sort by

12 publications mentioning gga-mir-20a

Open access articles that are associated with the species Gallus gallus and mention the gene name mir-20a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 95
The gene expression results showed that, compared with pCMV-HA vector, c-Myc overexpression increased the expression of the pri-miR-17-92 cluster transcript and mature miR-17-3p, miR-17-5p, miR-18a, miR-19a, miR-20a and miR-92a, suggesting that c-Myc regulates chicken miR-17-92 cluster expression (Fig.   9c). [score:9]
To further understand the mode of action for miR-17-5p/20a in inhibiting MAP3K2 expression, miR-17-5p and miR-20a inhibitors were respectively transfected into DF1 cells, and MAP3K2 mRNA and protein expression were examined using qRT-PCR and IP-western blot analyses. [score:9]
However, two members of the miR-17-92 cluster (miR-17 and miR-20a) can posttranscriptionally downregulate E2F1 expression [11], thus counterbalancing the positive feedback loop of E2F1 and c-Myc. [score:6]
The miRNA-17-5p inhibitor, miRNA-20a inhibitor and negative control were purchased from Ribobio (Guangzhou, China). [score:5]
At 30% confluency, the cells were respectively transfected with the miRNA-17-5p inhibitor, miRNA-20a inhibitor, miRNA negative control (miR-NC), siMAP3K2 and its corresponding negative controls (siNC) using Lipofectamine 2000 (Invitrogen, Life Technologies, USA) according to the manufacturer’s instructions. [score:5]
However, the miR-17-92 cluster postranscriptionally suppresses E2F1 expression through its two members (miR-17-5p and miR-20a). [score:5]
For example, miR-17 and miR-19a directly target MAPK1 [20], miR-17-5p can activate p38 MAPK-HSP27 signalling [51], and miR-20a-5p can activate MAPK/ERK and cAMP/PKA signalling pathways [52]. [score:4]
The results showed that both miR-17-5p and miR-20a inhibitors could inhibit the proliferation of DF1 cells compared with the negative control group (miR-NC) (Fig.   4e), in contrast with the effect of the miR-17-92 cluster on the proliferation of DF1 cells, suggesting that miR-17-5p and miR-20a mediate the promotive effect of the miR-17-92 cluster in the chicken cell proliferation. [score:4]
The luciferase reporter results showed that the activity of psi-CHECK2-MAP3K2-3′UTR-MUT was significantly higher than that of psi-CHECK2-MAP3K2-3′UTR-WT, suggesting that these miR-17-5p and miR-20a directly target the 3′UTR of MAP3K2. [score:4]
In the present study, we provided evidence that two members of miR-17-92 cluster, miR-17-5p and miR-20a, target the MAPK signalling pathway in chicken cells. [score:3]
Figure 3 The predicted binding sites of miR-17-5p and miR-20a in the 3′ untranslated region (3′UTR) of chicken MAP3K2 mRNA. [score:3]
To determine whether the miR-17-92 cluster promotes chicken cell proliferation through its two members, miR-17-5p and miR-20a, we tested the effect of miR-17-5p and miR-20a inhibitors on chicken cell proliferation. [score:3]
These data suggest that miR-17-5p and miR-20a target MAP3K2 by inducing mRNA degradation. [score:3]
Among these three different cells, the members of miR-17-92 cluster (miR-17-3p, miR-17-5p, miR-18a, miR-19a, miR-20a and miR-92a) were more highly expressed in DF1 cells than in SV and ICPA-1 cells (p < 0.01) (Fig.   1). [score:3]
Peng J Expressions of miR-181a and miR-20a in RPMI8226 cell line and their potential as biomarkers for multiple myelomaTumour. [score:3]
Together, these data suggest that the miR-17-92 cluster may promote chicken cell proliferation in part via MAP3K2 targeting by its two members, miR-17-5p and miR-20a. [score:3]
Inhibition of miR-17-5p and miR-20a reduces the proliferation of DF1 cells. [score:3]
In contrast, both miR-17-5p and miR-20a inhibitors highly significantly increased the luciferase activities of psi-CHECK2-MAP3K2-3′UTR-WT in DF1 cells (Fig.   4b). [score:3]
To verify whether miR-17-5p and miR-20a target chicken MAP3K2, the 3′UTR fragment (598 bp) of chicken MAP3K2 mRNA, containing the two putative binding sites for miR-17-5p/20a, was RT-PCR amplified and cloned into the psi-CHECK2 vector to yield the MAP3K2 3′UTR reporter (psi-CHECK2-MAP3K2-3′UTR-WT). [score:3]
The miR-17-5p and miR-20a inhibitors were transfected into DF1 cells and cell proliferation was assayed using the CCK-8 kit. [score:2]
Sylvestre Y An E2F/miR-20a autoregulatory feedback loopJ. [score:2]
Pu Y MiR-20a-5p represses multi-drug resistance in osteosarcoma by targeting the KIF26B geneCancer. [score:2]
As shown in Fig.   4c, d, compared with miR-NC (negative control), miR-17-5p and miR-20a inhibitors increased MAP3K2 mRNA by 70.1% and 84.5% (p < 0.05), respectively, at 48 h after transfection. [score:2]
The miR-17-92 cluster can generate at least six mature miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92a-1) from the same primary transcript [5]. [score:1]
Primer name Primer sequences (5′-3′) Tm (°C) miR-17-5p-F1 ACACTCCAGCTGGGCAAAGTGCTTACAGTGCA 55 miR-17-5p-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTACCTG miR-17-3p-F1 ACACTCCAGCTGGGACTGCAGTGAAGGC 55 miR-17-3p-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAAGTGC miR-18a-F1 ACACTCCAGCTGGGTAAGGTGCATCTAGTG 55 miR-18a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTATCTGCA miR-19a-F1 ACACTCCAGCTGGGTGTGCAAATCTATGCAA 55 miR-19a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAGTTTT miR-20a-F1 ACACTCCAGCTGGG TAAAGTGCTTATAGTGC 55 miR-20a-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCTACCTGC miR-92-F1 ACACTCCAGCTGGGTATTGCACTTGTCCC 55 miR-92-R1 CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAGGCCGG U6-F GCGCGTCGTGAAGCGTTC 55 U6-R GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAATA URP GTGCAGGGTCCGAGGT DF1 cells were grown at approximately 30~50% confluence, transfected with either psiCHECK2-MAP3K2-3′UTR-WT or psi-CHECK2-MAP3K2-3′UTR-MUT and designated plasmids or miRNA inhibitors in 24-well plates using Lipofectamine 2000 (Invitrogen, USA). [score:1]
For example, miR-17-5p promoted cell proliferation in gastric [39] and colorectal cancer cell lines [40], and miR-20a promoted cell proliferation in human lung cancer [41] and multiple myeloma [42]. [score:1]
The boxed sequences indicate the putative binding sites for miR-17-5p and miR-20a in the 3′UTR of MAP3K2 mRNA. [score:1]
In addition, the MAP3K2 3′UTR mutant reporter psi-CHECK2-MAP3K2-3′UTR-MUT was also generated using gene synthesis by Invitrogen, in which the sequence GUGA was mutated to ACUG within both the predicted miR-17-5p and miR-20a binding sites, respectively. [score:1]
In the present study, we demonstrated that the miR-17-92 cluster promotes chicken cell proliferation through its two members, miR-17-5p and miR-20a (Fig.   2). [score:1]
[1 to 20 of 29 sentences]
2
[+] score: 12
Other miRNAs which are expressed at high levels in HD11 include gga-miR-142-3p (10.5%), gga-miR-223 (6.9%), gga-miR-19b (4%), gga-miR-20a (3.7%) and gga-miR-22 (3.4%). [score:3]
The miR-17-92 cluster of miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) was also expressed at relatively high levels (accounting for 12.4% of the miRNAome) in the BP25 cell line. [score:3]
In addition, miR-17-92 cluster of miRNAs (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1, and miR-92-1) was also expressed at relatively high levels, accounting for 12.4% of the miRNAome in BP25. [score:3]
Other chicken miRNAs that are expressed at high levels in IAH30 cells include gga-miR-24 (5.5%), gga-miR-27b (4%), gga-miR-19b (3.9%), gga-miR-20a (3.9%), gga-miR-148a (3.7%), gga-miR-23b (3%), and gga-miR-92 (3%). [score:3]
[1 to 20 of 4 sentences]
3
[+] score: 10
For example, a comparison of miRNA expression profiles in proliferating myoblasts and differentiated myotubes revealed that miR-221 and miR-222 are down-regulated upon differentiation of primary and established myogenic cells, whereas miR-21, miR-103, miR-130, miR-99, miR-30 and miR20 are up-regulated [19, 33], suggesting that these miRNAs play important roles in the transition between proliferation and differentiation of muscle cells. [score:9]
In addition to miR-206, miR-1 and miR-181, nine other miRNAs among the most abundant in these libraries (miR-221, miR-222, miR-21, miR-103, miR-130, miR-99, miR-30, miR20, and miR128) have been implicated in the proliferation and differentiation of muscle cells (Table 1) [15, 19, 33]. [score:1]
[1 to 20 of 2 sentences]
4
[+] score: 8
Approximately 15.34% of the DEGs are targeted by at least two DEMs, and the LASP1 gene is regulated by seven DEMs (miR-24, miR-133a, miR-133b, let-7b, miR-20a, miR-20b and miR-130b). [score:4]
Let-7b is a key regulator of development [35], while miR-17-5p, miR-20a and miR-20b are members of miR-17 family, which play important roles during embryo development [63]. [score:4]
[1 to 20 of 2 sentences]
5
[+] score: 8
It is noteworthy that several of these miRNAs (gga-miR-17-5p, gga-miR-19a, gga-miR-19b and gga-miR-20a) were DEMs here (fold change 1.85 to 7.23) and were up-regulated in AbF from birds with high AbF contents. [score:4]
The miR17-92 cluster comprises seven miRNAs (miR-17-5p, miR-17-3p, miR-18a, miR-19a, miR-20a, miR-19b, and miR-92-1), and it has been shown to accelerate adipocyte differentiation by negatively regulating the tumor-suppressor Rb2/p130 32. [score:4]
[1 to 20 of 2 sentences]
6
[+] score: 5
In addition, the similar phenomenon was also observed in S. mansoni (miR-4, miR-6, miR-9, miR-32, miR-125, miR-3, and miR-5 were expressed in adult worms only, and miR-20, miR-18, miR-22, miR-26, and bantam were expressed in schistosomula only) (Simoes et al., 2011). [score:5]
[1 to 20 of 1 sentences]
7
[+] score: 4
The SDE miRNAs with high fold-changes were all down-regulated in L30, including miR-146b-5p (−8.50-fold), miR-24-3p (−7.39-fold), miR-146a-5p (−5.96-fold), miR-221-5p (−5.85-fold), miR-7b (−5.35-fold), miR-147 (−5.11-fold), miR-20-5p (−4.59-fold), and miR-140b-5p (−4.57-fold). [score:4]
[1 to 20 of 1 sentences]
8
[+] score: 3
Studies have suggested that E2F1 is the target gene of miR-20a (Sylvestre et al. 2007), miR-106b (Ambs et al. 2008), and miR-330 (Lee et al. 2009) in prostate cancer. [score:3]
[1 to 20 of 1 sentences]
9
[+] score: 3
An in silico search for putative binding sites of differentially abundant miRNAs was performed using TargetScan 6.0 [26]; note that non-conserved miRNAs (ENSGALT00000042483-3p, ENSGALT00000043002-3p, ENSGALT00000043002-5p, gga-miR-1736-3p) and those with borderline differential abundance (adjusted P-values of 0.0498; ccr-miR-133a-5p, mmu-miR-144-5p, gga-miR-20a, aca-miR-499-3p) were not included in the functional analysis. [score:3]
[1 to 20 of 1 sentences]
10
[+] score: 3
Moreover, the miR-17-92 cluster (miR-17, miR-18a, miR-19a, miR-20a, miR-19b-1 and miR-92-1) has been reported to be frequently over-expressed in human cancers and has oncogenic activity (He et al., 2005; Men dell, 2008). [score:3]
[1 to 20 of 1 sentences]
11
[+] score: 2
2014.289 25032870 6. Luo W Li G Yi Z Nie Q Zhang X E2F1-miR-20a-5p/20b-5p auto-regulatory feedback loop involved in myoblast proliferation and differentiationSci. [score:2]
[1 to 20 of 1 sentences]
12
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-140, hsa-mir-125b-2, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-206, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, gga-let-7i, gga-let-7a-3, gga-let-7b, gga-let-7c, gga-mir-125b-2, gga-mir-155, gga-mir-222a, gga-mir-221, gga-mir-92-1, gga-mir-19b, gga-mir-19a, gga-mir-18a, gga-mir-17, gga-mir-16-1, gga-mir-15a, gga-mir-1a-2, gga-mir-206, gga-mir-223, gga-mir-106, gga-mir-302a, gga-mir-181a-1, gga-mir-181b-1, gga-mir-16-2, gga-mir-15b, gga-mir-140, gga-let-7g, gga-let-7d, gga-let-7f, gga-let-7a-1, gga-mir-146a, gga-mir-181b-2, gga-mir-181a-2, gga-mir-1a-1, gga-mir-1b, gga-let-7a-2, gga-mir-34b, gga-mir-34c, gga-let-7j, gga-let-7k, gga-mir-23b, gga-mir-27b, gga-mir-24, gga-mir-122-1, gga-mir-122-2, hsa-mir-429, hsa-mir-449a, hsa-mir-146b, hsa-mir-507, hsa-mir-455, hsa-mir-92b, hsa-mir-449b, gga-mir-146b, gga-mir-302b, gga-mir-302c, gga-mir-302d, gga-mir-455, gga-mir-367, gga-mir-429, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-1458, gga-mir-1576, gga-mir-1612, gga-mir-1636, gga-mir-449c, gga-mir-1711, gga-mir-1729, gga-mir-1798, gga-mir-122b, gga-mir-1811, gga-mir-146c, gga-mir-15c, gga-mir-449b, gga-mir-222b, gga-mir-92-2, gga-mir-125b-1, gga-mir-449d, gga-let-7l-1, gga-let-7l-2, gga-mir-122b-1, gga-mir-122b-2
Within these clusters, the mir-92-mir-19b-mir-20a-mir-19a-mir-18a-mir-17, which is equivalent to the mammalian mir-17-92 cluster, and mir-302b-mir-302c-mir-1811-mir-302a-mir-302d-mir-367 cluster were the biggest clusters containing six miRNAs. [score:1]
[1 to 20 of 1 sentences]