sort by

34 publications mentioning zma-MIR166a

Open access articles that are associated with the species Zea mays and mention the gene name MIR166a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 160
Consistent with their reported in situ hybridization expression patterns, the miR166 target rolled leaf1 (rld1) is expressed in all tissue samples tested [7], rough sheath1 (rs1) transcripts are limited to those domains that include the subtending regions of leaves [22], and similar to kanadi2 (kan2), the expression of kan1 demarks cells in the developing young leaf primordia [23] (Figure 1B). [score:9]
However, the expression profiles of individual mir166 genes are unique, indicating a process of functional diversification perhaps not unlike their hd-zipIII targets, which have distinct but overlapping roles in organ polarity, vascular development and meristem activity [24]– [25]. [score:6]
mir166a, - f and - i are expressed both in and below the incipient primordium, whereas mir166c is expressed at detectable levels exclusively below the initiating leaf (Figure 2B). [score:5]
Although multiple mir166 family members are expressed in every tissue sample analyzed, each mir166 gene tested exhibits a unique expression profile (Figure 1C). [score:5]
The finding that mir166c and mir166i are expressed within and below the incipient leaf (Figure 2B) is consistent with previous observations showing that the tas3 ta-siRNA pathway generates the abaxial gradient of miR166 and specifies adaxial fate by restricting the expression domains of these two specific mir166 family members [3]. [score:5]
Distinct mir166 Expression Profiles Revealed by Laser-MicrodissectionMature miR166 exhibits a complex spatiotemporal pattern of expression. [score:5]
During primordium development, miR166 expression persists on the abaxial side of the leaf. [score:4]
MiR390 activity triggers ta-siRNA biogenesis on the adaxial side of the incipient primordium that indirectly restrict the expression of specific mir166 family members. [score:4]
Regulation of small RNAs in the ta-siRNA pathway at the level of biogenesis, stability, or possibly movement generates an inverse abaxial gradient of mature miR166 (purple) that delineates the expression of hd-zipIII genes, like rld1 and rld2, to the adaxial side of the incipient leaf establishing organ polarity. [score:4]
The comparison of mature small RNA in situ localization data with the expression profiles of precursor transcripts, as determined using laser-microdissected domains, indicates that the accumulation pattern of mature miR166 results from the co-operative activities of multiple mir gene family members and is further regulated at the level of biogenesis and/or stability. [score:4]
As tas3 ta-siRNAs indirectly restrict the expression of mir166c and mir166i, such a ta-siRNA gradient could specify the inverse graded accumulation of miR166 on the abaxial side of the leaf that adaxially restricts hd-zipIII transcripts (Figure 5). [score:4]
This includes, although indirectly, miR166, which is expressed ectopically in lbl1 leaf primordia and accumulates in both the adaxial and abaxial domains [3]. [score:4]
The partially overlapping expression patterns of mir166 precursors suggest some degree of redundancy. [score:3]
That miR390 restricts the accumulation of tasiR-ARFs places it as one of the upstream factors in the maize leaf polarity network, as genetic and expression data position the tas3 ta-siRNA pathway upstream of miR166 as well as the hd-zipIII and yabby genes [3], [8]. [score:3]
The adaxial accumulation of miR390 overlaps with that of tasiR-ARFs and the expression pattern of lbl1/SGS3 in these regions [3], and is opposite to the abaxial accumulation of miR166 in the incipient leaf (Figures 2C and 3A). [score:3]
To determine which family members contribute to the spatiotemporal expression pattern of mature miR166 in vegetative tissues, we investigated mir166 gene expression in hand-dissected apices containing the SAM and four to five leaf primordia. [score:3]
MiRNA miR166 promotes abaxial/ventral fate in developing primordia by restricting the expression of class III homeodomain leucine zipper (HD-ZIPIII) transcription factors, which are necessary and sufficient to specify adaxial/dorsal fate [5]– [7]. [score:3]
For example, their expression in stem tissues suggests a possible function for mir166a, - c, and - e in vascular differentiation (Figure 1C). [score:3]
Similarly, all nine mir166 genes are expressed in inflorescence tissues. [score:3]
1000320.g001 Figure 1 mir166 family members exhibit distinct overlapping expression profiles in the maize shoot apex. [score:3]
This result could indicate substantial redundancy in the mir166 gene family, or alternatively, mir166 genes may have distinct, sublocalized expression patterns in these tissues. [score:3]
Distinct mir166 Expression Profiles Revealed by Laser-Microdissection. [score:3]
Unexpectedly, miR390 remains polarized within the initiating and developing leaf primordia of lbl1-rgd1 (Figure 3B), even though these leaves are molecularly abaxialized with respect to expression of miR166 and members of the hd-zipIII and yabby families [3], [8]. [score:3]
The post-transcriptional regulatory mechanisms that limit miR390 accumulation in the SAM tip may similarly regulate other miRNAs such as miR166, which is not detected in the meristem despite the presence of precursor transcripts (Figure 2). [score:3]
Figure S1Expression analyses of mir166 family members in maize vegetative apices and female inflorescence tissues. [score:3]
1000320.g005 Figure 5The diagram on the left illustrates the spatial pattern of expression for both mir390 precursors as well as mature miR390 and miR166 in the SAM. [score:3]
In addition, mir166a transcripts are expressed in the SAM tip. [score:3]
It is most abundant in a group of cells below the incipient leaf but a gradient of miR166 expression, which establishes organ polarity, extends into the abaxial side of the newly initiating primordium. [score:3]
mir166 family members exhibit distinct overlapping expression profiles in the maize shoot apex. [score:3]
The abundance of rld1 and rld2 target transcripts in the meristem tip (Figure 2D and 2E; [3], [7]) further suggests a lack of miR166 activity in this region. [score:3]
Unlike the mir166 genes, all four tas3 family members are expressed within and below the incipient leaf and thus likely contribute redundantly to the establishment of leaf polarity (Figure S2). [score:3]
The diagram on the left illustrates the spatial pattern of expression for both mir390 precursors as well as mature miR390 and miR166 in the SAM. [score:3]
Our findings indicate that small amounts of RNA from laser-microdissected tissue samples are sufficient to detect mir166 and mir390 precursors, providing a novel approach to study miRNA regulation in specific cell-types and stages of development in plants and, perhaps, animals. [score:3]
Mature miR166 exhibits a complex spatiotemporal pattern of expression. [score:3]
This suggests that the post-transcriptional regulatory mechanism that limits the accumulation of miR166 in the stem cell-containing meristem tip also limits the accumulation of other miRNAs, perhaps acting as a general mechanism to limit miRNA -induced differentiation [17]. [score:2]
Along with in situ hybridization analyses, our results suggest that miR166 and miR390 accumulation is subject to complex tissue and cell-type specific transcriptional and post-transcriptional controls, allowing for functional diversification of miRNA gene family members in development. [score:2]
Accumulation of miR166 and miR390 within the SAM is regulated at the level of biogenesis and/or stability. [score:2]
The data also indicates that the complex pattern of miR166 accumulation results in part from the distinct transcriptional regulation of individual mir166 precursors. [score:2]
Interestingly, the abaxial-restricted accumulation of miR166 is regulated by the tas3 ta-siRNA pathway. [score:2]
Thus, organ polarity in leaves is ultimately achieved by regulating the spatial accumulation of both tas3-derived ta-siRNAs and miR166, which divide the small field of cells of the incipient primordium into adaxial and abaxial domains. [score:2]
Interestingly, mir166a precursor transcripts also accumulate in the tip of the SAM (Figure 2A and 2B). [score:1]
We therefore employed laser-microdissection (LM) [20]– [21] coupled to reverse-transcriptase PCR (LM-RT-PCR) as a technique to detect mir166 transcripts at cellular resolution [3]. [score:1]
Precursor transcripts of all nine mir166 genes accumulate in vegetative apices (Figure S1). [score:1]
The restricted accumulation of miR390 demarcates the adaxial most cells within developing leaves that produce tas3-derived ta-siRNAs, which in turn restrict the accumulation of miR166 to the abaxial side of leaf primordia [3]. [score:1]
For instance, mir166a precursor transcripts are detected in the SAM region and stem, whereas transcripts from mir166b accumulate in P2 and older leaf primordia (Figure 1C). [score:1]
LNA probes with sequences complementary to miR390, miR166, and murine miR122a were synthesized by Exiqon (Vedbaek, Denmark) and digoxigenin-labeled (Roche) according to the manufacturer's protocol. [score:1]
The maize genome contains at least nine mir166 loci, mir166a through mir166i, which have the potential to produce identical mature miR166 species (miRbase release 10.1). [score:1]
Specific mir166 Family Members Establish Leaf PolarityTo determine which mir166 genes act in the SAM to establish the abaxial-graded pattern of miR166 in the incipient leaf [3], [7] and therefore contribute to the specification of leaf polarity, we next microdissected precisely defined domains within the SAM. [score:1]
Likewise, tubulin6, mir166a, -f, and all tas3 transcripts were detectable in both the L1 and L2 layers (Figure 4B and 4D). [score:1]
Specific mir166 Family Members Establish Leaf Polarity. [score:1]
Transcripts of only a subset of mir166 family members are detected in the SAM. [score:1]
Sequences corresponding to the mir166a to mir166i precursors were retrieved from miRbase (http://microrna. [score:1]
To distinguish between these possibilities, we sought to localize individual mir166 precursor transcripts in discrete domains of the maize apex. [score:1]
The functional importance of tasiR-ARF and miR166 activity in specifying the adaxial and abaxial domains of the leaf suggests mechanisms exist to maintain the accuracy of their spatiotemporal localization. [score:1]
The hypothesis of miRNA movement from the L1 epidermal layer is intriguing, as it provides an appealing explanation for miR390's upstream role in defining the boundary between the adaxial and abaxial domains of leaves, and is consistent with an earlier hypothesis suggesting that mobility of ta-siRNA pathway components may generate the abaxial graded pattern of miR166 accumulation [3]. [score:1]
Expression of mir166a through mir166i was evaluated in cells captured from below the incipient leaf, the incipient primordium, as well as the tip of the SAM in which mature miR166 does not accumulate (Figure 2A). [score:1]
The lack of observable miR166 accumulation in this region raises the possibility that either the maturation and/or stability of this miRNA is compromised in these cells. [score:1]
Similar to our observations for mir166a, both mir390 precursor transcripts are detectable in the tip of the SAM, although mature miR390 does not accumulate in this domain (Figures 3A and 2B). [score:1]
To determine which mir166 genes act in the SAM to establish the abaxial-graded pattern of miR166 in the incipient leaf [3], [7] and therefore contribute to the specification of leaf polarity, we next microdissected precisely defined domains within the SAM. [score:1]
Cells were captured from regions in which miR166 accumulates [7], including: 1) the P2 and P3 developing leaf primordia; 2) the incipient leaf (P0) where polarity is established, the P1, and the region of tissue just below the SAM; 3) more developed P4-P6 primordia; and 4) stem tissue, which contains extensive vasculature (Figure 1A). [score:1]
The detection of mir166a transcripts in this domain is surprising, considering that mature miR166 is not detectable in this region by in situ hybridization using either a riboprobe [3], [7] or a highly-sensitive LNA -based probe (Figure 2C). [score:1]
As an initial analysis, we investigated the expression of a subset of mir166 genes in relatively broad domains of the maize apex (Figure 1). [score:1]
This data further supports the existence of functional diversification within the mir166 gene family and shows that a subset of mir166 precursor genes contributes to the abaxial accumulation of mature miR166 that is required for establishing abaxial fate. [score:1]
[1 to 20 of 63 sentences]
2
[+] score: 66
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR390b
The accumulation of miR166 in the early stage and the corresponding down-regulated expression of its target gene seen in our results indicate that it might play roles in transcriptional regulation in the embryogenesis of maize kernel. [score:9]
Detected expression levels of the unknown gene decreased significantly when the precursor of miR166 was expressed (Fig 1B), suggesting that miR166 can reduce the expression level of this unknown gene through interaction with the 3’-UTR region. [score:7]
Results show that miR159, miR166, miR171, and miR529 had relatively higher expression before the 10 [th] DAP, which corresponded to the deep-sequencing data, while their target genes had opposite expression trends, with more accumulation after the 14 [th] DAP (Fig 3A). [score:7]
To confirm the interaction between target genes and their cognate miRNAs in vivo, two miRNAs, miR166 and miR164 with higher expression in the early development of maize kernel were chosen. [score:6]
With the exception of miR166, whose expression did not vary across the four stages, and miR169, miR172, miR393, and miR395, which all had relatively more expression at the 6 [th] DAP, the others were consistent with the sequencing data (Fig 3). [score:5]
A total of 377 target genes were predicted from 165 miRNA families, the interaction between miR164, miR166 and their target genes were confirmed in vivo. [score:5]
miR166 was predicted to target basic-leucine zipper (bZIP) genes in maize [24], which could regulate many processes like seed maturation, stress signaling, and flowering timing [50]. [score:4]
Kang et al., also found that miR166 was highly expressed in developing seeds [50], but they did not reveal the exact stage. [score:3]
Target genes of miR159, miR166, miR171, and miR529 are transcription factors (S2 Table). [score:3]
Here, we found that miR166 had highest expression at the very early stage of seed maturity in Chang 7–2. [score:3]
In conclusion, conserved miRNA families that accumulate to higher levels during the early stage of maize seed development such as miR159, miR164, and miR166 might play roles by participating in transcriptional regulation and morphogenesis. [score:3]
In Arabidopsis, miR166/165 targets class III homeodomain leucine zipper (HD-ZIP III) transcription factors, which determine the fate of the shoot apical meristem (SAM), AGO10 acts as a decoy and sequesters miR166/165 from AGO1, thus preventing the silencing of the HD-ZIP III genes and resulting in defective SAM [28]. [score:3]
miR159, miR164, miR166, miR171, miR390, miR399, and miR529 families might play roles in the embryogenesis of maize grain by participating in transcriptional regulation and morphogenesis, while miR167 and miR528 families might play roles in the process of nutrient storage by participating in the metabolism process and stress response. [score:2]
We found that miR159, miR164, miR166, miR171, miR390, miR393, and miR529 families all accumulated to high levels during the very early stage of development (4–6 DAP), especially miR166. [score:2]
This differs from Zhengdan 958, the offspring of Zheng 58 (maternal parent) and Chang 7–2 (paternal parent), from which miR166 had higher accumulation after 25 DAP [72]. [score:1]
The target site of miR166 was located in the 3’-UTR of an uncharacterized gene (Unknown). [score:1]
The Agrobacterium tumefaciens (Agrobacterium) strain EHA105 was transformed with the constructs pCAMBIA 2300S: miR166, pCAMBIA 2300S: Unknown CDS, pCAMBIA 2300S: Unknown CDS+3’UTR, pCAMBIA 2300S: miR164, pCAMBIA 2300S: NAM CDS, pCAMBIA 2300S: GFP. [score:1]
Here we found that the target gene of miR166 was an uncharacterized gene. [score:1]
[1 to 20 of 18 sentences]
3
[+] score: 42
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR160e, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR529, zma-MIR390b
The target distributions of miRNA families themselves were investigated, which showed that zma-miR166, zma-miR396, zma-miR529, zma-miR164, and zma-miR169 had the most targets, with 6, 6, 5, and 5 target mRNAs, respectively, while zma-miR160, zma-miR390, zma-miR393, and zma-miR2275 had the fewest target mRNAs, with a single target each (Figure 3). [score:9]
Conversely, in V-372, members of 7 families—zma-miR164, zma-miR169, zma-miR393, zma-miR396, zma-miR399, zma-miR529, and zma-miR2275—were significantly up-regulated; and zma-miR156, zma-miR159, zma-miR166 and zma-miR395 families were significantly down-regulated. [score:7]
The expression of a class III homeodomain-leucine zipper (HD-Zip III) protein that functions in asymmetrical leaf development and that of a floral meristem transcription factor, APETALA2, responsible for meristem identity were found to be targeted by miR166 and miR172, respectively (Juarez et al., 2004). [score:6]
Members of the miR166 family generally participate in regulation of their target, HD-Zip III (homeodomain-leucine zipper III), which is engaged in lateral root development, initiation of axillary leaf meristems and leaf polarity (Boualem et al., 2008) (Figure 7). [score:5]
In tolerant genotype HKI-1532, 16 miRNAs belonging to the zma-miR159, zma-miR160, zma-miR164, zma-miR166, zma-miR169, zma-miR390, zma-miR395, zma-miR396, and zma-miR399 families were significantly up-regulated. [score:4]
m Rolled expressed zma-miR166-a,b,c,d,e,f,g,h,I,j,l gnl|GNOMON|15104054. [score:3]
m Rolled leaf1 zma-miR166-a,b,c,d,e,f,g,h,I,j,k,m,n,l gnl|GNOMON|54238013. [score:1]
m Partial zma-miR166-a,b,c,d,e,f,g,h,I,j,k,m,n,l gnl|GNOMON|35860043. [score:1]
In maize, it was reported that the leaf polarity was controlled by a subset of miR166 family members (Nogueira et al., 2009). [score:1]
MicroRNA166 controls root and nodule development in Medicago truncatula. [score:1]
m Tpa: homeobox lipid -binding domain family protein zma-miR166-a,b,c,d,e,f,g,h,I,j,k,m,n,l gnl|GNOMON|52446103. [score:1]
The miRNA families with the largest numbers of members included zma-miR166, zma-miR395 and zma-miR156, with 14, 14, and 12 members, respectively. [score:1]
m Wound responsive protein miR166 zma-miR166-a,b,c,d,e,f,g,h,I,j,k,l gnl|GNOMON|1168013. [score:1]
m Tpa: homeobox lipid -binding domain family protein zma-miR166-a,b,c,d,e,f,g,h,I,j,k,m,n,l gnl|GNOMON|8472093. [score:1]
[1 to 20 of 14 sentences]
4
[+] score: 36
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, zma-MIR444a, zma-MIR444b
A-K represented the expression profiles of some predicted target genes of miR156, miR164, miR166, miR167, miR168, miR169, miR319, miR393, miR408, miR528 and zma-miRn6 in dry and imbibed seeds, respectively. [score:5]
Previous studies indicated that miR166 regulated plant leaf morphogenesis, vascular development as well as lateral organ polarity and meristem formation, by targeting class III HOMEODOMAIN-LEUCINE ZIPPER (HD-ZIP III) transcription factors [62], [63]. [score:5]
These 17 targets were targets of 11 miRNA families (miR156, miR164, miR166, miR167, miR168, miR169, miR319, miR393, miR408, miR528 and zma-miRn6). [score:5]
Even they were significantly down-regulated in the imbibed seeds; there still were 342,738 and 282021 miRNA transcripts of miR156 and miR166, respectively, in the imbibed seeds. [score:4]
The 12 down-regulated miRNA families were miR156, miR159, miR164, miR166, miR167, miR168, miR169, miR172, miR319, miR393, miR394 and miR397. [score:4]
Whereas miR156 and miR166, although they both were down-regulated in imbibed seed only by 1.5 folds, their basal frequencies in dry seeds were 525,736 and 432,679, respectively, much higher than those of miR159, miR393 and miR394. [score:4]
The miR166 functions in acting on the asymmetry development of leaves in maize by regulating a class III homeodomain leucine zipper (HD-ZIPIII) protein [26]. [score:3]
Not only the miRNA156 and miRNA166 families were abundant in dry and imbibed seeds, but also they had more family members than any other miRNA families, suggesting the importance of these two miRNA families in dry and imbibed seeds. [score:1]
The largest miRNA family size identified was miR166 that consisted of 14 members and miR156/157, miR167 and miR169 possessed 12, 10 and 9 members, respectively; whereas miR162, miR529, miR827 and miR1432 had only one member detected in the maize seeds (Figure 4). [score:1]
MiR166 is the second most abundant miRNA in the dry seed and showed similar reduction in imbibed seed (from 432679 to 282021, by 1.5 fold). [score:1]
In dry seed, abundant miR166 also is needed to keep low activities of HD-ZIP III transcription factors. [score:1]
To validate conserved miRNAs identified and novel ones predicted, quantitative RT-PCR (qRT-PCR) was performed on 10 randomly selected miRNAs, miR156, miR159, miR166, miR167, miR319, miR408, miR528, zma-miRn6, zma-miRn15 and zma-miRn37 in dry and imbibed seed. [score:1]
The most abundant families were miR156/miR157, miR166, miR168 and miR528, and the least abundant families were miR162 and miR399 (Figure 3). [score:1]
[1 to 20 of 13 sentences]
5
[+] score: 28
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR528a, zma-MIR528b, zma-MIR827, zma-MIR390b, zma-MIR444a, zma-MIR444b
Expression levels of miR156, miR166, miR167, miR171 and miR827 decreased with the development of the embryo, but increased with the development of the endosperm, indicating that their functions are potentially involved in the switch from embryo to endosperm development (Figure 3b). [score:6]
It has been reported that miR166 positively controls the leaf polarity through downregulating its target, rld1, a class III homeodomain/leucine zipper TF in maize [56]. [score:6]
Meanwhile, lower and dynamic expression of five miR166 members during the developmental process of endosperm might be involved in the reserve filling (Figure 2a, Table S2). [score:4]
Another individual miRNA, miR166, was specifically expressed in the maize embryo at three stages, consistent with results in barely [47]. [score:3]
Six miRNA families zma-miR166, zma-miR156, zma-miR171, zma-miR167, zma-miR169 and zma-miR399 were predominantly expressed in maize kernel (Figure 2c, Table S2). [score:3]
These findings indicate that miR166 -mediated repression of transcription factors might be conserved for modulating cell differentiation during kernel development. [score:2]
MiR166 -targeted transcription factor gene rice Dof daily fluctuations 1 (RDD1) contributes to the increased grain productivity of rice via inducing the efficient uptake and accumulation of various nutrient ions [59]. [score:2]
Among them, miR166 was the most abundant family (17,602) followed by miR171 (11,988), miR827 (7686), miR167, miR396, miR528, miR156, miR408, miR160, miR390, miR159, miR444, miR319, miR398, miR168, miR394, miR164, miR393 and miR169 (Figure 3a). [score:1]
The MiR166/HD-ZIP III module participated in regulating cell differentiation in root and shoot apical meristems of Arabidopsis [57, 58]. [score:1]
[1 to 20 of 9 sentences]
6
[+] score: 24
These small RNAs then propagate (diffuse) into the adaxial side of the leaf, inhibiting the expression of miR166 either directly or through the ARF3 transcription factor. [score:6]
Possible targets of ta-siR2141/2 include members of the arf3 gene family (a transcription factor that is expressed abaxially), as well as members of the miR166 family [13]. [score:5]
Two of those, ta-siR2141/2, migrate into the adaxial side of the primordial leaf, where they inhibit miR166 (either directly or via ARF3). [score:4]
miR166 goes on to repress expression of HD-ZIPIII genes, which define adaxial fate. [score:3]
The target (either miR166 or ARF3) is transcribed uniformly throughout the leaf, and is localized to the cell where it is synthesized. [score:3]
The target, either miR166 or arf3, is transcribed uniformly throughout the leaf (green). [score:3]
[1 to 20 of 6 sentences]
7
[+] score: 22
Unlike Zma-miR156, Zma-miR166 family members exhibited similar expression patterns, but their dynamic expression status was likely the results of the transient expression of Zma-miR166a/b/f in kernel stages (Figure 2C). [score:7]
Despite different expression levels, Zma-miR166 family members showed similar expression trends: they were highly expressed in 0-, 3-, and 5-DAP kernels but not in endosperms. [score:7]
As predicted, a proportion of these conserved miRNAs exhibited temporal expression patterns in the kernels and endosperms, e. g., Zma-miR166 was predominantly expressed in 0-, 3-, and 5-DAP kernels, on average, and was ~8.7-fold higher than in 7, 10, 15 DAP endosperms. [score:5]
Among them, Zma-miR168, Zma-miR166, Zma-miR156, Zma-miR528, Zma-miR827, and Zma-miR167 were the top six most abundantly expressed miRNAs in both reciprocal crosses, corresponding to more than 98% of the total number of known miRNAs (Table S2, Figure 2A). [score:3]
[1 to 20 of 4 sentences]
8
[+] score: 21
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR171a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR390, osa-MIR444a, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1432, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR408b, zma-MIR528a, zma-MIR528b, zma-MIR827, zma-MIR1432, zma-MIR390b, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, zma-MIR444a, osa-MIR6251
[58, 67, 68], most of them showed different expression patterns upon exposure to light (Additional file 14) except (a) miR156, miR166, miR172, which showed almost identical expression curves, and (b) miR171 and miR390, which showed shifted expression patterns. [score:7]
For those miRNAs that showed similar expression patterns between maize and rice, i. e., miR156, miR166, miR168, miR172, miR2275 and miR528, GO enrichment analysis of their predicted targets was applied (Additional file 13). [score:5]
Similarly, expression levels of miR159 family, regulators of myeloblastosis (MYB) genes [41], and miR166 family, regulators of Homeodomain-Leucine zipper (HD- ZIP) transcription factor families [42], were also lower than control sample during de-etiolation process in maize, but higher than control sample in rice (Additional file 8). [score:5]
miR156, miR160, miR164, miR166, miR167, miR171, miR172, and miR390, had been earlier reported to play evolutionarily conserved roles in plant development [54]. [score:2]
The existence of one of the most conserved miRNA family, miR166, was estimated to date back to at least 400 million years old [66]. [score:1]
Many of them, i. e., miR156, miR160, miR164, miR166, miR167, miR171, miR172 and miR390, were suggested to play highly evolutionary conserved roles across plant species [54]. [score:1]
[1 to 20 of 6 sentences]
9
[+] score: 16
That is, they all (miR159 and its target with IAA; miR166, miR169, miR393, miR396, and their targets with ZR + iPA; miR159, miR396 and their targets with GA; miR396 and their targets with BR; miR159, miR396 and their targets with JA; miR160, miR164, miR166, miR169, miR172, and miR396 and their targets with ABA) showed a significant positive and/or negative correlation with the phytohormone levels. [score:13]
Eight known miRNAs (miR159, miR160, miR164, miR166, miR169, miR172, miR393, and miR396), four newly identified miRNAs, and 12 target genes were selected for qRT-PCR validation. [score:3]
[1 to 20 of 2 sentences]
10
[+] score: 15
Moreover, miRNAs of at least 2 times expression level higher in seeds were all from miR319, miR171 and miR166 family (Figure 3, Additional file 2), indicating the important roles of these miRNAs in seed development. [score:4]
A recent study reported that miR166 was sequestered by AGO10 to prevent its loading to AGO1, consequently several HD-ZIP III transcription factors were suppressed and this was critical for shoot apical meristem development [31]. [score:4]
MiR166 was predicted to target basic-leucine Zipper (bZIP) genes in maize [24], which could regulated many processes such as seed maturation, stress signalling and flower timing [50]. [score:3]
Both deep-sequencing and miRNA microarray suggested that miR319, miR166 and miR167 were highly expressed in the developing seeds. [score:3]
Most members of zma-miR171, zma-miR167 and zma-miR166 families not only had higher reads but the reads were higher in seeds (Figure 2). [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 14
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR169a, ath-MIR171a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR171a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR171b, ath-MIR171c, ath-MIR172c, ath-MIR172d, ath-MIR393a, ath-MIR393b, ath-MIR394a, ath-MIR394b, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, osa-MIR393a, osa-MIR394, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, osa-MIR528, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, ath-MIR827, osa-MIR529b, osa-MIR1432, osa-MIR169r, osa-MIR827, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
Overexpression of miR166a results in decreasing ATHB15 mRNA levels and causes accelerated vascular cell differentiation from cambial/procambial cells and consequently produces an altered vascular system with expanded xylem tissue and an interfascicular region [55]. [score:3]
The seed regions of the newly identified maize miRNAs t0002967, t0511822, t0207061, t0448353 and t0053880 were identical to those of ctr-miR171 and ctr-miR166, respectively, indicating that they may share the same targets. [score:3]
Previous studies indicated that MiRNA166 targets HD-ZIP transcription factors that are involved in plant leaf morphogenesis. [score:2]
This was also the case for some other miRNA families, such as zma-miR164 (from 14 read to 25,253 reads) and zma-miR166 (from 931 reads to 300,478 reads). [score:1]
For example, the majority of maize miRNAs were only sequenced less than 1,000 times, and some rare miRNAs were detected less than 10 times, whereas zma-miR167a, zma-miR166a, and zma-miR156a were detected 27,634, 300,503 and 374,492 times respectively (Additional file 2). [score:1]
Not only the miRNA166 and miRNA156 families were abundant during this stage of seed germination, but also they had more family members than other miRNA families, suggesting the importance of these two miRNA families at this very early stage of seed germination. [score:1]
The largest miRNA family size identified was miR166 that consisted of 14 members and miR156, miR169 and miR167 possessed 12, 12 and 10 members, respectively; whereas other miRNA families such as miR162, miR529, miR827 and miR1432 had only one member detected in this period. [score:1]
For example, miR156/157, miR159/319, miR166, miR169, and miR394 have been found in 51, 45, 41, 40 and 40 plant species, respectively [36- 38]. [score:1]
In our datasets, miRNA166 showed the highest abundance followed by miRNA156 and miRNA528, respectively, during the very early stage of seed germination. [score:1]
[1 to 20 of 9 sentences]
12
[+] score: 11
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR171a, osa-MIR393a, osa-MIR397a, osa-MIR397b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR319b, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169f, osa-MIR171b, osa-MIR171c, osa-MIR171d, osa-MIR171e, osa-MIR171f, osa-MIR171g, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR393b, osa-MIR172d, osa-MIR171i, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319b, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169f, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, osa-MIR529a, tae-MIR159a, tae-MIR159b, tae-MIR171a, tae-MIR1120a, osa-MIR1430, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR166n, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR397a, zma-MIR397b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, hvu-MIR168, hvu-MIR171, hvu-MIR397a, tae-MIR171b, hvu-MIR1120, hvu-MIR166b, osa-MIR3981, hvu-MIR166c, tae-MIR1120b, tae-MIR397, tae-MIR1120c, hvu-MIR397b, hvu-MIR156b
The highest expression level of pre-miR166n detected in 1-week-old plants corresponded to the lowest level of mature miR166 observed in the same growth stage. [score:3]
MIR166n generates two transcripts with heterogeneous, developmentally specific 5′ endsThe detailed structure of the MIR166n gene and its pre-miRNA are shown in Figure 3A and B. miR166 is represented by a very large gene family in both monocot and dicot plants. [score:2]
The level of the mature miR166 reached its highest level in 2-week-old plants. [score:1]
However, despite the identical sequences of mature miR166b and miR166n species, the nucleotide sequences of their pre-miRNAs are different, confirming that the miR166n described in this paper is a novel member of the miR166 family in barley. [score:1]
In Arabidopsis, the miR166 family consists of seven members [3, 8], whereas in both rice and maize, 14 miR166s were annotated [3, 4, 57, 60, 61]. [score:1]
Concerning the barley miR166 family, so far only three members, including miR166a, b and c, have been annotated in miRBase (release 19) among which only miR166b has been experimentally confirmed [48]. [score:1]
The detailed structure of the MIR166n gene and its pre-miRNA are shown in Figure 3A and B. miR166 is represented by a very large gene family in both monocot and dicot plants. [score:1]
In general, our observations show that the miR166 level fluctuates when various developmental stages are compared (Figure 3E). [score:1]
[1 to 20 of 8 sentences]
13
[+] score: 9
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR1432
The expression patterns of miRNAs from the miR166, miR167, miR169, and miR399 families were not completely uniform. [score:3]
Combined analyses indicated that the regulation of the miRNA families miR166, miR167, miR169, miR396, and miR399 might be involved in maize tissues and stress responses. [score:2]
Previous results indicated that miR166 controls development of the shoot apical meristem in Arabidopsis (Zhu et al., 2011), the nodule in Medicago truncatula (Boualem et al., 2008), and cell wall thickening in bast during the elongation phase in ramie (Wang et al., 2014). [score:2]
miR166, miR167, miR169, and miR396 also responded to RBSDV in rice leaves and roots (Sun et al., 2014). [score:1]
In the third group of miRNAs, members within five known miRNA families (miR166, miR167, miR169, miR396, and miR399) increased or decreased at the same time. [score:1]
[1 to 20 of 5 sentences]
14
[+] score: 8
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR171a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR408, osa-MIR172d, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR408a, zma-MIR156k, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR1432, zma-MIR156l, zma-MIR166n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR408b, zma-MIR482, zma-MIR1432, osa-MIR395x, osa-MIR395y
The miR166 has been found to target a class III homeodomain leucine zipper (HD-ZIPIII) protein that acts on the asymmetry development of leaves in maize [30]. [score:4]
For example, zma-miR168a, b and zma-miR166a had a very high abundance in the two mixed tissues and the endosperm while they could not be detected in the embryo library, which indicates that they may be endosperm specific. [score:1]
First, zma-miR166b, c, d, e, h, and i are annotated as 22-nt (UCGGACCAGGCUUCAUUCCCC), while zma-miR166a is annotated as 21-nt (UCGGACCAGGCUUCAUUCCC). [score:1]
The 21-nt form is nearly one hundred times more abundant than that of 22-nt, therefore we concluded that zma-miR166b, c, d, e, h and i should have the same mature miRNA of 21-nt as zma-miR166a. [score:1]
For example, there are two variants for miR166 in the current miRBase. [score:1]
[1 to 20 of 5 sentences]
15
[+] score: 7
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR397a, osa-MIR397b, osa-MIR398a, osa-MIR398b, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR171b, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR156k, zma-MIR160f, tae-MIR159a, tae-MIR159b, tae-MIR160, tae-MIR164, tae-MIR167a, tae-MIR1127a, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2275a, osa-MIR2275b, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, hvu-MIR156a, tae-MIR156, hvu-MIR159b, hvu-MIR159a, hvu-MIR166a, tae-MIR167b, hvu-MIR168, hvu-MIR169, tae-MIR169, hvu-MIR397a, tae-MIR398, tae-MIR171b, hvu-MIR166b, hvu-MIR166c, osa-MIR2275c, osa-MIR2275d, tae-MIR1122b, tae-MIR9653a, tae-MIR9654a, tae-MIR9656, tae-MIR9657a, tae-MIR9659, tae-MIR9660, tae-MIR1127b, tae-MIR9661, tae-MIR396, tae-MIR9665, tae-MIR2275, tae-MIR9667, tae-MIR167c, tae-MIR1120b, tae-MIR397, tae-MIR1130b, tae-MIR5384, tae-MIR9675, tae-MIR1120c, tae-MIR9679, tae-MIR9657b, hvu-MIR397b, hvu-MIR156b, tae-MIR9653b
Four of the 15 known miRNA families, including miR169, miR166, miR164 and miR160 were preferentially expressed in the developing seeds with the logarithm of the fold changes of 0.3 ~ 3.0. [score:3]
Of the 15 known miRNA families, 4 (miR169, miR166, miR164 and miR160) were preferentially expressed in the developing seeds (with the logarithm of the fold changes of 0.3 ~ 3.0 in the developing seeds, more than those in the flag leaves) (Figure  3a, Table  2). [score:3]
The highest read abundance (approximately 238,000 RPM) was detected in the miR168 family and was 3.8 to 78 times more abundant than the other miRNA families, including miR156, miR166, miR167 and miR172, whose abundance ranged from about 2,900 RPM to 62,000 RPM (Table  2). [score:1]
[1 to 20 of 3 sentences]
16
[+] score: 6
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, zma-MIR171d, zma-MIR171f, zma-MIR394a, zma-MIR394b, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR319a, zma-MIR319c, zma-MIR319b, zma-MIR319d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR408a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR397a, zma-MIR397b, zma-MIR398a, zma-MIR398b, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR482, zma-MIR528a, zma-MIR528b, zma-MIR529, zma-MIR827, zma-MIR1432, zma-MIR444a, zma-MIR444b
The same trend is observed in many other miRNA families including miR164, miR166, miR169, miR171, miR172, miR319 and miR396 as they target various families of transcription factors such as NAM (No Apical Meristem) proteins, bZIP (basic-leucine Zipper) genes, CBF (CCAAT binding factor), GRAS transcription factor, AP2 (APETALA2)-EREBP (Ethylene-Responsive Element Binding Proteins), CCCH type zinc finger protein and TCP (Teosinite branched, Cycloidea, and PCF), GRF transcription factor families respectively [12], [71], [85]– [87]. [score:3]
These families are: miR156, miR160, miR164, miR166, miR167, miR172, miR396, and miR528. [score:1]
Clusters of two members of miR166 are also observed in several plant species, including moss [33]– [37]. [score:1]
However, a subset of these was found as unusually compact clusters, with less than 2000nt separating adjacent genes, as shown in Table 2. Two members of the miRNA156 family (miR156b and miR156c) on chromosome 3 are separated by less than 200nt, as are two members of the miRNA166 family on chromosome 5. The close distance of miR156b and miR156c is observed in several monocots and they are transcribed as one transcript (polycistronic) in maize [24] and rice [35]. [score:1]
[1 to 20 of 4 sentences]
17
[+] score: 6
Other miRNAs from this paper: zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR171a, zma-MIR171b, zma-MIR171d, zma-MIR171f, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR171c, zma-MIR171j, zma-MIR171e, zma-MIR171i, zma-MIR171g, zma-MIR166l, zma-MIR166m, zma-MIR171k, zma-MIR171h, zma-MIR393a, zma-MIR156k, zma-MIR160f, zma-MIR396c, zma-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR171l, zma-MIR171m, zma-MIR171n, zma-MIR390a, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR528a, zma-MIR528b, zma-MIR827
Another miRNA down-regulated in GP, miR166, influences establishment of adaxial/abaxial leaf polarity in maize, and regulates shoot apical meristem and floral development in Arabidopsis [43]– [45]. [score:6]
[1 to 20 of 1 sentences]
18
[+] score: 5
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR169a, osa-MIR393a, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR393b, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, osa-MIR444a, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR166l, zma-MIR166m, zma-MIR393a, zma-MIR156k, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR820a, osa-MIR820b, osa-MIR820c, osa-MIR1425, osa-MIR1428a, osa-MIR169r, osa-MIR444b, osa-MIR444c, osa-MIR444d, osa-MIR444e, osa-MIR444f, osa-MIR1428b, osa-MIR1428c, osa-MIR1428d, osa-MIR1428e, osa-MIR1874, osa-MIR2055, osa-MIR827, osa-MIR1428f, osa-MIR1428g, zma-MIR396d, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR393b, zma-MIR393c, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR827, osa-MIR395x, osa-MIR395y, zma-MIR444a, zma-MIR444b
The functional significance for expressing tandem array of similar miRNAs is not clear, but it has been shown for the rice/maize miR156 and the Medicago miR166. [score:3]
In the case of the tandem miR166 gene in Medicago truncatula it was shown that it is important for the control of root architecture [40]. [score:1]
These correspond to miR156 and miR395 in rice and maize [37- 39] and miR166 in Medicago truncatula [40]. [score:1]
[1 to 20 of 3 sentences]
19
[+] score: 5
Plant miRNAs are described that function in the ARGONAUTE1-directed regulation of leaf initiation and polarity, including miR166, and miR156 (reviewed in [73], [74]). [score:3]
Genetic analyses have identified several maize genes involved in these SAM functions, including those required for leaf initiation and phyllotaxy (terminal ear1 and aberrant phyllotaxy1), proximodistal patterning (rs2 and semaphore1), mediolateral development (narrow sheath1&2, ragged seedling2, wavy auricle in blade1), and adaxial-abaxial patterning (rolled1, miR166, leafbla deless1, milkweed pod1) [11], [8], [12]– [19]. [score:2]
[1 to 20 of 2 sentences]
20
[+] score: 4
miR168 was the most abundant family, followed by miR166. [score:1]
In the identified miRNA families (Fig 2), miR166 consisted of 14 members, miR156 and miR167 had 12 and 10 members, respectively, and miR162, miR529, miR827 and miR1432 had only one member. [score:1]
0164026.g002 Fig 2 miR166 consisted of 14 members, miR156 and miR167 had 12 and 10 members, respectively, and miR162, miR529, miR827 and miR1432 had only one member. [score:1]
miR166 consisted of 14 members, miR156 and miR167 had 12 and 10 members, respectively, and miR162, miR529, miR827 and miR1432 had only one member. [score:1]
[1 to 20 of 4 sentences]
21
[+] score: 4
Recently, 25 miRNA decoys from Arabidopsis and 94 miRNA decoys from rice were identified; overexpressing the decoys of miR160 and miRNA166 can alter plant development, indicating that ncRNAs, short ORF encoding genes and intergenic sequences acting as miRNA decoys are functional in plants [41]. [score:4]
[1 to 20 of 1 sentences]
22
[+] score: 3
The mature form of miR166 is 22 nt while its precursors are ∼100 nt and seen near the top of the gel. [score:1]
These data show that the majority of CentC RNAs are discretely-sized, but much longer than micro or siRNAs (compare to miR166 at 22 nt; Figure 7A). [score:1]
Radiolabeled RNA probes specific to microRNA166 (miR166) [55] and CentC forward (GenBank AY530283.1) and reverse strands were hybridized in succession. [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 3
Other miRNAs from this paper: ath-MIR156a, ath-MIR156b, ath-MIR156c, ath-MIR156d, ath-MIR156e, ath-MIR156f, ath-MIR159a, ath-MIR160a, ath-MIR160b, ath-MIR160c, ath-MIR162a, ath-MIR162b, ath-MIR164a, ath-MIR164b, ath-MIR166a, ath-MIR166b, ath-MIR166c, ath-MIR166d, ath-MIR166e, ath-MIR166f, ath-MIR166g, ath-MIR167a, ath-MIR167b, ath-MIR168a, ath-MIR168b, ath-MIR169a, ath-MIR172a, ath-MIR172b, ath-MIR159b, osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR160a, osa-MIR160b, osa-MIR160c, osa-MIR160d, osa-MIR162a, osa-MIR164a, osa-MIR164b, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR169a, ath-MIR167d, ath-MIR169b, ath-MIR169c, ath-MIR169d, ath-MIR169e, ath-MIR169f, ath-MIR169g, ath-MIR169h, ath-MIR169i, ath-MIR169j, ath-MIR169k, ath-MIR169l, ath-MIR169m, ath-MIR169n, ath-MIR172c, ath-MIR172d, ath-MIR395a, ath-MIR395b, ath-MIR395c, ath-MIR395d, ath-MIR395e, ath-MIR395f, ath-MIR396a, ath-MIR396b, ath-MIR399a, ath-MIR399b, ath-MIR399c, ath-MIR399d, ath-MIR399e, ath-MIR399f, osa-MIR395b, osa-MIR395d, osa-MIR395e, osa-MIR395g, osa-MIR395h, osa-MIR395i, osa-MIR395j, osa-MIR395k, osa-MIR395l, osa-MIR395s, osa-MIR395t, osa-MIR395c, osa-MIR395a, osa-MIR395f, osa-MIR395u, osa-MIR396a, osa-MIR396b, osa-MIR396c, osa-MIR399a, osa-MIR399b, osa-MIR399c, osa-MIR399d, osa-MIR399e, osa-MIR399f, osa-MIR399g, osa-MIR399h, osa-MIR399i, osa-MIR399j, osa-MIR399k, ath-MIR408, ath-MIR156g, ath-MIR156h, ath-MIR159c, ath-MIR164c, ath-MIR167c, ath-MIR172e, osa-MIR156k, osa-MIR156l, osa-MIR159a, osa-MIR159b, osa-MIR159c, osa-MIR159d, osa-MIR159e, osa-MIR159f, osa-MIR160e, osa-MIR160f, osa-MIR162b, osa-MIR164c, osa-MIR164d, osa-MIR164e, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR169b, osa-MIR169c, osa-MIR169d, osa-MIR169e, osa-MIR169f, osa-MIR169g, osa-MIR169h, osa-MIR169i, osa-MIR169j, osa-MIR169k, osa-MIR169l, osa-MIR169m, osa-MIR169n, osa-MIR169o, osa-MIR169p, osa-MIR169q, osa-MIR172a, osa-MIR172b, osa-MIR172c, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR171h, osa-MIR408, osa-MIR172d, osa-MIR167j, osa-MIR166m, osa-MIR166j, osa-MIR164f, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR160a, zma-MIR160c, zma-MIR160d, zma-MIR160b, zma-MIR164a, zma-MIR164d, zma-MIR164b, zma-MIR164c, zma-MIR169a, zma-MIR169b, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR160e, zma-MIR162, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, zma-MIR172a, zma-MIR172d, zma-MIR172b, zma-MIR172c, osa-MIR396e, zma-MIR395b, zma-MIR395c, zma-MIR395a, zma-MIR396b, zma-MIR396a, zma-MIR399a, zma-MIR399c, zma-MIR399b, zma-MIR399d, zma-MIR399e, zma-MIR399f, zma-MIR156j, zma-MIR159a, zma-MIR159b, zma-MIR159c, zma-MIR159d, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR169c, zma-MIR169f, zma-MIR169g, zma-MIR169h, zma-MIR169i, zma-MIR169k, zma-MIR169j, zma-MIR169d, zma-MIR169e, zma-MIR172e, zma-MIR166l, zma-MIR166m, zma-MIR171h, zma-MIR408a, zma-MIR156k, zma-MIR160f, osa-MIR529a, osa-MIR395m, osa-MIR395n, osa-MIR395o, osa-MIR395p, osa-MIR395q, osa-MIR395v, osa-MIR395w, osa-MIR395r, osa-MIR529b, osa-MIR169r, osa-MIR396f, zma-MIR396c, zma-MIR396d, osa-MIR2118a, osa-MIR2118b, osa-MIR2118c, osa-MIR2118d, osa-MIR2118e, osa-MIR2118f, osa-MIR2118g, osa-MIR2118h, osa-MIR2118i, osa-MIR2118j, osa-MIR2118k, osa-MIR2118l, osa-MIR2118m, osa-MIR2118n, osa-MIR2118o, osa-MIR2118p, osa-MIR2118q, osa-MIR2118r, osa-MIR2275a, osa-MIR2275b, zma-MIR2118a, zma-MIR2118b, zma-MIR2118c, zma-MIR2118d, zma-MIR2118e, zma-MIR2118f, zma-MIR2118g, zma-MIR2275a, zma-MIR2275b, zma-MIR2275c, zma-MIR2275d, osa-MIR396g, osa-MIR396h, osa-MIR396d, zma-MIR156l, zma-MIR159e, zma-MIR159f, zma-MIR159g, zma-MIR159h, zma-MIR159i, zma-MIR159j, zma-MIR159k, zma-MIR160g, zma-MIR164e, zma-MIR164f, zma-MIR164g, zma-MIR164h, zma-MIR166n, zma-MIR167j, zma-MIR169l, zma-MIR169m, zma-MIR169n, zma-MIR169o, zma-MIR169p, zma-MIR169q, zma-MIR169r, zma-MIR395d, zma-MIR395e, zma-MIR395f, zma-MIR395g, zma-MIR395h, zma-MIR395i, zma-MIR395j, zma-MIR395k, zma-MIR395l, zma-MIR395m, zma-MIR395n, zma-MIR395o, zma-MIR395p, zma-MIR396e, zma-MIR396f, zma-MIR396g, zma-MIR396h, zma-MIR399g, zma-MIR399h, zma-MIR399i, zma-MIR399j, zma-MIR408b, zma-MIR529, osa-MIR395x, osa-MIR395y, osa-MIR2275c, osa-MIR2275d, ath-MIR156i, ath-MIR156j
The six most abundantly expressed miRNA families were miR166, miR168, miR167, miR156, miR159, and miRs6. [score:3]
[1 to 20 of 1 sentences]
24
[+] score: 3
Prigge and Clark [73], and Floyd and Bowman [75] have previously suggested that HD-Zip III sequences across all land plants produce transcripts that could be targeted by miRNA165 and miRNA166. [score:3]
[1 to 20 of 1 sentences]
25
[+] score: 3
For conserved miRNAs, we identified a total of 72 target mRNAs that had at least one degradome tag matching the corresponding cleavage sits, for MIR166a/b/c/d/g/h/I, MIR169s, MIR172b/c/d, MIR395s, MIR408, and MIR408b (data not shown). [score:3]
[1 to 20 of 1 sentences]
26
[+] score: 3
By comparing the positions of candidate gene and QTL, zma-MIR166i(P5)was found to co-localize with the peaks of the QTL ph1-3. The accumulation of zma-miR166 under submergence stress could modulate hormone homeostasis via regulating transcripts of HD-ZIP, ARF and GAMYB and then trigger adventitious root formation and lateral root development [24]. [score:3]
[1 to 20 of 1 sentences]
27
[+] score: 2
Other miRNAs from this paper: osa-MIR156a, osa-MIR156b, osa-MIR156c, osa-MIR156d, osa-MIR156e, osa-MIR156f, osa-MIR156g, osa-MIR156h, osa-MIR156i, osa-MIR156j, osa-MIR166a, osa-MIR166b, osa-MIR166c, osa-MIR166d, osa-MIR166e, osa-MIR166f, osa-MIR167a, osa-MIR167b, osa-MIR167c, osa-MIR156k, osa-MIR156l, osa-MIR166k, osa-MIR166l, osa-MIR167d, osa-MIR167e, osa-MIR167f, osa-MIR167g, osa-MIR167h, osa-MIR167i, osa-MIR168a, osa-MIR168b, osa-MIR166g, osa-MIR166h, osa-MIR166i, osa-MIR167j, osa-MIR166m, osa-MIR166j, zma-MIR156d, zma-MIR156f, zma-MIR156g, zma-MIR156b, zma-MIR156c, zma-MIR156e, zma-MIR156a, zma-MIR156h, zma-MIR156i, zma-MIR167a, zma-MIR167b, zma-MIR167d, zma-MIR167c, zma-MIR166h, zma-MIR166e, zma-MIR166i, zma-MIR166f, zma-MIR166g, zma-MIR166b, zma-MIR166c, zma-MIR166d, gma-MIR156d, gma-MIR156e, gma-MIR156c, gma-MIR166a, gma-MIR166b, gma-MIR167a, gma-MIR167b, gma-MIR168a, gma-MIR156a, gma-MIR156b, zma-MIR156j, zma-MIR166k, zma-MIR166j, zma-MIR167e, zma-MIR167f, zma-MIR167g, zma-MIR167h, zma-MIR167i, zma-MIR168a, zma-MIR168b, zma-MIR166l, zma-MIR166m, zma-MIR156k, osa-MIR535, gma-MIR167c, gma-MIR1507a, gma-MIR167d, gma-MIR1507b, gma-MIR167e, gma-MIR167f, zma-MIR156l, zma-MIR166n, zma-MIR167j, gma-MIR167g, gma-MIR156f, gma-MIR156g, gma-MIR156h, gma-MIR156i, gma-MIR166c, gma-MIR166d, gma-MIR166e, gma-MIR166f, gma-MIR166g, gma-MIR166h, gma-MIR168b, gma-MIR1507c, gma-MIR167h, gma-MIR167i, gma-MIR3522, gma-MIR156j, gma-MIR156k, gma-MIR156l, gma-MIR156m, gma-MIR156n, gma-MIR156o, gma-MIR166i, gma-MIR166j, gma-MIR167j, gma-MIR156p, gma-MIR156q, gma-MIR156r, gma-MIR156s, gma-MIR166k, gma-MIR156t, gma-MIR166l, gma-MIR166m, gma-MIR156u, gma-MIR156v, gma-MIR156w, gma-MIR156x, gma-MIR156y, gma-MIR156z, gma-MIR156aa, gma-MIR156ab, gma-MIR166n, gma-MIR166o, gma-MIR166p, gma-MIR166q, gma-MIR166r, gma-MIR166s, gma-MIR166t, gma-MIR166u, gma-MIR167k, gma-MIR167l
Nipponbare) was probed for corn miR168 sequence (Panel A); soybean miR168 sequence (Panel B), or miR166 (Panel C). [score:1]
The plant miRNAs used in the search include miR156, miR166, miR167, miR168, miR535 and miR3522. [score:1]
[1 to 20 of 2 sentences]
28
[+] score: 2
These miRNAs increased as the embryos were dedifferentiated into calli, with the exception of miR166 and miR167 that decreased. [score:1]
They identified miR528, miR156, miR166, miR168, miR390, miR164, miR167, miR398, miR397, miR408, and miR319 as the most abundant during dedifferentiation. [score:1]
[1 to 20 of 2 sentences]
29
[+] score: 2
For instance, Juarez et al. showed miR166 constituted a highly conserved signal in maize leaf development [23]. [score:2]
[1 to 20 of 1 sentences]
30
[+] score: 1
As shown in Fig.   4A–E, the levels of all five tested maize miRNAs (zma-miR164a-5p, zma-miR166a-3p, zma-miR167e-5p, zma-miR168a-5p and zma-miR319a-3p) gradually increased after one meal of fresh maize, reaching peak values at 6 or 12 hours within the first 24 hours. [score:1]
[1 to 20 of 1 sentences]
31
[+] score: 1
The nine families comprised miR156, miR166, miR167, miR171, miR396, miR398, miR408, miR444, and miR827. [score:1]
[1 to 20 of 1 sentences]
32
[+] score: 1
The abundance of extremely conserved miRNAs has been determined, such as miR156, miR159, miR164, miR166, miR167, miR168, and miR398, which was very similar to previous reports (Zhao et al., 2013). [score:1]
[1 to 20 of 1 sentences]
33
[+] score: 1
However, even though LBL1 is necessary for the proper spatiotemporal pattern of miR166 accumulation [17], its levels overall appear not significantly changed in the mutant. [score:1]
[1 to 20 of 1 sentences]
34
[+] score: 1
In the maize hybrid Yuyu22, miR167 was predominantly activated, whereas miR156, miR160, miR164 and miR166 were either dominantly or predominantly repressed. [score:1]
[1 to 20 of 1 sentences]