sort by

74 publications mentioning rno-mir-125b-2

Open access articles that are associated with the species Rattus norvegicus and mention the gene name mir-125b-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 376
Other miRNAs from this paper: rno-mir-125a, rno-mir-125b-1
MiR-125b downregulates the expression of luciferase through Nestin 3’untranslated region (3’-UTR), and the regulation was abolished by mutations in the miR-125b binding site. [score:10]
Our study presented here revealed that the inhibition of Nestin expression by miR-125b provides double insurance to inhibit NS/PCs proliferation when miR-125b expression is elevated upon differentiation. [score:9]
MiR-125b Inhibits Nestin Expression by Binding to its 3’-UTRToward understanding the role of miR-125b involved in regulating wide array of cellular process in NS/PCs, it is therefore important to identify its target genes. [score:8]
The expression of this target is down-regulated as miR-125b accumulates. [score:8]
The results are in good agreement with previous findings demonstrating that exogenous miR-125b expression increased migration of ishikawa cells and abrogating expression of miR-125b suppressed migration of AN3CA cells in vitro [20]. [score:7]
Using the MicroCosm Targets (formerly miRBase Targets), miR-125b was identified to have a conserved target site in the 3’-UTR of Nestin gene (Figure 2A). [score:7]
Taken together, our data suggested that miR-125b regulates neural stem cell proliferation, differentiation and migration through targeting Nestin expression. [score:6]
The data also indicated the regulatory role of miR-125b in NS/PCs might through the suppression of Nestin expression. [score:6]
Immunostainings for BrdU show that the up-regulation of miR-125b inhibited the proliferation of NS/PCs (Figure 5). [score:6]
The results of real-time PCR assays were well consistent with the results of immunofluorescence indicating that overexpression of miR-125b can independently increase the expression of neuronal marker Tuj1 and Map-2 but decrease the expression of Nestin, Sox2 and Vimentin (Figure 6F). [score:6]
Transfection with miR-125b mimics led to down-regulation of Nestin mRNA and protein in NS/PC cells compared with NC, whereas treatment with miR-125b inhibitor induced the expression of Nestin increase in NS/PC cells compared with INNC. [score:6]
By using BrdU incorporation assays, we demonstrated that overexpression of miR-125b led to dramatically reduced NS/PCs proliferation in line with the results of Nestin siRNA -treated cells, indicating that miR-125b inhibit NS/PCs proliferation by targeting Nestin. [score:6]
The results showed that the expression pattern of miR-125b was up-regulated in a time -dependent manner with neural differentiation proceeded suggesting that miR-125b may be involved in differentiation of NS/PCs (Figure 1). [score:6]
When Nestin was knocked down by siRNA, the stimulus effect on cell proliferation and the inhibitory effect on differentiation and migration which miR-125b inhibitors bring about was weakened (Figure 8). [score:6]
The cells were transfected with 500 ng of wild-type or mutant reporter plasmid, 25 ng of Renilla luciferase expression vector, and miR-125b mimic (10nM) or miR-125b inhibitor (10nM) or equal amounts of NC, INNC (GenePharma Co. [score:5]
Also, the Nestin siRNA may weaken the inhibitory effect on NS/PCs migration which miR-125b inhibitors bring about. [score:5]
MiR-125b expression increases during neural stem cell differentiationNS/PCs may give rise to neural and neuronal progenitor cells, it has been demonstrated that the dynamic changes in the expression of miRNA occurs during neuronal differentiation. [score:5]
Furthermore, our studies first demonstrated that miR-125b suppresses the expression of Nestin by binding to the 3'-UTR of its mRNAs. [score:5]
The wild-type or mutant vector of Nestin was cotransfected into Hela cells with miR-125b mimics, miR-125b inhibitors, miR-125b NC (negative control), miR-125b INNC (inhibitor negative control). [score:5]
In order to further validate the function of miR-125b in NS/PCs activities via direct regulating Nestin, we transfected NS/PCs with miR-125b mimics and the Nestin overexpressed plasmid (Nes-640-GFP) simultaneously. [score:5]
The results indicated that miR-125b mimics and miR-125b inhibitors had little effect on luciferase expression with the ACTB 3’-UTR. [score:5]
As expected, the intracellular level of miR-125b was elevated by transfection of miR-125b mimics, and was decreased by the transfection of miR-125b inhibitors, showing that the cellular level of miR-125b could be controlled by the transfection of miR-125b mimics and miR-125b inhibitors (Figure 4B). [score:5]
These experiments demonstrated that miR-125b interacts directly with the binding site in Nestin 3’-UTR to regulate luciferase reporter expression. [score:5]
However, miR-125b mimics were unable to suppress luciferase expression with the mutant Nestin 3’-UTR which the putative binding sites of miR-125b were mutated (Figure 3B). [score:5]
In addition, it has also been demonstrated that miR-125b was up-regulated during neural differentiation of embryonic stem (ES) cells and embryo carcinoma (EC) cells. [score:4]
Figure 3 MiR-125b suppresses the expression of the luciferase reporter with Nestin 3’-UTR. [score:4]
To gain a better understanding the role of miR-125b involved in regulating wide array of cellular processes in NS/PCs, it is necessary to identify its target genes. [score:4]
To support the hypothesis that the effect of miR-125b on cellular process is mediated largely through Nestin, we also knocked down Nestin expression in NS/PCs using its sequence-spcific siRNA. [score:4]
In conclusion, these results support the conclusion that miR-125b is implicated in regulating its downstream target genes, Nestin, which play a crucial role in NS/PCs proliferation, differentiation and migration. [score:4]
In order to understand the role of miR-125b in the regulation of neuronal differentiation, the expression pattern of miR-125b was performed by real-time PCR. [score:4]
Taken together, these experiments support the hypothesis that Nestin is a direct target of miR-125b and that miR-125b activation in NS/PCs elicits a decrease of Nestin protein. [score:4]
Our study presented here revealed a previously undescribed link between miR-125b and an essential stem cell regulator Nestin, identified it as a key target of miR-125b in NS/PCs. [score:4]
Real-time PCR analyses indicated that miR-125b is significantly up-regulated during the differentiation of NS/PCs. [score:4]
Our results are coincident with previous reports indicating that miR-125b was up-regulated during neural differentiation process [10- 12]. [score:4]
MiR-125b Inhibits Nestin Expression by Binding to its 3’-UTR. [score:4]
Subsequently, we demonstrated that Nestin was a direct functional target of miR-125b. [score:4]
Also, the Nestin siRNA may weaken the inhibitory effect on NS/PCs differentiation which MiR-125b inhibitors bring about. [score:4]
Both real-time PCR and western blot data suggests that miR-125b could repress Nestin expression at both the mRNA and protein levels via directly binding to its 3'-UTR. [score:4]
When miR-125b mimics were co -transfected with the Nestin reporter constructs, luciferase activity was significantly suppressed compared with cotransfection with miR-125b inhibitors, NC and INNC. [score:4]
Taken together, these findings indicated that Nestin is a direct downstream target for miR-125b in NS/PCs. [score:4]
Site-directed mutagenesis was performed to mutate base pairs in the predicted seed region targeted by miR-125b in the Nestin 3'-UTR. [score:4]
We demonstrated the important role of miR-125b in coordinating the proliferation and differentiation of NS/PCs using both knockdown and ectopic expression approaches. [score:4]
Toward understanding the role of miR-125b involved in regulating wide array of cellular process in NS/PCs, it is therefore important to identify its target genes. [score:4]
The results indicated that overexpression of miR-125b led to a increase in cell migration whereas knockdown of miR-125b led to a reduction in cell migration compared to control group in NS/PCs (Figure 7). [score:3]
MiR-125b inhibits NS/PCs proliferationIn an attempt to investigate whether miR-125b influences the proliferation of NS/PCs, we performed BrdU labeling on rat NS/PCs after transfection of miR-125b mimics, miR-125b inhibitor, NC and INNC. [score:3]
It is likely that the distinct temporal expression patterns of miR-125b reflect its specific roles in coordinating gene expression profiles that characterize neural cell fate determination. [score:3]
We considered the possibility of these biological changes induced by miR-125b may be due to the down-regulation of Nestin. [score:3]
In addition, our study does not exclude the possibility that additional target genes may also play a role in miR-125b function in NS/PCs. [score:3]
Minh T et al. have also demonstrated that the ectopic expression of miR-125b increases the percentage of differentiated SH-SY5Y cells with neurite outgrowth. [score:3]
When cells reached 70% confluence, the miR-125b mimics, miR-125b inhibitor, NC and INNC was transfected into the cells. [score:3]
Taken together, we identified Nestin as a target of miR-125b in NS/PCs by using a bioinformatics approach and experimental validation. [score:3]
In another group, NS/PCs were cotransfected with Nestin siRNA and miR-125b inhibitor, 10 μM Nestin siRNA and 10 nM of miR-125b mimics were mixed together to perform the cotransfection experiments. [score:3]
It has previously been reported that miR-125b is a positive regulator of differentiation of human neural progenitor ReNcell VM (RVM) cells [19], but the underlying mechanism of how it regulates proliferation is not known. [score:3]
Also, the Nestin siRNA may decrease the stimulus effect on proliferation which miR-125b inhibitors bring about. [score:3]
Figure 8 MiR-125b regulates NS/PCs activities by targeting Nestin. [score:3]
MiR-125b regulate NS/PCs activities by targeting Nestin. [score:3]
In our study we first quantified the relative expression levels of miR-125b during neural differentiation. [score:3]
Figure 5 miR-125b inhibit NS/PCs proliferation. [score:3]
The results indicated that miR-125b over -expression enhances rate of neuron differentiation, by contrast, knockdown of miR-125b decreases rate of neuron differentiation compared to the control. [score:3]
Hence, our data support the idea that Nestin as a downstream target of miR-125b was implicated in NS/PCs activities, such as proliferation, differentiation and migration. [score:3]
We report here the transfection of exogenous miR-125b inhibited proliferation of NS/PCs but promoted differentiation and migration. [score:3]
Figure 1 Expression pattern of miR-125b and Nestin in NS/PCs during differentiation. [score:3]
Furthermore, we determined to test whether depletion of Nestin may weakened the role of miR-125b inhibitors in NS/PCs. [score:3]
MiR-125b down-regulated luciferase activities controlled by wild-type Nestin 3’UTR, but did not affect luciferase activity controlled by mutant Nestin 3’UTR. [score:3]
Overexpression of miR-125b resulted in the percentage of Tuj1 and Map-2 positive cells increased, whereas that of Nestin -positive cells decreased. [score:3]
We demonstrated that exogenously expressed Nestin could rescue the effect on NS/PCs proliferation, differentiation and migration resulting by miR-125b mimics (Figure 8). [score:3]
We constructed vectors containing wild-type or mutant 3’-UTR of Nestin directly fused to the downstream of the Firefly luciferase gene to verify that the putative miR-125b binding site in the 3’-UTR of Nestin is responsible for regulation by miR-125b (Figure 3A). [score:3]
Also, we provided direct evidence that miR-125b is a positive regulator of migration during early neuronal differentiation of NS/PCs. [score:3]
Using a luciferase assay, we showed that miR-125b directly target Nestin through binding a specific site in its 3’-UTR in NS/PCs. [score:3]
MiR-125b, a brain-enriched miRNA, is highly expressed in the central nervous system (CNS), including the brain and spinal cord. [score:3]
Furthermore, we constructed the 3'-UTR vectors of ACTB and then cotransfected the vector into Hela cells with miR-125b mimics and inhibitors. [score:3]
Figure 2 Identification of a miR-125b target site in the 3’UTR of Nestin mRNA. [score:3]
Given that knockdown of Nestin was sufficient to activate cdk5 anctivity, miR-125b promote neural differentiation and migration might via activate cdk5 activity during early neuronal differentiation of NS/PCs. [score:2]
MiR-125b inhibits NS/PCs proliferation. [score:2]
Taken together, these observations suggest that miR-125b may act as an ancient regulatory switch for neuronal differentiation in stem cells. [score:2]
Expression pattern of miR-125b in NS/PCs during differentiation quantified by real-time PCR using specific Taqman primers. [score:2]
We used transwell migration assay to compare the in vitro migratory capacities of NS/PCs among groups transfected with miR-125b mimics, miR-125b inhibitor, NC, INNC. [score:2]
Following transfected with miR-125b mimics, miR-125b inhibitors, NC, INNC, NS/PCs were cultured in differentiation conditions for 72 h. A significant decrease in the number of Nestin -positive cells, Sox2 -positive cells and Vimentin -positive cells was found in NS/PCs transfected with miR-125b mimics compared to control group (Figure 6A, B, C). [score:2]
Our data showed the involvement of miR-125b in the coordinated regulation of proliferation, differentiation and migration in NS/PCs. [score:2]
The work also indicated that miR-125b mediated silencing of Nestin may be involved in regulating NS/PCs cell proliferation, differentiation and migration. [score:2]
MiR-125b expression increases during neural stem cell differentiation. [score:2]
MiR-125b promotes the migration of NS/PCsWe used transwell migration assay to compare the in vitro migratory capacities of NS/PCs among groups transfected with miR-125b mimics, miR-125b inhibitor, NC, INNC. [score:2]
Their report demonstrates that miR-125b is important in regulating neuronal differentiation [11]. [score:2]
A better understanding of the role exerted by miR-125b in NS/PCs will contribute to offer promising prospects for their increasing application in the development of new cellular therapies in humans. [score:2]
Subsequently, we transfected miR-125b mimics, miR-125b inhibitor, NC and INNC in NS/PCs to evaluate whether Nestin mRNA and protein levels are directly affected by the activation of miR-125b. [score:2]
MiR-125b targeted the 3'-UTR of Nestin and reduced the abundance of Nestin at both mRNA and protein levels. [score:2]
Data from computational analyses suggest that Nestin may be regulated by miR-125b. [score:2]
Figure 4 Efficient transfection of miR-125b in NS/PCs. [score:1]
The siRNA transfected NS/PCs showed a similar biological behavior as observed in the cells transfected with miR-125b mimics. [score:1]
miR-125b, one of neuronal miRNAs, recently was found to be necessary for neural differentiation of neural stem/progenitor cells (NS/PCs). [score:1]
The full length 3'-UTR of the human Nestin gene and the fragment containing the putative miR-125b binding site were amplified from human cDNA and individually cloned into a modified pGL3-promoter vector (Promega, Madison, WI, USA). [score:1]
As a homolog of lin-4 (82% identical), miR-125b is highly conserved from flies to humans (100% identical) [9]. [score:1]
We next examined whether miR-125b influences the differentiation of NS/PCs. [score:1]
The results provided new insight into the function by which miR-125b modulates NS/PCs proliferation, differentiation and migration. [score:1]
In an attempt to investigate whether miR-125b influences the proliferation of NS/PCs, we performed BrdU labeling on rat NS/PCs after transfection of miR-125b mimics, miR-125b inhibitor, NC and INNC. [score:1]
We used rat NS/PCs as a mo del system to study the role of miR-125b in governing the behavior of NS/PCs. [score:1]
Figure 6 miR-125b accelerates neural differentiation. [score:1]
In the present study, we systematically investigated the functions of miR-125b in NS/PCs and found new downstream target of miR-125b. [score:1]
We also identified miR-125b promotes migration during the early stages of neuronal differentiation. [score:1]
To further validated the interaction between miR-125b and the Nestin 3’-UTR, the luciferase reporter system was used. [score:1]
As mentioned above, there is growing evidence to suggest a role for miR-125b during neuronal differentiation. [score:1]
The nucleotide pairing of miR-125b and Nestin 3'-UTR. [score:1]
Moreover, our results suggested that miR-125b promote migration during the early differentiation of NS/PCs. [score:1]
MiR-125b accelerates neural differentiation of NS/PCsWe next examined whether miR-125b influences the differentiation of NS/PCs. [score:1]
For each well of a Lipofectamine LTX transfection, 2.5 μg of NES-640-GFP plamid DNA and 10nM of miR-125b mimic were combined with 1.25 μl of Plus reagent (Invitrogen,catalog number 11514-015) in 500 μl of serum-free media for 5 min. [score:1]
The role of miR-125b in promoting the differentiation of NS/PCs was demonstrated further by staining for neuronal markers. [score:1]
Although 3’-UTR sequences of Nestin are not highly conserved in mammals, the putative binding sites for miR-125b in Nestin are also found in both human and rat (Figure 2B). [score:1]
Transfection of NS/PCs with a FAM-labeled miR-125b mimics indicated the high efficiency of transfection after 24 hours (Figure 4A). [score:1]
Considering that there still lies some complementary sequence to miR-125b in the Nestin 3'-UTR besides the bases we have mutated, the binding force between miR-125b and the Nestin 3'-UTR was weakened but not eliminated. [score:1]
Upon neural differentiation, miR-125 as a key player in the molecular cascade that contributes to the irreversible commitment of pluripotent human stem cells to the neural lineage [10]. [score:1]
Sequence alignment indicates that miR-125b is 100% conserved in human and rat. [score:1]
Computer analysis predicted that miR-125b had partial sequence complementarity within the 3’-UTR region of the Nestin mRNA. [score:1]
This program predicted a putative binding site for miR-125b in the Nestin 3’-UTR. [score:1]
The Nestin 3’-UTR sequences containing the putative binding sites of miR-125b were inserted into the the pGL3 luciferase reporter vector. [score:1]
However, the other specific biological role of miR-125b in NS/PCs is little known. [score:1]
Quantitation and representative photomicrographs showing that miR-125b promote cell migration in NS/PCs. [score:1]
Whereas anti-miR-125b had the opposite effect. [score:1]
In the meantime, decrease of Nestin by RNAi strikingly accelerated the neural differentiation process, suggesting that miR-125b promoted differentiation might be mediated by Nestin. [score:1]
On the other hand, The percentage of Tuj1 -positive cells and Map2 -positive cells in NS/PCs transfected with miR-125b mimics were significantly higher than control group (Figure 6D, E). [score:1]
We also evaluated transfection efficiency by detecting the relative expression of miR-125b. [score:1]
In rescue experiment, NS/PCs were cotransfected with the plasmid NES-640-GFP and miR-125b mimics. [score:1]
In contrast, the level of miR-125b is increased significantly upon differentiation. [score:1]
For quantification of miR-125b, 2 μg total RNA was reverse-transcribed and amplified by using the microRNA reverse transcription and detection Kit (Applied Biosystems, Inc. [score:1]
[1 to 20 of 123 sentences]
2
[+] score: 226
The expression of the Hh signaling molecules, shh, s mo, gli2, and gli3, and the profibrotic genes, vimentin and mmp9, was downregulated in primary HSCs co-cultured with CP-MSCs or scrambled inhibitor -transfected CP-MSCs, whereas the expression of those genes was upregulated in primary HSCs co-cultured with miRNA-125b -inhibited CP-MSCs (Fig. 7). [score:15]
Although the expression level of miRNA-125b in CP-MSCs were significantly downregulated at 12 and 24 hours after transfection (Supplementary Fig. S7B), the transfected cells for 12 hours were used in the co-culture experiments, considering the suppressive effect of the inhibitor in the expression of miRNA-125b. [score:12]
QRT-PCR analysis of the expression of Hh signals, including shh, smo, gli2, and gli3, and profibrotic genes, including vimentin and mmp9, in LX2 mono-culture (alone), LX2 treated with 1 μM GDC-0449 (Smo antagonist), and co-cultured LX2 with CP-MSCs (CP-MSC), CP-MSC having miRNA-125b inhibitor (CP-MSC miRNA-125b inhibitor), or CP-MSC having scrambled-miRNA inhibitor (CP-MSC (-) CON) for 12 hours. [score:9]
The miRNA-125b inhibitor effectively reduced the expression of miRNA-125b in CP-MSCs at 12 to 24 hours after transfection, whereas the false inhibitor affected neither the expression of miRNA-125b nor the cell viability of CP-MSCs (Supplementary Fig. S7B). [score:9]
QRT-PCR analysis of the expression of Hh signals, including shh, smo, gli2, and gli3, and profibrotic genes, including vimentin and mmp9, in mono-cultured primary HSCs isolated from rats with CCl [4] -induced fibrosis (alone), and co-cultured primary rat HSCs with CP-MSCs (CP-MSC), CP-MSC having miRNA-125b inhibitor (CP-MSC miRNA-125b inhibitor), or CP-MSC having scrambled-miRNA inhibitor (CP-MSC (-) CON) for 12 hours. [score:9]
Subsequently, the expression of the Hh signaling molecules, shh, s mo, gli2, and gli3, and the profibrotic genes, vimentin and mmp9, was still higher in co-cultured LX2 with miRNA-125b -downregulated CP-MSCs than in any other treatment group, such as LX2 cultured with GDC-0449, CP-MSCs, or CP-MSCs having a negative control inhibitor (Fig. 6). [score:8]
MiRNA-125b -downregulated CP-MSCs fail to downregulate expression of Hh signaling and profibrotic genes in LX2. [score:8]
CP-MSCs were transfected with 10 nM of human miRNA-125b inhibitor or scrambled-miRNA inhibitor not disturbing any miRNA expression, demonstrating transfection specificity. [score:7]
These results suggest that the exosomes in CP-MSCs contained miRNA-125b, which inhibited the expression of Hh-target genes. [score:7]
CP-MSCs (1 × 10 [5] cells/well) cultured for 24 hours were transfected with 10 nM of miRNA-125b inhibitor (AccuTarget™ human miRNA-125b inhibitor, Bioneer corp. [score:7]
Before treating cells with miRNA inhibitors, the diluted miRNA-125b inhibitor or negative control inhibitor in Opti-MEM® I reduced serum medium (Gibco) was incubated with the diluted Lipofectamine RNAiMAX transfection reagent (Invitrogen) in Opti-MEM® I for 20 minutes at RT to make the transfection complexes. [score:7]
Taken together, those results support our hypothesis that CP-MSCs release exosomes or MVs containing miRNA-125b into target cells, such as Hh-responsive HSCs, and hinder the activation of Hh signaling by inhibiting Smo expression, eventually alleviating hepatic fibrosis. [score:7]
To confirm whether the inhibitory effect of CP-MSCs on Hh signaling was caused by miRNA-125b, LX2 was co-cultured with CP-MSCs in which miRNA-125b expression was inhibited. [score:7]
In addition, our co-culture experiments demonstrated that CP-MSCs inhibited the expression of Hh signaling and profibrotic genes in LX2 and primary HSCs, whereas miRNA-125b -suppressed CP-MSCs did not induce such changes in those cells (Figs 4, 6 and 7). [score:7]
Therefore, these findings suggest that miRNA-125b produced by CP-MSCs inhibits the activation of MF-HSCs by regulating Hh expression. [score:6]
The expression of miRNA-125b was also significantly increased in the CP-MSC-transplanted livers, and upregulation of miRNA-125b led to a reduction of Smo. [score:6]
In addition, Tx livers showed upregulation of miRNA-125b (1.98 ± 0.34-fold increase compared to healthy liver), whereas non-Tx livers showed downregulation of miRNA-125b (0.50 ± 0.02-fold decrease compared to healthy liver) at two weeks post-transplantation (Fig. 5C). [score:5]
Our findings demonstrate for the first time that CP-MSCs harbor miRNA-125b inhibiting expression of Smo, and attenuate Hh activation in CP-MSC-transplanted liver, suggesting that Hh signaling plays a pivotal role in the regenerative effects of CP-MSCs on liver with chronic damage. [score:5]
Hh signaling and profibrotic genes were highly expressed in activated primary HSCs co-cultured with CP-MSCs containing miRNA-125b inhibitor. [score:5]
It was previously reported that miRNA-125b, miRNA-324-5p and miRNA-326 targeted Hh target genes in human medulloblastoma cell lines 33. [score:5]
LX2 transfected with miRNA-125b mimic showed increased expression of miRNA-125b after transfection (Fig. 8A), followed by decreased expression of Hh pathway genes, smo, gli2, and gli3, and profibrotic genes, col1α1, vimentin, and mmp9 (Fig. 8B). [score:5]
CP-MSCs showed highly increased expression of miRNA-125b targeting s mo compared to human healthy liver and activated LX2 (p < 0.005). [score:4]
After miRNA-125b was successfully downregulated in CP-MSCs at 12 hours, we transferred the Transwell inserts containing CP-MSCs onto wells with fully activated LX2, and then co-cultured those cells for 12 hours. [score:4]
MiRNA-125b by CP-MSCs suppresses activation of HSCs by abrogating Hh expression. [score:4]
It is possible that abundant miRNA-125b in the CP-MSCs and in the CP-MSC-transplanted liver downregulates the Hh activator Smo and Glis. [score:4]
Our results demonstrated that miRNA-125b produced by CP-MSCs regulated the expression of Hh signaling which promoted the regression of fibrosis, eventually contributing to liver regeneration. [score:4]
Transfection of miRNA-125b inhibitor into CP-MSCs. [score:3]
In line with previous findings, we present evidence that miRNA-125b is highly expressed in CP-MSCs, but not in LX2 (Fig. 5A,B), and that it is retained in the exosomes released from CP-MSCs (Fig. 5E). [score:3]
The expression level of miRNA-125b in CP-MSCs transfected with the negative control was equivalent to that in CP-MSCs without transfection. [score:3]
LX2 (1.5 × 10 [5] cells/well) cultured for 24 hours were transfected with 10 nM of miRNA-125b mimic (AccuTarget™ human miRNA-125b mimic, Bioneer corp. [score:3]
The expression of miRNA-125b showed a gradual increase, peaking at 72 hours followed by an eventual decline during CP-MSCs culture (Supplementary Fig. S7A). [score:3]
To show whether the inhibitory action of miRNA-125b in the activation of HSCs was relevant to physiological condition, we isolated primary HSCs from chronically damaged liver of rats (Supplementary Fig. S8). [score:3]
These activated HSCs were co-cultured with CP-MSCs transfected with scrambled or miRNA-125b inhibitor. [score:3]
ISH analysis showed the expression of miRNA-125b (brown-colored dots) in cytosol of CP-MSCs (Fig. 5B). [score:3]
CP-MSCs express miRNA-125b. [score:3]
MiRNA-125b regulates expression of Hh signaling and profibrotic genes in LX2. [score:3]
Because Hh signaling is known as a viable factor for myofibroblastic HSCs 21 31, it confirms our findings that CP-MSCs lead to miR-125b -suppressed Hh signaling, which contributes to the decreased viability of myofibroblasts, activated HSCs. [score:3]
The differential expression of miRNA-125b in the non-Tx and Tx livers was sustained until three weeks post transplantation. [score:3]
MiRNA-125b is complementary to the 3′-untranslated region on the smo gene conserved in human and mouse 33. [score:2]
MiRNA-125b is expressed in CP-MSCs. [score:2]
In addition, we transfected directly miRNA-125b mimic into LX2 in order to assess the specific function of miRNA-125b on LX2 activation. [score:2]
To perform ISH, cells were fixed, prehybridized in microRNA ISH buffer (Exiqon, Vedbaek, Denmark) at 55 °C for 2 hours, and hybridized with 5′-digoxigenin (DIG)-labeled LNA™ microRNA probe (Exiqon, Vedbaek, Denmark) detecting hsa-miRNA-125b-5p or scramble-miRNA at 55 °C overnight. [score:1]
One study reported that miRNA-125b is rich in MSCs derived from human BM, as well as in human liver resident stem cells (HLSCs) 15. [score:1]
In situ hybridization (ISH) for miRNA-125b in cells. [score:1]
The transfected CP-MSCs with miRNA-125b or negative control were transferred into co-culture system and cultured with fully activated with LX2 for 12 hours. [score:1]
Isolation and analysis of exosomal miRNA-125b of CP-MSCs. [score:1]
QRT-PCR analysis revealed that miRNA-125b expression was greater in the exosomes from CP-MSC-CM than in human normal liver and LX2 (51.09 ± 13.97-fold increase compared to healthy live; 69.47 ± 18.99-fold increase compared to LX2). [score:1]
In situ hybridization (ISH) for miRNA-125b in cells1 × 10 [5] cells/well (6-well plate) of CP-MSCs and LX2 were seeded and cultured in growth medium for 24 hours. [score:1]
Transfection of miRNA-125b mimic into LX2. [score:1]
[1 to 20 of 49 sentences]
3
[+] score: 200
We used established methods for modulating gene expression levels in vivo in axolotl, and showed that inhibition of miR-125b leads to defective axonal regeneration due to upregulation of the axon-repulsion gene Sema4D. [score:8]
Blue text indicates genes that were upregulated in miR-125b -mimic -treated rats; yellow text indicates genes that were downregulated in miR-125b -mimic -treated rats. [score:7]
In support of this mo del, overexpression of either axolotl or human Sema4D in cells at the injury site was sufficient to inhibit axonal regeneration in axolotl, and generates a similar phenotype as that resulting from treatment with the miR-125b inhibitor (supplementary material Fig. S3A). [score:7]
In the future it will be interesting to follow up on the role of several of these target genes; for example, SLC16A6, which encodes a monocarboxylate transporter, is a predicted target of miR-125b and its expression levels were significantly decreased in miR-125b -mimic -treated rats after injury. [score:7]
This role for Sema4D in axolotl, and its regulatory link to miR-125b, were both corroborated by results showing that inhibition of miR-125b causes upregulation of Sema4D in cells at the injury site (Fig. 3H; supplementary material Fig. S3A), whereas decreased levels of Sema4D were observed in mimic -treated animals (supplementary material Fig. S3B). [score:7]
Reduction of miR-125b in the axolotl to levels similar to those in rat was found to inhibit regeneration via upregulation of an ‘axon repulsion’ gene, Sema4D. [score:6]
These data suggest that the earlier and more pronounced decrease in abundance of miR-125b in axolotl compared with rat could be an important and active regulatory process required for regeneration in this species, presumably by triggering the upregulation of one or more gene(s) targeted by miR-125b. [score:6]
For the axolotl studies, ablation injuries were performed and the levels of miR-125b were modulated by microinjection of a synthetic inhibitor: an RNA hairpin that binds owing to its complementary sequence to the mature miRNA, sequestering the miRNA and inhibiting the miRNA from functioning. [score:5]
Microinjection of a miR-125b inhibitor in axolotl to reduce miR-125b to levels similar to those observed in rats resulted in strong inhibition of axonal regeneration (Fig. 3A,C) and a degeneration of axons caudal to the injury site (Fig. 3B,D). [score:5]
miR-125b is expressed in similar cell types in axolotl and rat, but the expression levels are very different in uninjured and injured tissues. [score:5]
MiR-125b expression affects the proliferation and apoptosis of human glioma cells by targeting Bmf. [score:4]
Our data show that miR-125b and its target Sema4D need to be regulated in the right cells at the right time to guide axons through the lesion site (Fig. 7A,B). [score:4]
Downregulation of miR-125b is necessary for faithful axon regeneration in axolotls. [score:4]
Array analysis identified differential regulation of multiple targets of miR-125b in the mimic -treated rat samples. [score:4]
Sema4D is a conserved target of miR-125b in axolotl and ratWe used bioinformatics analyses to identify downstream protein-coding transcripts regulated by miR-125b. [score:4]
The phenotypic observations from the inhibition of miR-125b and from increasing the levels of mature miR-125b after spinal cord injury suggest that a precise regulation of that miRNA is necessary to achieve functional regeneration in axolotl. [score:4]
Sema4D is a conserved target of miR-125b in axolotl and rat. [score:3]
The array analysis of the animals shows that a single dose of miR-125b targets multiple pathways that improve functional recovery after complete transection of the spinal cord. [score:3]
The initial comparative array analysis showed that miR-125b is expressed at ~eightfold lower levels in rat than in axolotl. [score:3]
Astrocytes had the highest level of miR-125b expression in rat (Fig. 1C). [score:3]
After injury, only a slight decrease in miR-125b was initially observed, but its levels were significantly reduced at 7 days post-injury, when the predicted target gene, Sema4D levels are increased. [score:3]
Under pre-injury conditions in axolotl, we found that miR-125b expression in the spinal cord was concentrated primarily in radial glial cells (Fig. 1C); the control mismatched probe showed no specific staining (supplementary material Figs S1, 2). [score:3]
This suggests that miR-125b plays a role in fine-tuning gene expression during regeneration (Fig. 7B). [score:3]
These data indicate that precise control of miR-125b expression is required for correct regeneration of the axolotl spinal cord following complete-transection injuries. [score:3]
A miRNA that is expressed at significantly different levels between the two species, miR-125b, was selected for further in vivo analysis. [score:3]
In vitro analysis in primary astrocytes showed that inhibition of miR-125b leads to increased levels of the Sema4D protein, and reduction of Sema4D by RNAi creates a more permissive environment for neural outgrowth after scratch -induced injury (supplementary material Fig. S5). [score:3]
Modulators were microinjected among the glial cells within 500 μm rostral or caudal to the injury because in situ hybridization studies showed that these were the main cells expressing miR-125b (Fig. 1C). [score:3]
Fig. 3. Inhibition of miR-125b in axolotl after injury causes defects in regeneration. [score:3]
Animals received injections into the spinal cord with 10 μM miR-125b mimic or 20 μM miR-125b inhibitor (Dharmacon, Thermo Scientific) suspended in buffer [phosphate-buffered saline (PBS) + 0.1 mg/ml Fast Green] using a pressurized microinjector (WPI) and a Leica dissecting microscope. [score:3]
The efficiency of modulation of the levels of miR-125b was quantified by qRT-PCR, and was effective for both mimic and inhibitor (Fig. 2E,F). [score:3]
Fig. 4. Mimic treatments to increase miR-125b levels in vivo following spinal cord injury in rat lead to decreased levels of the target gene Sema4D. [score:3]
Using this cell-culture injury mo del, we observed that in vitro inhibition of miR-125b in astrocytes led to increased levels of Sema4D (supplementary material Fig. S4A,B). [score:3]
RT-PCR (One-Step RT-PCR kit, Qiagen) was performed using total RNA extracted from spinal cords of axolotls injected with 20 μM miR-125b inhibitor. [score:3]
On the basis of these results, we hypothesize that the requirement for precisely controlled levels of miR-125b early during axolotl spinal cord regeneration underlies an equally precise and rapid increase in expression of Sema4D that is essential for faithful and functional regeneration. [score:3]
However, the levels in the rat spinal cord were below the detection level of in situ hybridization, so qRT-PCR was used to identify the cells that express miR-125b in the adult rat spinal cord. [score:3]
In miR-125b -inhibitor -injected animals, fibrin deposition, an indicator of scar tissue, is observed in the neural tube (arrows and asterisk in F) (n=15). [score:3]
We do not rule out that miR-125b could target other genes that might be involved in the glial-scar response. [score:3]
We identified miR-125b as an interesting candidate for further study because it showed marked differences between axolotl and rat, and it has been implicated previously in normal development and in cancer and stem-cell differentiation (Le et al., 2009; Xia et al., 2009; Zhang et al., 2011). [score:2]
MicroRNA-125b promotes neuronal differentiation in human cells by repressing multiple targets. [score:2]
Significant regulation of genes involved in stabilizing microtubules was also observed, suggesting that more axons might be preserved at the injury site in miR-125b -treated animals. [score:2]
Maintaining high levels of miR-125b after injury also leads to defective axonal regeneration because the axons sprout randomly around the injury site and are not directed through the lesion site. [score:2]
We used bioinformatics analyses to identify downstream protein-coding transcripts regulated by miR-125b. [score:2]
This observation in the knockout mice corresponds with the locomotive recovery observed in the miR-125b -treated rats. [score:2]
These results support the proposed miR-125b– Sema4D regulatory pathway. [score:2]
The arrays revealed ~1500 genes that were differentially regulated in the mimic -treated animals; 53 of these were predicted to have seed sequences for miR-125b in the 3′ UTR, and 23 of the 53 were significantly decreased on the rostral side of the injury (supplementary material Table S1). [score:2]
Fig. 7. Mo del of miR-125b and Sema4D regulation of axonal regeneration in axolotl after injury. [score:2]
However, in vivo antero- and retrograde tracing of axons in control- and mimic -treated animals showed no clear evidence of regeneration of long-tract axons in miR-125b -mimic -treated animals. [score:1]
At the same time point, the caudal side showed a more modest (~20–30%) decrease in miR-125b levels in axolotl, whereas the corresponding levels did not change dramatically in rat. [score:1]
The authors then tested the effect of increasing the levels of miR-125b in rat after spinal cord injury; this was found to result in an overall positive effect on regeneration, including a significant improvement in locomotive ability in some animals. [score:1]
Therefore, microarrays were performed using RNA samples harvested at 1 week post-treatment of control- and miR-125b -mimic -treated animals. [score:1]
Initial cell-culture experiments showed that astrocytes had the highest levels of both miR-125b and Sema4D (Fig. 1D; supplementary material Fig. S1B). [score:1]
These data gave us a rationale to modulate miR-125b levels in vivo in rat after spinal cord injury. [score:1]
This could suggest that miR-125b plays a different role depending on the regeneration paradigm and will be interesting to determine in the future. [score:1]
After spinal cord injury in rat, miR-125b levels were significantly decreased by 7 days post-injury and Sema4D levels increased (Fig. 4A). [score:1]
By contrast, the levels of miR-125b in rat displayed marked decreases from day 1 to 7 on both sides of the injury, which coincided with the emergence of a glial scar (Fig. 1B). [score:1]
In vivo modulation of miR-125b and Sema4D levels in axolotlsAll the animals used in the experiments were naturally bred and grown in the axolotl facility of the Max Plank Institute for Cell Biology and Genetics (Dresden, Germany) and the University of Minnesota. [score:1]
Immediately prior to surgery, miR-125b mimic (Qiagen) was mixed with the 15% pluronic gel at 4°C to obtain a final concentration of 10 μM. [score:1]
Increased levels of miR-125b promote a more regeneration-permissive environment in rat. [score:1]
The mimic induced increased levels of miR-125b, resulted in aberrant sprouting of the axons on both the rostral and caudal sides, and reduced the growth of axons through the lesion site by 7 days post-injury (Fig. 2B), at which time the control animals showed full regeneration (Fig. 2A). [score:1]
To assess whether miRNA supplementation affected spinal cord repair, another set of animals underwent spinal cord transection as described above, and underwent treatment with 100 μl pluronic gel alone (n=14) or pluronic gel with 10 μM miR-125b (n=18) applied into the transection site. [score:1]
We investigated how these results might translate to the mammalian mo del by modulating the levels of miR-125b in vitro in rat primary neural cells. [score:1]
To increase the levels of miR-125b, a commercially available chemically synthesized mature form of the miRNA (mimic) was injected after injury (Diaz Quiroz and Echeverri, 2012). [score:1]
Fig. 5. Mimic treatment to increase miR-125b levels in vivo in rat following complete spinal cord transection improves functional recovery. [score:1]
The miR-125b in pluronic gel was injected into the lesion site immediately after injury. [score:1]
In the miR-125b -treated animals, the number and length of axons projecting into the scar tissue increased (Fig. 5B). [score:1]
We then examined the role of miR-125b in rat. [score:1]
To test this hypothesis, we studied the effects of modulating miR-125b levels in vivo on spinal cord injury repair following complete transection in both axolotl and rat. [score:1]
Fig. 6. Mo del of how miR-125b promotes a regeneration-permissive environment in rat. [score:1]
To test whether this pathway is conserved in axolotl, we cloned the axolotl homolog of Sema4D and found that it contained an 8-mer seed sequence for miR-125b in its 3′ UTR (supplementary material Fig. S1B). [score:1]
A synthetic mimic of the mature form of rat miR-125b, which is identical to human, mouse and axolotl miR-125b, was mixed into pluronic gel, an inert biodegradable gel that facilitates the localized delivery of siRNAs in vivo to the spinal cord (Cronin et al., 2006). [score:1]
Both groups that received pluronic gel and pluronic gel with miR-125b mimic underwent behavioral assessments once a week for 8 weeks. [score:1]
Fig. 2. Increased levels of miR-125b in vivo in axolotl after injury leads to defects in regeneration. [score:1]
We tested the effect of modulating the levels of miR-125b in vivo in rat following spinal cord injury. [score:1]
miR-125b levels are reduced after injury, whereas Sema4D is more abundant in a discrete set of cells (green circles) and functions to repel axons (red lines) and thereby guide them to grow through the lesion site (green dots) along the ependymal tube formed by radial glial cells (peach ovals). [score:1]
In previous studies we also used transcriptional profiling to identify miRNAs involved in the early stages of tail regeneration; interestingly, in that study, increased levels of miR-125b were seen at 3 days post-amputation (Sehm et al., 2009). [score:1]
This included BBB scores ranging from 4–5 for the majority of miR-125b -mimic -treated animals. [score:1]
In vivo modulation of miR-125b and Sema4D levels in axolotls. [score:1]
By 1 day after spinal cord transection, the rostral side of the injury site showed a rapid ~40% reduction of the initially high miR-125b levels in axolotl, whereas the corresponding levels decreased by less than 1% in rat (Fig. 1B). [score:1]
[1 to 20 of 78 sentences]
4
[+] score: 199
INH also decreased the expression of miR-122, which corresponded to the increase of two gene targets: Cyclin G1 and CAT-1. Finally, the aberrant downregulation of miR-125b and miR-106b upregulated the STAT3 expression to stimulate the secretion of inflammatory factors during INH -induced liver injury. [score:13]
The above results suggested that the aberrantly downregulated miR-125b and miR-106b upregulated the STAT3 expression to stimulate the secretion of inflammatory factors during INH -induced liver injury. [score:9]
Taking these experimental data into consideration, we can conclude that aberrant downregulation of miR-125b and miR-106b can upregulate STAT3 expression to stimulate the secretion of inflammatory factors involved in INH -induced liver injury. [score:9]
Our results suggested that DNA methylation likely regulated the expression of miRNA genes (miR-122, miR-125b and miR-106b), thereby affecting the expression of their target genes (Cyclin G1, CAT-1 and STAT3) and participating in the process of INH -induced liver injury. [score:8]
Our results suggested that DNA methylation probably regulates the expression of miRNA genes (miR-122, miR-125b, and miR-106b), affecting the expression of their gene targets (Cyclin G1, CAT-1, and STAT3) and participating in the process of INH -induced liver injury. [score:8]
In the present study, the expression levels of hepatic miR-122, miR-106b and miR-125b were downregulated and correlated with liver pathology scores and serum AST and ALT activities, suggesting that the dynamic change in the expression levels of miR-122, miR-106b and miR-125b were related to INH -induced liver injury. [score:8]
The amount of methylated miR-122, miR-125b and miR-106b in the liver increased after INH administration and correlated with their expression levels, suggesting the role of methylation in regulating miRNA gene expression. [score:6]
Finally, we detected the expression levels of their target genes cell cycle protein G1 (Cyclin G1), cationic amino acid transporter-1 (CAT-1) and signal transducer and activator of transcription 3 (STAT3)) and explored the possible regulation mechanisms of miR-122, miR-125b and miR-106b during INH -induced liver injury. [score:6]
Methylated levels of miR-122, miR-106b and miR-125b were upregulated in INH -induced liver injury and correlated with their expression levels. [score:6]
These results suggested that methylation was responsible for the downregulation of miR-122, miR-106b and miR-125b expression during INH -induced liver injury. [score:6]
Hepatic miR-122, miR-125b and miR-106b expression levels dramatically decreased after INH administration for 3, 7 and 7 days (* p < 0.05 versus control group)The analysis of Pearson correlation coefficients demonstrated that the expression levels of miR-122, miR-125b and miR-106b were negatively correlated with liver scores (r = − 0.591, − 0.654 and − 0.701, p < 0.001, see Additional file 5: Figure S3) and serum ALT and AST activities (ALT, r = − 0.672, − 0.771 and − 0.695, p < 0.001, see Additional file 5: Figure S1; AST, r = − 0.462, − 0.584 and − 0.606, p < 0.001, see Additional file 5: Figure S2). [score:5]
Signal transducer and activator of transcription 3 (STAT3) was a common target gene of miR-125b and miR-106b, and its expression levels of mRNA and protein increased after INH administration. [score:5]
Furthermore, the expression of miR-125b and miR-106b has a causal role in enhanced STAT3 mRNA and protein expression during INH -induced liver injury. [score:5]
We analysed the methylation and expression levels of miR-122, miR-125b and miR-106b and their potential gene targets in livers. [score:5]
Hepatic miR-122, miR-125b and miR-106b expression levels dramatically decreased after INH administration for 3, 7 and 7 days (* p < 0.05 versus control group) The analysis of Pearson correlation coefficients demonstrated that the expression levels of miR-122, miR-125b and miR-106b were negatively correlated with liver scores (r = − 0.591, − 0.654 and − 0.701, p < 0.001, see Additional file 5: Figure S3) and serum ALT and AST activities (ALT, r = − 0.672, − 0.771 and − 0.695, p < 0.001, see Additional file 5: Figure S1; AST, r = − 0.462, − 0.584 and − 0.606, p < 0.001, see Additional file 5: Figure S2). [score:5]
These results demonstrate that lower levels of hepatic miR-125b and miR-106b contribute to the upregulation of STAT3 in stimulating the secretion of inflammatory factors during INH -induced liver injury. [score:4]
Thus, we hypothesise that methylation is responsible for the downregulation of miR-122, miR-125b and miR-106b in INH -induced liver injury. [score:4]
Thus, the correlation between the expression levels and methylation of CpG islands of the miR-122, miR-125b and miR-106b genes have been revealed, indicating the possibility of epigenetic regulation of these genes during INH -induced liver injury. [score:4]
This investigation aimed to evaluate the role of methylation in the regulation of microRNA (miR)-122, miR-125b and miR-106b gene expression and the expression of their target genes during isoniazid (INH) -induced liver injury. [score:4]
First, we searched for putative miR-125b and miR-106b targets that might regulate inflammatory immune response. [score:4]
miR-122, miR-106b and miR-125b expression levels are correlated with liver pathology scores and AST and ALT levels, supporting the correlation of these three miRNAs with INH -induced liver injury. [score:3]
We also found that STAT3, an important signal transduction pathway, was predicted and experimentally proven as the common gene target of miR-125b and miR-106b [25– 27]. [score:3]
miR-122 was one of the most abundant miRNAs in the liver, accounting for up to 72% of all hepatic miRNAs [12], while the expressions of miR-106b and miR-125b not only occur in the liver, but also in many other tissues, including the uterus, ovaries and lungs. [score:3]
Expression levels of the selected miRNAs (U6, miR-122, miR-125b and miR-106b) and selected mRNAs (β-actin, Cyclin G1, CAT-1, mitogen-activated protein kinase 14 MAPK14, STAT3, RAR-related orphan receptor gamma (RORγt), IL-17, IL-6, TNF-α, CXCL1 and MIP-2) were quantified using real-time RT-PCR analysis. [score:3]
Methylated levels of miR-122, miR-125b and miR-106b in INH-administered rat liver tissues were significantly higher than those in the control rats (* p < 0.05 versus control group) We also analysed the correlation between methylation levels and the gene expression of miR-122, miR-125b and miR-106b. [score:3]
Fig. 5Expression levels of miR-122, miR-125b and miR-106b in the liver tissue of different groups. [score:3]
The miR-122 expression was significantly lower after 3 days, while both miR-125b and miR-106b significantly decreased after 7 days. [score:3]
The results showed the negative correlation between methylation and expression levels of miR-122, miR-125b and miR-106b (miRNA-122, r = − 0.587, p < 0.001; miRNA-125b, r = − 0.536, p < 0.001; miRNA-106b, r = − 0.568, p < 0.001, see Additional file 5: Figure S4). [score:3]
Methylated levels of miR-122, miR-125b and miR-106b in INH-administered rat liver tissues were significantly higher than those in the control rats (* p < 0.05 versus control group)We also analysed the correlation between methylation levels and the gene expression of miR-122, miR-125b and miR-106b. [score:3]
Our results also confirmed that both miR-125b and miR-106b expression levels dramatically decreased during INH -induced liver injury. [score:3]
Previous studies confirmed that MAPK14 and STAT3 were common gene targets of miR-125b and miR-106b [25– 27]. [score:3]
To our knowledge, this study shows for the first time that hepatic miR-122, miR-125b and miR-106b expression levels gradually decreased during a mo del of INH -induced liver injury. [score:3]
Moreover, we clearly found that the expression of miR-122, miR-125b and miR-106b were significantly lower at different times. [score:3]
Moreover, expression levels of miR-122, miR-125b and miR-106b reached a nadir after 14-, 21-, and 21-day administration. [score:3]
Relative expression levels of miR-122, miR-125b and miR-106b genes in the liver decreased after INH administration and correlated with the scores of liver pathology and serum AST and ALT activities, suggesting that miR-122, miR-125b and miR-106b are associated with INH -induced liver injury. [score:3]
Therefore, we first analysed the expression levels of hepatic miR-122, miR-125b and miR-106b after INH administration and explored their correlation with INH -induced liver injury. [score:3]
We further analysed whether the expression levels of miR-122, miR-106b and miR-125b are correlated with the ongoing liver damage according to liver histopathology and serum ALT and AST activities. [score:3]
CpG island hypermethylation of miR-122, miR-125b and miR-106b genes correlate with their expression levels. [score:3]
One study also demonstrated that inflammatory miR-125b is dysregulated in APAP -induced liver injury, and this miRNA could potentially represent a biomarker of DILI. [score:2]
For the first time, we have detected the frequent methylation of miR-122, miR-125b and miR-106b. [score:1]
The analysis of the promoter region revealed that miR-122, miR-125b and miR-106b had CpG islands within the 2000 bp upstream of the transcriptional start site (Fig.   6a– e), providing the structural basis of DNA methylation. [score:1]
miR-125b and miR-106b are two miRNAs identified to be associated with inflammation. [score:1]
Fig. 6MiR-122, miR-125b and miR-106b were epigenetically silenced in INH -induced liver injury. [score:1]
Agarose gel electrophoresis of the PCR products of gene promoter methylation of (b), miR-122, (e) miR-125b and (h) miR-106b. [score:1]
In addition, hepatic miR-122, miR-125b and miR-106b methylation levels significantly increased at 7 days after INH administration. [score:1]
To verify this hypothesis, we used qMSP analysis to detect the methylation level of hepatic miR-122, miR-125b and miR-106b. [score:1]
The CpG island methylation of miR-122, miR-125b and miR-106b was analysed using SYBR Green -based quantitative methylation-specific PCR (qMSP). [score:1]
Altogether, this discovery raised the question of whether miR-125b and miR-106b were related to the inflammatory immune response in INH -induced liver injury. [score:1]
demonstrated that the methylation levels of miR-122, miR-125b and miR-106b in rat liver tissues treated with INH were significantly higher than those in the control group (Figs.   6c– i and see Additional file  6, p < 0.05 versus control). [score:1]
DNA methylation at particular CG dinucleotides within the miR-122 gene promoter (c), miR-125b gene promoter (f) and miR-106b gene promoter (i) in liver tissues from INH-administered rats was determined by qMSP. [score:1]
Previous studies have confirmed that miR-125b and miR-106b were two important indicators that reflect inflammatory response. [score:1]
The time of significant changes and the changing trends of miR-125b and miR-106b were all consistent. [score:1]
We attempted to elucidate the underlying mechanism of miR-125b and miR-106b involved in INH -induced liver injury. [score:1]
MiR-125b and MiR-106b regulated STAT3 in INH -induced liver injury. [score:1]
These results suggested that miR-122, miR-125b and miR-106b participated during the early phases of INH -induced liver injury. [score:1]
Changes in miRNA profiles, including lower miR-122, miR-106b and miR-125b levels, have been reported in animal mo del studies on drug -induced liver injury. [score:1]
In this study, lower hepatic levels of miR-122, miR-125b and miR-106b are associated with INH -induced liver injury. [score:1]
edu/) was used to obtain a 2000 bp promoter sequence in the upstream of miR-122, miR-125b and miR-106b genes. [score:1]
[1 to 20 of 58 sentences]
5
[+] score: 181
Bars show means; error-bars, SD; *p < 0.05; [#]p < 0.01. decreased ectopic dendrites of RBCsTo further study the role of miR-125b-5p in the development of ectopic dendrites on RBCs of RCS rats, we next upregulated the expression of miR-125b-5p using AAV-125b. [score:7]
To further study the role of miR-125b-5p in the development of ectopic dendrites on RBCs of RCS rats, we next upregulated the expression of miR-125b-5p using AAV-125b. [score:7]
The above data showed that reduced expression of miR-125b-5p increased the expression of its target, BDNF, and induced ectopic neuritogenesis by RBCs. [score:7]
Immunoblot showed that overexpression of miR-125b-5p resulted in no change in TrkB expression, but significantly lower expression of CREB (Fig.   7d). [score:7]
Although miR-125b-5p is highly expressed in the retina and is involved in retinal development 31, 32, this is the first study to demonstrate that miR-125b-5p regulates the development of ectopic dendrites on RBCs during retinal degeneration. [score:6]
Figure 3The expression of miR-125b-5p in RBCs and regulation of BDNF mRNA expression. [score:6]
The expression of mGluR6 was also significantly increased when miR-125b-5p was down-regulated by TuD-125b (Supplementary Fig.   S7). [score:6]
showed that overexpression of miR-125b-5p resulted in a decrease in BDNF expression at five weeks after surgery (Fig.   4e). [score:5]
Taken together, these findings indicated that miR-125b-5p regulated BDNF expression, and suggested that this pathway may be involved in the development of ectopic dendrites in the RBCs of RCS rats. [score:5]
To validate that miR-125b-5p was directly targeting BDNF, we performed a dual luciferase reporter gene assay, which showed that miR-125b-5p mimics significantly decreased luciferase expression in pmirGLO-BDNF transfected cells (Fig.   3f). [score:5]
In contrast, miR-125b-5p inhibitor significantly increased luciferase expression in the pmirGLO-BDNF transfected cells (Supplementary Fig.   S5). [score:5]
Furthermore, BDNF was predicted to be one of targets of miR-125b-5p by TargetScan (Supplementary Fig.   S4). [score:5]
showed that knockdown of miR-125b-5p resulted in an increase in BDNF expression at five weeks after surgery (Fig.   5e). [score:4]
We further confirmed that miR-125b-5p was downregulated in the retinae of RCS rats using RT-qPCR (Fig.   3b). [score:4]
However, overexpression of miR-125b-5p in RCS rats decreased b-wave amplitude, and conversely, knockdown of miR-125b-5p (or subretinal injection of BDNF) improved b-wave amplitude. [score:4]
Since miR-125b-5p is mainly expressed in the OPL, INL and GCL, photoreceptors are not regulated by miR-125b-5p. [score:4]
Figure 5Downregulation of miR-125b-5p increased the number and length of RBC ectopic dendrites and the ERG responses in RCS rats. [score:4]
Knockdown of miR-125b-5p increases ectopic dendrite formation by RBCs, and can improve the ERG b-wave, via increased BDNF expression. [score:4]
Down-regulation of miR-125b-5p. [score:4]
Of these microRNAs, miR-125b-5p was downregulated most in retinae of RCS rats compared with age-matched control retinae at P36 and P60 (Fig.   3a). [score:3]
Overexpression of miR-125b-5p. [score:3]
However, miR-125b-5p and BDNF are not uniquely expressed in RBCs, and further studies are therefore necessary to determine if miR-125-5p and BDNF are involved in other retinal remo deling processes. [score:3]
Overexpression of miR-125b-5p decreased ectopic dendrites of RBCs. [score:3]
To determine the expression of miR-125b-5p in the retinae, we used the recently developed Basescope technology, which allows detection of 50–300 nucleotides (nt) of RNA with very high sensitivity and specificity. [score:3]
The Tough-Decoy (TuD) miR-125b-5p was subcloned into the pAAV-CAG-eGFP-U6-shRNA vector to generate pAAV-CAG-eGFP-U6-TuD-miR-125b-5p (TuD-125b) for expression of miR-125b-5p antagonists according to a previous protocol 16, 17. [score:3]
The AAV-GFP vectors expressing TuD against miR-125b-5p (TuD-125b) were injected into the subretinal space of P25 RCS rats. [score:3]
We confirmed that neither miR-125b-5p mimics nor inhibitor modulated the luciferase levels in pmirGLO -transfected control cells (Fig.   3f and Supplementary Fig.   S5). [score:3]
Figure 4Overexpression of miR-125b-5p decreased the number and length of RBC ectopic dendrites and the ERG responses in RCS rats. [score:3]
RT-qPCR assays validated that miR-125b-5p was down-regulated by TuD-125b five weeks after surgery (Supplementary Fig.   S9). [score:3]
Using gain- and loss-of-function experiments, we showed that miR-125b-5p was involved in the regulation of ectopic dendrite formation by the RBCs of RCS rats, and that this regulation occurred via BDNF signaling. [score:3]
HEK293T cells were co -transfected with pmirGLO or pmirGLO-BDNF reporter constructs with miR-125b-5p negative control (NC), miR-125b-5p mimics or miR-125b-5p inhibitor using Lipofectamine 2000 (Invitrogen). [score:3]
Reduced expression of miR-125b-5p increased ectopic dendrites from RBCs. [score:3]
Notably, no other obvious changes were observed, such as any change in the number of photoreceptors at five weeks after overexpression of miR-125b-5p (Supplementary Fig.   S8). [score:3]
We showed that a specific microRNA, miR-125b-5p, regulated functional dendritic growth in RBCs of RCS rats. [score:2]
We next knocked down miR-125b-5p in the retinae of RCS rats using a Tough-Decoy (TuD) approach. [score:2]
In this study of RCS rats, we used miRNA microarray technology to show that miR-125b-5p was associated with retinal degeneration, and that it regulated dendritic growth and function in RBCs. [score:2]
The results from this study not only improve understanding of the molecular mechanisms of retinal remo deling, but suggest a new treatment for retinal degeneration: miR-125b-5p knockdown. [score:2]
This suggests that miR-125b regulates synaptic structure and function in different kinds of neurons via different downstream effectors. [score:2]
These showed that knockdown of miR-125b-5p did not affect the a-wave (Fig.   5g). [score:2]
This work provides proof-of-concept for the potential treatment of retinal degeneration by knockdown of miR-125b-5p. [score:2]
Functional ectopic neuritogenesis by retinal rod bipolar cells is regulated by miR-125b-5p during retinal remo deling in RCS rats This work was supported by the National Foundation of Natural Science, project number 81130017, and the National Basic Research Program of China (973 Program, 2013CB967002). [score:2]
Importantly, this work suggests that knockdown of miR-125b-5p could be a therapeutic option for preserving visual function during early retinal degeneration. [score:2]
The red arrow indicates where the relative expression of miR-125b-5p in the retinae of RCS rats decreased compared with the control retinae. [score:2]
RT-qPCR assays verified that miR-125b-5p was overexpressed in the AAV-125b -injected retinae five weeks after surgery (Supplementary Fig.   S6). [score:2]
In conclusion, we have shown in RCS rats, functional ectopic neuritogenesis by RBCs is regulated by miR-125b-5p during retinal remo deling. [score:2]
Recently, miR-125b has been shown to modulate synaptic structure and function through the regulation of the NMDA receptor subunit, NR2A [33]. [score:2]
In contrast, knockdown of miR-125b-5p (or subretinal injection of BDNF) induced RBC ectopic dendrite formation. [score:2]
Perhaps more importantly, this also suggests that knockdown of miR-125b-5p, or subretinal injection of BDNF, could potentially rescue vision in retinal degeneration. [score:2]
From the above findings, we concluded that miR-125b-5p regulated ectopic neuritogenesis in the RBCs of RCS rats via BDNF. [score:2]
Name Sequence miR-125b-5p-F ACTGATAAATCCCTGAGACCCTAAC miR-125b-5p-R TATGGTTTTGACGACTGTGTGAT U6-F ATTGGAACGATACAGAGAAGATT U6-R GGAACGCTTCACGAATTTG BDNF-F GCGCGAATGTGTTAGTGGTTACCT BDNF-R AACGGCACAAAACAATCTAGGCTAC GAPDH-F GCCCATCACCATCTTCCAGGAG GAPDH-R GAAGGGGCGGAGATGATGAC mGluR6-F GTGCTAGGTCAACCCTCAAA mGluR6-R CTAGAAGAGATCCCAGAGGAGAA miR-9a-3p-F GGCGCGGAAATAAAGCTAGATA miR-9a-3p-R TATGGTTGTTCACGACTCCTTCAC miR-124-5p-F ACTTTCAACGTGTTCACAGCG miR-124-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-134-5p-F CCTCTATTCTGTGACTGGTTGACC miR-134-5p-R AAAGGTTGATCTCGTGACTCTGTT miR-219a-5p-F CTGATTCCCTGATTGTCCAAAC miR-219a-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-379-5p-F GCGGCGGGTGGTAGACTATG miR-379-5p-R GTGCAGGGTCCGAGGT In situ RNA hybridization was performed using Basescope technology (Advanced Cell Diagnostics, Hayward, California) following the manufacturer’s protocol with minor modifications. [score:1]
The TuD miR-125b-5p template sequences used were as follows: GGCGCTAGGATCATCAACTCACAAGTTAGGATCTGTCTCAGGGACAAGTATTCTGGTCACAGAATACAACTCACAAGTTAGGATCTGTCTCAGGGACAAGATGATCCTAGCGCCACCTTTTT. [score:1]
Name Sequence miR-125b-5p-F ACTGATAAATCCCTGAGACCCTAAC miR-125b-5p-R TATGGTTTTGACGACTGTGTGAT U6-F ATTGGAACGATACAGAGAAGATT U6-R GGAACGCTTCACGAATTTG BDNF-F GCGCGAATGTGTTAGTGGTTACCT BDNF-R AACGGCACAAAACAATCTAGGCTAC GAPDH-F GCCCATCACCATCTTCCAGGAG GAPDH-R GAAGGGGCGGAGATGATGAC mGluR6-F GTGCTAGGTCAACCCTCAAA mGluR6-R CTAGAAGAGATCCCAGAGGAGAA miR-9a-3p-F GGCGCGGAAATAAAGCTAGATA miR-9a-3p-R TATGGTTGTTCACGACTCCTTCAC miR-124-5p-F ACTTTCAACGTGTTCACAGCG miR-124-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-134-5p-F CCTCTATTCTGTGACTGGTTGACC miR-134-5p-R AAAGGTTGATCTCGTGACTCTGTT miR-219a-5p-F CTGATTCCCTGATTGTCCAAAC miR-219a-5p-R TATGCTTGTTCTCGTCTCTGTGTC miR-379-5p-F GCGGCGGGTGGTAGACTATG miR-379-5p-R GTGCAGGGTCCGAGGT In situ hybridization and immunostaining In situ RNA hybridization was performed using Basescope technology (Advanced Cell Diagnostics, Hayward, California) following the manufacturer’s protocol with minor modifications. [score:1]
In situ hybridization with mir-125b probe (green) was followed by immunostaining with anti-PKCα (red) and anti-BDNF (blue) antibodies, as described in. [score:1]
Thus, we generated Basescope probes for miR-125b-5p precursor (mir-125b). [score:1]
The TuD miR-125b-5p template sequences used were as follows:GGCGCTAGGATCATCAACTCACAAGTTAGGATCTGTCTCAGGGACAAGTATTCTGGTCACAGAATACAACTCACAAGTTAGGATCTGTCTCAGGGACAAGATGATCCTAGCGCCACCTTTTT. [score:1]
We found that the mir-125b signal was present in the outer plexiform layer (OPL), inner nuclear layer (INL) and ganglion cell layer (GCL), and was co-localized with PKCα, which suggested that RBCs could be miR-125b-5p positive (Fig.   3c). [score:1]
Consistent with this, neither manipulation of miR-125b-5p, nor BDNF treatment, affected the number of photoreceptors and the ERG a-wave. [score:1]
[1 to 20 of 57 sentences]
6
[+] score: 71
We also found that miR-125b downregulation was correlated with the upregulation of a target gene, with our results suggesting SP1 as a previously unrecognized miR-125b-5p target. [score:11]
Given that modulation of SP1 expression could alleviate DR progression, the application of miR-125b or other miRNAs to target SP1 and other downstream targets might produce beneficial effects in DR treatment. [score:7]
Subsequently, we transfected an miR-125b-5p mimic into ARPE-19 cells under hyperglycemia exposure, confirmed miR-125b upregulation, and determined the SP1 -expression level at both the mRNA and protein levels. [score:6]
Notably, after introduction of miR-125b into cells, SP1 expression was significantly inhibited at both the protein and mRNA levels (Figures 5(c) and 5(d)). [score:5]
Furthermore, it is critical to study miR-125b-target genes related to the DR pathogenesis; however, only a few mRNAs have thus far been verified as miR-125b targets involved in DR pathogenesis [17]. [score:5]
Accordingly, in ARPE-19 cells, miR-125b upregulation abolished the high levels of SP1 induced by hyperglycemia. [score:4]
These results strongly suggested that SP1 is a previously unidentified direct target of miR-125b associated with the progression of DR. [score:4]
The Role of SP1, a Previously Unknown Potential Target of miR-125b-5p, in DR Progression. [score:3]
Moreover, SP1 was identified as a potential target of miR-125b-5p associated with DR progression. [score:3]
Previous work revealed miR-125b-5p as one of the most abundant miRNAs in the retina, with this miRNA exhibiting an inherent ability to regulate cell differentiation, growth, and development [17, 18]. [score:3]
In this study, we confirmed that miR-125b was expressed at low levels in both HRECs and ARPE-19 cells under hyperglycemia exposure and in the DM retina. [score:3]
In this study, we also focused on specificity protein 1 (SP1), which could represent a previously unknown target of miR-125b-5p. [score:3]
Therefore, we propose that miR-125b could restrict SP1 levels in cells and that this modulation might affect its downstream targets and thereby ameliorate DR progression. [score:3]
In the MN osmotic-control groups, SP1 levels did not change significantly; however, when HRECs and ARPE-19 cells were exposed to HG, SP1 levels increased and remained high until days 5 and 7. This increase in SP1 expression along with DR progression was the opposite of that observed with miR-125b levels. [score:3]
As shown in Figure 5(a), putative interaction sites for miR-125b are present in the 3′-UTR of SP1 mRNA; therefore, we directly tested the effect of an miR-125b mimic on SP1 levels. [score:2]
org/vert_71/), we identified SP1 as a target of miR-125b-5p; therefore, to examine potential regulatory interactions between miR-125b and SP1 during the course of DR, we used qPCR to measure SP1 mRNA levels in HG -treated HRECs and RPE cells. [score:2]
Transfection of the miR-125b mimic led to a 25-fold increase in the level of miR-125b relative to a level in cells transfected with scramble-control miRNA (Figure 5(b)). [score:1]
Upon reaching ~70% to 80% confluence, cells were transfected with miR-125b mimic or scramble-control miRNA (both at 50 nmol/L) using Lipofectamine RNAiMAX (Invitrogen, Carlsbad, CA, USA) transfection reagent. [score:1]
Therefore, modulation of miR-125b in early DR might exert beneficial effects with regard to slowing DR progression and DR -associated impairment. [score:1]
The hsa-miR-125b-5p mimic and a scrambled negative-control miRNA were chemically synthesized by GenePharma (Shanghai, China). [score:1]
[1 to 20 of 20 sentences]
7
[+] score: 69
Figure S5 Conservation of (A) Timp3 miR-1/206 targeting seed, (B) Rbm24 miR-125b-5p targeting seed, (C) Tgfbr2 miR-204 targeting seed, (D) Csnk2a2 miR-208b targeting seed. [score:9]
We found that miR-125b-5p over -expression could lower Rbm24, but not Rbm38, levels in HPASM cells, and that the down-regulation was directly mediated by the microRNAs as verified via luciferase reporter assay. [score:6]
Expression profiles of miR-1/Timp3 and miR-125b-5p/Rbm24 were also anti-correlated with microRNA expression in the dog (Figure S2) and cynomolgus monkey (Figure S3). [score:5]
However only Rbm24 expression was directly inhibited by miR-125b co-transfection in the luciferase assay (Figure 7F), while luc-Rbm38 signal was unaffected (data not shown). [score:5]
A subset of microRNAs (miR-1, miR-125b-5p, miR-204 and miR-208b) was selected for further cross-species analysis and their expression level relative to heart apex is shown in Figure 4. MiR-1 was highly expressed in all rat, dog and cynomolgus monkey heart structures except valves. [score:5]
RNA binding motif proteins 24 and 38 (Rbm24 and Rbm38) play a role in muscle differentiation [25], [28] and carry a miR-125b-5p targeting site. [score:3]
MiR-1, miR-204 and miR-125b were detected in rat cardiac tissue by in situ hybridization (ISH), and the staining patterns observed were consistent with the relative expression observed by microRNA sequencing and qPCR. [score:3]
Confirmation of microRNAs Distribution by in situ HybridizationMiR-1, miR-204 and miR-125b were detected in rat cardiac tissue by in situ hybridization (ISH), and the staining patterns observed were consistent with the relative expression observed by microRNA sequencing and qPCR. [score:3]
Interestingly, Rbm38 was also anti-correlated to miR-125b in our cardiac tissue samples, and has a predicted miR-125b targeting site in its 3′UTR. [score:3]
The levels of Rbm24 and Rbm38 mRNAs increased during myoblastic differentiation concomitantly with a decrease in miR-125b-5p expression [35]. [score:3]
We selected 4 genes (Timp3, Rbm24, Tgfbr2 and Csnk2a2), respectively targeted by miR-1, miR-125b, miR-204 and miR-208b, for further analysis. [score:3]
Mutation of the predicted miR-125b-5p binding site within Rbm24 mRNA resulted in rescue of luciferase gene activity. [score:2]
MiR-125b-5p and miR-204 were highly enriched in the valves of all 3 species compared to all other structures although it is noteworthy that significant miR-125b-5p expression was observed in non-valve structures in dog. [score:2]
We have also identified novel microRNA -mediated post-transcriptional mRNA regulatory interactions with potentially important roles in cardiac/muscle physiopathology including miR-1/Timp3, miR-125b/Rbm24, miR-204/Tgfbr2 and miR-208b/Csnk2a2. [score:2]
In summary, we have demonstrated that four genes (Timp3, Rbm24, Tgfbr2 and Csnk2a2) important for cardiac/muscular physiology are post-transcriptionally regulated by miR-1, miR-125b-5p, miR-204 and miR-208b and exhibit conserved cardiac tissue miR-mRNA interactions across species. [score:2]
Here we focused on the characterization of four microRNAs, including myocardial specific miR-1 and miR-208b and valve enriched mir-204 and miR-125b-5p, based on their distinct heart-structure-specific distribution patterns and known roles in cardiac physiology, disease and pathological remo deling. [score:1]
0052442.g007 Figure 7 (A–D) Real-Time RT-PCR of Timp3, Rbm24, Tgfbr2 and Csnk2a2 in HPASM cells transfected with mimics for miR-1, miR-125b-5p, miR-204, miR-499 and miR-208b or with a mimic microRNA negative control. [score:1]
Figure S6 Distribution of miR-1, miR-125b-5p, miR-204 and miR-208b in the cardiac structures in 1 human donor. [score:1]
Similarly to miR-204, miR-125b-5p showed a strong signal in the cardiac valves and could not be detected in the ventricular cardiomyocytes (Figure 5D, E and F). [score:1]
While signals for miR-1 and miR-125b-5p were strong, miR-204 was at the limit of detection, consistent with its relatively low abundance as determined by microRNA sequencing (Table S8). [score:1]
An assessment of the degree of conservation for structure-specific distribution of microRNAs in Wistar rat, Beagle dog and cynomolgus monkey (see for relative enrichment analysis), revealed high enrichment of nine microRNAs cardiac valves (miR-let7c, mIR-125b, miR-127, mir-199a-3p, miR204, miR-320, miR-99b, miR-328 and miR-744) (Figure 3A) and seven microRNAs in the myocardium (miR-1, mir-133a, miR-133b, miR-208b, miR-30e, miR-499-5p, miR-30e*) (Figure 3A). [score:1]
Timp3 and miR-1 (A), Rbm24 and miR-125b-5p (B), Tgfbr2 and miR-204 (C), Csnk2a2 and miR-208b (D). [score:1]
Distribution of miR-1, miR-125b-5p, miR-204 and miR-208b in cardiac structures across species. [score:1]
Conserved microRNA signatures were identified in valves (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and in ventricular-specific regions of the myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*) of Wistar rat, Beagle dog and cynomolgus monkey. [score:1]
0052442.g006 Figure 6 Timp3 and miR-1 (A), Rbm24 and miR-125b-5p (B), Tgfbr2 and miR-204 (C), Csnk2a2 and miR-208b (D). [score:1]
Localization of miR-204, miR-125b-5p, miR-1 and miR-122 in rat heart by in situ hybridization. [score:1]
0052442.g005 Figure 5Localization of miR-204, miR-125b-5p, miR-1 and miR-122 in rat heart by in situ hybridization. [score:1]
miR-125b-5p in valves (D–E) and ventricle (F). [score:1]
[1 to 20 of 28 sentences]
8
[+] score: 68
To determine the effect of CKD on miRNA expression, we isolated VSMC from the aorta of CKD (Cy/+) rats and their normal littermates and determined the expression of miR-125b, miR-145, and miR-155 by real time PCR. [score:5]
To determine if CKD affects the expression of circulating miR-125b, miR-145 and miR-155, we analyzed the expression in stored sera from 90 stage 3–4 CKD patients who had participated in a previous study and consented for future use of their blood samples. [score:5]
Thus, our findings of down regulation of miR-125b in both the circulation of patients with CKD and in arteries and VSMC from CKD rats, and an upregulation of RUNX2 in arteries/VSMC, suggests that miR-125b may play a role in preventing this de-differentiation of VSMC to osteoblast like cells. [score:5]
The potential importance of miR-125b in the regulation of this RUNX2 mediated osteochondrogenic differentiation is supported by a study demonstrating that miR-125b inhibits the BMP-4 induced differentiation/proliferation of mesenchymal stem cells towards an osteoblast phenotype. [score:4]
We chose to examine miR-125b, 145 and 155 due to their known role in the regulation of the VSMC phenotype and the finding that circulating levels are decreased in patients with coronary artery disease [7]. [score:4]
Sera were collected from stage 3–4 CKD patients (n = 10), hemodialysis patients (n = 10) and healthy volunteers (n = 8) and total RNA isolated and real time PCR performed to determine the expression of circulating levels of miR-125b (A), miR-145 (B) and miR-155 (C) normalized by U6. [score:3]
At this time there is no evidence that RUNX-2 is directly regulated by miR-125b and thus its effects are likely further upstream and/or earlier in the differentiation pathway [46]. [score:3]
For every one ml/min decrease in eGFR, there were a 0.05, 0.04, and 0.02 unit decreases in the expression of the miRNA for miR-125b, 145, and 155, respectively. [score:3]
However, we did not find a significant correlation between miR-125b and RUNX2 expression. [score:3]
The expression of RUNX2 was also increased in CKD animals (Figure 2E), with a non-statistical correlation of RUNX2 with miR-125b (r = –0.47, p = 0.07) and miR-155 (r = –0.45, p = 0.08). [score:3]
Therefore, in the present study we evaluated three “vascular” miRNAs that are known to be expressed in the artery and involved in vascular smooth muscle cell (VSMC) differentiation (miR-145 and 155) [2], [15], [16], inflammatory vascular disease (miR-155) [17]– [19], abnormalities in the angiotensin pathway (miR-155) [20]– [22] and arterial calcification (miR-125b) [23], [24] in patients with CKD. [score:3]
When VSMC [24] and adipocytes [40] are induced towards an osteogenic differentiation pathway through high phosphorus containing media, there is a decline in miR-125b expression. [score:3]
Indeed, miR-125b has over 7000 possible gene targets (www. [score:3]
was performed to determine the expression of miR-125b, miR-145, miR-155 and miR-210 and normalized by U6 (A). [score:3]
0064558.g001 Figure 1 Sera were collected from stage 3–4 CKD patients (n = 10), hemodialysis patients (n = 10) and healthy volunteers (n = 8) and total RNA isolated and real time PCR performed to determine the expression of circulating levels of miR-125b (A), miR-145 (B) and miR-155 (C) normalized by U6. [score:3]
The results demonstrated that there is significantly reduction in expression in miR-125b, miR-145, and in thoracic aorta from CKD compared to that from normal rats (Figure 2A). [score:2]
By real time PCR, the expression of miR-125b, miR-145 and miR-155 were lower in thoracic aorta from CKD compared to that from normal rats (all p<0.01; Figure 2A). [score:2]
Cultured VSMC from CKD rats had significantly lower expression of miR-125b, miR-145 and miR-155 compared to that from normal rats (Figure 3A). [score:2]
Target-specific PCR primers (miR-125b, miR-145, miR-155 and miR-210) were obtained from Applied Biosystems. [score:2]
The circulating levels of miR-125b, miR-145 and miR-155 are decreased with progressive eGFR; the ability to detect such miRNA may offer hope of a novel cardiovascular biomarker. [score:1]
When the activity of miR-125b was blocked, there was increased alkaline phosphatase activity and mineralization, suggesting continued osteoblast differentiation of these mesenchymal stem cells [23]. [score:1]
Finally, Goettsch et al found that miR-125b was decreased during calcification of human VSMC [24]. [score:1]
Thus, the low levels of miR-125b observed in both the aorta tissue of CKD rats and the sera of CKD patients may have widespread effects on cell differentiation in multiple organ systems in CKD. [score:1]
There were negative correlations of miR-155 with the presence of calcification miR-155 (r = –0.537, p = 0.04; Figure 2B) and miR-125b and calcification (r = –0.478, p = 0.07), but no relationship with miR-145. [score:1]
Circulating levels of miR-125b, miR-145 and miR-155 are decreased in CKD. [score:1]
Calcium and vitamin D levels were no longer significant for miR-125b, miR-145 or miR-155. [score:1]
[1 to 20 of 26 sentences]
9
[+] score: 41
One, rno-miR-125b-5p, was abundantly expressed (RPM ~3000, ranked 30 [th] overall, Additional file 1: Table S1); it was down-regulated in HA and marginally so also in LA. [score:6]
These were rno-miR-30d-5p and rno-miR-125b-5p which were expressed abundantly and rno-miR-379-5p which was expressed at modest copy number. [score:5]
Only 3 miRNAs that were expressed abundantly (rno-miR-30d-5p, rno-miR-125b-5p) or at moderate levels (rno-miR-379-5p) were differentially regulated. [score:4]
The most notable observations were enhanced ion, protein and nucleic acid binding, and hence possibly regulation, among the protein targets of rno-miR-30d-5p and rno-miR-125b-5p, and enriched ion channel activity, including Na [+] channel activity, in rno-miR-125b-5p (Figure  8). [score:4]
Figure 8 Pie charts show the Gene Ontology (GO) molecular function terms that are enriched compared to the overall genome, among the mRNA targets predicted by the TargetScan algorithm for miR-125b-5p (n = 451) and miR-30d-5p (n = 1094). [score:4]
Most had no known validated targets, but the two most abundant ones (rno-miR-30d and rno-miR-125b-5p) had 50 amongst them. [score:3]
Further research is required to determine whether some of the other known or predicted gene targets of rno-miR-30d-5p and rno-miR-125b-5p might also contribute. [score:3]
The differentially regulated isomiR of rno-miR-125b-5p (RPM ~35) differed from the consensus sequence of its canonical miRNA only by deletion of the nucleotides uga from the 3’ end [ucccugagacccuaacuug uga]. [score:2]
Among these were one isomiR of rno-miR-130a-3p and one of rno-miR-125b-5p (a miRNA already identified as differentially regulated, Table  1). [score:2]
As noted above, Tnf, Bdnf and Stat3 have already been verified experimentally as targets of rno-miR-30d-5p and rno-miR-125b-5p, and functional assays involving primary afferents have already established all three as major players in pain physiology. [score:2]
The few miRNAs that were differentially regulated (diff-reg) are indicated by yellow triangles (rno-miR-30d-5p, rno-miR-125b-5p and rno-miR-379-5p) or large blue dots. [score:2]
The target miRNAs (and corresponding assay numbers) were: rno-miR-23a (000399), rno-miR-26b (000407), rno-miR-30-5p (000420), rno-miR-101b (002531), rno-miR-125b-5p (000449), rno-miR-379 (001138) and rno-miR-431 (001979). [score:2]
LA rats Small RNA type and sequence Mean RPM Mean RPM SNL-reg diff-reg (canonical miRNA or RNA type)(sham pools)(SNL pools)subtraction method (SNL/sham fold-change )  HALAHALAHALAHA-LA unique-sequence miRNA isoform (isomiR), all pools, and those added by HA_SNL1 pool exclusion *UAUAGUACUGUGAUAACUGACU (rno-miR-101a-3p)11.79.39.911.3−0.167 (−1.182)0.194 (1.215)−0.361 (0.397)CAGUGCAAUGUUAAAAGGGC (rno-miR-130a-3p) *38.041.948.245.00.237 (1.268)0.071 (1.074)0.166 (0.194)UCCCUGAGACCCUAACUUG (rno-miR-125b-5p) *47.830.435.533.1−0.295 (−1.346)0.085 (1.089)−0.380 (0.435)UGGACGGUGUGAGGCC (sha-miR- 5105) *11.015. [score:1]
We conclude that rno-miR-30d-5p, rno-miR-125b-5p, and perhaps rno-miR-379-5p are fundamental to the contrasting neuropathic pain phenotype in HA vs. [score:1]
[1 to 20 of 14 sentences]
10
[+] score: 27
This further confirms that the upregulation of expression observed for miR-125b-2*, -27a*, -422a, -488 and -627 is indeed a consequence of acute cerebral ischemia. [score:6]
Analysis of the expression profiles of miR-125b-2*, -27a*, -422a, -488 and -627, from stroke onset till recovery of two years showed that their highest expression occurred within the acute phase (one to seven days) of stroke in humans (Figure 4). [score:5]
Among these let-7a, let-7g, miR-125b-2*, -130a, -192, -196a*, -23a, -26b, 30b, -30c, -30e*, -320b, -320d, -340, -381, -488, -652 and -92a were also reported to exhibit similar expression patterns between human [15] and rat stroke mo dels [14, 16]. [score:3]
miR-125b-2* blood profile showed similar expression to that of the ischemic brain, albeit with greater fold change differences. [score:3]
Incidentally, miR-125b-2* was shown to be conserved in the brain throughout the chimpanzee, macaque and human species, implicating its crucial functional roles in mammalian brain development [26]. [score:2]
ROC analysis of miR-125b-2*, -27a*, -422a, -488 and -627 in the Cohort 3 patients exhibiting stroke associated risk factors only, showed poor AUC values suggesting that the selected miRNAs were indeed exclusively indicative of the onset of cerebral ischemia (Table 2). [score:1]
We also found miR-125b-2*, -27a*, -422a, -488 and -627 to be consistently altered during acute stroke. [score:1]
miR-125b-2*, -27a*, -422a, -488 and -627 showed high AUC values of 0.95, 0.89, 0.92, 0.87 and 0.84 in the Cohort 1 and 0.85, 0.86, 0.86, 0.86, and 0.76 in the Cohort 2 patients, respectively (Table 2). [score:1]
In fact we also observed miR-125b-2* to have the strongest biomarker potential based on AUC values (Table 2). [score:1]
Thus, we propose that miR-125b-2*, -27a*, -422a, -488 and -627 could reflect the onset of ischemic stroke and prove to be of diagnostic value. [score:1]
let-7d*, miR-125b-2*, -1261, -1299, -130a, -1321, -208a, -22*, -23a, -27a*, -320b, -320d, -30c, -340, -422a, -423-3p, -488, -502-5p, -549a, -574-3p, -574-5p, -617, -627, -886-5p, -92a and -93* were unique for acute stroke while let-7a, let-7g, miR-129-5p, -192-5p, -196a*, -26b, -30b, -30e*, -370, -381, -493*, -525-5p, -652, -920, -933 and -96 were unique for “recovered” stroke patients (Figure 3; highlighted in bold). [score:1]
miR-125b-2* and miR-488 peaked at 6 h from the onset of stroke, to 1.56 ± 0.28 and 1.36 ± 0.24 fold, respectively in ischemic rat brain whereas miR-27a*, -422a and -627 peaked at 24 h from the onset of stroke, to 5.37 ± 0.46, 1.52 ± 0.28 and 8.53 ± 1.23 fold, respectively (Figure 4). [score:1]
Except for miR-125b-2*, the remaining miRNAs exhibited an opposing profile in the brain and blood at their corresponding time points. [score:1]
[1 to 20 of 13 sentences]
11
[+] score: 22
Female-biased expression of miR-29b and miR-152 occurred from 15 to 78 weeks of age while male-biased expression of miR-125b-5p and miR-99a occurred during this same age span. [score:5]
miR-125b-5p and miR-99a showed the most consistent male-biased expression with sex differences observed at 15, 21, 52, and 78 weeks of age and fold changes ranging from 1.5 to 2.3. miR-99a* exhibited similar significant male-biased expression of 1.7- to 2.3-fold at 15, 52, and 78 weeks of age. [score:5]
Despite only seven sexually dimorphic miRNAs being in common between the adult and the old rats (miR-125b-5p, miR-152, miR-29b, miR-374, miR-96, miR-99a*, and miR-99a), 91% (74/81) of the mRNA targets in the old rats were also mRNA targets in the adult rats. [score:5]
miR-125b-5p and miR-99a are suggested to be co-expressed in humans from chromosome 21 and play a role in vincristine resistance of leukemia cells [62]. [score:3]
miRNAs showing the most male-biased expression included miR-125b-5p, miR-99a*, miR-99a, miR-96, miR-221, and miR-183 (Fig.   3). [score:3]
miR-125b-5p and miR-221 play a role in glioma carcinogenesis and have been recently proposed as prognostic markers in assessing glioma tumors [63]. [score:1]
[1 to 20 of 6 sentences]
12
[+] score: 22
Astrocyte activation also seems to be promoted by the upregulation of miR125b, which leads to GFAP and vimentin overexpression and cdkn2a silencing in vitro [103]. [score:6]
In fact, according to previous studies [17], [18], [19], [21], [22], highly expressed microRNAs in the spinal cord or the CNS, such as miR-125b, miR-29a, miR-30b, and miR-9*, show sustained, high levels of expression before and after injury (see file S1), suggesting an overall preservation of the cell populations in the spinal cord. [score:5]
For example, the increased levels of pro-inflammatory factors such as TNF-α [84] or IL-6 [8] following injury may result from the reduced expression of their regulators, miR125b and let7a, respectively [85], [86]. [score:4]
However, mir-125b demonstrated significant downregulation after injury in the present study. [score:4]
It is possible that the changes in expression for both mir-125b and miR-21 observed in the present study are associated with an infiltration or a response by cell types other than astrocytes. [score:3]
[1 to 20 of 5 sentences]
13
[+] score: 21
More importantly, the miRNAs analyzed in this study not only included the miRNAs like Let-7a, miR-15b, miR24, miR-100 and miR-125 which may suppress the expression of cyclins A and B, and miRNAs such as Let-7a, miR24 and miR-125 which may regulate activity of CDK1, but also miRNAs such as miR-181a, miR-221 and miR-222 which can target CDK inhibitors [30– 32]. [score:10]
To investigate whether miRNAs have a role in the cell cycle regulation of splenocytes following aniline exposure, the expression of miRNAs, including Let-7a, miR-15b, miR24, miR-100, miR-125, miR-181a, miR-221 and miR-222 which are known to mainly control G2/M phase regulators [30– 32], was analyzed by using real-time PCR and the results are presented in Fig 7. Aniline exposure led to significantly decreased expression of Let-7a (decreased 82%), miR-15b (decreased 62%), miR24 (decreased 78%), miR-100 (decreased 63%), miR-125 (decreased 86%), whereas miR-181a, miR-221 and miR-222 increased by 155%, 78% and 56%, respectively, in comparison to controls (Fig 7). [score:5]
Real-time PCR analysis of miRNAs Let-7a, miR-15b, miR24, miR-100 and miR-125 (A), and miRNAs miR-181a, miR-221 and miR-222 (B) expression in rat spleens following aniline exposure. [score:3]
Therefore, greater decreases in Let-7a, miR-15b, miR24, miR-100 and miR-125 expression and significant increases in miR-181a, miR-221 and miR-222 levels in the spleens following aniline treatment may be mechanistically important in generalizing that aniline exposure leads to increased cyclin A, cyclin B, CDK1, and decreased p21, p27, thus triggering the splenocytes to go through G2/M transition. [score:3]
[1 to 20 of 4 sentences]
14
[+] score: 21
The expression of these four miRNAs (miR-125b, miR-30d, miR-34a and miR-1) did not change during UPR, with exception of miR-125b whose expression was increased after Tg treatment (Figure 3). [score:5]
The effect of Tg on miR-125b expression is likely due to its effect on calcium homeostasis rather than UPR because Tm treatment had no effect on miR-125b expression. [score:5]
The miRNAs (miR-206, miR-24, miR-125b, miR-133b) deregulated upon UPR in H9c2 cells are abundantly expressed in adult heart. [score:4]
The four miRNAs (miR-125b, miR-30d, miR-34a and miR-1) were included as control miRNAs whose expression did not show significant change during conditions of UPR. [score:3]
We found that miRNAs with known function in cardiomyoblasts biology (miR-206, miR-24, miR-125b, miR-133b) were significantly deregulated during the conditions of UPR in H9c2 cells. [score:2]
We found that miRNAs (miR-206, miR-24, miR-125b, miR-133b) with known function in cardiomyoblasts biology [20– 22] were significantly deregulated during the conditions of UPR in H9c2 cells. [score:2]
[1 to 20 of 6 sentences]
15
[+] score: 18
Interestingly, miR-22, miR-1224 and miR-125-3p were initially up-regulated under EGF and bFGF treatment, but reversed their quantitative expression in the presence of IGF-1. In addition, miR-214 and miR-708 were expressed inconsistently in Group A while their expression went down in Group B. To validate the microRNA microarray expression data, a qRT-PCR assay was conducted to confirm the expression levels of three randomly selected microRNAs (let 7-b, miR-181a, and miR26a). [score:13]
These data support our findings that the down-regulation of mir-125-3p reduced apoptosis and increased cell proliferation possibly by a p53- and Fyn-regulated manner. [score:5]
[1 to 20 of 2 sentences]
16
[+] score: 17
The majority of these progression -associated miRNAs, including miR-10a, miR10b, miR-124, miR-125b, miR-126, miR-145, were increasingly downregulated with increasing lesion severity, while 2 miRNAs, miR-21 and miR-200a, were upregulated with advancing tumor progression. [score:7]
Several of the progression -associated miRNAs identified mirror those found to be changed during progression in human normal, DCIS, and IDC breast cancer samples, including an upregulation of miR-21 and a downregulation of miR-10b, miR-125b, and miR-126 [15]. [score:7]
The 8 miRNAs we found from our profiling (specifically, miR-10a, miR-10b, miR-21, miR-124, miR-125b, miR-126, miR-145, and miR-200a) each showed progressive changes in expression with advancing lesion grade. [score:3]
[1 to 20 of 3 sentences]
17
[+] score: 16
Gene expression analysis in the same animals revealed a distinct profile characterizing the hyperglycaemic GK rat, including altered expression of several predicted miR-125 target genes. [score:5]
Both miR-125a and miR-125b have been reported to be down-regulated in ovarian [43] and breast cancers [44], with potential roles in cell proliferation and differentiation. [score:4]
Experimentally validated target genes of both miR-125a and miR-125b in humans include ERBB2 and ERBB3 [41] and LIN28 [42]. [score:3]
MiR-125a and its close homolog miR-125b differ by a single nucleotide [40], and thus share many predicted target genes. [score:3]
In each case, the significance of the overlap (estimated false discovery rate) is calculated as the proportion of 10,000 random sets of non-miR-125 target genes of the same size showing equal or greater overlap. [score:1]
[1 to 20 of 5 sentences]
18
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
The relative expression intensities of miR-125 were 2.8 ± 1.6 in adenoma-free mice and 5.6 ± 2.7 in adenoma-bearing mice, thus accounting for a 2.0-fold upregulation. [score:6]
Our study showed that no miRNA was different between males and females in adenoma-free mice, while 3 miRNAs (miR-10a, miR-125, and miR-130a) were differentially expressed in adenoma-bearing male and female mice. [score:3]
The panels report the amplification curves for each one of the 20 mouse lung fragments tested, either adenoma-free (green) or adenoma-bearing (purple), relatively to miRNAs miR-125, miR-374, and miR-669k. [score:1]
According to volcano-plot analyses, no miRNA was different in males and females from adenoma-free mice, whereas 3 miRNAs (miR-10a, miR-125, and miR- 130a) from adenoma-bearing mice showed intergender differences. [score:1]
In particular, miR-10a is related to estrogen dependent cancer promotion [112, 113], miR-130a both to the estrogen and HER2 pathways [114, 115], and miR-125 to HER2/erbb2 estrogen sensitive oncogene activation [116, 117]. [score:1]
Validation of microarray data was performed by real time-qPCR for miR-125, miR-374, and miR-669k. [score:1]
Figure 4 The panels report the amplification curves for each one of the 20 mouse lung fragments tested, either adenoma-free (green) or adenoma-bearing (purple), relatively to miRNAs miR-125, miR-374, and miR-669k. [score:1]
[1 to 20 of 7 sentences]
19
[+] score: 13
In Group 1, the most significantly up-regulated miRNAs were miR-1187, miR-125a-3p, miR-466c-5p, miR-5105 and miR-3472, whereas the most significantly down-regulated was miR-125b-5p. [score:7]
The miR-125b was the highest up-regulated miRNA, and thus it was associated with a decrease in apoptosis-related gene expression. [score:6]
[1 to 20 of 2 sentences]
20
[+] score: 12
Figure  2 confirms that the addition of Ucn-1 in reperfusion significantly upregulated the expression of miR-125-3p and miR-324-3p, meanwhile it downregulated miR-139-3p. [score:9]
In addition, miR-125b protected heart from I/R injury by the prevention of apoptotic signaling [14], meanwhile miR-499 mediates cardiac protection against I/R injury by targeting the called programmed cell death 4 (PDCD4) during ischemia postconditioning [15]. [score:3]
[1 to 20 of 2 sentences]
21
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
Overexpression of miR-125a and miR-125b decreased ERBB2 and ERBB3 mRNA and protein levels, inhibited phosphorylation of ERK1/2 and AKT, and inhibited the anchorage-independent growth of ERα -negative/ErbB2 -overexpressing SKBR3 breast cancer cells [195]. [score:9]
E [2] decreased miR-146a, miR 125a, miR-125b, let-7e, miR-126, miR-145, and miR-143 and increased miR-223, miR-451, miR-486, miR-148a, miR-18a, and miR-708 expression in mouse splenic lymphocytes [199]. [score:3]
[1 to 20 of 2 sentences]
22
[+] score: 12
Ultraviolet radiation stress induced the up-regulation of miR-125b, which promoted cell survival by negatively regulating p38α expression through targeting its 3′-UTR [19]. [score:9]
Recently, emerging evidence showed miR-125 is involved in the regulation of cell stress, inflammation and pain. [score:2]
Other studies had focused on the relationship between miR-125 and p38 MAPK. [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 11
For example, miR-134 regulates LimK1 at the spine by stimulation of BDNF [19], miR-138 regulates palmitoylation in neurons by inhibiting the translation of LYPLA [16], [18], miR-132 targets p250GAP to enhance spine growth [20] and the FMRP associated miRNA, miR-125b blocks the translation of NR2B resulting in neuronal structural changes [21]. [score:11]
[1 to 20 of 1 sentences]
24
[+] score: 10
The 3′UTR of human, mouse and rat p53 mRNA all have miR-485 conserved predicted target sites, but only the 3′UTRs of human p53 mRNA has miR-125b target site, (B–D) Quantitative RT-PCR assays were performed to examine p53 mRNA levels in three cell types (H460, NIH/3T3 and H9C2) treated with p53 siRNA and other miRNAs for 48 h. GAPDH served as the internal control (top). [score:4]
However, unlike miR-138, miR-125b specifically target human p53 instead of mouse and rat (Fig. 6A,B). [score:3]
MiR-125b targeting p53 shows divergence between species. [score:2]
In fact, not only miR-138, miR-125b regulation of p53 also has species specificity, compared with miR-485 without this feature. [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 10
Although it has been reported that brain-specific miR-124, miR-125b and let-7 are expressed in mouse and rat eye lenses [27– 30], no studies have involved the spatial and temporal expression profiles of miRNAs in lens development and cataractogenesis. [score:6]
Our data revealed that expression levels of miR7 and miR125b were unchanged in ED16, 4W and 14W lenses. [score:3]
In previous research [27, 29, 30], several miRNAs such as miR124, miR7, miR125b and let7b have been detected in rat lens and in regeneration of new lens by transdifferentiation of pigment epithelial cells of the dorsal iris. [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 9
Picking out 7 miRNAs associated with heart failure and taking statistical analysis, our data reveal that Shenfu injection could significantly downregulate the levels of rno-miR-30c-1-3p, rno-miR-125b-5p, rno-miR-133a-5p, rno-miR-199a-5p, rno-miR-221-3p,rno-miR-146a-5p, and rno-miR-1-3p. [score:4]
Picking out 7 miRNAs associated with heart failure and taking statistical analysis, we found that Shenfu injection could significantly downregulate the levels of rno-miR-30c-1-3p, rno-miR-125b-5p, rno-miR-133a-5p, rno-miR-199a-5p, rno-miR-221-3p, rno-miR-146a-5p, and rno-miR-1-3p (Figure 5(b)). [score:4]
At the same time, miR-125b and miR-199a were implicated in myocardial signaling networks triggering fibrosis [30]. [score:1]
[1 to 20 of 3 sentences]
27
[+] score: 9
[31] MiR-27a affects the expression of MMP-13 and IGFBP-5. [32] MiR-93 regulates collagen loss by targeting MMP-3, [33] and miR-125b regulates the expression of Adamts-4 in human chondrocytes. [score:9]
[1 to 20 of 1 sentences]
28
[+] score: 9
MiR-125b-5p [38] as well as miR-23a and miR-376a are up-regulated in pancreatic cancer [32], [39]. [score:4]
MiR-23a and miR-125b-5p were mostly acinar, and expressed at a lower level in islets. [score:3]
Cluster I and II consisted of miR-29a and miR-21, and miR-125b-5p and miR-23a, respectively, and showed an increased expression at P0 and P2 compared to E20. [score:2]
[1 to 20 of 3 sentences]
29
[+] score: 9
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-372, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
On the other hand, the top upregulated miRNAs at the OP3-OL transition included miRNAs (miR-181a, miR-181b, miR-125b, and miR-184) that are associated with decreased proliferation in maturing CNS cells and decreased malignancy in glioma stem cells [49], [50], [51], [52], [53], [54], [55]. [score:4]
Brain research 55 Henson B Bhattacharjee S O'Dee D Feingold E Gollin S 2009 Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy. [score:3]
European Journal of Cancer 54 Shi L Zhang J Pan T Zhou J Gong W 2009 MiR-125b is critical for the suppression of human U251 glioma stem cell proliferation. [score:2]
[1 to 20 of 3 sentences]
30
[+] score: 8
Five differentially expressed microRNAs were randomly selected for validation, including three arterial highly expressed microRNAs (rno-miR-139-3p, rno-miR-423-5p, rno-miR-125b-5p) and two venous highly expressed microRNAs (rno-miR-1-3p, rno-miR-340-3p). [score:7]
This association was mainly contributed by miR-125b and miR-126. [score:1]
[1 to 20 of 2 sentences]
31
[+] score: 8
MicroRNA-125 also promotes neuronal differentiation in human cells by repressing multiple targets (28) and in mammalian neurons, miR-125 is associated with regulation of dendritic spine length (29). [score:4]
By targeting glypican-4, miR-125 regulates cell growth (27). [score:4]
[1 to 20 of 2 sentences]
32
[+] score: 7
In the mo del group, 17 miRNAs were downregulated, including miR-1, miR-133, miR-29, miR-126, miR-212, miR-499, miR-322, miR-378, and miR-30 family members, whereas the other 18 miRNAs were upregulated, including miR-21, miR-195, miR-155, miR-320, miR-125, miR-199, miR-214, miR-324, and miR-140 family members. [score:7]
[1 to 20 of 1 sentences]
33
[+] score: 7
Other miRNAs from this paper: mmu-mir-30a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-132, mmu-mir-134, mmu-mir-135a-1, mmu-mir-138-2, mmu-mir-142a, mmu-mir-150, mmu-mir-154, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-194-1, mmu-mir-200b, mmu-mir-122, mmu-mir-296, mmu-mir-21a, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-96, rno-mir-322-1, mmu-mir-322, rno-mir-330, mmu-mir-330, rno-mir-339, mmu-mir-339, rno-mir-342, mmu-mir-342, rno-mir-135b, mmu-mir-135b, mmu-mir-19a, mmu-mir-100, mmu-mir-139, mmu-mir-212, mmu-mir-181a-1, mmu-mir-214, mmu-mir-224, mmu-mir-135a-2, mmu-mir-92a-1, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-125b-1, mmu-mir-194-2, mmu-mir-377, mmu-mir-383, mmu-mir-181b-2, rno-mir-19a, rno-mir-21, rno-mir-24-1, rno-mir-27a, rno-mir-30a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-96, rno-mir-100, rno-mir-101a, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-132, rno-mir-134, rno-mir-135a, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-150, rno-mir-154, rno-mir-181b-1, rno-mir-181b-2, rno-mir-183, rno-mir-194-1, rno-mir-194-2, rno-mir-200b, rno-mir-212, rno-mir-181a-1, rno-mir-214, rno-mir-296, mmu-mir-376b, mmu-mir-370, mmu-mir-433, rno-mir-433, mmu-mir-466a, rno-mir-383, rno-mir-224, mmu-mir-483, rno-mir-483, rno-mir-370, rno-mir-377, mmu-mir-542, rno-mir-542-1, mmu-mir-494, mmu-mir-20b, mmu-mir-503, rno-mir-494, rno-mir-376b, rno-mir-20b, rno-mir-503-1, mmu-mir-1224, mmu-mir-551b, mmu-mir-672, mmu-mir-455, mmu-mir-490, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-504, mmu-mir-466d, mmu-mir-872, mmu-mir-877, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-872, rno-mir-877, rno-mir-182, rno-mir-455, rno-mir-672, mmu-mir-466l, mmu-mir-466i, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, rno-mir-551b, rno-mir-490, rno-mir-1224, rno-mir-504, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-466b-8, rno-mir-466d, mmu-mir-466q, mmu-mir-21b, mmu-mir-21c, mmu-mir-142b, mmu-mir-466c-3, rno-mir-322-2, rno-mir-503-2, rno-mir-466b-3, rno-mir-466b-4, rno-mir-542-2, rno-mir-542-3
The levels of miR-212, miRNA-183, miRNA-182, miRNA-132, miRNA-370, miRNA-377, and miRNA-96 were up-regulated, whereas miR-125b, miRNA-200b, miR-122, miRNA-466b, miR-138, miRNA-214, miRNA-503 and miRNA27a were down-regulated in response to 17α-E2 treatment. [score:7]
[1 to 20 of 1 sentences]
34
[+] score: 7
Because, for example, let-7i and miR-146b has been reported to down regulate TLRs [30], [35], and miR-125b has been reported to suppress TNF-α [30]. [score:4]
Among miRNAs that were present at higher levels in colostrum whey, let-7i, miR-148b-3p, miR-27b, and miR-125b-3p affect the function of antigen-presenting cells, and miR-15b, miR-24, miR-92a, miR-181a, miR-181c, and miR-181d affect T cell development and function [29], [30], [35]. [score:2]
On the other hand, other miRNAs such as, let-7i, miR-143, miR-148b-3p, miR-15b, miR-17-5p, miR-24, miR-27b, miR-92a, miR-106b, miR-125b-5p, miR-181a, miR-181c, miR-181d, miR-200c, miR-375, miR-107, miR-141, and miR-370, were present at higher levels in colostrum whey than in mature milk whey (Fig. 6). [score:1]
[1 to 20 of 3 sentences]
35
[+] score: 7
miR-125b overexpression inhibits proliferation of neural stem/progenitor cells (NS/PCs) but promotes differentiation and migration by targeting Nestin [8]. [score:7]
[1 to 20 of 1 sentences]
36
[+] score: 6
Moreover, the expression of miR-125b in mitochondrial fractions showed a significant downregulation after administration of recombinant human growth hormone [44]. [score:6]
[1 to 20 of 1 sentences]
37
[+] score: 6
Similarly, the expression of oncogenic miRNAs like miR-21, miR-10b, let-7i, miR-34c, were increased more than 2 fold in EpCAM [+] liver cancer cells; whereas miR-125b, miR-200a, miR-148b were most down-regulated. [score:6]
[1 to 20 of 1 sentences]
38
[+] score: 6
Experiment 1: Expression of E [2]-responsive mature miRNAs in the hypothalamus of ovarian intact animals changes with ageOur previous studies showed that E [2] regulated a subset of mature miRNAs (let-7i, miR-7a, miR-9, miR-9–3p, miR-125, miR-181a, and miR-495) in an age- and brain-region dependent manner [46]. [score:4]
Our previous studies showed that E [2] regulated a subset of mature miRNAs (let-7i, miR-7a, miR-9, miR-9–3p, miR-125, miR-181a, and miR-495) in an age- and brain-region dependent manner [46]. [score:2]
[1 to 20 of 2 sentences]
39
[+] score: 5
Emerging evidence indicates that miRNAs act as key modulators of target gene expression, and some, such as miR-21, miR-126, miR-33, miR-125, and miR-222, have been shown to be involved in the pathogenesis of stroke [5, 6]. [score:5]
[1 to 20 of 1 sentences]
40
[+] score: 5
As depicted in Fig 6, among the miRNAs elevated in serum in our study, LPS has been shown to increase expression of miR-10a, miR-100, miR-508/511, miR-30c, and miR-125b in human fibroblast-like synoviocytes [41], increase expression of miR-146a in a human monocyte cell line [42], and increase miR-21 in cultured murine monocytes [43]. [score:5]
[1 to 20 of 1 sentences]
41
[+] score: 5
In the PH-group, 49 miRNAs were significantly deregulated (e. g., rno-miR-26a/b, rno-miR-125b-5p and various members of the let-7 family), showing an expression change to at least ≤ 0.8 or ≥ 1.2 compared to normal healthy liver [6], while 45 miRNAs showed significant expression changes in liver samples of animals undergoing SL (Table 1). [score:5]
[1 to 20 of 1 sentences]
42
[+] score: 5
Overexpression of miR-125b [16] would inhibit osteogenic differentiation while anti-miR-221 [17] intervention would trigger the osteogenic differentiation. [score:5]
[1 to 20 of 1 sentences]
43
[+] score: 5
We found that the most abundantly expressed miRNAs are miR-125b-5p. [score:3]
miR-125b has been described to be involved in different cellular processes such as inflammation, cell proliferation, and cell cycle regulation [26– 29]. [score:2]
[1 to 20 of 2 sentences]
44
[+] score: 5
Importantly, the expression of hematopoiesis -associated miRNA (miR-451), brain-enriched miRNA (miR-143), hepatoblastoma -associated miRNA (miR-125) and of the short non-coding RNA RNU6 remained unchanged during the observed period (Fig. 6, lower row), indicating that the amount of these vesicle -associated miRNAs is not modulated at 2, 4 and 6 days after PHx. [score:3]
Other small non-coding RNAs included in the panel [i. e., RNU6, miR-143, miR-451 and miR-125 (close to significance, P = 0.057)] shows a constant expression throughout 2, 4 and 6 days after PHx and a trend of downr-egulation compared to the expression measured at day 0 (See Fig. 7, lower row). [score:2]
[1 to 20 of 2 sentences]
45
[+] score: 5
After normalizing the signal intensities for all miRNA expression levels, miR-124-3p, miR-9a-3p, miR-34a-5p, miR-9a-5p, miR-125b-5p, miR-let-7c-5p, miR-29a-3p, miR-23b-3p, miR-451-5p, and miR-30c-5p were the miRNAs expressed at the highest levels (Figure  1). [score:5]
[1 to 20 of 1 sentences]
46
[+] score: 4
Other miRNAs from this paper: rno-mir-125b-1, rno-mir-134, rno-mir-146a, rno-mir-155
It is remarkable that several significantly up-regulated brain miRNAs– miR-125b, miR-146a and miR-155–may contribute to so many of the observed deficits in AD including increased glial cell proliferation, altered synaptogenesis, deficits in neurotrophism, altered cytokine signalling and non-homoeostatic activation of innate immunity and inflammatory signalling [60– 62]. [score:4]
[1 to 20 of 1 sentences]
47
[+] score: 4
In general agreement with the array data, we observed a trend towards downregulation of miR-125-a-5p (p = 0.079, fold change −1.79) and miR-145 (p = 0.089, fold change −1.82) in methamphetamine self-administration rats (Figure  3a, n = 6 in each group). [score:4]
[1 to 20 of 1 sentences]
48
[+] score: 4
miR-21 and miR-125, which have been published to be androgen responsive and play a role in prostate carcinogenesis, are also upregulated in normal prostate [22], [23]. [score:4]
[1 to 20 of 1 sentences]
49
[+] score: 4
A recent study showed that the serum levels of miR-122-5p, miR-125b-5p and miR-21-5p were significantly upregulated in patients with bone fracture in comparison with healthy controls [21], implying the potential values of these miRNAs as biomarkers for bone fracture. [score:4]
[1 to 20 of 1 sentences]
50
[+] score: 4
And 17 miRNAs are downregulated as shown in the lower part of this figure, let-7d, miR-665, miR-125b*, let-7b*, miR-124*, miR-770, miR-383, miR-29b-2*, miR-760-3p, miR-324-3p, miR-135b, miR-21, miR-409-5p, let-7f-1*, miR-28, miR-499*,let-7i* (Table 2). [score:4]
[1 to 20 of 1 sentences]
51
[+] score: 3
The deficiency of let-7 can stimulate DNA replication and cell division [27], so it suggested that let-7, miR-125, and miR-9 were the key regulators of retinal progenitor cells in the early to late developmental stages [28, 29]. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 3
Combination wt-p53 and microRNA-125b transfection in a genetically engineered lung cancer mo del using dual CD44/EGFR -targeting nanoparticles. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
Validation of a selected few by qPCR identified 10 miRNAs - miR-133b-3p, miR-208b-3p, miR-21-5p, miR-125a-5p, miR-125b-5p, miR-126-3p, miR-210-3p, miR-29a-3p, miR-494-3p and miR-320a, that were significantly up-regulated in HF myocardium compared to normal controls. [score:3]
[1 to 20 of 1 sentences]
54
[+] score: 3
Out of the 14 miRNAs that were detected to be differentially expressed using NGS (Table  4), five (rno-let-7d-5p, rno-miR-100-5p, rno-miR-203a-3p, rno-miR-21-5p, rno-miR-320-3p) were represented on the TLDA-A, while nine (rno-miR-378a-3p, mmu-miR-5100, rno-miR-30e-3p, rno-miR-125b-2-3p, rno-miR-320-5p, rno-miR-3473, rno-miR-21-3p, rno-miR-455-5p, and hsa-miR-7641) were not. [score:3]
[1 to 20 of 1 sentences]
55
[+] score: 2
Recent studies have successfully established a functional link between cell survival and a discrete group of survival -regulating miRNAs, including miRNA-1 [14], miRNA-125 [15], miRNA-206 [14], miRNA-210 [16, 17] and miRNA-708 [18]. [score:2]
[1 to 20 of 1 sentences]
56
[+] score: 2
Tili E. Michaille J. J. Cimino A. Costinean S. Dumitru C. D. Adair B. Fabbri M. Alder H. Liu C. G. Calin G. A. Modulation of miR-155 and miR-125b levels following lipopolysaccharide/ TNF-α stimulation and their possible roles in regulating the response to endotoxin shockJ. [score:2]
[1 to 20 of 1 sentences]
57
[+] score: 2
Other miRNAs from this paper: rno-mir-125b-1, rno-mir-132
Regulation of synaptic structure and function by FMRP -associated microRNAs miR-125b and miR-132. [score:2]
[1 to 20 of 1 sentences]
58
[+] score: 2
Other miRNAs from this paper: rno-mir-125b-1, rno-mir-132
Regulation of synaptic structure and function by FMRP -associated microRNAs miR-125b and miR-132. [score:2]
[1 to 20 of 1 sentences]
59
[+] score: 2
Other miRNAs shown to regulate neuronal lineage commitment include members of the let-7 family and miR-125b (Leucht et al., 2008; Rybak et al., 2008). [score:2]
[1 to 20 of 1 sentences]
60
[+] score: 2
miR-125b, miR-146, miR-150, miR-199a, miR-21, miR-129, miR-341 and miR-451 have been confirmed to play an important role in the different developmental stages of the cardiovascular system (4– 18). [score:2]
[1 to 20 of 1 sentences]
61
[+] score: 2
Regulation of the histamine/VEGF axis by miR-125b during cholestatic liver injury in mice. [score:2]
[1 to 20 of 1 sentences]
62
[+] score: 2
Regulation of synaptic structure and function by FMRP -associated microRNAs miR-125b and miR-132. [score:2]
[1 to 20 of 1 sentences]
63
[+] score: 2
The expression patterns of some miRNAs observed in our study are consistent with what were observed in previous studies by using the blot-array and Northern blot assays, i. e. miR-125b, miR-9, and miR-181a [6], as well as miR-29a, miR-138 and miR-92 [53]. [score:2]
[1 to 20 of 1 sentences]
64
[+] score: 1
Moreover, miRNA-125b and miRNA-146a are involved in astroglial cell proliferation and in the innate immune and inflammatory response [30]. [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
We found four microRNAs (LET-7, MIR-100, MIR-125, and MIR-126) that could detect teratomas and had previously been associated with oncogenic transformations (Gu et al., 2015, Wu et al., 2015). [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
The coded proteins are critically involved in lipid and cholesterol homeostasis while inflammatory signalling of the Toll-like receptor 4 and STAT3 pathways was influenced by let-7i-5p and miR-125b-5p, respectively. [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
For example, the miR-125 and let-7 microRNAs are dramatically induced at puparium formation, in tight temporal synchrony with the 20E primary-response E74A mRNA, but do so in a manner that is independent of either 20E or EcR [24]. [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
Synthetic miR-125 was also taken up by the synaptosomes through a non-specific endocytic mechanism. [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
Seeliger et al. profiled miRNAs in bone tissue from patients with osteoporotic fractures and identified five miRNAs, miR-21, miR-23a, miR-24, miR-100, and miR-125b that are highly associated with osteoporotic fractures [13]. [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
The TPM of tsp-miR-100-5p and tsp-miR-100-3p, tsp-miR-125-5p and tsp-miR-125-3p, tsp-miR-9-1-5p and tsp-miR-9-1-3p, tsp-miR-9-2-3p and tsp-miR-9-2-5p behaved in similar fashion (Fig. 4, Fig. 5A and Table S5). [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
For example, miR-105, miR-125b and miR-140 are involved in the inflammatory phase; miR-15a, miR-15b and miR-16 participate in the granulation phase; and miR-29 and miR-192 function in the remo deling phase [10]. [score:1]
[1 to 20 of 1 sentences]
72
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
These include rno-miR-195, rno-miR-125a-5p, rno-let-7a, rno-miR-16, rno-miR-30b-5p, rno-let-7c, rno-let-7b, rno-miR-125b-5p, rno-miR-221, rno-miR-222, rno-miR-26a, rno-miR-322, rno-miR-23a, rno-miR-191, rno-miR-30 family, rno-miR-21, rno-miR-126, rno-miR-23b, rno-miR-145 and rno-miR-494. [score:1]
[1 to 20 of 1 sentences]
73
[+] score: 1
Brain-enriched miRNAs such as miR-9, miR-124a, miR-125, and numerous others are induced in primary neural tissues and differentiating primary neurons [20]– [22]. [score:1]
[1 to 20 of 1 sentences]
74
[+] score: 1
Other miRNAs from this paper: rno-mir-17-1, rno-mir-34a, rno-mir-96, rno-mir-125b-1, rno-mir-17-2
When ER stress reaches a certain threshold, IRE1α selectively degrades four pre-microRNAs, including four microRNAs (miR-17, miR-34a, miR-96 and miR-125b) [49]. [score:1]
[1 to 20 of 1 sentences]