sort by

11 publications mentioning gga-mir-18a

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-18a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 33
a ADIPOR2 is targeted by miR-20b and let-7c, b INSIG1 is targeted by miR-182, miR-183, and miR-454, c MAPK4K4 is targeted by miR-29a, d FASN is targeted by miR-107, e FADS2 is targeted by let-7c, f ELOVL2 is targeted by miR-10b, g HMGCS1 is targeted by miR-18a, and h MSMO1 is targeted by miR-20b and miR-454 To further explore miRNA regulatory networks associated with the metabolic switch, we identified potential metabolic mRNA targets for let-7c, miR-20b, and miR-183 using in silico target prediction in combination with IPA pathway analysis. [score:22]
Many SREBF1 regulated genes are also regulated by miRNAs, including let-7c, miR-200b, miR-107, and miR-18a Fig. 2Differential hepatic expression of a lipid metabolism network involving FADS2 and SCD and associated miRNA between E18 and D3 chickens. [score:5]
Many SREBF1-regulated genes are also regulated by miRNAs, including let-7c, miR-200b, miR-107, and miR-18a. [score:3]
HMGCS1 mRNA is a predicted target of miR-18a (Fig. 2), which decreased between E18 and D0 (Fig. 3g). [score:3]
[1 to 20 of 4 sentences]
2
[+] score: 14
The gene expression results showed that, compared with pCMV-HA vector, c-Myc overexpression increased the expression of the pri-miR-17-92 cluster transcript and mature miR-17-3p, miR-17-5p, miR-18a, miR-19a, miR-20a and miR-92a, suggesting that c-Myc regulates chicken miR-17-92 cluster expression (Fig.   9c). [score:9]
Among these three different cells, the members of miR-17-92 cluster (miR-17-3p, miR-17-5p, miR-18a, miR-19a, miR-20a and miR-92a) were more highly expressed in DF1 cells than in SV and ICPA-1 cells (p < 0.01) (Fig.   1). [score:3]
The miR-17-92 cluster can generate at least six mature miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1) from the same primary transcript [5]. [score:1]
Primer name Primer sequences (5′-3′) Tm (°C) miR-17-5p-F1 ACACTCCAGCTGGGCAAAGTGCTTACAGTGCA 55 miR-17-5p-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTACCTG miR-17-3p-F1 ACACTCCAGCTGGGACTGCAGTGAAGGC 55 miR-17-3p-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAAGTGC miR-18a-F1 ACACTCCAGCTGGGTAAGGTGCATCTAGTG 55 miR-18a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTATCTGCA miR-19a-F1 ACACTCCAGCTGGGTGTGCAAATCTATGCAA 55 miR-19a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAGTTTT miR-20a-F1 ACACTCCAGCTGGG TAAAGTGCTTATAGTGC 55 miR-20a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCTGC miR-92-F1 ACACTCCAGCTGGGTATTGCACTTGTCCC 55 miR-92-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAGGCCGG U6-F GCGCGTCGTGAAGCGTTC 55 U6-R GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAATA URP GTGCAGGGTCCGAGGT DF1 cells were grown at approximately 30~50% confluence, transfected with either psiCHECK2-MAP3K2-3′UTR-WT or psi-CHECK2-MAP3K2-3′UTR-MUT and designated plasmids or miRNA inhibitors in 24-well plates using Lipofectamine 2000 (Invitrogen, USA). [score:1]
[1 to 20 of 4 sentences]
3
[+] score: 10
Among the upregulated miRNAs in DT40 cells, many miRNAs including gga-miR-18a and -18b, -222, -20b, -148a, -221, -106, -103, -101 and -21 also increased in CD40L-stimulated cells (Figure 3A). [score:4]
In addition, miR-17-92 cluster of miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) was also expressed at relatively high levels, accounting for 12.4% of the miRNAome in BP25. [score:3]
The miR-17-92 cluster of miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) was also expressed at relatively high levels (accounting for 12.4% of the miRNAome) in the BP25 cell line. [score:3]
[1 to 20 of 3 sentences]
4
[+] score: 7
Other miRNAs from this paper: gga-mir-19a, gga-mir-200b, gga-mir-23b, gga-mir-383
Among the predicted miRNA-target relationships, correlations between miR-18a, miR-19a and the target THBS1 are reported to be involved in angiosarcomas 19, while the correlation between miR-200b and target FN1 is associated with ovarian cancer 20. [score:7]
[1 to 20 of 1 sentences]
5
[+] score: 6
3.4Wang et al. identified 32 known miRNAs from skeletal muscle of Arbor Acres commercial chickens, of which 12 form five clusters: miR-133a-1-miR-1a-2, miR-23b-miR-24, miR-99a-let-7c, miR-92-miR-19b-miR-18a-miR-17, and miR-30e-miR-30c-1, suggesting that most miRNAs co-express in skeletal muscle [85]. [score:3]
Wang et al. identified 32 known miRNAs from skeletal muscle of Arbor Acres commercial chickens, of which 12 form five clusters: miR-133a-1-miR-1a-2, miR-23b-miR-24, miR-99a-let-7c, miR-92-miR-19b-miR-18a-miR-17, and miR-30e-miR-30c-1, suggesting that most miRNAs co-express in skeletal muscle [85]. [score:3]
[1 to 20 of 2 sentences]
6
[+] score: 5
In addition, the similar phenomenon was also observed in S. mansoni (miR-4, miR-6, miR-9, miR-32, miR-125, miR-3, and miR-5 were expressed in adult worms only, and miR-20, miR-18, miR-22, miR-26, and bantam were expressed in schistosomula only) (Simoes et al., 2011). [score:5]
[1 to 20 of 1 sentences]
7
[+] score: 4
The miR17-92 cluster comprises seven miRNAs (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92-1), and it has been shown to accelerate adipocyte differentiation by negatively regulating the tumor-suppressor Rb2/p130 32. [score:4]
[1 to 20 of 1 sentences]
8
[+] score: 3
Moreover, the miR-17-92 cluster (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1) has been reported to be frequently over-expressed in human cancers and has oncogenic activity (He et al., 2005; Men dell, 2008). [score:3]
[1 to 20 of 1 sentences]
9
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-15a, hsa-mir-18a, hsa-mir-33a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-mir-27b, mmu-mir-126a, mmu-mir-128-1, mmu-mir-140, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-191, hsa-mir-10a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, mmu-mir-297a-1, mmu-mir-297a-2, hsa-mir-27b, hsa-mir-128-1, hsa-mir-140, hsa-mir-152, hsa-mir-191, hsa-mir-126, hsa-mir-146a, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-15a, mmu-mir-18a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-342, hsa-mir-155, mmu-mir-107, mmu-mir-10a, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, hsa-mir-374a, hsa-mir-342, gga-mir-33-1, gga-let-7a-3, gga-mir-155, gga-mir-15a, gga-mir-218-1, gga-mir-103-2, gga-mir-107, gga-mir-128-1, gga-mir-140, gga-let-7a-1, gga-mir-146a, gga-mir-103-1, gga-mir-218-2, gga-mir-126, gga-let-7a-2, gga-mir-27b, mmu-mir-466a, mmu-mir-467a-1, hsa-mir-499a, hsa-mir-545, hsa-mir-593, hsa-mir-600, hsa-mir-33b, gga-mir-499, gga-mir-211, gga-mir-466, mmu-mir-675, mmu-mir-677, mmu-mir-467b, mmu-mir-297b, mmu-mir-499, mmu-mir-717, hsa-mir-675, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-297c, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-467c, mmu-mir-467d, mmu-mir-466d, hsa-mir-297, mmu-mir-467e, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-467f, mmu-mir-466j, mmu-mir-467g, mmu-mir-467h, hsa-mir-664a, hsa-mir-1306, hsa-mir-1307, gga-mir-1306, hsa-mir-103b-1, hsa-mir-103b-2, gga-mir-10a, mmu-mir-1306, mmu-mir-3064, mmu-mir-466m, mmu-mir-466o, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-466c-2, mmu-mir-467a-4, mmu-mir-466b-4, mmu-mir-467a-5, mmu-mir-466b-5, mmu-mir-467a-6, mmu-mir-466b-6, mmu-mir-467a-7, mmu-mir-466b-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, hsa-mir-466, hsa-mir-3173, hsa-mir-3618, hsa-mir-3064, hsa-mir-499b, mmu-mir-466q, hsa-mir-664b, gga-mir-3064, mmu-mir-126b, gga-mir-33-2, mmu-mir-3618, mmu-mir-466c-3, gga-mir-191
According to previous experimental studies, DICER1 was found targeted by nine miRNAs: hsa-let-7a, - 7b, - 7c, and -7d, hsa-mir-18a, -103, -107, -374a, and -519a [52]– [55]. [score:3]
[1 to 20 of 1 sentences]
10
[+] score: 1
MiR-18, miR-98, miR-128, miR-135, and miR-148 affect ovarian cell steroidogenesis, including the production of progesterone, testosterone, and estradiol [17]. [score:1]
[1 to 20 of 1 sentences]
11
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-20a, gga-mir-19a, gga-mir-17, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
Within these clusters, the mir-92-mir-19b-mir-20a-mir-19a-mir-18a-mir-17, which is equivalent to the mammalian mir-17-92 cluster, and mir-302b-mir-302c-mir-1811-mir-302a-mir-302d-mir-367 cluster were the biggest clusters containing six miRNAs. [score:1]
[1 to 20 of 1 sentences]