al., the concentrations of miR-16, miR-20b, miR-26b and miR-29a assessed in whole blood were increased in healthy male students who perceived chronic mental stress due to an upcoming examination as a psychological stressor [22]. [score:1]
[1 to 20 of 7 sentences]
38
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Moreover, GC patients with over -expression of miR-107 [28, 29, 30], miR-143 [40], miR-145 [41, 42], miR-181b/c [17, 47, 48, 55, 56], miR-196a/b [59], miR-20b [23, 66], miR-23a/b [77, 78, 79], miR-34 [17, 47, 48, 55, 56] and miR-630 [100] and decreased expression of miR-1 [111], miR-1207-5p [121], miR-125a-3p/-5p [24, 125, 126, 127], miR-185 [140], miR-193b [60], miR-20a [111], miR-206 [150, 151], miR-215 [142], miR-217 [153], miR-27a [111], miR-29c [169], miR-34a [172, 173], miR-423-5p [111], and miR-520d-3p [99] indicate advanced tumor stage or TNM stage. [score:5]
Xue T. M. Tao L. D. Zhang M. Xu G. C. Zhang J. Zhang P. J. miR-20b overexpression is predictive of poor prognosis in gastric cancer OncoTargets Ther. [score:5]
[1 to 20 of 2 sentences]
39
[+] score: 10
For example, several up-regulated miRNAs in preeclamptic placenta, including miR-210 [83, 105], miR-20b [136], miR-29b [23], miR-16 [25], miR-155 [117] and miR-675 [115], have been demonstrated or suggested to inhibit angiogenesis and/or trophoblast proliferation, migration and invasion. [score:6]
However, miR-20b was not detected in endothelial cells of term placenta by ISH [136], and the direct effect of miR-20b on angiogenesis has not yet been determined. [score:2]
MicroRNA-20b targets ephrin receptor B4 (EPHB4) and ephrin-B2 [134], which are known to play important roles in placental angiogenesis [135]. [score:2]
[1 to 20 of 3 sentences]
40
[+] score: 10
In esophageal cancers cell line KYSE150, as shown in the up panel of Figure 2A, over -expression of MIR30e, MIR363, MIR498, MIR196, MIR422, MIR337 or MIR202 remarkably increase the LC3-I to LC3-II conversion whereas miR-20b modestly decrease. [score:3]
Follow-up experiments indicated transfection of MIR20b, MIR30e, MIR498 and MIR196 affected the apoptotic pathway in esophageal cancers cells. [score:1]
The cleaved PARP were modestly but significantly increased when transfection of MIR20b, MIR30e, MIR498 or MIR196 in both cell lines (Figure 2B). [score:1]
Interestingly, three out of the four apoptotic related miRNAs (MIR20b, MIR498 and MIR196), can modulate both autophagy and apoptosis processes. [score:1]
Collectively, above results suggested that the four predicted miRNAs, MIR20b, MIR30e, MIR498 and MIR196 may be involved in the apoptotic pathway in esophageal cancers cells. [score:1]
In another esophageal cancers cell line TE3, transfection of MIR20b, MIR363, MIR498 or MIR196 affected the autophagy when monitoring both LC3 and p62 (down panel of Figure 2A and Figure 2B). [score:1]
The results indicated at least 3 miRNAs (MIR20b, MIR498 and MIR196) were involved in cell death in two esophageal cancers cell lines. [score:1]
In addition to LC3, the sequestosome 1(SQSTM1/P62) protein were accumulated when MIR30e, MIR363, MIR498 or MIR196 were transfected whereas MIR20b significantly decreased (up panel of Figure 2B). [score:1]
[1 to 20 of 8 sentences]
41
[+] score: 10
Silencing of Bcr-Abl provokes a downregulation of these lncRNAs; among them, beta globin locus transcript 3 (non-protein coding) (lncRNA-BGL3) acts as a tumor suppressor transcript acting as a ceRNA for those miRNAs that target the oncosuppressor PTEN, such as miR-17, miR-20 and miR-106. [score:10]
[1 to 20 of 1 sentences]
42
[+] score: 10
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
First, a subgroup of miRNAs (miR-15b-5p, miR-17-5p, miR-18a-5p, miR-19a-3p, miR19b-3p, miR-20a-5p, miR-20b-5p, miR-21-5p, miR-23b-5p, miR-24-3p, miR-27a-3p, miR-92a-3p, miR-93-5p, miR-142-3p, miR-344b-2-3p, miR-431, miR-466b-5p and miR-674-3p) displayed increased expression levels during latency (4 and 8 days after SE), decreased their expression levels at the time of the first spontaneous seizure and returned to control levels in the chronic phase (Fig. 2, Supplementary Fig. S1). [score:5]
In fact, the expression patterns of miR-20b-5p, miR-142-3p, miR-181d-5p, miR-212-5p, miR-344b-5p and miR-674-3p were identical to those observed using the microarray, and those of miR-21-5p and miR-146a-5p were very similar, although not identical (Fig. 4). [score:3]
Cluster 4, together with cluster 1 (that includes miR-674-3p, miR-505-3p and miR-212-5p) and cluster 5 (including miR-144b-5p and miR-20b-5p), may also strongly influence neuronal activity. [score:1]
MiR-344b-5p and miR-20b-5p were in cluster 5. They were associated with different cancer related pathways, endocytosis (adjusted P = 0.044), MAPK signaling (adjusted P = 0.0081) and neuroactive ligand-receptor interaction (adjusted P = 0.0015; Fig. 3E). [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 9
Other over-expressed members of the cluster, such as miR-17-5p/miR-20, have been linked to the regulation of cell proliferation through a Cyclin D1 regulatory feedback loop [32] and through the inhibition of AIB1 translation [33] in breast cancer. [score:9]
[1 to 20 of 1 sentences]
44
[+] score: 9
miR-20b is reported to be up- or downregulated in different cancers [70– 73]. [score:4]
Overexpressing E10 cell line with miR-20b mimic led to reduced proliferation. [score:3]
This cluster encodes six miRNAs: miR-106a, miR-18b, miR-19b-2, miR-20b, miR-92a-2, and miR-363 [42]. [score:1]
Our group has shown that both miR-20b and miR-363 from this 106a-363 cluster are barely detectable in human oral carcinoma cell line E10 [85]. [score:1]
[1 to 20 of 4 sentences]
45
[+] score: 9
One of the hsa-mir-20 targets is the transcription factor E2F1, involved in apoptosis and cell proliferation which is consistent with our observations about the enrichment of mir-20 targets in this group of proteins. [score:5]
In TarBase, there are two validated targets for hsa-mir-20 and one for hsa-mir-106a. [score:3]
The sites in Alus with sense orientation are overrepresented most significantly in the categories ‘information processing’ (the sites for hsa-mir-106a and - 20b occur in 8 of 7 proteins in this category), and ‘protein modifications”, where 12 of 15 proteins have hsa-mir-17-5p site and 11 of 15 – hsa-mir-20b site. [score:1]
[1 to 20 of 3 sentences]
46
[+] score: 9
A similar pattern was observed for the paralogous miR-106-363 cluster showing a non-significant down-regulation in expression of miR-106a, miR-18a, and miR-20b after 24 h and a highly significant down-regulation of miR-106a, miR-18a, miR-20b, and miR-19b after 5 days of E. faecalis infection (Figure 1B). [score:9]
[1 to 20 of 1 sentences]
47
[+] score: 9
To further confirm whether impaired c-Myc expression was responsible for the decreased expression of miR-17 and miR-20 upon NC treatment, we detected the expression of miR-17 and miR-20a in K562 stably overexpressing c-Myc. [score:9]
[1 to 20 of 1 sentences]
48
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
MiR-92a, miR-19b and miR-363 were found to be highly expressed, while miR-17-5p, miR-18a, miR-20b and miR-106a were lowly expressed. [score:5]
As mentioned above, miR-17-5p, miR-363, miR-106a, miR-18a, miR-19b, miR-92a, miR-20b and miR-92b formed a complex cluster and family network, and they also showed different expression patterns. [score:3]
In the genome, miR-92a/19b showed three copies; miR-363 and miR-20b had two copies; while miR-17, miR-18a and miR-106a had one copy. [score:1]
[1 to 20 of 3 sentences]
49
[+] score: 9
During the whole time course of the mo del, PXN is a potential target of several downregulated (mmu-miR-203, -218, -30b, -30c, -27a and -21) and upregulated (mmu-miR-20b, -466g, -30d and -145) miRNAs. [score:9]
[1 to 20 of 1 sentences]
50
[+] score: 9
Other miRNAs from this paper: hsa-mir-17, hsa-mir-20a
LNA -modified miR-20a inhibitor (LNA-20a) efficiently suppressed endogenous miR-20 expression (Supplementary Figure S3c). [score:7]
To ablate the miR-20 bindings sites, we used site-directed mutagenesis kit (Takara, Kusatsu, Japan) to generate mutated vectors (Mut). [score:2]
[1 to 20 of 2 sentences]
51
[+] score: 9
Of 6 downregulated miRNA in TGF-β -treated cells, 5 were also downregulated in iron -treated cells: hsa-miR-20b, -605, -638, 663, and -720. [score:7]
06 hsa-miR-595 5.29 hsa-miR-92b −9.97 hsa-miR-601 5.88 hsa-miR-765 4.47 hsa-miR-98 5.05 hsa-miR-99a 6.41 TGF-β -treated hsa-miR-20b −1.29 hsa-let-7a 1.38 hsa-miR-221 −1.25 hsa-let-7d 1.43 hsa-miR-605 −4.64 hsa-let-7e 2 hsa-miR-638 −1.40 hsa-miR-125a-5p 2.87 hsa-miR-663 −2.06 hsa-miR-146a 2.72 hsa-miR-720 −2.40 hsa-miR-21 1.14 hsa-miR-23a 1.20 hsa-miR-23b 1.14 hsa-miR-30c 1.89 hsa-miR-483-5p 1.38 hsa-miR-574-5p 2.23 hsa-miR-99b 1.63 10.1371/journal. [score:1]
06 hsa-miR-595 5.29 hsa-miR-92b −9.97 hsa-miR-601 5.88 hsa-miR-765 4.47 hsa-miR-98 5.05 hsa-miR-99a 6.41 TGF-β -treated hsa-miR-20b −1.29 hsa-let-7a 1.38 hsa-miR-221 −1.25 hsa-let-7d 1.43 hsa-miR-605 −4.64 hsa-let-7e 2 hsa-miR-638 −1.40 hsa-miR-125a-5p 2.87 hsa-miR-663 −2.06 hsa-miR-146a 2.72 hsa-miR-720 −2.40 hsa-miR-21 1.14 hsa-miR-23a 1.20 hsa-miR-23b 1.14 hsa-miR-30c 1.89 hsa-miR-483-5p 1.38 hsa-miR-574-5p 2.23 hsa-miR-99b 1.63 10.1371/journal. [score:1]
[1 to 20 of 3 sentences]
52
[+] score: 9
This would lead to a loss of gene regulation for targets of MIR20B in a testis-specific fashion, although the specific cell type affected and functional consequences remain to be determined. [score:4]
Interestingly, there is enrichment for this mature miRNA in our testis pool, indicating there may be testis-specific de-regulation of genes the MIR20B produced miRNA typically silences. [score:2]
The human cluster contains six miRNAs (MIR363, MIR19A2, MIR19B2, MIR20B, MIR18B and MIR106A), all six of which were predicted from Meug_1.0 (ENSMEUG000000: 16895, 17431, 17730, 17261, 17356, and 17668 respectively). [score:1]
Additionally, another miRNA was found between MIR19B2 and MIR20B that is in a region of low homology between human and tammar yet outside of any predicted gene. [score:1]
While the conservation of the six miRNA genes in this region was confirmed by the presence of mature miRNAs in our miRNA pools, a miRNA peak was identified just downstream of MIR20B that was highly represented in the testis. [score:1]
[1 to 20 of 5 sentences]
53
[+] score: 9
We then applied real-time qRT-PCR to validate the expression of two up-regulated miRNAs (hsa-miR-27a-3p and hsa-miR-146a-5p) and two down-regulated miRNAs (hsa-miR-20b-3p and hsa-miR-519e-5p) from the HLEC and colon cancer cell co-culture system. [score:9]
[1 to 20 of 1 sentences]
54
[+] score: 9
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
In MCL, miR-20b expression is related to poor survival, and its lack of expression distinguished cases with a survival probability of 56% at 60 months [57]. [score:5]
miR-20b, another member of the oncomir-1 cluster, had a significant clinical prognostic value, loss of which was associated with better prognosis in MCL similar to several other diseases like gastric cancer, T-cell leukemia, and mammary tumors [57]. [score:3]
Distinctive miRNA signatures obtained using unsupervised hierarchical clustering could distinguish these three groups based on just 16 miRNAs with miR-17~92 cluster members (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-20b, and miR-92) and its paralog miR-106a, being the predominant one in addition to miR-29a/c,miR-100, miR-199a*, miR-140, miR-630, and miR-16 [49]. [score:1]
[1 to 20 of 3 sentences]
55
[+] score: 9
Interestingly, many moRNA-deriving, cancer -associated hairpins are also expressed in oocytes such as mir-17-92 cluster, miR-20, miR-21, miR-15a/16 and miR-103 [50] whereas miR-421 from mir-374b-421 cluster has been reported to be up-regulated in ovarian teratomas [60]. [score:6]
The other known hESC miRNA clusters detected highly represented in our study gave rise to several overexpressed moRNAs as well: moRNAs derived from both ends of mir-363 and miR-20b hairpins, moR-92a-2-5p from miR-106a-363 cluster and four moRNAs from the paralog miR-17-92 cluster. [score:3]
[1 to 20 of 2 sentences]
56
[+] score: 8
Evaluating the miRNA profile in a human vascular endothelial cell line (EAhy926) infected with DENV-2 (TR1751 strain) by microarray and qRT-PCR, 12 miRNA candidates were found to be up-regulated (miR-3178, miR-324-3p, miR-937, miR-3195, hsv1-miR-H6-3p, kshv-miR-K12-12*, let-7a-2*, miR-20b*) and down-regulated (miR-21*, miR-2116, miR-142-3p, miR-223). [score:5]
A bioinformatics search for miRNAs that target the SOCS1 3′ UTR resulted in 11 candidates (miR-15a, miR-20, miR-21, miR-96, miR-126, miR-146, miR-150, miR-181a, miR-155, miR-221 and miR-57). [score:3]
[1 to 20 of 2 sentences]
57
[+] score: 8
Absolute granulocyte numbers and miRNA expression correlated most significantly in both mouse strains (23 miRNAs with significant correlations; violet circles in Figure 3), with miR-223-3p, miR-142-3p, and miR-20b-5p correlating the most positively in both mouse strains ([ρ [DBA/2J] + ρ [C57BL/6J]]/2 > 0.7). [score:3]
Expression of subsets of miRNAs correlated significantly with peripheral blood granulocyte and monocyte numbers, particularly in DBA/2J mice; miR-223-3p, miR-142-3p, and miR-20b-5p correlated most positively with these cell types in both mouse strains. [score:3]
For instance, miR-142-5p plays critical roles in lymphocyte development and homeostasis (57), and miR-106a-5p, miR-130-3p, miR-20b-5p, miR-345-3p, and the miR-15 cluster have been associated with immune or stress responses (58– 62). [score:2]
[1 to 20 of 3 sentences]
58
[+] score: 8
miRNA Target Genes Pathways miR-128 ABCB9, BTG1, DSCR1, RASD1 ABC transporters General miR-136 GRN, PPP1R9B miR-147 HOXA1, PTGFRN miR-148 EGR3, SCN3A miR-181b IGF1R, NKX6-1 Adherens junction, Maturity onset diabetes of the, Focal adhesion, **Long term depression miR-196a ABCB9, CPB2, IRS1, MAPK10 ABC transporters General, Complement and coagulation cas, Adipocytokine signaling pathwa, Insulin signaling pathway, Type II diabetes mellitus, Fc epsilon RI signaling pathwa, Focal adhesion, **GnRH signaling pathway, **MAPK signaling pathway, Toll like receptor signaling p, Wnt signaling pathway miR-203 SARA1 miR-20 BTG1, SARA1, YWHAB Cell cycle miR-21 TPM1 mir-216 GNAZ **Long term depression miR-217 RHOA Adherens junction, Axon guidance, Focal adhesion, Leukocyte transendothelial mig, Regulation of actin cytoskelet, TGF beta signaling pathway, T cell receptor signaling path, Tight junction, Wnt signaling pathway miR-31 ATP2B2, DNM1L, EGR3, PPP1R9B, YWHAB **Calcium signaling pathway, Cell cycle miR-7 SLC23A2 miR-7b HRH3, NCDN, SLC23A2 **Neuroactive ligand receptor in b: miRNAs and their targets (from TargetScan and miRanda). [score:8]
[1 to 20 of 1 sentences]
59
[+] score: 8
Compared to ALK(−) ALCLs, miR-203, miR-135b, miR-886-5p/3p, miR-20b, miR-106a and miR-183 were significantly upregulated in ALK(+) ALCLs while others (miR-155, miR-181a, miR-210, miR-29a/b, miR-342-5p/3p, miR-369-3p miR-374a/b, miR-423-5p, miR-625, miR-205, miR-146a and miR-26a) were down-regulated (Table 1). [score:6]
Surprisingly, only few miRNA identified as part of the signature distinguishing ALK(+) ALCL from T-cells or ALK(−) ALCL were affected by ALK knockdown: miR-20b, miR-106a, miR-886-5p and miR-181a. [score:2]
[1 to 20 of 2 sentences]
60
[+] score: 8
For instance, the paralog miRNA clusters miR-106a/363 (integrated by miR-106a, miR-363, miR-92-2, miR-19b-2, miR-20 and miR-18b), miR-106b/25 (compound of miR-106b, miR-25 and miR-93) and miR-17/92 (comprising miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1) are down-regulated upon differentiation, while clusters miR-29a/29b and miR221/222 are strongly up-regulated, suggesting an important role for coordinate regulatory miRNA networks during GIC differentiation. [score:8]
[1 to 20 of 1 sentences]
61
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
While up-regulation of miR-20 was associated with higher complete remission rates and overall survival [105], miR-204 expression was reduced in AML patients and low miR-204 expression was correlated with short patient survival [114]. [score:8]
[1 to 20 of 1 sentences]
62
[+] score: 8
Cascio S. D'Andrea A. Ferla R. Surmacz E. Gulotta E. Amodeo V. Bazan V. Gebbia N. Russo A. miR-20b modulates VEGF expression by targeting HIF-1alpha and STAT3 in MCF-7 breast cancer cells J. Cell Physiol. [score:5]
VEGF expression in breast cancer cells is triggered by HIF-1 and STAT3 under the influence of miR-20b [139]. [score:3]
[1 to 20 of 2 sentences]
63
[+] score: 8
An increase in the expression level of miRNA genes (except miR-20b and miR-132/212) was mostly observed in CD4+ T cells; in nervous system cells, expression of the three miRNAs was reduced, and that of two miRNAs was enhanced. [score:5]
It is important to note that targets of miR-29b and miR-20b are mRNAs of the TBX21 and RORC genes encoding T-bet and RORγt, which are the main transcription factors involved in the differentiation of Th0 cells to Th1 and Th17 cells, respectively. [score:3]
[1 to 20 of 2 sentences]
64
[+] score: 8
Four miRNAs [hsa-miR-125b (B), hsa-miR-720 (C), hsa-miR-1280 (D), and hsa-miR-20b (E)], which were differentially expressed (p<0.05, Figure 3A) and (p<0.10, Figure S2) during weeks 4, 5, and 6 of human embryonic development, were chosen. [score:4]
0069230.g003 Figure 3Four miRNAs [hsa-miR-125b (B), hsa-miR-720 (C), hsa-miR-1280 (D), and hsa-miR-20b (E)], which were differentially expressed (p<0.05, Figure 3A) and (p<0.10, Figure S2) during weeks 4, 5, and 6 of human embryonic development, were chosen. [score:4]
[1 to 20 of 2 sentences]
65
[+] score: 8
Cascio S. D’Andrea A. Ferla R. Surmacz E. Gulotta E. Amodeo V. Bazan V. Gebbia N. Russo A. miR-20b modulates VEGF expression by targeting HIF-1α and STAT3 in MCF-7 breast cancer cells J. Cell. [score:5]
Recent analysis identified miRNAs expressed in undifferentiated mouse embryonic stem cells and differentiating cardiomyocytes and found increased level of miRNA-1, miRNA-18, miRNA-20, miRNA-23b, miRNA-24, miRNA-26a, miRNA-30c, miRNA-133, miRNA-143, miRNA-182, miRNA-183, miRNA-200a/b, miRNA-292-3p, miRNA-293, miRNA-295 and miRNA-335 in mice [14, 45]. [score:3]
[1 to 20 of 2 sentences]
66
[+] score: 7
Similarly, in colorectal cancer, miR-20b, -21 and 130 inhibited PTEN expression, resulting in PD-L1 overexpression [43]. [score:7]
[1 to 20 of 1 sentences]
67
[+] score: 7
thymus we found a reduced expression of miR-142-3p and miR-20b by PCR but a slight up-regulation in the lymphomas by sequencing. [score:6]
For the miRNAs shown in the diagram of Figure 1C, the level seen in thymus tissue was set to 1. The strongest relative induction was observed for miR-145 (11-fold), miR-143 (8-fold), and miR-125b (7-fold), while strongest reduction was determined for miR-20b (10-fold), miR-181b (8-fold), and miR-146a+b (5-fold). [score:1]
[1 to 20 of 2 sentences]
68
[+] score: 7
miR-20b modulates VEGF expression by targeting HIF-1α and STAT3 in MCF-7 breast cancer cells. [score:5]
Regulation of HIF-1α and VEGF by miR-20b tunes tumor cells to adapt to the alteration of oxygen concentration. [score:2]
[1 to 20 of 2 sentences]
69
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-218-1, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-128-1, hsa-mir-145, hsa-mir-191, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-296, hsa-mir-30e, hsa-mir-361, hsa-mir-337, hsa-mir-148b, hsa-mir-196b, hsa-mir-425, hsa-mir-486-1, hsa-mir-488, hsa-mir-181d, hsa-mir-498, hsa-mir-519c, hsa-mir-520a, hsa-mir-526b, hsa-mir-520d, hsa-mir-506, hsa-mir-92b, hsa-mir-608, hsa-mir-617, hsa-mir-625, hsa-mir-641, hsa-mir-1264, hsa-mir-1271, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-30d, bta-mir-128-1, bta-mir-145, bta-mir-181a-2, bta-mir-30b, bta-mir-181b-2, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-let-7d, bta-mir-148b, bta-mir-181c, bta-mir-191, bta-mir-210, bta-mir-23a, bta-mir-361, bta-mir-425, bta-let-7g, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-99b, hsa-mir-890, hsa-mir-888, hsa-mir-889, hsa-mir-938, hsa-mir-1184-1, hsa-mir-1203, hsa-mir-1204, hsa-mir-1265, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-128-2, bta-mir-181d, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-218-1, bta-mir-296, bta-mir-30f, bta-mir-486, bta-mir-488, bta-mir-92a-1, bta-mir-92b, bta-mir-1271, bta-mir-181a-1, bta-mir-181b-1, bta-mir-148c, hsa-mir-1184-2, hsa-mir-1184-3, hsa-mir-486-2, bta-mir-1264, bta-mir-148d
Moreover, miR-361-5p, miR-1184 and miR-218-1* were the top among the upregulated miRNAs while miR-1265, miR-20b*, miR-520d-5p and miR-506 were the top among the downregulated miRNAs in the SE animals. [score:7]
[1 to 20 of 1 sentences]
70
[+] score: 7
Additionally, miR-20b* was higher expressed in pediatric PreBII large cells (up 14.1 fold, p = 0.0106), and miR-18b*/miR-19a*/miR-19b-1*/miR-20b*/miR-25* were higher expressed in adult Immature B cells (up 4.6–17.3 fold, p = 0.0465–0.0093). [score:5]
Interestingly, five star-form partners were similarly significantly higher expressed in pediatric PreBII small cells as compared to adults (miR-17a*/miR-18a*/miR-19b*/miR-20b*/miR-93*) (up 3–29 fold, p = 0.0018–0.042). [score:2]
[1 to 20 of 2 sentences]
71
[+] score: 7
Their results included two of the most upregulated (miR-221 and miR-222) and six downregulated miRNAs (miR-151-3p, miR-19a, miR-20b, miR-342-3p, miR-363, and miR-576-3p). [score:7]
[1 to 20 of 1 sentences]
72
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
In breast cancer cells, over -expression of miR-221, miR-222, let-7 and miR-20b is associated with reduced of ERα protein content, signaling and expression of ERα target genes [47- 49]. [score:7]
[1 to 20 of 1 sentences]
73
[+] score: 7
In summary, our results underline the relevance of microRNAs during kidney development and will encourage further functional studies examining single microRNAs and their target mRNA interactions – such as miR-20 and its targets PKD1 and PKD2 [3, 6, 30, 31] - as regulators of renal organogenesis. [score:7]
[1 to 20 of 1 sentences]
74
[+] score: 7
The 50 miRNAs that showed highest total reads (most abundant) in the exosomes of the 36 patient samples were then subjected to unsupervised hierarchal clustering with the expression heat maps of the individual patient samples shown in Figure 1. The twenty most variable miRNAs among all samples were then further validated by qPCR analysis to examine their differential expression within the four patient cohorts described in Table 1. These miRNAs included let-7b, let-7g, miR-17, miR-19a, miR-19b, miR-20b, miR-21, miR-23a, miR-29a, miR-92a, miR-125b, miR-126, miR-128, miR-137, miR-148a, miR-149, miR-199a, miR-221, miR-222 and miR-423 (Table 2). [score:5]
hsa-let-7b TGAGGTAGTAGGTTGTGTGGTT hsa-let-7g-5p TGAGGTAGTAGTTTGTACAGTT hsa-miR-125b TCCCTGAGACCCTAACTTGTGA hsa-miR-126 TCGTACCGTGAGTAATAATGCG hsa-miR-128 TCACAGTGAACCGGTCTCTTT hsa-miR-137 TTATTGCTTAAGAATACGCGTAG hsa-miR-148a AAAGTTCTGAGACACTCCGACT hsa-miR-149 TCTGGCTCCGTGTCTTCACTCCC hsa-miR-17 CAAAGTGCTTACAGTGCAGGTAG hsa-miR-199a-5p CCCAGTGTTCAGACTACCTGTTC hsa-miR-19a TGTGCAAATCTATGCAAAACTGA hsa-miR-19b TGTGCAAATCCATGCAAAACTGA hsa-miR-20b TAAAGTGCTTATAGTGCAGGTAG hsa-miR-21 TAGCTTATCAGACTGATGTTGA hsa-miR-221 AGCTACATTGTCTGCTGGGTTTC hsa-miR-222 AGCTACATCTGGCTACTGGGT hsa-miR-23a ATCACATTGCCAGGGATTTCC hsa-miR-29a TAGCACCATCTGAAATCGGTTA hsa-miR-423-5p TGAGGGGCAGAGAGCGAGACTTT hsa-miR-92a TATTGCACTTGTCCCGGCCTGT Since there are no known control or house-keeping microRNAs in exosomes, we adopted the strategy of using spiked-in C. elegans miRNAs directly into Qiazol prior to RNA extraction as normalizing controls [20]. [score:2]
[1 to 20 of 2 sentences]
75
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26b, hsa-mir-27a, hsa-mir-31, hsa-mir-33a, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-147a, hsa-mir-34a, hsa-mir-182, hsa-mir-199a-2, hsa-mir-212, hsa-mir-221, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-142, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-127, hsa-mir-134, hsa-mir-200c, hsa-mir-106b, hsa-mir-361, hsa-mir-148b, hsa-mir-410, hsa-mir-202, hsa-mir-503, hsa-mir-33b, hsa-mir-643, hsa-mir-659, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-221, bta-mir-26b, bta-mir-27a, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-127, bta-mir-142, bta-mir-20b, bta-let-7d, bta-mir-132, bta-mir-148b, bta-mir-200c, bta-mir-22, bta-mir-23a, bta-mir-29b-2, bta-mir-361, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-let-7f-1, bta-let-7i, bta-mir-25, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, hsa-mir-708, hsa-mir-147b, hsa-mir-877, hsa-mir-940, hsa-mir-548j, hsa-mir-302e, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-100, bta-mir-106b, bta-mir-130a, bta-mir-134, bta-mir-147, bta-mir-152, bta-mir-153-1, bta-mir-153-2, bta-mir-182, bta-mir-24-1, bta-mir-199a-2, bta-mir-202, bta-mir-212, bta-mir-224, bta-mir-33a, bta-mir-33b, bta-mir-410, bta-mir-708, bta-mir-877, bta-mir-940, bta-mir-29b-1, bta-mir-148c, bta-mir-503, bta-mir-148d
Among the overexpressed miRNAs miR-20b-3p and miR-708-3p showed the highest fold change regulation, while miR-153 and miR-134 exhibit highest fold change among the downregulated miRNAs. [score:7]
[1 to 20 of 1 sentences]
76
[+] score: 7
MiR-20b inhibits Mycobacterium tuberculosis induced inflammation in the lung of mice through targeting NLRP3. [score:4]
Similarly, Lou et al. (2017) demonstrated that miR-20b can alleviate the inflammatory response in TB mice by targeting the NLRP3/caspase-1/IL-1β pathway. [score:3]
[1 to 20 of 2 sentences]
77
[+] score: 7
microRNAs downregulated in quiescent cells included miR-18, miR-20, miR-29, and miR-7, and microRNAs upregulated with quiescence included let-7b, miR-125a, miR-30, miR-181, miR-26, and miR-199. [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 7
Intriguingly, 4 different down-regulated miRNAs all target the same validated growth factor, VEGFA (mir-20b, 20a, 34a, 34b*), a molecule implicated in depression in both humans and animal mo dels (see ). [score:6]
In contrast, VEGFA showed a mix of smaller positive and inverse correlations: (mir-20a: r = 0.08 in controls and r = 0.26 in depressed; mir-20b: r = 0.34 in controls and r = 0.24 in depressed; mir-34a: r = 0.34 in controls and r = −0.39 in depressed; mir-34b-5p: r = −0.363 in controls and r = 0.08 in depressed). [score:1]
[1 to 20 of 2 sentences]
79
[+] score: 7
Hua et al. [29] showed that VEGF is predicted to be targeted by multiple miRNAs, including miR-15b, miR-16, miR-20a and miR-20b, and transfection of these miRNAs into CNE cells (a human nasopharyngeal carcinoma cell line) can inhibit VEGF expression [29]. [score:7]
[1 to 20 of 1 sentences]
80
[+] score: 7
However, the identification of target genes specific for miR-519d is especially challenging because it shares target sequence specificity with miR-17-5p, miR-20 A and B, as well as miR-106 A and B. Other microRNAs overexpressed more than twofold in human male breast cancer, but not yet described in female breast cancer are miR-183, miR-197, miR-493-5p, and 519d. [score:7]
[1 to 20 of 1 sentences]
81
[+] score: 7
Conversely, in the advanced fibrosis group they demonstrated an upregulation of miR-1 and miR-10b-5p, and a downregulation of miR-20b-5p and miR-455-3p, implicated in immune response and cellular senescence. [score:7]
[1 to 20 of 1 sentences]
82
[+] score: 7
5.0 and reported that miR-92, miR-20, miR-18 and precursor miR-18 had significantly high expression in poorly differentiated HCC samples, moderate expression in moderately differentiated HCC and low expression in well-differentiated HCC. [score:7]
[1 to 20 of 1 sentences]
83
[+] score: 6
Similarly, upregulation of miR-20 in senescence cells correlates with the ability of miR-20 to inhibit proliferation of K562 human erythromyeloblastoid leukemia cells [43]. [score:6]
[1 to 20 of 1 sentences]
84
[+] score: 6
There are only a few studies on the expression changes of miRNA in the serum of patients with GC, which are summarized in Table 2. Some miRNAs were reported to be up-regulated, including miR-20b, miR-20a, miR-17, miR-106a, miR-18a, miR-21 [72], miR-17-5p, miR-21, miR-106a and miR-106b [73]. [score:6]
[1 to 20 of 1 sentences]
85
[+] score: 6
Moreover, the existence of skin-specific miRNAs involved in normal epidermal and follicular development, such as the miR-200, the miR-19 and miR-20 families, indicate that their therapeutic expression or inhibition might also be relevant to epidermal pathology [103]. [score:6]
[1 to 20 of 1 sentences]
86
[+] score: 6
We also found that 4 miRNAs belonging to the miR-17 family (that is, miR-20a, miR-20b, miR-17-5p and miR-106a) are down-regulated during WJ-MSC neurogenesis (Figures 1, 2). [score:4]
Five miRNAs were enriched in WJ-MSCs, including miR-345, miR-106a, miR-17-5p, miR-20a and miR-20b. [score:1]
Five miRNAs were enriched in WJ-MSCs, including hsa-miR-345, hsa-miR-106a, hsa-miR-17-5p, hsa-miR-20a and hsa-miR-20b (Figure 1B). [score:1]
[1 to 20 of 3 sentences]
87
[+] score: 6
Hsa-mir-142, hsa-mir-18a, and hsa-mir-20b have greater functional consistency score (FCS) among their target genes and the known target genes associated with prostate neoplasms. [score:5]
45) 6 hsa-mir-34b dbDEMC 31 hsa-mir-20b Higher FCS (No. [score:1]
[1 to 20 of 2 sentences]
88
[+] score: 6
Examples of miRNAs with increased expression as development proceeds include: let-7f, miR-9 and miR-21, whereas, for example, miR-20b and miR-363 display reduced expression with increasing embryo age (Fig.  5D). [score:6]
[1 to 20 of 1 sentences]
89
[+] score: 6
MiR-20b, -21, and -130b inhibit PTEN expression resulting in B7-H1 over -expression in advanced colorectal cancer. [score:6]
[1 to 20 of 1 sentences]
90
[+] score: 6
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
More precisely, we identified five miRNAs expressed at the level > 10 cpm solely in PSSM GM muscle: eca-miR-144, eca-miR-20b, ecaub_novel-miR-472, ecaub_novel-miR-568, and ecaub_novel-miR-892. [score:3]
The miR-144 was also expressed at >10 cpm level in bone and eca-miR-20b in bone and liver (Additional file 3: Table S2). [score:3]
[1 to 20 of 2 sentences]
91
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Xia et al. (2011) Heart miR-218a-1/2 Zebrafish Knockdown, overexpression, ISH, luciferase reporter assay, qRT-PCR Heart field migration Fish et al. (2011) miR-138 Zebrafish Knockdown, antagomiR, ISH, luciferase reporter assay, qRT-PCR Cardiac patterning Morton et al. (2008) miR-21, miR-218a Zebrafish Knockdown, overexpression, ISH, qRT-PCR, luciferase reporter assay Heart valve formation Chiavacci et al. (2012) and Banjo et al. (2013) let-7e,f,g,h,i,j,k,l,m,n,o, miR-1a, miR-20, miR-21a,b,c, miR-29a,b, miR-103, miR-125, miR-126a,b, miR-128c, miR-145, and miR-199b Asian seabass qRT–PCR ? [score:5]
Also, let-7 family, miR-20b, miR-31, miR-221, and miR-181a promote angiogenesis and lymphangiogenesis in zebrafish (Biyashev et al. 2012; Nicoli et al. 2012; Dunworth et al. 2013). [score:1]
[1 to 20 of 2 sentences]
92
[+] score: 6
Of them, hsa-miR-378 is located in the intron of protein-coding genes PPARGC1B, an experimentally validated transcriptional targets of MYC [40], and another eight miRNAs (hsa-miR-17, hsa-miR-19a, hsa-miR-19b, hsa-miR-20b, hsa-miR-92, hsa-miR-106a, hsa-miR-25, and hsa-miR-106b) belong to three paralogous clusters located on chromosome 13 (the hsa-miR-17 cluster), chromosome X (the hsa-miR-106a cluster), and chromosome 7 (the hsa-miR-106b cluster), with the former two clusters having been proved to be regulated by MYC [41]. [score:4]
In our network, MYC was predicted to regulate 10 miRNAs: miR-378, hsa-miR-17, hsa-miR-19a, hsa-miR-19b, hsa-miR-20b, hsa-miR-92, hsa-miR-106a, hsa-miR-25, and hsa-miR-106b, and hsa-miR-125b. [score:2]
[1 to 20 of 2 sentences]
93
[+] score: 6
MiRNA-17-5p and miRNA-20 down regulate the expression of p300/CBP -associated factor (PCAF) histone acetyl-transferase, can induce the inhibition of the HIV virus in the human body (Munshi et al., 2014). [score:6]
[1 to 20 of 1 sentences]
94
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The overexpression of certain oncogenic miRNAs (miR-21, miR-27a, miR-155, miR-9, miR-10b, miR-373/miR-520c, miR-206, miR-18a/b, miR-221/222) and the loss of several tumor suppressor miRNAs (miR-205/200, miR-125a, miR-125b, miR-126, miR-17-5p, miR-145, miR-200c, let-7, miR-20b, miR-34a, miR-31, miR-30) lead to loss of regulation of vital cellular functions that are involved in breast cancer pathogenesis [127, 128]. [score:6]
[1 to 20 of 1 sentences]
95
[+] score: 6
Let-7g and miR-23b up-regulate TGFBR2 expression and are associated with SSc [31], while miR-140-5p, miR-17-5p, and miR-20 have an opposite effect, thus resulting in hypertrophic scars [32]. [score:6]
[1 to 20 of 1 sentences]
96
[+] score: 6
Indeed, some estrogen -induced miRNAs such as miR-18a, miR-19b, and miR-20b target and regulate ERα expression, thus forming a negative feedback loop [83]. [score:6]
[1 to 20 of 1 sentences]
97
[+] score: 6
In another study, the authors found that miR-20 downregulates the transcriptional repressor gene REST, inhibiting the differentiation of NSPCs [121]. [score:6]
[1 to 20 of 1 sentences]
98
[+] score: 5
Next-generation RNA sequencing also revealed a number of miRNAs that were differentially expressed in response to miR-34b expression (Figure S4A, Table S2), and several such miRNAs (miR-20b, -134, -140, and -199b) are reportedly involved in cancer progression [40], [41], [42], [43]. [score:5]
[1 to 20 of 1 sentences]
99
[+] score: 5
In S. mansoni, 112 miRNAs (including 84 novel miRNA families) have been reported in adult worms of S. mansoni (Marco et al., 2013); miR-4, miR-6, miR-9, miR-32, miR-125, miR-3, and miR-5 are expressed in adult worms only, and miR-20, miR-18, miR-22, miR-26 and bantam are expressed in schistosomula only (Simões et al., 2011). [score:5]
[1 to 20 of 1 sentences]
100
[+] score: 5
For the association miR-20b-prostate cancer which cannot be verified, Moltzahn et al. [50] had reported an upregulation of miR-20b in prostate cancer patients comparing with the healthy samples. [score:4]
With our prediction, there may be an association between miR-20b and prostate cancer. [score:1]
[1 to 20 of 2 sentences]