sort by

26 publications mentioning gga-mir-1b

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-1b. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 160
miRNA -mediated negative regulation of target mRNAs is important for myogenic differentiation of C2C12 myoblasts, and the sustained expression of some miR-1/206 targets results in the activation of non-myogenic programs (Goljanek-Whysall et al., 2012b). [score:8]
These results indicate that, following myotome formation and myoblast commitment, miR-133 and miR-1/206 negatively regulate BAF60a and BAF60b variants by preventing the translation of residual transcripts expressed in progenitors at earlier developmental stages. [score:7]
Mouse BAF60a and BAF60b expression vectors (MRC Geneservice) and GFP plasmid were used for targeted misexpression in vivo at a ratio of 5:1. Mouse NIH3T3 cells in DMEM, 10% FBS, 1% pen/strep were transfected with miR-206, miR-1 or miR-133 (50 nM; Sigma) with and without antimiRs (100 nM; Ambion) using Lipofectamine 2000. [score:7]
The function of miR-133 or miR-1/miR-206 was inhibited by injection of specific antagomirs into somites of HH14-15 embryos, which were analyzed after 24 h. Northern blots of pooled somites showed that antagomir-133 inhibited miR-133 expression (supplementary material Fig. S4A). [score:7]
To examine the regulation of endogenous BAF60a and BAF60b transcripts by miRNAs in a physiological context and in a different species we used mouse NIH3T3 cells, which express all BAF60 variants (supplementary material Fig. S3B), but do not express the myomiRs miR-133, miR-1 or miR-206. [score:6]
Similarly, co-transfection of a BAF60b sensor with miR-1 or miR-206 led to downregulation of luciferase expression compared with controls. [score:5]
Simultaneous inhibition of both miR-1 and miR-206 led to a significant number of embryos with complete loss of myogenin expression (Fig.  4B, third column). [score:5]
Co-transfection of miR-133, miR-1 or miR-206 led to downregulation of luciferase expression compared with controls. [score:5]
In vertebrate embryos, miR-206 expression is restricted to skeletal myoblasts in somites, limb buds and head muscles, whereas miR-1 and miR-133 are expressed in developing skeletal muscle and heart (Darnell et al., 2006; Sweetman et al., 2006, 2008). [score:5]
Chicken BAF60a and BAF60b 3′UTR sensor constructs containing target sites for either miR-133 or miR-1/206 were efficiently targeted by miR-133 or miR-1/206 (Fig.  3C; supplementary material Fig. S3C). [score:5]
We identify the chromatin remo deling factor BAF60a as an important target for miR-133 and show that BAF60b is an important target for miR-1/206, not only in myogenic C2C12 cells (Goljanek-Whysall et al., 2012b) but also in embryonic myoblasts in developing somites. [score:5]
We previously used this approach to uncover a requirement for miR-206 and, to a lesser degree, for miR-1 activity for Pax3 downregulation in the somite myotome, which ensures the timely transition of myogenic progenitor to committed myoblast (Goljanek-Whysall et al., 2011). [score:4]
Here, we reveal the expression of BAF60 variants in embryonic somites and uncover the negative regulation of BAF60a and BAF60b by the myomiRs miR-1/206 and miR-133 during the commitment and differentiation of embryonic myoblasts. [score:4]
Fig. 3. miR-133 and miR-1/206 regulate the expression of BAF60a and BAF60b variants. [score:4]
Inhibition of miR-1 or miR-206 at this stage led to partial loss of myogenin expression in the majority of embryos as compared with the contralateral control (Fig.  4A,B). [score:4]
Regulation of multiple target genes by miR-1 and miR-206 is pivotal for C2C12 myoblast differentiation. [score:4]
In somites and C2C12 myoblasts, MRFs regulate miR-1, miR-206 and miR-133 expression (Rao et al., 2006; Rosenberg et al., 2006; Sweetman et al., 2008). [score:4]
Zebrafish miR-1 and miR-133 shape muscle gene expression and regulate sarcomeric actin organization. [score:4]
To test whether BAF60a and BAF60b are directly targeted by miR-133 and by miR-1 or miR-206 respectively, sensor constructs were generated with 3′UTR fragments containing putative miRNA binding sites downstream of luciferase (Fig.  3C). [score:4]
Specific antagomirs inhibiting miR-133 or miR-1/206 were injected into somites on one side of the embryo at HH14-15. [score:3]
Inhibition of miR-133 or miR-1/miR-206 abrogates myogenesis and alters BAF/Brg1 subunit composition. [score:3]
We previously showed that antagomir-1 or antagomir-206 specifically inhibits miR-1 or miR-206, respectively (Goljanek-Whysall et al., 2011). [score:3]
In situ hybridization shows that miR-1, miR-206 and miR-133 are expressed in the myotome (Fig.  3B; see also Goljanek-Whysall et al., 2011; Sweetman et al., 2008). [score:3]
The seed sequences of miR-1 and miR-206, which are identical, are complementary to the predicted target site in the chicken BAF60b 3′UTR. [score:3]
Finally, we examined whether increased BAF60a and BAF60b protein levels, after antagomir -mediated inhibition of miR-133 or miR-1/206, altered the composition of BAF/Brg1 complexes. [score:3]
Similarly, miR-1/206 transfection resulted in lower levels of endogenous BAF60b expression without affecting BAF60a or BAF60c. [score:3]
Specific requirements of MRFs for the expression of muscle specific microRNAs, miR-1, miR-206 and miR-133. [score:3]
This indicates species-specific differences and suggests the presence of non-canonical miR-1/206 target sites in mouse and human. [score:3]
BAF60b variant was elevated after miR-1/miR-206 inhibition. [score:3]
Expression of BAF60c was unaffected by miR-133 or miR-1/206 (supplementary material Fig. S3B). [score:3]
Mutant constructs had BamHI or SalI sites within miR-1/206 or miR-133 target sites. [score:3]
Inhibition of both miR-1 and miR-206 with antagomirs led to an increase in the amount of BAF60b protein that interacted with Brg1, when compared with the non -injected somites. [score:2]
We show here for the first time that the amount of BAF60a and BAF60b variants bound to Brg1 decreases during somite differentiation, and our experiments suggest that negative post-transcriptional regulation, mediated by miR-1/206 and miR-133, is necessary for the timely progression of myogenic differentiation. [score:2]
Transfection with miR-1 or miR-206 or both miRNAs led to reduced BAF60b protein compared with control cells, and co-transfection with antimiR-206, which inhibits both miR-1 and miR-206 (Goljanek-Whysall et al., 2011), restored BAF60b protein levels to that of controls (Fig.  3D). [score:2]
Here, using complementary in vitro and in vivo assays, we identified BAF60a and BAF60b as key targets of the myomiRs miR-1/206 and miR-133 during initiation of the myogenic differentiation program in embryogenesis. [score:2]
These data suggest that miR-133, miR-1 and miR-206 affect the composition of BAF/Brg1 chromatin remo deling complexes through post-transcriptional regulation of BAF60a and BAF60b variants during somite differentiation. [score:2]
In developing embryos, miR-1 and miR-206 have been shown to facilitate myogenic differentiation through negative regulation of the paired-box transcription factor Pax3 in myogenic progenitor cells (Goljanek-Whysall et al., 2011). [score:2]
microRNA-1 and microRNA-206 regulate skeletal muscle satellite cell proliferation and differentiation by repressing Pax7. [score:2]
The effect of miR-133 or a combination of miR-1 and miR-206 on transcript levels of all BAF60 variants was also examined by qPCR. [score:1]
The number and position of complementary nucleotides outside the seed sequence vary between species and between miR-1 and miR-206, as these miRNAs differ outside the seed. [score:1]
A putative binding site for miR-1 or miR-206 was found in the 3′UTR of the BAF60b gene, but here the seed sequence is less well conserved between the three species (Fig.  3A). [score:1]
The present study extends this work to assess the role of the miR-1/206 and miR-133 cluster in later somite differentiation (HH14-15). [score:1]
Members of the miR-1/206 family are produced from the same primary transcripts as members of the miR-133 family. [score:1]
In skeletal muscle, two highly conserved miRNA families, miR-1/206 and miR-133, play important roles in proliferation, differentiation and cell fate specification; therefore, they have been termed myomiRs (McCarthy, 2008; van Rooij et al., 2008). [score:1]
In embryonic stem cells (ESCs), miR-1 and miR-133 promote mesoderm differentiation (Ivey et al., 2008), and transcriptomic analyses in zebrafish have revealed their importance for sarcomeric actin organization (Mishima et al., 2009). [score:1]
In human and mouse BAF60b 3′UTR, fewer nucleotides are complementary to the miR-1 or miR-206 seed sequence, suggesting a non-canonical binding site where nucleotides outside the seed compensate. [score:1]
Transfection with miR-1 or miR-206 or both led to reduced BAF60b protein levels; co-transfection of miRNAs with the relevant antimiR restored BAF60b protein levels to that of mock transfected controls. [score:1]
Furthermore, PCR experiments showed that antagomir-1 and antagomir-206 led to loss of miR-1 and miR-206, but had no effect on miR-133, and antagomir-133 specifically affected miR-133 and had no effect on miR-1 or miR-206 (supplementary material Fig. S4B,C). [score:1]
Interestingly, the miR-1 and miR-206 seed sequences are not well conserved in the 3′UTR of human and mouse BAF60b (Fig.  3A). [score:1]
We propose that, following myoblast commitment, miRNA -mediated post-transcriptional repression of residual BAF60a and BAF60b transcripts is a key event by which miR-133 and miR-1/206 stabilize the myogenic differentiation program in the embryo. [score:1]
The chicken BAF60a 3′UTR sensor did not respond to miR-1 or miR-206, and the BAF60b 3′UTR sensor did not respond to miR-133 (supplementary material Fig. S3C). [score:1]
[1 to 20 of 51 sentences]
2
[+] score: 145
By contrast, in the up-regulated genes of 23DSI, the predicted target genes of miR-1-miR-71-miR-7-miR-7-5p appeared to regulate the ribonucleoprotein complex assembly, cellular protein complex assembly, microtubule -based process, response to oxidative stress, multicellular organismal aging, respiratory electron transport chain, pyrimidine ribonucleoside triphosphate biosynthetic process, positive regulation of epithelial cell differentiation, positive regulation of cell proliferation, apoptosis, energy coupled proton transport, electron transport chain, ATP synthesis-coupled proton transport, anatomical structure formation involved in morphogenesis, ribonucleoprotein complex biogenesis, mitotic cell cycle, larval development, microtubule polymerisation or depolymerisation, female gamete generation, regulation of transcription from RNA polymerase II promoter, and imaginal disc development, among others (Table  2 and Additional file 6: Table S4). [score:12]
In 23 DSI, the high level of bantam and low levels of miR-1, miR-71, miR-7, and miR-7-5p possibly regulated and organised a specific gene expression profile for sexual maturation and egg production by inhibiting and strengthening specific gene expression and metabolic processes. [score:8]
Furthermore, among all samples, bantam was distinctly up-regulated in 23 DSI, and miR-1, miR-71, miR-7-5p, and miR-7 were distinctly up-regulated in 23SSI. [score:7]
To analyse the effect of the differential expression of miRNAs on female development after pairing, we sequenced the libraries of 23DSI and 23SSI, predicted the target genes of miRNA-1-miRNA-71-miRNA-7-miR-7-5p (Additional file 3: Table S1) and bantam (Additional file 4: Table S2), and analysed the differential expression of these genes in 23DSI compared with 23SSI. [score:7]
In unpaired females (23SSI), bantam was notably not up-regulated, whereas miR-1, miR-71, miR-7, and miR-7-5p were significantly up-regulated. [score:7]
Click here for file Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in up-regulated genes in 23DSI. [score:6]
Although miRNAs do not regulate all genes in organisms, evidence provided by miRNA analyses in the present study indicated that pairing likely limited the expression of non-essential genes through increasing the expression of bantam and specific genes by maintaining miR-1, miR-71, miR-7, and miR-7-5p at relatively low levels. [score:6]
By contrast, in paired females (23DSI), the above mentioned miRNAs were not up-regulated, suggesting that the functions of the target genes of miR-1-miR-71-miR-7-miR-7-5p were required in paired females. [score:6]
Similar miRNA profiles were observed in 18SSI and 18DSI, with the presence of identically expressed high-abundance miRNA, such as miRNA-1, miRNA-71b-5p and let-7. By contrast, in 23DSI and 23SSI, most of these high-abundance miRNAs were down-regulated. [score:6]
Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in up-regulated genes in 23DSI. [score:6]
We found that the target genes of miR-1-miR-71-miR-7-miR-7-5p, such as ribosomal protein genes (CAX72037.1, CAX71939.1, CAX78482.1, CAX77178.1, AAP06483.1, CAX77387.1, CAX72859.1, CAX70956.1, CAX71543.1, CAX83047.1, CAX70121.1) (Additional file 6: Table S4), thioredoxin peroxidase (CAX75860.1), tubulin (XP_002580033.1, CAX75788.1, CAX75500.1, CAX71989.1, CAX76110.1), ATP synthase- H + transporting (CAX75390.1, CAX76063.1), and cytochrome c oxidase (CAX74747.1, CAX76589.1), among others, were significantly up-regulated. [score:6]
Out of the 50 genes, 33 were the predicted target genes of bantam (Figure  3B), whereas only 2 were predicted target genes of miR-1-miR-71-miR-7-miR-7-5p. [score:5]
revealed that in unpaired females, the highly-expressed miRNA-1, miRNA-71, miRNA-7, and miR-7-5p only inhibited the limited pathways, such as proteasome and ribosome assembly. [score:5]
Differential expression of the predicted target genes of bantam and miRNA-1-miRNA-71-miRNA-7-5p- miR-7 between samples from 23 DSI and 23SSI. [score:5]
For instance, in ribosome assembly, 15 of 49 detected genes in this metabolic process were predicted as the target genes of miR-1-miR-71-miR-7-miR-7-5p, whereas only 1 of 49 genes was the predicted target gene of bantam (Figure  3A). [score:5]
For example, the higher expression of bantam was observed only in 23DSI, whereas higher expression of miR-1, miR-71, miR-7-5p, and miR-7 manifested only in 23SSI (Figure  1B). [score:5]
The predicted target genes of bantam hardly participated in the proteasome, porphyrin metabolism, ribosome, whereas more predicted target genes of miR-1-miR-71-miR-7-miR-7-5p were involved in these process. [score:5]
C. miR-1, with respect to 23DSI, was significantly up-regulated in 23SSI (P < 0.01). [score:4]
Moreover, few of the predicted target genes of miR-1-miR-71-miR-7-miR-7-5p participated in the peroxisome, RNA degradation, mRNA surveillance pathway, axon guidance, basal transcription factors, apoptosis, glycerophospholipid metabolism, insulin signalling pathway, lysosome, regulation of actin cytoskeleton, and endocytosis. [score:4]
Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in Schistosoma japonicum. [score:3]
The miRNAs with high-abundance, such miRNA-1c, miRNA-1a, miRNA-1, miRNA-71b-5p, let-,7 and so on showed identical expression. [score:3]
Click here for file Predicted target genes of miR-1-miR-71-miR-7-miR-7-5p in Schistosoma japonicum. [score:3]
To confirm the differentially expressed miRNAs in 23DSI, 23SSI, 18DSI, and 18SSI, bantam, miRNA-1, and miR-71 were selected for quantitative RT–PCR analysis. [score:3]
Only several high-abundance miRNAs differentially expressed between 23DSI and 23 SSI, such as bantam, miR-1, miR-71, miR-7, and miR-7-5p. [score:3]
The transcriptomes of 23DSI and 23SSI revealed that the predicted target genes of miRNA-1, miRNA-71, miRNA-7, and miR-7-5p were associated with the ribonucleoprotein complex assembly and microtubule -based process. [score:3]
However, none of the predicted target genes of miR-1-miR-71-miR-7-miR-7-5p are involved the citrate cycle, gastric acid secretion, glycolysis/gluconeogenesis, protein digestion and absorption, aminoacyl-tRNA biosynthesis, fatty acid biosynthesis, and the pentose phosphate pathway. [score:3]
These results suggested that miR-1, miR-71, miR-7, and miR-7-5p played an essential role in regulating ribosomal assembly. [score:2]
Furthermore, the low abundance of miR-1, miR-71, miR-7, and miR-7-5p in 23DSI compared with 23SSI was likely capable of promoting specific gene expression. [score:2]
In particular, various ribosomal protein genes were regulated by miR-1-miR-71-miR-7-miR-7-5p. [score:2]
We found the level of high-abundance miRNAs such as miR-1, miR-1a, miR-1c, miR-71b-5p, and let-7 to be higher in 18DSI and 18SSI than in 23DSI and 23SSI. [score:1]
For example, their levels of miR-1c, miR-1a, miR-1, miRNA-71b-5p, and let-7 were far lower than those in 18 DSI or 18SSI. [score:1]
Similarly, higher amount of miR-71 (Figure  2B) and miR-1 (Figure  2C) were observed in 23SSI than in 23DSI. [score:1]
[1 to 20 of 32 sentences]
3
[+] score: 71
Expression of miR-133 is up-regulated in response to increased expression of myogenin, a myogenic transcription factor which transactivates miR-133 in the presence of exogenous IGF-1. Overexpression of miR-133 has important implications on the IGF-1R/PI3K/Akt signaling pathway due to its ability to block IGF-1R expression and sequentially decrease regulation of Akt phosphorylation, miR-1 overexpression gives rise to pronounced down-regulation of phospho-Akt supported by a generalized decrease in the IGF-1 signal transduction pathway. [score:18]
Up-regulation of miR-1 is primarily due to accumulation of myocyte enhancer factor-2 (MEF2) resulting from decreased expression of HDAC4; interestingly, this confined expression of HDAC4 is caused by high miR-1 expression. [score:10]
In turn, active Akt phosphorylates and depresses transcription factor forkhead box O3 (Foxo3a), a negative regulator of protein synthesis and muscle growth which regulates miR-1 promoter activity; the declining miR-1 reciprocally regulates IGF-1 and IGF-1R expression since they are targets of miR-1. This inverse correlation between IGF-1 protein levels and miR-1 is also found in myocardial biopsies of acromegalic patients [61]. [score:8]
Thus, when MEF2 expression increases accompanied by up-regulation of miR-1, HDAC4 activity is repressed, resulting in further expression of MEF2 and control of myocyte differentiation. [score:8]
Some miRNAs are expressed ubiquitously in different tissues, while some are expressed in a tissue-specific manner; miR-1, miR-133, and miR-206 belong to the latter category. [score:5]
For instance, transcription regulation of miR-1/ 133/ 206 can be implemented by mammalian target of rapamycin (mTOR) signaling in a Myo -dependent manner. [score:4]
With the aid of MyoD, which lies downstream of mTOR, transcription of miR-1 is triggered and in turn degrades HDAC4, a follistatin suppressor, affecting myocyte fusion. [score:3]
For example, miR-1 and miR-206 have four mutual targets: histone deacetylase 4 (HDAC4) [38, 39], connexin43 (Cx43) [40], paired box 7 (Pax7 ) [41], and cMet [42]. [score:3]
Although three miRNAs, miR-1, miR-101, and miR-499, were predicted to target the activin A receptor type IIB (ACVR2B) gene, validation was only performed for miR-1 and ACVR2B. [score:3]
As described above, miR-1 and miR-133 are involved in skeletal muscle growth and development. [score:2]
Moreover, miR-1 and miR-133 can regulate myogenesis via phosphatidylinositol 3-kinase/v-AKT murine thymoma viral oncogene (Akt) (PI3K/Akt) signaling Fig. (1), which at least partially participates in muscle growth and hypertrophy [59]. [score:2]
In situ hybridization of chicken embryos during early stages of incubation revealed that miR-1, which facilitates differentiation of mesodermal progenitors to the muscle lineage [69], was detected in the somatic myotome beginning at stage 14 [70], which corresponds to the onset of skeletal muscle cell differentiation. [score:1]
A bicistronic gene cluster encoding miR-1 and miR-133a, and another encoding miR-133b and miR-206 are transcribed from non-coding regions on mouse chromosomes 2 and 1, respectively. [score:1]
Many growth-related miRNAs have been discovered, including miR-1, miR-133, miR-206, miR-101, and let-7b, the biochemical roles of which have been demonstrated through experimental validation. [score:1]
Thus, miR-1 and miR-206 play important roles in promoting differentiation. [score:1]
For example, subtle sequence variations exist within the gga-miR-1 and gga-miR-133 genes, but none exist for gga-miR-206 (http://www. [score:1]
[1 to 20 of 16 sentences]
4
[+] score: 46
Starting with 16 known miRNAs validated as differentially expressed between broilers and layers, and eight muscle-related miRNAs (gga-miR-1, gga-miR-206, gga-miR-499, gga-miR-221, gga-miR-222, gga-miR-128, gga-miR-367 and gga-miR-27b), TargetScan (version 5.1) [43] was used to predict putative targets. [score:7]
As demonstrated in Figure 7C, the luciferase activity was significantly reduced when a miR-1 mimic was co -transfected with pGL3- ACVR2B-UTR containing a miR-1 targeting site into 293T cells, suggesting that miR-1 directly targets chicken ACVR2B UTR. [score:6]
Furthermore, miR-1 was demonstrated specifically to target the 3' untranslated region of the activin receptor IIB gene, ACVR2B, which can cause dramatic increases in muscle mass [29]. [score:5]
miR-1 promotes myocyte differentiation by repressing the expression of histone deacetylase 4 (HDAC4), a negative regulator of differentiation and a repressor of the MEF2 (myocyte enhancer factor-2) transcription factor [19]. [score:4]
miR-1 and ACVR2B had opposite expression patterns in skeletal muscle tissue from broiler and layer chickens (Figure 7B). [score:3]
B. Expression of miR-1 and ACVR2B gene in skeletal muscle of broiler and layer chickens at embryonic day 18 were analyzed using real-time RT-PCR. [score:3]
miR-1 and miR-133 have been reported to regulate different aspects of skeletal muscle development in vitro and in vivo [19]. [score:3]
It has been demonstrated that miR-1 is an important regulator of myogenesis [19, 56]. [score:2]
miR-1 seed region mutations were generated by site-directed mutagenesis with primers (mut-F: CAAACTCAGTATATAAGCTATGAGTAAGGTTAGTATTGCAAAAC and mut-R: GCAATACTAACCTTACTCATAGCTTATATACTGAGTTTGATTGGT). [score:2]
Therefore, the target relationship between miR-1 and ACVR2B was validated using a luciferase reporter gene assay. [score:2]
In particular, the critical roles of three muscle-specific miRNAs, miR-1, miR-133 and miR-206, in the regulation of myogenesis have been well documented [17, 18]. [score:2]
293T cells were co -transfected with miR-1 mimic or scramble double-strand small RNA and the reporter plasmid pGL3 or pGL3- ACVR2B-UTR or pGL3-m ACVR2B-UTR, respectively. [score:1]
Like miR-1, miR-206 promotes differentiation of C [2]C [12 ]myoblasts in vitro. [score:1]
org/ was used to identify the predicted miR-1 binding site. [score:1]
Two other myomiRs, miR-1 [19] and miR-181 [24], were high-count sequences in both libraries (Table 1). [score:1]
Transfections were performed with 150 ng of reporter plasmid and 50 ng of miR-1 mimic or scramble (Fugene; Roche). [score:1]
In addition to miR-206, miR-1 and miR-181, nine other miRNAs among the most abundant in these libraries (miR-221, miR-222, miR-21, miR-103, miR-130, miR-99, miR-30, miR20, and miR128) have been implicated in the proliferation and differentiation of muscle cells (Table 1) [15, 19, 33]. [score:1]
A. Schema of miR-1 binding site in chicken ACVR2B 3'-UTR sequence (seed sequence highlighted in red). [score:1]
[1 to 20 of 18 sentences]
5
[+] score: 30
Stage-by-stage examinations revealed further expression patterns, such as emergence at specific time-points during embryogenesis and up-regulation of miRNA groups in late embryos (miR-1 and bantam), expression associated with stage transition between instar and molt larval stages (miR-34b), expression associated with silk gland growth and spinning activity (miR-274), continuous high expression from the spinning larval to pupal and adult stages (miR-252 and miR-31a), a coordinate expression trough in day 3 pupae of both sexes (miR-10b and miR-281), up-regulation in pupal metamorphosis of both sexes (miR-29b), and down-regulation in pupal metamorphosis of both sexes (miR-275). [score:20]
In total, 15 miRNAs were highly expressed throughout pupal and adult stages by microarray, among which 10 were common to both sexes and 9 were robustly expressed over the whole life cycle (including miR-252, miR-1, and let-7a) (Additional files 9 and 10). [score:5]
Half of the 92 miRNAs passed the filtering expression threshold, 35 were also confirmed by, and 15 (including bantam and miR-1) were robustly expressed from the embryo to adult stages (Additional files 3 and 4). [score:5]
[1 to 20 of 3 sentences]
6
[+] score: 15
miR-1b, miR-61 and miR-281 were highly expressed in males whereas miR-8447, miR-2f, mir-8437, miR-31, bantam, miR-2c, miR-2d, miR-71b, miR-36b and miR-755 were highly expressed in females. [score:5]
Three other novel miRNAs (lin-4, miR-1b and miR-277b) are significantly expressed (>20,000 reads in the libraries) and conserved in other metazoan although the current draft S. japonicum genome data lacks the predicted hairpin structures. [score:3]
We used Northern blots to independently demonstrate the expression of four (let-7b, miR-1b, let-7s, and miR-750) of these newly identified S. japonicum miRNAs (Fig 1B and S3 Table). [score:3]
Of these, 10 miRNAs were new to S. japonicum (lin-4, miR-1b, let-7b, let-7s, miR-277b, miR-750, miR-1175, miR-1989, miR-new1 and miR-new2) and 6 are new to schistosomes (let-7b, let-7s, miR-750, miR-1989, miR-new2, miR-277b) (Table 1). [score:1]
Name SequencesReads * Hairpin locus sja-let-7b AGAGGUAGUGAUUCAUAUGACU 655,165 SJC_S000353: 80195–80367 sja-let-7s GAGGUAGUUAGAUGUACGACU 111,993 SJC_S000383:436660–436832 sja-miR-750 CCAGAUCUGUCGCUUCCAACU 281,357 SJC_S000460:180604–180776sja-miR-1175 # UGAGAUUCAAUUACUUCAACUG 20,657 SJC_S000460:180879–181001 sja-miR-1989 UCAGCUGUGUUCAUGUCUUCGA 2,812 SJC_S000128:160744–160623sja-miR-new1 # GAGAGAGCACUUUUAUGACGGA 1,192 SJC_S004484:20079–20188 sja-miR-new2 AGCUAAAUAGGUUAGUUUGACUGUC 15,436 SJC_S016196:787–876sja-lin-4 # UCCCUGAGACCUUAGAGUUGU 23,558 N/Asja-miR-1b # UGGAAUGUUGUGAAGUAUGUGC 1,412,190 N/A sja-mir-277b AAAAUGCAUCAUCUACCCUAGA 207,027 N/A * The number is the sum of miRNA reads in all of the 8 libraries. [score:1]
Considering the critical role that eggs play in the pathogenesis of schistosomiasis, miRNAs in schistosome eggs have also been analyzed and several miRNAs (sja-miR-71b-5p, sja-miR-71, sja-miR-1, sja-miR-36-3p, and sja-124-3p) were shown to be the most abundant in the egg stage [44]. [score:1]
In S. japonicum, Cai et al demonstrated miR-7-5p, miR-61, miR-219-5p, miR-125a, miR-125b, miR-124-3p, and miR-1 were dominant in males, while bantam, miR-71b-5p, miR-3479-5p and miR-Novel-23-5p were predominantly found in the female parasites [45]. [score:1]
[1 to 20 of 7 sentences]
7
[+] score: 14
However, among the remaining 12 miRNAs, we found that miR-2188 affects embryonic development in fishes [86, 87]; miR-1306 is related to Alzheimer’s disease by targeting ADAM10 [88]; miR-1684 was differentially expressed in chicken lines selected for necrotic enteritis [89]; miR-1b could be potentially related to immunity genes in insects [90]; no literature was found for the other 8 miRNAs (miR-3535, miR-1434, miR-1805–3p, miR-1551, miR-1563, miR-1653, miR-1416, miR-460a). [score:8]
The most significantly differentially expressed were gga-miR-206 (3.5-fold), gga-miR-31 (2.5-fold), gga-miR-3535 (2.5-fold), gga-miR-17–3p (2.3-fold), gga-miR-429 (2.3-fold) and gga-miR-200b (2.2-fold), and in comparison, gga-miR-454 (-2.9-fold) and gga-miR-1b (-2.7-fold) were those mostly down-regulated in the fat line (Fig. 4). [score:6]
[1 to 20 of 2 sentences]
8
[+] score: 12
miR-206 is proved to have much higher expression level than that of miR-1 during development and perinatal period, but in adult muscle it was much lower than that of miR-1 [14, 15, 16]. [score:4]
Sweetman D. Goljanek K. Rathjen T. Oustanina S. Braun T. Dalmay T. Munsterberg A. Specific requirements of MRFs for the expression of muscle specific microRNAs, miR-1, miR-206 and miR-133 Dev. [score:3]
Many studies also demonstrated that miR-1/206 and miR-133a/133b families were necessary for proper skeletal and cardiac muscle development, and had a profound function on multiple myopathies, such as hypertrophy, dystrophy, and conduction defects [13]. [score:2]
Gagan J. Dey B. K. Layer R. Yan Z. Dutta A. Notch3 and Mef2c proteins are mutually antagonistic via MKP1 protein and miR-1/206 microRNAs in differentiating myoblasts J. Biol. [score:1]
Although miR-1 and miR-206 have the completely conservable seed sequences among all vertebrates, they exhibited different functions during the muscle formation. [score:1]
Among these muscle-specific miRNAs, the most wi dely studied miRNAs were members of the miR-1/206 and miR-133a/133b families which highly enriched in both human and mouse heart and skeletal muscle [12]. [score:1]
[1 to 20 of 6 sentences]
9
[+] score: 11
The AKT-FOXO3 pathway has been reported to affect the IGF1 pathway by regulating miR-1 expression [55]. [score:4]
Furthermore, miR-206 was also abundantly expressed in our samples, while miR-1 was not. [score:3]
miRNAs have an important role in muscle tissues during embryonic development and miR-133, miR-1 and miR-206 are crucial regulatory factors during myogenesis [19, 38, 42, 43]. [score:3]
Chen J. F. Man del E. M. Thomson J. M. Wu Q. Callis T. E. Hammond S. M. Conlon F. L. Wang D. Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation Nat. [score:1]
[1 to 20 of 4 sentences]
10
[+] score: 10
Several well-known myogenic miRNAs, such as miR-1, miR-206, and miR-133, were reported to regulate muscle development by inhibiting target gene expression (Anderson et al., 2006; Chen et al., 2006). [score:9]
The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation. [score:1]
[1 to 20 of 2 sentences]
11
[+] score: 9
[32] This skin-specific miRNA can also be expressed in early skeletal muscle cells, a finding that was similar to the three muscle-specific miRNAs miR-1, miR-133a and miR-206 that are expressed in brown pre- and mature adipocytes. [score:5]
[38] The most notable myomiRs, miR-206, miR-1 and miR-133a, are all significantly upregulated during muscle differentiation. [score:4]
[1 to 20 of 2 sentences]
12
[+] score: 9
Clop et al. found that a point mutation within the 3' UTR of GDF8 in Texel sheep resulted in a target site that allowed miR-1 and miR-206 to act simultaneously. [score:4]
Chen et al. demonstrated that miR-1 promotes differentiation of myoblasts into mature muscle cells by acting on HDAC4, inhibiting myoblast proliferation. [score:3]
Using the loss- and gain-of-function method, Kwon et al. showed that miRNA-1 of the ancient muscle-specific gene in Drosophila regulates functions of the heart and muscle-specific genes via their interaction with members of the Notch signaling pathway [36]. [score:2]
[1 to 20 of 3 sentences]
13
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-19a, gga-mir-18a, gga-mir-17, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
When tissues in the state of virus infection were compared, 28 and 23 miRNAs were specifically and highly expressed in lungs, respectively, and only 6 miRNAs (miR-1a-1 and 2, miR-1b, miR-34b, 34c and miR-449) were highly expressed in tracheae (Table 5). [score:4]
The potential target genes for miR-1a and miR-1b are the T-cell immuno-modulatory protein. [score:3]
[1 to 20 of 2 sentences]
14
[+] score: 6
Four myo-miRs, miR-1, miR-133a, miR-133b, and miR-206, together account for nearly 25% of miRNA expression in skeletal muscles in both humans and mice [12]. [score:3]
Four myo-miRs (miR-1, miR-133a, miR-133b, and miR-206) accounted for nearly 25% of miRNA expression in skeletal muscle in both humans and mice [12]. [score:3]
[1 to 20 of 2 sentences]
15
[+] score: 5
Third, bioinformatic analyses have indicated that several evolutionarily conserved miRNAs (miR-8, miR-1, miR-124, miR-71, and miR-195) in schistosomes may regulate phylogenetically conserved mRNA targets (Cheng and Jin, 2012); however, experimental confirmation of these results is needed. [score:4]
In addition, some S. japonicum miRNAs (e. g., miR-1b, miR-124, miR-190, et al. ) also displayed evolutionary conservation among Homo sapiens, Mus musculus, Caenorhabditis elegans, and Drosophila melanogaster (Cheng and Jin, 2012). [score:1]
[1 to 20 of 2 sentences]
16
[+] score: 5
MiR-1, miR-206, miR-613, and miR-34a repress expression of lipogenic genes in the human hepatocyte cell line HepG2 by suppression of nuclear transcription factors such as LXRα (miR-1, miR-206, miR-613) [30, 31] and RXRα (miR-34a) [32]. [score:5]
[1 to 20 of 1 sentences]
17
[+] score: 4
Additionally, an increasing number of reports indicate that microRNAs (miRNAs), such as let-7b, miR-1, miR-133 and miR-206 [13, 14], function in animal growth by regulating their target genes. [score:4]
[1 to 20 of 1 sentences]
18
[+] score: 3
Avian influenza impacted the expression levels of several miRNAs in the chicken trachea and lung including the following miRNAs significant in the current study: let-7a-1, let-7f, let-7j, mir-1b, mir-30d, mir-34c, mir-101-2, mir-144, mir-200b, and mir-451 (Wang et al., 2009). [score:3]
[1 to 20 of 1 sentences]
19
[+] score: 2
Besides, some of the muscle-specific miRNAs, such as miR-1, miR-133 and miR-206, can also be regulated by MYOD during myoblast differentiation. [score:2]
[1 to 20 of 1 sentences]
20
[+] score: 1
Chen J. F. Man del E. M. Thomson J. M. Wu Q. Callis T. E. Hammond S. M. Conlon F. L. Wang D. Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation Nat. [score:1]
[1 to 20 of 1 sentences]
21
[+] score: 1
cn/kech/swxxx/jakj/dianzi/Bioinf4/miRNA/miRNA1. [score:1]
[1 to 20 of 1 sentences]
22
[+] score: 1
Our statistical analysis of the expression data yielded a total of 37 significantly cardiac enriched miRNA transcripts, containing all of the previously described characteristic cardiac enriched microRNA transcripts, like miR499 and the miR1 and 133 family. [score:1]
[1 to 20 of 1 sentences]
23
[+] score: 1
Of these, nine (gga-mir-1b, gga-mir-7, gga-mir-7b, gga-mir-10b, gga-mir-31, gga-mir-130b, gga-mir-204, gga-mir-215, gga-mir-489) are increased, and five (gga-mir-223, gga-mir-124b, gga-mir-140, gga-mir-183, gga-mir-222a) are decreased in CD30 [hi] cells. [score:1]
[1 to 20 of 1 sentences]
24
[+] score: 1
Other miRNAs from this paper: dme-mir-1, dme-bantam, gga-mir-1a-2, gga-mir-1a-1, gga-mir-1c
The role of ban in GSC maintenance and its genetic interaction with dFmr1 appear specific since another miRNA that is associated with dFmrp, miR-1, has no effect on GSCs (Chen and Jin, unpublished data). [score:1]
[1 to 20 of 1 sentences]
25
[+] score: 1
Chen J. F. Man del E. M. Thomson J. M. Wu Q. Callis T. E. Hammond S. M. Conlon F. L. Wang D. Z. The role of microRNA-1 and microRNA-133 in skeletal muscle proliferation and differentiation Nat. [score:1]
[1 to 20 of 1 sentences]
26
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-25, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-105-1, hsa-mir-105-2, dme-mir-1, dme-mir-10, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-124-3, mmu-mir-134, mmu-mir-10b, hsa-mir-10a, hsa-mir-10b, dme-mir-92a, dme-mir-124, dme-mir-92b, mmu-let-7d, dme-let-7, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-134, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-92a-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-25, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-92a-1, hsa-mir-379, mmu-mir-379, mmu-mir-412, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-92-1, gga-mir-17, gga-mir-1a-2, gga-mir-124a, gga-mir-10b, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-1a-1, gga-mir-124b, gga-let-7a-2, gga-let-7j, gga-let-7k, dre-mir-10a, dre-mir-10b-1, dre-mir-430b-1, hsa-mir-449a, mmu-mir-449a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-10b-2, dre-mir-10c, dre-mir-10d, dre-mir-17a-1, dre-mir-17a-2, dre-mir-25, dre-mir-92a-1, dre-mir-92a-2, dre-mir-92b, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, hsa-mir-412, hsa-mir-511, dre-let-7j, hsa-mir-92b, hsa-mir-449b, gga-mir-449a, hsa-mir-758, hsa-mir-767, hsa-mir-449c, hsa-mir-802, mmu-mir-758, mmu-mir-802, mmu-mir-449c, mmu-mir-105, mmu-mir-92b, mmu-mir-449b, mmu-mir-511, mmu-mir-1b, gga-mir-1c, gga-mir-449c, gga-mir-10a, gga-mir-449b, gga-mir-124a-2, mmu-mir-767, mmu-let-7j, mmu-let-7k, gga-mir-124c, gga-mir-92-2, gga-mir-449d, mmu-mir-124b, gga-mir-10c, gga-let-7l-1, gga-let-7l-2
The family defining bootstrap cutoff values are tree-specific, and are set to be the smallest bootstrap value of the reference miRNA families (let7, mir-124, mir-17 and mir-1, See additional file 3: Reference miRNA families) in each input tree. [score:1]
[1 to 20 of 1 sentences]