sort by

113 publications mentioning rno-let-7a-1 (showing top 100)

Open access articles that are associated with the species Rattus norvegicus and mention the gene name let-7a-1. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 412
As demonstrated, GATA4 was activated by β [1]-AR up-regulation through cAMP-PKA signaling pathway in early phase of ischemia, then GATA4 positively regulated let-7a expression which in turn suppressed β [1]-AR expression. [score:11]
A. Expression of t-GATA4 and p-GATA4 in NRVCs treated with DOB or in combination with GATA-4 decoy ODN; B-D. Effects of GATA-4 decoy ODN on DOB regulated expression of let-7a, β1-AR protein andβ1-AR mRNA, respectively; E. Expression of t-GATA4 and p-GATA4 treated with dobutamine (DOB) or in combination with GATA-4 siRNA; F-H. Effects of GATA-4 siRNA on DOB regulated expression of let-7a, β1-AR protein and β1-AR mRNA, respectively. [score:11]
Figure 5 A. Expression of t-GATA4 and p-GATA4 in NRVCs treated with DOB or in combination with GATA-4 decoy ODN; B-D. Effects of GATA-4 decoy ODN on DOB regulated expression of let-7a, β1-AR protein andβ1-AR mRNA, respectively; E. Expression of t-GATA4 and p-GATA4 treated with dobutamine (DOB) or in combination with GATA-4 siRNA; F-H. Effects of GATA-4 siRNA on DOB regulated expression of let-7a, β1-AR protein and β1-AR mRNA, respectively. [score:11]
A. Expression of t-GATA4 and p-GATA4 treated with FSK or in combination with GATA-4 decoy ODN; B-D. Effects of GATA-4 decoy ODN on forskolin (FSK) regulated expression of let-7a, β1-AR protein and β1-AR mRNA, respectively; E. Expression of t-GATA4 and p-GATA4 treated with FSK or in combination with GATA-4 siRNA; F-H. Effects of GATA-4 siRNA on FSK regulated expression of let-7a, β1-AR protein and β1-AR mRNA, respectively. [score:11]
Figure 6 A. Expression of t-GATA4 and p-GATA4 treated with FSK or in combination with GATA-4 decoy ODN; B-D. Effects of GATA-4 decoy ODN on forskolin (FSK) regulated expression of let-7a, β1-AR protein and β1-AR mRNA, respectively; E. Expression of t-GATA4 and p-GATA4 treated with FSK or in combination with GATA-4 siRNA; F-H. Effects of GATA-4 siRNA on FSK regulated expression of let-7a, β1-AR protein and β1-AR mRNA, respectively. [score:11]
This negative feedback pathway is described as that β [1]-AR is excited and up-regulated in early phase of myocardial ischemia, which activates transcription factor GATA4 via cAMP/PKA signaling pathway, leading to up-regulation of let-7a which inhibits β [1]-AR expression in CIHF. [score:11]
Our findings allowed us to establish a negative feedback circuit as a mechanism for abnormal up-regulation of let-7a and to verify the up-regulation of let-7a as a mechanism for the down-regulation of β [1]-ARs in heart failure. [score:10]
Overexpression of let-7a inhibited β [1]-AR expression in neonatal rat ventricular cells (NRVCs), which was abolished by anti-let-7a antisense inhibitor. [score:9]
Figure 4 A. Effects of decoy ODN (oligodeoxynucleotide) on the expression of total GATA4 protein (t-GATA4) and phosphorylated GATA4 (p-GATA4); B. Effects of GATA-4 decoy ODN on let-7a expression; C and D. Effects of GATA-4 decoy ODN on β1-AR protein and mRNA levels, respectively; E. Effects of GATA-4 siRNA on the expression of t-GATA4 and p-GATA4; F. Effects of GATA-4 siRNA on let-7a expression; G and H. Effects of GATA-4 siRNA on β1-AR protein and mRNA levels, respectively. [score:9]
A. Effects of decoy ODN (oligodeoxynucleotide) on the expression of total GATA4 protein (t-GATA4) and phosphorylated GATA4 (p-GATA4); B. Effects of GATA-4 decoy ODN on let-7a expression; C and D. Effects of GATA-4 decoy ODN on β1-AR protein and mRNA levels, respectively; E. Effects of GATA-4 siRNA on the expression of t-GATA4 and p-GATA4; F. Effects of GATA-4 siRNA on let-7a expression; G and H. Effects of GATA-4 siRNA on β1-AR protein and mRNA levels, respectively. [score:9]
Down-regulation of β [1]-ARs and up-regulation of let-7 in chronic ischemic failing heartThe expression level of β [1]-ARs was decreased by 34.0 ± 6.3% in failing hearts compared with those in non-failing hearts (Figure 1A). [score:8]
Effects of let-7a knockdown on β [1]-ARs expression and cardiac function of rats with CIHFThe level of let-7a was significantly up-regulated by 2.0-fold in the CIHF rats than controls, and len-pre-let-7a further increased let-7a expression by 0.8-fold compared with the CIHF group. [score:8]
Our previous study revealed that let-7 is considerably down-regulated in the setting of acute myocardial ischemia which results in the upregulation of β [1]-ARs and the associated arrhythmogenesis and dysfunction of the heart. [score:7]
The mechanisms for let-7 up-regulation and the possible pathophysiological role of let-7 upregulation in CIHF remained unknown. [score:7]
In the present study, we found that let-7a, b, c, d, f and I were significantly upregulated and let-7e downregulated in rat failure hearts. [score:7]
β [1]-AR level was obviously down-regulated and let-7a up-regulated in the failing heart 4 weeks after myocardial infarction. [score:7]
First, the level of let-7 family members, especially let-7a, was significantly up-regulated in CIHF, along with down-regulation of β [1]-ARs. [score:7]
Down-regulation of β [1]-ARs and up-regulation of let-7 in chronic ischemic failing heart. [score:7]
Inhibition of let-7a alleviated the downregulation of β1-AR and improved cardiac function in a rat mo del of CIHF. [score:6]
GATA-4 participates in the regulation of let-7a and β [1]-AR expression GATA4 is a cardiac specific transcription factor that plays a key role in the regulation of cardiac physiology and development. [score:6]
Let-7a was increased by long-term treatment of FSK, and the up-regulated expression of let-7a was reversed by GATA4 siRNA transfection (Figure 6F). [score:6]
Intriguingly, in our preliminary studies in a rate mo del of chronic myocardial ischemia, members of the let-7 miRNAs family were found upregulated, whereas let-7a showed the opposite expression. [score:6]
Artificial mediation on this feedback circuit by interfering let-7 expression may be a potential strategy and new idea for the regulation of β [1]-AR expression in the prevention and treatment of heart failure. [score:6]
Let-7 regulates expression of β [1]-ARs in cardiomyocytesTargetScan miRNA database was used to predict a binding site at the 3’UTR of β [1]-AR mRNA for all members of the let-7 family, which is highly conserved among human, rat and mouse (Figure 2A). [score:6]
Consistent with luciferase assay, let-7a overexpression inhibited β [1]-ARs protein expression in NRVCs. [score:6]
Second, let-7a directly targeted ADRB1 mRNA 3’UTR to repress β [1]-AR expression. [score:6]
Our results revealed that GATA4 positively regulated let-7a expression that in turn reduced β [1]-AR expression by acting on the 3’UTR of ADRB1 mRNA. [score:6]
These data indicate that cAMP-PKA signaling pathway mediates the down-regulation of β [1]-AR by targeting GATA4 and let-7a. [score:6]
The main purpose of our study was to explore the mechanisms of β [1]-AR down-regulation in CIHF and role of let-7a in regulating the β [1]-AR/cAMP/PKA/GATA-4 signaling pathway. [score:5]
The level of let-7a was significantly up-regulated by 2.0-fold in the CIHF rats than controls, and len-pre-let-7a further increased let-7a expression by 0.8-fold compared with the CIHF group. [score:5]
Let-7 belongs to a miRNA family containing 13 members sharing the same seed sequence thereby the same set of target genes [18], and is affluently expressed in the heart [19]. [score:5]
DOB -induced Let-7a upregulation was inhibited by transfection of GATA4 siRNA (Figure 5F). [score:5]
This can be translated into a more physiological term: in the early stage, or the acute phase, of ischemia, the enhanced sympathetic tone induces β [1]-AR activation and the subsequent signal transduction, leading to activation of GATA4 thereby the expression of let-7a. [score:5]
The role of GATA4 on cAMP activator forskolin in regulation in expression of let-7a and β1-AR in NRVCs. [score:4]
The present work was conducted to elucidate the mechanism by which let-7a is up-regulated and the influence it produces to the heart in a mo del of CIHF. [score:4]
Prolonged activation of β [1]-AR and Its downstream pathway factor cAMP forms a regulation of negative feedback loop on β [1]-AR expression through GATA4While the above experiments provided strong evidence for the role of GATA4 in the regulation of let-7a transcription, we pretreated the NRVCs with dobutamine (DOB, a selective β [1]-AR agonist, 10 μM) for 72 h. We observed that the levels of the total protein (t-GATA4) and phosphorylated form of GATA4 (p-GATA4) were increased compared with the control groups (Figure 5A). [score:4]
The limitations of the study may be that (1) there is a lack of transgenic overexpression or knockout mo del to further confirm the function of let-7a;(2) the role of let-7a in human heart failure has not been explored. [score:4]
In the presence of DOB, the level of let-7a was up-regulated, which was abolished by the decoy ODN of GATA4 (Figure 5B). [score:4]
The role of GATA4 on β1-AR activation in regulation of expression of let-7a and β1-AR in NRVCs. [score:4]
The lentivirus vector containing precursor let-7a (len-pre-let-7a) further down-regulated the reduced β [1]-AR level by CIHF and the effect was reversed by len-AMO-let-7a. [score:4]
Under such a condition, the levels of β [1]-AR protein and mRNA were both reduced in a concentration dependent manner (Figure 1D and 1E), whereas, the members of let-7 family, particularly let-7a, were markedly up-regulated (Figure 1F). [score:4]
Of note, len-let-7a profoundly strengthened the CIHF -induced down-regulation of β [1]-AR protein level, which was repealed by co-treatment with len-AMO-let-7a. [score:4]
Among which, let-7a was the most notably up-regulated miRNA. [score:4]
However, let-7a level was significantly diminished (Figure 4B), and β [1]-AR was pronouncedly up-regulated at both protein and mRNA levels (Figure 4C and 4D). [score:4]
The regulatory effects of GATA4 on let-7a and β1-AR expression. [score:4]
GATA-4 participates in the regulation of let-7a and β [1]-AR expression. [score:4]
Studies discovered the deregulation of the let-7 members in cardiovascular diseases, such as cardiac hypertrophy, cardiac fibrosis, and myocardial infarction [20]. [score:4]
Moreover, len-AMO-let-7a alone reversed the CIHF -induced down-regulation of β [1]-ARs. [score:4]
Effects of let-7a knockdown on β [1]-ARs expression and cardiac function of rats with CIHF. [score:4]
FSK up-regulated the level of let-7a, and the effects were abolished by GATA4 decoy ODN (Figure 6B). [score:4]
These data suggested that GATA4 regulates β [1]-AR expression through let-7a. [score:4]
A. Alignment of the sequences of let-7 family (bottom) with their target sites in the 3’UTRs of human, rat and mouse β1-AR mRNAs (top). [score:3]
Figure 3 A. let-7a in CIHF treated with len-pre-let-7a, len-AMO-let-7a, or len-NC; B and C. β1-AR protein and mRNA expression in CIHF treated with len-let-7a, len-AMO-let-7a, or len-NC; D and E. Cardiac function of rats by echocardiography; F. Heart rate (HR) of rats in mo dels of CIHF. [score:3]
We therefore conducted a series of experiments to experimentally verify the targeting relationship between let-7a and β [1]-ARs. [score:3]
Data are expressed as mean ± SD; n = 4-6 batches for each group; *P < 0.05 vs Ctl (no treatment); #P < 0.05 vs the group transfected with let-7a. [score:3]
In agreement with the in vivo data, reciprocal changes of expression of β [1]-AR and let-7 miRNAs were also observed in ISO -treated NRVCs. [score:3]
Lentivirus vectors expressing mature let-7a, anti-miRNA-oligo of let-7a (AMO-let-7a) or NC sequence were constructed (Invitrogen, China). [score:3]
This discrepancy of let-7 family expression may be attributed to the family members’ transcript from different gene clusters which contribute to different processes in heart failure. [score:3]
Let-7 regulates expression of β [1]-ARs in cardiomyocytes. [score:3]
Our results displayed that luciferase activities were significantly inhibited by let-7a with wild-type 3’UTR of rat and human ADRB1, which were canceled by co-transfection of AMO-let-7a (Figure 2B and 2C). [score:3]
Let-7a mimics (sequence: 5’-UGAGGUAGUAGG UUGUAUAGUU-3’) and its antisense inhibitor AMO-let-7a (sequence: 5’-AACUAUACAACCUC CUACCUCA-3’) were synthesized by RiboBio (RiboBio, Guangzhou, China). [score:3]
Let-7a regulates β [1]-AR expression and forms a negative feedback loop with β [1]-AR signaling pathway in ischemic heart failure. [score:3]
Date are expressed as mean ± SD, n = 5-10 in each group; *P < 0.05 vs Sham,#P < 0.05 vs MI,&P < 0.05 vs MI + Len-pre-let-7a. [score:3]
Experimental verification of β1-AR as a target of let-7a. [score:3]
Figure 2 A. Alignment of the sequences of let-7 family (bottom) with their target sites in the 3’UTRs of human, rat and mouse β1-AR mRNAs (top). [score:3]
In all cases, negative control constructs failed to affect the expression of let-7a and β [1]-ARs. [score:3]
Targetscan predicts the presence of a putative binding site for let-7 in the 3’UTR of ADRB1 mRNA, the gene encoding β [1]-AR, which is highly conserved among mammals. [score:3]
A. let-7a in CIHF treated with len-pre-let-7a, len-AMO-let-7a, or len-NC; B and C. β1-AR protein and mRNA expression in CIHF treated with len-let-7a, len-AMO-let-7a, or len-NC; D and E. Cardiac function of rats by echocardiography; F. Heart rate (HR) of rats in mo dels of CIHF. [score:3]
TargetScan miRNA database was used to predict a binding site at the 3’UTR of β [1]-AR mRNA for all members of the let-7 family, which is highly conserved among human, rat and mouse (Figure 2A). [score:3]
Reduced heart rate in let-7a -treated MI rats was likely attributed to inhibition of β [1]-AR in heart sinus. [score:3]
Thus, it forms a critical feedback loop signaling pathway of β [1]-AR/cAMP/PKA/GATA-4/let-7/β [1]-AR, and the decreasing of β [1]-AR in CIHF is induced by β [1]-AR activation in early phase of CIHF, which is a kind of self-regulation of β [1]-AR in the course of ischemia induced heart failure. [score:2]
The aim of the present study was to investigate the role of microRNA (miRNA) let-7a in down-regulation of β [1]-adrenoceptors (β [1]-AR) and elucidate the underlying mechanism of chronic ischemia heart failure (CIHF) in rats. [score:2]
Our initial computational analysis using the JASPAR database predicted that there are putative binding regions for GATA4 in the upstream regulatory domain of the let-7a gene. [score:2]
Third, GATA4 positively regulated the transcription of let-7a. [score:2]
Conversely, knockdown of endogenous let-7a by AMO-let-7a increased β [1]-AR protein level relative to the control group (Figure 2G). [score:2]
To explore the possible role of GATA4 in regulating let-7a transcription, the decoy ODN (oligodeoxynucleotide) for GATA4 was transfected into NRVCs. [score:2]
Importantly, there exists a negative feedback loop associated with β [1]-AR regulation through β [1]-AR/cAMP/PKA/GATA4/let-7a/β [1]-AR signaling pathway in CIHF. [score:2]
Meanwhile, GATA4 siRNA was also used to testify the role of GATA4 in regulation of let-7a and β [1]-AR in NRVCs. [score:2]
Construction of plasmid carrying the 3’UTR of β [1]-adrenergic receptor (ADRB1) gene and luciferase assayTargetscan predicts the presence of a putative binding site for let-7 in the 3’UTR of ADRB1 mRNA, the gene encoding β [1]-AR, which is highly conserved among mammals. [score:2]
The transfection efficiency of let-7a and the effectiveness of AMO-let-7a to knockdown endogenous let-7a were determined by qRT-PCR in NRVCs. [score:2]
Len-pre-let-7a caused a significant deterioration of cardiac function, as reflected by decreased ejection fraction (EF) and fractional shortening (FS) in CIHF rats. [score:1]
The complementary nucleotides are highlighted in green; B and C. Luciferase reporter gene activities generated by luciferase vectors carrying wild-type 3’UTRs of rat and human β1-adrenergic receptor (ADRB1), respectively; D and E. Luciferase reporter gene activities generated by luciferase vectors carrying mutant 3’UTRs of rat and human ADRB1, respectively; F. Let-7a levels in NRVCs transfected with let-7a mimic, AMO-let-7a or negative control (NC); G and H. β1-AR mRNA and protein levels in NRVCs transfected with let-7a, AMO-let-7a or NC group. [score:1]
It is conceivable based on our findings that let-7 participates in the β [1]-AR/cAMP/PKA/GATA-4 signaling pathway as an upstream component and its participation forms a negative feedback loop. [score:1]
While the above experiments provided strong evidence for the role of GATA4 in the regulation of let-7a transcription, we pretreated the NRVCs with dobutamine (DOB, a selective β [1]-AR agonist, 10 μM) for 72 h. We observed that the levels of the total protein (t-GATA4) and phosphorylated form of GATA4 (p-GATA4) were increased compared with the control groups (Figure 5A). [score:1]
Virus-containing solution (20μl, 10 [8]TU) including pre-let-7a, pre-AMO-let-7a and pre-NC were injected into the cavity of the left ventricle of rat heart with ascending aortic artery clamped. [score:1]
Let-7a was increased by 6.3-fold by transfection of let-7a mimics and reduced by 35.6 ± 22.2 % by transfection of AMO-let-7a (Figure 2F). [score:1]
A-C. β1-AR protein, β1-AR mRNA and let-7 family levels in the hearts of ischemic heart failure rats; D-F. β1-AR protein, β1-AR mRNA and let-7 family levels in NRVCs treated with isoproterenol (ISO) for 72 h. HF, heart failure; Ctl, control. [score:1]
A schematic diagram illustrating the feedback circuit of the signaling pathway β1-AR—cAMP—PKA—GATA-4—let-7a—β1-AR in CIHF. [score:1]
The sequences of human and rat ADRB13’UTR containing the binding site for let-7a inserted into the vectors were as follows: The human β [1]-AR 3’UTR (position 704-711 of human ADRB13’UTR, 160 base pairs): 5’-CGAGCTCTTAAGCTCTTCTTGGAACAAGCCCCACCTTGCTTTCCTTGTGTAGGGCAAACCCGCTGTCCCCCGCGCGCCTGGGTGGTCAGGCTGAGGGATTTCTACCTCACCTGTGCATTTGCACAGCAGATAGAAAGACTTGTTTATATTAAGCTTGGG-3’. [score:1]
Level of β1-AR and let-7 in chronic ischemic failing hearts and ISO -treated neonatal rat ventricular cardiomyocytes (NRVCs). [score:1]
We therefore proposed the modified signaling pathway: β [1]-AR↑→cAMP↑→PKA↑→GATA-4↑→let-7↑→β [1]-AR↓. [score:1]
Figure 1 A-C. β1-AR protein, β1-AR mRNA and let-7 family levels in the hearts of ischemic heart failure rats; D-F. β1-AR protein, β1-AR mRNA and let-7 family levels in NRVCs treated with isoproterenol (ISO) for 72 h. HF, heart failure; Ctl, control. [score:1]
After transfection with let-7a mimics (100 nM) or AMO-let-7a (200 nM) for 36 h, the NRVCs were used for qRT-PCR and. [score:1]
Construction and infection of lentivirus carrying pre-let-7a. [score:1]
Administration of len-AMO-let-7a reduced let-7a level in CIHF rats, while Len-NC had no effect (Figure 3A). [score:1]
A segment containing the let-7 miRNA binding sites flanked by the Hand III and Sac I restriction sites and a scramble sequence as a negative control (NC) were synthesized by Invitrogen. [score:1]
β [1]-AR mRNA level was similarly affected by let-7a (Figure 2H). [score:1]
[1 to 20 of 97 sentences]
2
[+] score: 245
Engraftment of MSCs dramatically ameliorated the downregulation of let-7a expression in PAH animals, indicating a potential critical role of let-7a in the development of PAH. [score:7]
Patel K Kollory A Takashima A Sarkar S Faller DV Ghosh SK MicroRNA let-7 downregulates STAT3 phosphorylation in pancreatic cancer cells by increasing SOCS3 expressionCancer Lett. [score:6]
Chen Z Wang D Gu C Liu X Pei W Li J Down-regulation of let-7 microRNA increased K-ras expression in lung damage induced by radonEnviron Toxicol Pharmacol. [score:6]
Concomitantly, we also simulated the condition of PAH by hypoxia exposure in vitro and observed a high expression of let-7a in hypoxia -treated MSCs, suggesting that MSCs could induce the expression of let-7a in the progression of PAH. [score:5]
Furthermore, application of MSC-let-7a also attenuated the wall thickness of pulmonary arterioles and restrained the expression of ECM protein Fn and α-SMA, indicating an inhibitory effect of MSC-let-7a on vascular remo deling. [score:5]
However, co-culture with MSCs significantly inhibited hypoxia -induced PASMC proliferation, which was further augmented when PASMCs were co-cultured with let-7a -overexpressed MSCs. [score:5]
Interestingly, suppression of PASMC proliferation and enhancement of cell apoptosis triggered by MSC-let-7a were obviously abated when silencing BMPR2 expression. [score:5]
Furthermore, suppressing BMPR2 expression remarkably counteracted the pro-apoptotic effect of MSC-let-7a on PASMCs (Fig.   5f). [score:5]
The expression of let-7a was analyzed by quantitative RT-PCR (a) and, about 3 weeks later, the expression of let-7a was analyzed in lung tissues (b). [score:5]
As shown in Fig.   5a, MSC-let-7a abrogated hypoxia -induced expression of p-STAT3 and increased downstream BMPR2 expression, suggesting that MSC-let-7a abolished the activation of the STAT3-BMPR2 pathway. [score:5]
The expression of let-7a was normalized to U6, and β-actin was used as a quality control to normalize other gene expression. [score:5]
Therefore, these results confirmed that MSC-let-7a suppressed the growth of PASMCs by suppressing cell proliferation and cell resistance to apoptosis, which may ameliorate the progression of PAH. [score:5]
Overexpression of let-7a in MSCs regulates hypoxia -induced PASMC proliferation. [score:4]
with PAH show a dramatic downregulation of let-7a in the lungs [16]. [score:4]
This study indicated that MSC-let-7a could ameliorate the development of MCT -induced PAH by suppressing the growth of PASMCs. [score:4]
Fig. 5The STAT3-BMPR2 signaling was responsible for MSC-let-7a-regulated growth inhibition of PASMCs. [score:4]
A previous study corroborated the downregulation of let-7a in lung injury [25]. [score:4]
Whether MSC-let-7a can attenuate the development of PAH by regulating lipid metabolism will provide a new direction for further research and will be explored in our future research. [score:4]
Consistent with our previous hypothesis, MSC-let-7a significantly antagonized p-STAT3 levels, concomitant with the upregulation in its downstream BMPR2. [score:4]
Furthermore, a higher expression of let-7a was also conferred in MSCs exposed to hypoxia, in contrast to the normoxia group (Fig.   2b). [score:3]
Fig. 4MSC-let-7a administration dramatically inhibited PASMC proliferation and reduced its resistance to apoptosis. [score:3]
To explore the effects of MSC -based therapy against PAH, MSCs were exposed to Ad-let-7a or Ad-NC viruses and cultured for 48 h. Then, quantitative RT-PCR was performed to detect let-7a expression in MSCs (c). [score:3]
Cell that overexpressed let-7a were then harvested with phosphate-buffered saline (PBS) buffer supplement with 0.25% trypsin and 1 mmol/L EDTA before use. [score:3]
Additionally, hypoxia-triggered expression of known proliferation markers Ki67 and PCNA were also dramatically dampened after MSC-let-7a treatment (Fig.   4b and c). [score:3]
Moreover, MSC treatment enhanced let-7a expression in the lungs of PAH rats, indicating a potential role of let-7a in MSC -mediated therapy for PAH. [score:3]
Importantly, preconditioning with BMPR2 siRNA dramatically abated the suppressive effects of MSC-let-7a on PASMC proliferation and apoptosis resistance. [score:3]
Collectively, this study suggests that MSCs modified with let-7a may ameliorate the progression of PAH by inhibiting PASMC growth through the STAT3-BMPR2 signaling, supporting a promising therapeutic strategy for PAH patients. [score:3]
After co-culture with MSCs modified with let-7a or NC, the expression levels of STAT3, p-STAT3, and downstream BMPR2 were determined in PASMCs upon hypoxia by. [score:3]
STAT3-BMPR2 signaling is involved in the growth inhibition of PASMCs triggered with MSC-let-7a. [score:3]
Pulmonary arterial hypertension mesenchymal stem cells let-7a pulmonary artery smooth muscle cell STAT3 pathway BMPR2 Pulmonary arterial hypertension (PAH) is a well-recognized, devastating, and life-threatening disease. [score:3]
To elucidate the underlying mechanism involved in MSC-let-7a -mediated inhibition of PASMC growth, the activation of STAT3 was determined. [score:3]
Notably, the suppressive role of MSC-let-7a in SMC proliferation was also restored when cells were pre-administered with BMPR2 siRNA (Fig.   5d). [score:3]
Expression levels of let-7a in MSCs. [score:3]
Furthermore, the expression of let-7a in lung tissues was also increased in MSC-let-7a groups (Fig.   3b). [score:3]
In contrast to the PBS group, the expression of let-7a was obviously increased at 7 days after injection with MSCs, which was further elevated in the MSC-let-7a group. [score:3]
Moreover, let-7 expression also negatively correlated with the severity of PAH in patients with systemic scleroderma [19]. [score:3]
Simultaneously, MSC-let-7a treatment mitigated cyclin D1 levels in hypoxia-exposed PASMCs, concomitant with the increase in the cell cycle inhibitor protein p21. [score:3]
To further clarify the effect of MSC-let-7a on MCT -induced pulmonary vascular remo deling, the expression of ECM protein fibronectin (Fn) was determined. [score:3]
Importantly, let-7a-MSC treatment obviously suppressed RVSP and RVH, which is the final pathway leading to the death of patients [1]. [score:3]
Magnification × 200 Consistent with a previous report [16], an obvious attenuation of let-7a expression was substantiated in PAH rats (Fig.   2a). [score:3]
Adenoviral vectors of AdmiRa-rno-let-7a expressing green fluorescent protein (GFP) and miR-control (normal control; NC) were obtained from Applied Biological Materials Inc. [score:3]
Fig. 2Expression of let-7a in MSCs and PAH rats. [score:3]
Thus, MSC-let-7a could suppress PASMC growth by dampening cell proliferation and antagonizing cell resistance to apoptosis. [score:3]
Moreover, 3 week later, the expression of let-7a was still maintained at a relatively higher level in MSC-let-7a groups relative to PBS and MSC groups (Fig.   3a). [score:3]
BMPR2 bone morphogenetic protein receptor 2, MSC mesenchymal stem cell, NC miR-control, PCNA proliferating cell nuclear antigen, siRNA small interfering RNA, STAT3 signal transducers and activators of transcription 3 Recently, let-7a has generated broad interest as a promising therapeutic agent for several diseases associated with proliferative and metabolic abnormalities, including cancer [24]. [score:3]
Then, the obtained rMSCs at P3–P4 were infected with the above adenovirus to generate the let-7a -overexpressed MSCs. [score:3]
Moreover, a more obvious decrease in Fn expression was seen in the MSC-let-7a groups than that in the MSC groups. [score:3]
MSCs were exposed to hypoxia (3% oxygen) or normoxia (control group) for 24 h. The expression of let-7a was detected in control and hypoxia -treated groups (b). [score:3]
The expression of let-7a was analyzed by quantitative RT-PCR (a). [score:3]
In this study, we aimed to explore the function of MSCs transfected with let-7a in PAH development. [score:2]
An analogous decrease in let-7a was also validated when cells were exposed to chronic hypoxia, suggesting a potential role of let-7a in the development of PAH [18]. [score:2]
These results indicate a potential protective effect of MSC-let-7a on PAH development. [score:2]
Quantitative RT-PCR assay showed that the expression of let-7a in let-7a [+] MSCs was obviously enhanced relative to the control group (Fig.   2c). [score:2]
Fig. 3Effect of MSC-let-7a on the development of PAH. [score:2]
Taken together, these data indicated that MSC-let-7a might regulate PASMC growth majorly by the STAT3-BMPR2 pathway. [score:2]
Sun T Fu M Bookout AL Kliewer SA Mangelsdorf DJ MicroRNA let-7 regulates 3 T3-L1 adipogenesisMol Endocrinol. [score:2]
Izumiya Y Jinnn M Kimura Y Wang Z Onoue Y Hanatani S Expression of Let-7 family microRNAs in skin correlates negatively with severity of pulmonary hypertension in patients with systemic sclerodermaIJC Heart & Vasculature. [score:2]
A mechanism assay revealed that MSC-let-7a restrained the activation of signal transducers and activators of transcription 3 (STAT3) and increased its downstream bone morphogenetic protein receptor 2 (BMPR2) expression. [score:2]
Therefore, these data suggest that STAT3-BMPR2 signaling might account for MSC-let-7a-regulated PASMC survival. [score:2]
Consistently, the increase in the ratio of RV/BW induced by MCT, another index of RVH, was also obviously decreased following MSC-let-7a treatment (Fig.   3e). [score:1]
Simultaneously, the resistance of PASMCs to apoptosis was remarkably abrogated by MSC-let-7a administration. [score:1]
Transplantation of MSC-let-7a ameliorates MCT-triggered right ventricular impairment. [score:1]
When co-cultured with MSC-let-7a, hypoxia-triggered PASMC proliferation was obviously attenuated, concomitant with the decrease in cell proliferation -associated proteins. [score:1]
Importantly, MSC-let-7a transplantation strikingly antagonized the MCT -induced increase in the ratio of RV/(LV + Sep), an index of right ventricular hypertrophy (RVH), relative to the MSC -treated groups, but without a statistically significant difference between normal MSC and NC-MSC groups (Fig.   3d). [score:1]
In brief, these data suggested that MSC-let-7a might participate in MCT -induced pulmonary vascular remo deling. [score:1]
The rPASMCs were exposed to hypoxia or normoxia for 24 h, followed by co-culture with modified MSCs (MSC-NC or MSC-let-7a) using the transwell system. [score:1]
The effect of MSC-let-7a on RVSP was analyzed by inserting 3-F Miller catheters into the right ventricle through the right jugular vein (c). [score:1]
Bai M Zhu XZ Zhang Y Zhang S Zhang L Xue L Anhedonia was associated with the dysregulation of hippocampal HTR4 and microRNA Let-7a in ratsPhysiol Behav. [score:1]
Emerging studies suggest that let-7a may restrain tumor cell proliferation by blocking the STAT3 pathway [28, 33]. [score:1]
Interestingly, MSC-let-7a administration further reduced RVSP in contrast to MSC -treated groups. [score:1]
Furthermore, the STAT3-BMPR2 pathway was involved in MSC-let-7a -mediated PASMC proliferation. [score:1]
MSC transplantation enhanced let-7a levels in MCT -induced PAH rats. [score:1]
Moreover, MSC-let-7a treatment remarkably attenuated cell resistance to apoptosis. [score:1]
Rat pulmonary artery smooth muscle cells (rPASMCs) under hypoxia were co-cultured with MSCs or MSC-let-7a. [score:1]
Specifically, the elevated expression of α-SMA, a marker for SMCs that is used to evaluate muscularization of pulmonary arteries, was obviously restrained following injection with MSC-let-7a (Fig.   3g). [score:1]
Following the co-culture with MSC-NC or MSC-let-7a, caspase-3 activity was detected according to the manufacturer’s instructions. [score:1]
Adenovirus production for let-7a in rMSCs. [score:1]
MSC-let-7a administration abrogates apoptosis resistance of PASMC. [score:1]
Treatment with let-7a/MSCs attenuates pulmonary vascular remo deling induced by MCT. [score:1]
Importantly, the notable increase in wall thickness of pulmonary arterioles was markedly restrained when rats received MSC-let-7a administration (Fig.   3h). [score:1]
A higher apoptotic rate of PASMCs was validated after co-culture with let-7a -elevated MSCs and reached 31.2 ± 1.04% (Fig.   4e). [score:1]
Furthermore, the effects of MSC-let-7a on pulmonary artery smooth muscle cell (PASMC) growth, as well as the underlying mechanism, were also explored. [score:1]
After isolation and identification of MSCs from rat bone marrow, cells were infected with recombinant adenovirus vector Ad-let-7a. [score:1]
Lewis rats were subcutaneously injected with monocrotaline (MCT) to induce PAH, followed by the administration of MSCs, MSCs-NC (miR-control), or MSC-let-7a, respectively. [score:1]
The increase in caspase 3 activity further identified the enhanced impact of MSC-let-7a on PASMC apoptotic response, in contrast to the MSC -treated group (Fig.   4f). [score:1]
This study only clarifies the effect of MSC-let-7a on PAH in an animal mo del. [score:1]
EDTA-anticoagulated whole blood samples were collected at 7, 14, and 21 day after the injection of MSC-let-7a, MSCs, or PBS. [score:1]
Interestingly, a previous study also corroborated the protective effect of let-7a on oxidized low-density lipoprotein -induced endothelial cell injury [36]. [score:1]
Nevertheless, this increase was mitigated when cells were incubated with MSC-let-7a. [score:1]
Then, the modified MSCs (MSC-NC or MSC-let-7a) were cultured in the lower chamber. [score:1]
About 3 weeks later, rats treated with MCT were randomized to four groups (n = 10/group, n = 40 in total): rats treated with PBS (MCT + PBS group); rats received MSCs (MCT + MSC group); rats injected with MSC-let-7a (MCT + MSC-let-7a group); rats received MSC-NC (MCT + MSC-NC group). [score:1]
To further elucidate the mechanism underlying the MSC-let-7a -mediated protective effect against PAH, we analyzed the MSC-let-7a function in PASMC proliferation. [score:1]
Accordingly, to elucidate the mechanism involved in the inhibitory effect of MSC-let-7a on PASMC growth, STAT3 signaling was evaluated. [score:1]
However, blocking BMPR2 levels could not absolutely abolish the effect of MSC-let-7a on PASMC growth. [score:1]
Bao MH Zhang YW Lou XY Cheng Y Zhou HH Protective effects of let-7a and let-7b on oxidized low-density lipoprotein induced endothelial cell injuriesPLoS One. [score:1]
After injection with MSC-let-7a, RVSP, right ventricular hypertrophy, and pulmonary vascular remo deling were notably ameliorated, indicating a protective effect of MSC-let-7a against PAH. [score:1]
Rats were given PBS, MSCs, MSC-NC, or MSC-let-7a 2 weeks after intraperitoneal injection with MCT. [score:1]
PASMCs were treated with BMPR2 siRNA and co-cultured with or without MSC-let-7a. [score:1]
Therefore, this study provides the groundwork for the further study of MSC-let-7a as a therapeutic strategy against PAH. [score:1]
In this study, depression of let-7a was observed in PAH rats. [score:1]
Next, we explored the effect of let-7a -modified MSCs on PAH. [score:1]
As a whole, our research may illustrate the protective role of MSC-let-7a in the progression of PAH. [score:1]
[1 to 20 of 102 sentences]
3
[+] score: 234
Let-7 can also inhibit LIN28B translation by binding to the 3′-untranslated region target sites, creating a double -negative feedback loop. [score:8]
Thus, five of the eight studied mature let-7 family members were significantly downregulated in the PFC, and the two of the remaining three showed a tendency to downregulation (let-7a: P=0.058; let-7e: P=0.080). [score:7]
[44] The let-7 family was previously shown to directly inhibit IL-6 expression in breast cancer cell lines, to be abundant in the adult brain and to be implicated in the regulation of neural stem cell proliferation, differentiation and synaptic plasticity. [score:7]
We showed that the exercise -induced upregulation of let-7 miRNAs in FSL was independent of Lin28b and Drosha changes, implying that other mechanisms are involved in regulating let-7 expression in response to physical activity. [score:7]
Third, we compared the total expression levels of pri-let-7b, pri-let-7c-1, pri-let-7f-1, pri-let-7i and pri-mir-98 between the FSL and FRL PFC; none of those pri-let-7 transcripts showed different expression between the rat strains (P>0.5, Figure 1d), indicating that reduction in mature let-7 expression in the FSL did not originate from decreased levels of pri-let-7 transcripts. [score:6]
Second, we examined whether the increased Il6 levels in the FSL associated with downregulation of let-7 expression. [score:6]
36, 37 Since the let-7 family is known to target Il6, the results suggest that the let-7 family dysregulation contributes to the overexpression of Il6 in the PFC of FSL. [score:6]
Increased Il6 levels are associated with downregulation of let-7 family expression in the prefrontal cortex of the FSL rats. [score:6]
21, 22, 23 A previous study showed that the let-7 family directly inhibited IL-6 expression in breast cancer cell lines, and thereby may act as an immunorepressor. [score:6]
24, 32, 33 Importantly, a recent study showed that LIN28B and LIN28A inhibited let-7 expression by different mechanisms, that is, LIN28B directly binds the primary let-7 (pri-let-7) transcripts and prevents DROSHA -mediated cleavage. [score:6]
Fourth, we assessed whether the expression levels of key enzymes (Drosha and Dicer) involved in miRNA biogenesis could potentially influence let-7 expression. [score:5]
43, 44 We hypothesized that Il6 expression was elevated in the prefrontal cortex (PFC) of the FSL strain compared with FRL, and that this elevation would associate with a downregulation of the let-7 family, in turn influenced by alterations in miRNA biogenesis. [score:5]
No differences were found for the mRNA levels of Lin28b and Drosha (P>0.8), suggesting that the physical activity increased expression of certain let-7 miRNAs expression independently of LIN28B and DROSHA. [score:5]
We also tested whether Hnrnpa1, a negative regulator of let-7 that is independent of LIN28 regulation, was associated with the decreased let-7 expression in the FSL. [score:5]
It is possible that let-7 dysregulation can lead to disturbances also in other pathophysiological processes because miRNAs often have multiple target genes. [score:4]
LIN28B elevation co-occurred with downregulation of the let-7 family in the FSL PFC. [score:4]
[58] Further, in blood samples from depressed patients, a number of let-7 family members were upregulated after a 3-month treatment with escitalopram. [score:4]
Let-7 expression showed the opposite expression changes over time, possibly dependent on the LIN28 dynamics. [score:4]
Second, we examined whether the Il6 reduction in the FSL runners associated with upregulation of let-7 miRNAs that showed a difference between naïve FSL and FRL (let-7b, let-7c, let-7f, let-7i and miR-98). [score:4]
Elevation of Il6 is associated with downregulation of let-7 miRNAs in the PFC of FSL, a rat mo del of depression. [score:4]
Increased Il6 levels are associated with downregulation of let-7 family expression in the prefrontal cortex of the FSL ratsFirst, we measured Il6 mRNA levels in the PFC from FSL and FRL rats. [score:4]
Elevation of Il6 is associated with downregulation of let-7 miRNAs in the PFC of FSL, a rat mo del of depressionElevation of peripheral proinflammatory cytokine IL-6 has been reported in clinical depression by a number of studies. [score:4]
Thus, the downregulation of let-7 family members in FSL PFC region was associated with increased LIN28B levels, increased LIN28B binding to pri-let-7 transcripts and reduced DROSHA levels. [score:4]
In cancer research, coordinated downregulation of multiple let-7 family members was found in many tumor types. [score:4]
The let-7 upregulation by physical activity appeared not to be associated with miRNA biogenesis processes but rather with epigenetic changes upstream pri-let-7 mRNA. [score:4]
[34] Besides, heteronuclear ribonucleoprotein A1 (hnRNPA1) was shown to negatively regulate let-7 biogenesis in cells lacking LIN28 expression. [score:4]
[54] In agreement, we found that Lin28b mRNA, but not Lin28a, was expressed at detectable levels in adult rat PFC, suggesting that LIN28B is the major paralog in regulating let-7 synthesis in the PFC. [score:4]
Physical activity rescued let-7 expression independent of LIN28B regulation. [score:4]
Second, we hypothesized that physical exercise would lower the elevated Il6 levels in the PFC of the FSL rats, by normalizing let-7 expression. [score:3]
Physical activity reduced Il6 levels and rescued let-7 expression in the FSL PFCFirst, we investigated where physical activity (voluntary wheel running) could normalize Il6 expression in the FSL PFC. [score:3]
[35] Next, we showed that LIN28B overexpression was associated with enrichment of LIN28B-pri-let-7 binding in FSL in vivo, which most likely led to excessive repression of mature let-7 synthesis, explaining the reduced mature let-7 levels. [score:3]
[59] Collectively, these results may suggest a role for let-7 as a therapeutic target in depression. [score:3]
Thus, physical activity reduced the elevated Il6 levels in PFC region of the FSL rats and increased expression of certain let-7 family members present already at primary transcript stage, possibly through epigenetic mechanisms. [score:3]
This Il6 decrease associated with an increased let-7 expression. [score:3]
The individual let-7 family members may compete with each other when exerting their repressive function since each member uses the same seed (5′-GAGGUA-3′ sequence of the let-7) as a template for recognizing complementary sites in the 3′-untranslated region of Il6 (5′-UACCUCA-3′). [score:3]
28, 50 However, other roles of let-7 family in the adult brain have been less investigated although let-7 is upregulated in later developmental stages and is one of the most abundant miRNA families in the adult brain. [score:3]
These results suggested that elevation of Il6 in the FSL PFC is associated with a deficiency of let-7 family expression, possibly linked with a disturbed let-7 biogenesis. [score:3]
[57] These results suggest that the antidepressant-like effect of physical activity may, in part, be due to brain let-7 expression. [score:3]
23, 29, 30, 31 This reduction was associated with an overexpression of LIN28 (including paralogous LIN28A and LIN28B in mammals), an RNA -binding protein that selectively represses let-7 maturation. [score:3]
Noteworthy, the let-7 deficiency in the FSL was not associated with changes in Hnrnpa1, which was a negative regulator of let-7 biogenesis when LIN28 regulation was absent. [score:3]
22, 23, 24, 25, 26 We showed that the Il6 elevation in PFC of FSL was associated with a reduced let-7 miRNAs expression. [score:3]
However, Il6 and let-7 are expressed throughout the central nervous system, including both neuron and glia cells. [score:3]
51, 52 We found that let-7 expression in the PFC of depressed FSL rats associated with elevated Il6. [score:3]
cDNA was synthesized using the SuperScript III First-Strand Synthesis System for RT-PCR (Invitrogen) followed by RT-PCR for pri-let-7 expression. [score:3]
In addition to LIN28B changes, we observed that FSL PFC had a decreased DROSHA expression, suggesting a disturbed miRNA biogenesis probably not only in let-7 but also in a variety of other miRNAs. [score:3]
In addition, we show that physical activity normalizes Il6 levels and could rescue let-7 expression. [score:3]
[53] Notably, let-7 expression appeared to be more decreased by chronic than acute stress paradigm, [53] which may be in line with our data, as FSL is a genetic mo del that exhibits a persistent depression-like behavior. [score:3]
Pri-let-7 and mRNA expression data were normalized to two reference genes (Gapdh, glyceraldehyde-3-phosphate dehydrogenase; and Ppia, cyclophilin A). [score:3]
First, we tested the hypothesis that overexpression of LIN28A and LIN28B, acting as let-7 repressors, was associated with the let-7 family deficiency in the FSL. [score:3]
Physical activity reduced Il6 levels and rescued let-7 expression in the FSL PFC. [score:3]
We show that the low levels of let-7 may be a result of disturbed LIN28B -mediated miRNA biogenesis and DROSHA dysregulation. [score:2]
[27] Noteworthy, let-7 could also be regulated in an LIN28B-independent fashion, for example, through epigenetic mechanisms such as DNA methylation and histone modifications, 49, 55 which is supported by our data from FSL rats under physical exercise (discussed in the next section). [score:2]
Let-7 deficiency is associated with LIN28B overexpression in the PFC of FSL rats. [score:2]
Our results warrant further studies on let-7 regulation in depression. [score:2]
Second, to gain further support that LIN28B directly associated with pri-let-7 to block mature let-7 synthesis in vivo, we performed RIP analysis. [score:2]
The results also suggest that this decrease of let-7 miRNA levels is in part due to a disturbed LIN28B -mediated miRNA biogenesis, and possibly in part due to a dysregulated DROSHA. [score:2]
The let-7 family has an important role in early neurodevelopment. [score:2]
Physical activity was found to normalize the Il6 and let-7 levels through epigenetic regulations upstream primary miRNA transcription. [score:2]
[20] In human, the let-7 family consists of 12 genes encoding nine distinct miRNAs (let-7a to let-7i and miR-98). [score:1]
[16] Lethal-7 (let-7) is one of the most studied miRNA families and is highly conserved between species. [score:1]
Consistently, a recent study reported that physical exercise was able to induce let-7 in the mouse hippocampus. [score:1]
[42] (6) We did not have the possibility to analyze Il6 and let-7 in specific cell types in this experiment. [score:1]
LIN28 is an RNA -binding protein that selectively represses let-7 maturation. [score:1]
In agreement, let-7 miRNAs were also found to respond actively to antidepressant drug treatment. [score:1]
There is increasing evidence suggesting the involvement of the let-7 family in inflammation and immune response. [score:1]
In the present study, we demonstrate increased Il6 levels and in parallel decreased levels of let-7 miRNA family in the PFC of a well-established mo del of depression, the FSL rat. [score:1]
For instance, in a rat mo del of learned helplessness, enoxacin exerted an antidepressant-like effect coupled with a let-7a elevation in the frontal cortex. [score:1]
Thus we observed that Il6 correlated negatively with each of the let-7 family miRNAs, however, none with statistical significance. [score:1]
28, 68, 69 We provide results demonstrating for, we believe, the first time that elevated proinflammatory Il6 in the depressed brain is associated with let-7 deficiency. [score:1]
[1 to 20 of 69 sentences]
4
[+] score: 184
Our results suggested that TGF- β1/smads signaling was activated in DN rats and MMCs in high glucose condition and NAR inhibited TGF- β1/smads signaling activation through upregulating let-7a and suppressing TGFBR1 expression. [score:10]
Taken together, our data exhibited that NAR regulated the alteration of TGF- β1/smads signaling through upregulating let-7a expression and suppressing TGFBR1. [score:9]
More importantly, in vitro experiments, overexpression of let-7a decreased the expression of p-smad2 and TGFBR1 proteins compared with HG group and it suggested that let-7a may negatively regulate TGF- β1/smads signaling by targeting TGFBR1. [score:7]
So these results suggested that NAR alleviated the deposition of ECM proteins by upregulating let-7a expression. [score:6]
These results demonstrated that NAR upregulated let-7a expression both in vivo and in vitro in DN. [score:6]
These data suggested that NAR could upregulate the expression of let-7a in DN. [score:6]
So our results suggested that NAR could improve the excessive deposition of ECM by upregulating let-7a expression. [score:6]
This study demonstrated that let-7a and its related pathway-TGF- β1/smad signaling formed a negative feedback to inhibit the deposition of ECM by targeting TGFBR1 in DN. [score:5]
MMCs were seeded at a density of 0.75 × 10 [6] cells/mL in serum-free DMEM, with the addition of a transfection agent and let-7a mimics oligonucleotides (let7a-M), negative control mimics (NC-M), let-7a inhibitor oligonucleotides (let7a-I), and negative control inhibitor (NC-I) (Jima, Shanghai, China). [score:5]
To determine whether NAR affected the expression of let-7a in vivo, let-7a expression was examined in blood and kidney tissue of DN rats. [score:5]
The expression of let-7a was significantly elevated in NAR + let-7a group, whereas let-7a declined in NAR + let-7a inhibitor group (Figure 3(c)). [score:5]
The results showed that let-7a was highly expressed in let-7a mimics group and decreased in inhibitor group. [score:5]
Additionally, NAR alleviated the changes of Col4 and FN proteins cooperated with let7a mimics more significantly than NAR group, whereas the inhibitory effect of NAR cooperated with let-7a inhibitor was weakened. [score:5]
MicroRNA let-7 and its family members have been reported to participate in many diseases including kidney diseases. [score:5]
NAR played a biological role in TGF- β1/smad signaling pathway by regulating let-7a/TGFBR1, and let-7a might be a novel therapeutic target for NAR protect against DN. [score:4]
Also, let-7 family members regulated collagen expression in glomerular mesangial cells under diabetic conditions [20]. [score:4]
In this study, our data displayed that there was a significant reduction of TGFBR1 protein in the presence of let-7a mimics by dual-luciferase reporter assay, and overexpression of let-7a could decrease the expression of TGFBR1 protein by western blot. [score:4]
The data indicated that let-7a could negatively regulated TGFBR1 expression. [score:4]
We further observed whether NAR affected fibrosis markers Col4 and FN expressions by regulating let-7a in cells. [score:4]
Let-7a and let-7d could affect glucose metabolism by downregulating IL-13 in the skeletal muscle of type 2 DM patients [19]. [score:4]
Let-7a Negatively Regulated TGFBR1 Expression. [score:3]
Therefore, TGFBR1 was a target for let-7a. [score:3]
Let-7a regulated glucose metabolism and insulin synthesis/secretion with type 2 DM by targeting lin28 pathway [17, 18]. [score:3]
In our study, real-time RT PCR results exhibited that let-7a expression was significantly decreased in both blood and kidney tissues of DN rats and mesangial cells under hyperglycemic condition. [score:3]
Six hours after transfection, the medium was changed and the cells were incubated with fresh serum-containing medium for another 24~48 h. In addition, MMCs were transfected with let-7a mimics plus NAR as the NAR + let7a-M group; cells were transfected with let-7a inhibitor plus NAR as the NAR + let7a-I group. [score:3]
By analyzing homology, we found that the putative mmu-let-7a target site in TGFBR1 3′-UTR was highly conserved in sixteen genomes (Figure 4(a)). [score:3]
Results showed let-7a was the only miRNA which reversed the expression level when treated with NAR in mesangial cells cultured with high glucose. [score:3]
org/), we found that DN related gene-TGFBR1 was a potential target of let-7a. [score:3]
Meanwhile, NAR cooperated with let7a mimics; its effects were more remarkable than NAR or let-7a mimics' individual effect in the reductions of p-smad2 and TGFBR1 proteins, while the reductions of p-smad2 and TGFBR1 proteins in the NAR cooperated with let-7a inhibitor group were weakened. [score:3]
These data verified that TGFBR1 was a target for let-7a. [score:3]
Our previous study demonstrated that several miRNAs were differentially expressed in blood samples of DN patients by miRNA array and real-time PCR, including let-7a, let-7d, let-7f, miR-363, and miR-4429 (data not shown). [score:3]
Furthermore, numerous researches showed that let-7a was closely linked to modulate cell proliferation in various diseases [36– 38]. [score:3]
And the expression of let-7a was elevated after NAR treatment in vivo and in vitro. [score:3]
MMCs were transfected with let-7a mimics (let7a-M), let-7a inhibitor (let7a-I), NAR, or NAR with let-7a intervention. [score:3]
Moreover, NAR might repress glomerular mesangial cells proliferation and accumulation of ECM by let-7a/TGFBR1 signaling in DN, and let-7a may be a novel potential target for NAR protecting against diabetic nephropathy. [score:3]
Furthermore, our previous experiments showed that let-7a was downexpressed in DN patients, and the let-7a-3 promoter hypermethylation and the rs1143770 polymorphism of let-7a-2 were participated in DN [21, 22]. [score:3]
Meanwhile, western blot results showed that the expression level of TGFBR1 protein was reduced significantly in the let-7a mimics group compared with the HG group (Figures 4(c) and 4(d)). [score:2]
We found that overexpression of let-7a and NAR treatment decreased the ratio of p-smad2/smad2 and TGFBR1 proteins compared with MMCs without treatment. [score:2]
Furthermore, we observed whether NAR affected TGF- β1/smad signaling by regulating let-7a in MMCs or not. [score:2]
After the treatment of NAR, the expression of let-7a was significantly enhanced in the NAR group compared with the DN group (Figure 3(b)). [score:2]
Effect of NAR on Col4 and FN Expressions with Let-7a Intervention. [score:2]
Additionally, NAR alleviated the change in the ratio of p-smad2/smad2 and TGFBR1 proteins cooperation with let7a-M more significantly than NAR group and let7a-M group, whereas the ratio of p-smad2/smad2 and TGFBR1 protein was increased in the NAR + let-7a inhibitor group compared with NAR group (Figures 5(f) and 5(g)). [score:2]
The potential binding sequences of let-7a on the TGFBR1 3′UTR were mutated by the QuikChange ™ Site-Directed Mutagenesis Kit (Stratagene). [score:2]
Interestingly, the expressions of Col4 and FN were lower after transferring let-7a mimic and NAR into mesangial cell compared with NAR or let-7a group (Figures 3(d) and 3(e)). [score:2]
Moreover, the expressions of Col4 and FN were decreased in let-7a or NAR group compared with those in the untreated HG group. [score:2]
These findings suggested that let-7a may be an important factor in the effects of NAR in DN. [score:1]
In the present study, we aimed to explore the protective effects of NAR on kidney as well as its effects on let-7a/TGFBR1 signaling in diabetic nephropathy rats and mesangial cell under high glucose condition. [score:1]
Transcripts carrying the TGFBR1 3′-UTR-wt exhibited a significant reduction in luciferase activity in the presence of let-7a. [score:1]
Also, our previous studies also showed that the promoter hypermethylation and single nucleotide polymorphism of let-7a played important roles in DN [21, 22]. [score:1]
Moreover, let-7a had been reported to modulate ECM deposition in breast and pancreas cells [23– 25]. [score:1]
Furthermore, our result displayed that only let-7a was reversed when treated with NAR among the five miRNAs in mesangial cells with high glucose (Figure 3(a)). [score:1]
Therefore, these studies suggested that let-7a might be related to the therapeutic effects of NAR in DN. [score:1]
To evaluate possible functions of let-7a, we screened potential target genes of let-7a. [score:1]
For transfection, 293T cells were seeded into 96-well plates at a density of 1.5 × 10 [4] per well; then cells were transfected with TGFBR1-3′UTR-wt (200 ng/mL), TGFBR1-3′UTR-mut (200 ng/mL), and let-7a mimics (50 nmol/L) using lipofectamine ™ 2000. [score:1]
[1 to 20 of 54 sentences]
5
[+] score: 168
All in all, the above expression data from two rodent species strongly suggest a dynamic reciprocal regulation of Lin28a and let-7 (and related miRNAs) along the spermatogenic cycle, whereby high expression of Lin28a or Lin28b is associated with (and possibility caused by) low or absent expression of regulatory miRNAs in specific cell types of the seminiferous epithelium; this profile of reciprocal changes is depicted in Fig. 2-II. [score:9]
However, while this phenomenon might explain loss of expression of some transcripts (e. g., Lin28b), the arrest of spermatogenesis at early stages can hardly justify the observed increases in miRNAs, such as let-7b and mir-145, which are abundantly expressed in spermatocytes and early spermatids, therefore suggesting additional regulatory phenomena reciprocally linking Lin28 and let-7 expression in the testis. [score:8]
This is a complex event, regulated by a large number of factors, including miRNAs 30, which function mainly post-transcriptionally by controlling the stability or translation of their target mRNAs 7. Among the miRNAs described in rodent testis, the let-7 family displays prominent expression 53 55. [score:8]
Different mo dels of perturbed puberty and hormonal manipulation, targeting key endocrine axes with proven roles in the control of testicular function, were explored as a means to provide indirect evidence for the relevance of the Lin28 /let-7 system in the regulation of the rat testis and its modulation by key developmental and hormonal signals. [score:6]
Interestingly, recent studies from our group assessing the dynamics in the hypothalamic expression of the Lin28/let-7 system documented that, as is the case for the testis, at central levels reciprocal changes between Lin28 and let-7 expression levels are detectable along postnatal maturation and in neonatally estrogenized rats. [score:5]
Expression analyses of Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-132, and mir-145 miRNAs were conducted in testicular samples from rats at different stages of postnatal development. [score:4]
Regulation of testicular expression of the Lin28/let-7 system by other pituitary hormonal axes was also explored using various approaches. [score:4]
How to cite this article: Sangiao-Alvarellos, S. et al. Testicular expression of the Lin28/let-7 system: Hormonal regulation and changes during postnatal maturation and after manipulations of puberty. [score:4]
Regulation of the expression of the Lin28/let-7 hub was explored in vivo in a number of mo dels of neuroendocrine manipulation, known to impact on testicular function. [score:4]
However, whereas Lin28b mRNA was only marginally increased by FSH, the relative expression levels of let-7a, let-7b and mir-132 were more robustly increased by FSH and hCG, or their combination, which suggests a strong gonadotropic regulation that may take place at the tubular and/or interstitial compartment of the testis. [score:4]
These findings suggest that the bidirectional regulatory loops between Lin28 and let-7 miRNAs might operate at different levels of the reproductive axis, but the nature and functional implications of this regulatory loop likely vary at different tissues. [score:4]
Thus, in Experiment 5, regulation of testicular Lin28/let-7 expression by pituitary gonadotropins was explored. [score:4]
Hormonal regulation of testicular expression of the Lin28/let-7 system and related miRNAs. [score:4]
Testicular expression of the elements of the Lin28/let-7 system was also affected in mo dels of photoperiodic and nutritional manipulation, as well as after HPX, suggesting the convergence of multiple regulatory signals. [score:4]
With regard to miRNA expression, HPX did not result in detectable alterations in relative let-7a, let-7b or mir-145 miRNA levels. [score:3]
As mentioned above, compelling biochemical data suggest the existence of a double negative feedback loop whereby Lin28a/Lin28b redundantly represses the synthesis of mature let-7 miRNAs, which in turn suppress Lin28 levels. [score:3]
Effects of HPX and gonadotropin replacement on testicular expression Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-132, and mir-145 miRNAs. [score:3]
The impact of postnatal under-nourishing on testicular expression of the Lin28 /let-7 system was explored using rats reared in large litters (20 pups/litter), as mo del of delayed puberty 45. [score:3]
Changes in the profiles of testicular expression of Lin28/let-7 in mo dels of perturbed puberty. [score:3]
Expression profiles of the components of the Lin28/ let-7 axis and related factors in rat testis during postnatal maturation. [score:3]
Thus, both congenital elimination of Lin28a 36 and embryonic over -expression of let-7 24 have been shown to induce a reduction of the germ cell pool, with Lin28a KO mice displaying reduced fertility in adulthood 36. [score:3]
Changes in testis expression of the Lin28/let-7 system in mo dels of perturbed puberty. [score:3]
While additional mechanistic studies are needed to fully support these hypotheses, our present results, which characterize the profiles of developmental expression and hormonal regulation of the Lin28/let-7 system in the rodent testis, help to consolidate the view that the elements of this system are involved in the dynamic control of male gonadal maturation and function in mammals. [score:3]
Analysis of CD males at PND-15 and -45 revealed no changes in testicular Lin28a mRNA and let-7a miRNA levels, while Lin28b expression levels were decreased on PND-45. [score:3]
Expression analyses included Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-132 and mir-145 miRNAs. [score:3]
Thus, neonatally estrogenized rats, in which puberty was altered, showed decreased testicular Lin28a and Lin28b mRNA levels, while let-7a, let-7b and mir-145 miRNAs expression levels were enhanced. [score:3]
Impact of growth hormone deficiency on the expression profiles of the components of the Lin28/ let-7 axis and related factors in adult rat testis. [score:3]
Changes in testicular miRNA expression were less consistent; thus, while let-7b miRNA levels remained unchanged along postnatal maturation, let-7a decreased during the neonatal period. [score:3]
Expression profiles of the components of the Lin28/ let-7 axis and related factors in pubertal rat testis rats following neonatal estrogenization. [score:3]
For this reason, we studied testicular expression of Lin28a and Lin28b mRNAs and let-7a, let-7b, mir-145 and mir-132 miRNAs in mo dels of GH deficiency, hypothyroidism and in adrenalectomized rats. [score:3]
Expression profiles of the components of the Lin28/let-7 axis and related factors in rat testis following photoperiod manipulation (dark (10–15), constant darkness from postnatal day [PND] 10–15). [score:3]
In order to complement our expression data, localization analyses were applied to adult testicular samples to address the pattern of cellular distribution of key elements of the Lin28/ let-7 system. [score:3]
For instance, during neonatal period, Lin28a/Lin28b mRNA expression was minimum and (especially for Lin28b) increased thereafter, whereas let-7 and also mir-132, mir-9 and mir-145 miRNAs abundance was maximal on PND1, decreasing progressively along postnatal maturation. [score:3]
Analyses in mo dels of perturbed puberty, with variable impact on pubertal timing, revealed that early manipulations of the hormonal and nutritional milieu, as well as photic cues, could influence the profiles of expression of different members of the Lin28/let-7 hub along postnatal testicular maturation. [score:3]
Expression profiles of the components of the Lin28/ let-7 axis and related factors in rat testis following postnatal undernutrition, caused by rearing in large litters (20 pups per litter). [score:3]
In Experiment 1, the expression profiles of Lin28a and Lin28b mRNAs, as well as let-7a, let-7b, mir-9, mir-145 and mir-132 miRNAs were determined in the testis of rats at different age-points during postnatal maturation: neonatal (PND-1), infantile (PND-15), juvenile (PND-30), early pubertal (PND-38), pubertal (PND-45) and adult (>PND-75) ages, in keeping with previous references 38; size = 7–8 per group. [score:3]
In addition, in Experiment 6, testicular Lin28/let-7 expression levels were monitored in a rat mo del of GH deficiency, a dwarf rat strain derived from the Lewis rat (2–3 months old; Harlan, UK). [score:3]
For instance, on the basis of previous findings and our current data, it is arguable that the concomitant increase in Lin28a/Lin28b and decrease of let-7 expression during post-natal maturation might favour completion of spermatogenesis during puberty, while reversion of the Lin28/let-7 ratio might contribute to perturbation of spermatogenesis in mo dels such as neonatal estrogenization. [score:3]
Expression of Lin28/let-7 and related miRNAs in the testis during postnatal maturation. [score:3]
Expression of Lin28/let-7 system and related miRNAs in the testis during postnatal maturation. [score:3]
Notably, comparison of expression analyses of Lin28a/Lin28b transcripts (and let-7 miRNAs) in the testis of rats (present results) and mice 53 reveals a strikingly similar profile between these two rodent species, suggesting a notable degree of conservation of the Lin28 system in the testis. [score:3]
Assessment of hormonal regulation of testicular Lin28/let-7 expression was first evaluated using HPX rats, with or without gonadotropin replacement, as experimental mo del. [score:2]
The Lin28/let-7 tandem is subjected to a dual negative feedback regulatory loop. [score:2]
Hormonal regulation of the Lin28/let-7 system in the testis. [score:2]
Our current findings complement those previous observations and help to provide educated hypotheses in the testicular roles of the Lin28/let-7 system in the postnatal testis in normal and pathophysiological conditions. [score:1]
The same profiles of inverse relationship was found in mo dels of altered puberty due to neonatal estrogenization, where Lin28a/Lin28b mRNA levels were consistently reduced while let-7 levels were increased, and in the dwarf GH -deficient rat mo del, which displayed opposite profiles. [score:1]
Let-7a, let-7b, mir-132, and mir-145 (Fig. 1), as well as mir-9 (Suppl. [score:1]
Finally, in Experiment 7, the involvement of other neurohormonal axes in the control of testicular Lin28/let-7 expression was assessed by measuring changes in mRNA/miRNA levels in mo dels of surgical deprivation of adrenal hormones, by adrenalectomy (ADX), and chemically -induced hypothyroidism by administration of 0.1% aminotriazole in drinking water for three weeks in keeping with previous references 49 50. [score:1]
In contrast, let-7a, let-7b and mir-145 miRNA levels (Fig. 3) were significantly higher than in controls, while mir-132 (Fig. 3) and mir-9 (Suppl. [score:1]
Recent works suggest a role for Lin28/ let-7 axis in fertility and spermatogenesis. [score:1]
However, the trends of such changes were diametrically opposite between the hypothalamus and the testis, so that the hypothalamic Lin28/let-7 ratio decreased during maturation and increased after neonatal estrogenization 16, whereas the contrary applies to the testis. [score:1]
This protocol of neonatal estrogenization resulted also in detectable changes in the Lin28/ let-7 axis at the expected time of puberty (PND-45). [score:1]
However, while let-7a, mir-132 and mir-9 decreased sharply after PND1, let-7b increased between the neonatal and infantile age, to decline thereafter until puberty, whereas mir-145 levels remained elevated during infantile period and dropped during the juvenile transition. [score:1]
[1 to 20 of 53 sentences]
6
[+] score: 147
Fig. S1 Effects of methyl donor deficiency and folic acid supplementation on the expression of let-7a as depicted by in situ hybridization in the hippocampus, cerebellum and cerebral cortex from E20 fetuses (PDF 230 kb) Fig. S2 Effects of methyl donor deficiency and folic acid supplementation on the expression of miR-34a as depicted by in situ hybridization in the hippocampus, cerebellum and cerebral cortex from E20 fetuses (PDF 201 kb) Fig. S3 Consequences of miR-34a silencing on the morphology of control and folate -deficient (MDD) H19–7 cells at 13 h after induction of their differentiation (Si- = non -targeting siRNA, Si-miR-34a = miR-34a targeted siRNA). [score:9]
MicroRNA Targets RT [2] Profiler PCR ArraysRat microRNA Targets RT [2] Profiler PCR Arrays (Qiagen, Courtaboeuf, France) in a 96-well plate format were used to monitor the expression of the most relevant experimentally documented or bioinformatically predicted gene targets for let-7a and miR-34a. [score:9]
More specifically, the average downregulation of let-7a targets was above 6-fold in brain tissues from deficient fetuses, 95 % being downregulated by more than 3-fold. [score:9]
Rat microRNA Targets RT [2] Profiler PCR Arrays (Qiagen, Courtaboeuf, France) in a 96-well plate format were used to monitor the expression of the most relevant experimentally documented or bioinformatically predicted gene targets for let-7a and miR-34a. [score:7]
c Expression levels of Trim71 and effects of let-7 siRNA in control (C) and folate -deficient (MDD) H19-7 cells at 13 h after induction of differentiation (Si− = non -targeting siRNA, Si+ = let-7 -targeted siRNA). [score:7]
In conclusion, we showed that methyl donor deficiency was associated with enhanced expression of let-7a and miR-34a, with subsequent alterations of their development regulatory targets such as Trim71 and Notch signaling partners. [score:7]
Belonging to the family of Trim-NHL ubiquitin ligases, Trim71 is highly expressed in undifferentiated cells, such as embryonic stem cells, but becomes rapidly downregulated upon differentiation, in response to the rise of let-7 levels [59]. [score:6]
Cells are colabeled with antibodies against actin (green) and NF68 (red) and their nuclei counterstained by Dapi (blue) (PDF 150 kb) Table S1Downregulation of let-7a gene targets, according to their known functions, in methyl donor deficient (MDD) and supplemented deficient (MDD-B9) brain fetuses. [score:6]
For d and e: statistically significant difference with the respective control: * P < 0.05 and** P < 0.01; statistically significant difference between Si− and Si+: ° P < 0.05 (n = 5) Let-7 siRNA that repeatedly inhibited the expression of let-7a by >85 % after quantification by increased Trim71 levels in both control and folate -deficient H19-7 cells at 13 h after induction of their differentiation (Fig. 6c). [score:5]
Early Methyl Donor Deficiency Alters the Expression Pattern of a Wide Range of Genes Influenced by Let-7 and miR-34 and Involved in Various Aspects of Development. [score:4]
While it cannot fully prevent early-occurring NTDs such as spina bifida, maternal supplementation with folic acid during the period corresponding to the last trimester of pregnancy in women appeared to help preserve a normal development, at least partly through restoring let-7 and miR-34 normal expression. [score:4]
The downregulation of let-7a by siRNA led to a noticeable restoration of these processes. [score:4]
In the present study, we provide the first evidence that the epigenetic overexpression of let-7a and miR-34a, along with the disruption of their related pathways, would be key players in the deleterious effects of early methyl donor deficiency on the anatomical and functional development of the central nervous system. [score:4]
Fig. 4Transcriptional alteration of relevant experimentally documented or bioinformatically predicted gene targets of let-7a in fetal brain under methyl donor deficiency: effects of folic acid supplementation. [score:3]
Analysis of Let-7a and miR-34a Expression. [score:3]
The siRNA oligonucleotide duplexes were purchased from Ambion (Applied Biosystems) for targeting the rat let-7a (hsa-let-7a-5p) or miR-34a (hsa-miR-34a-5p) in H19-7 cells. [score:3]
Under the conditions of methyl donor deficiency, we observed a disruption of the expression of let-7a and miR-34a and their related pathways. [score:3]
Statistically significant differences between control and MDD rats, ** P < 0.01, and between MDD and supplemented MDD, °° P < 0.01 When studied by, let-7a expression patterns showed a significant increase (by 2.5-fold) in the midbrain extracts from E20 deficient fetuses, an effect that was reversed by folic acid supplementation (Fig. 3a). [score:3]
Among the subset of miRNAs known to be regulated by methylation [28], let-7 (lethal 7) and miR-34 are believed to exert a requisite role at various steps of cerebral development, while they would influence the occurrence of NTDs [27, 29]. [score:3]
Let-7a and miR-34a expression in cell cultures was silenced using small interfering RNA. [score:3]
Methyl Donor Deficiency Affects Protein Expression Levels of Known Downstream Pathways of Let-7 and miR-34: Reversion by Folic Acid Supplementation. [score:3]
The siRNA sequence is (sense strand indicated): 5′-UGAGGUAGUAGGUUGUAUAGUU-3′ for let-7a, 5′-UGGCAGUGUCUUAGCUGGUUGU-3′ for miR-34a, and mirVana™ miRNA Inhibitor Negative Control #1 was used as control for evaluation of the effect of the experimental miRNA inhibition. [score:3]
a Expression levels of let-7 in arbitrary units (AU) in the midbrains of control (C) and deficient (MDD) rat embryos at E16 and E20, and effects of folic acid (B9) supplementation. [score:3]
Most importantly, folic acid supplementation helped restoring the levels of let-7 and miR-34 and their respective targets. [score:3]
Methyl Donor Deficiency Increases Expression Levels of Let-7 and miR-34: Reversion by Folic Acid Supplementation. [score:3]
Fig. 6Effects of methyl donor deficiency and folic acid supplementation on Trim71, a target of let-7. Consequences of silencing let-7a on differentiating H19-7 cells. [score:3]
In our experimental mo dels of methyl donor deficiency, we observed a strong increase in let-7a expression, especially in rat pups at the E20 stage and in differentiating progenitors, along with significantly lower levels of Trim71 protein. [score:3]
Fig. 3Effects of methyl donor deficiency on the expression of let-7 and miR-34: influence of folic acid supplementation. [score:3]
Among the microRNAs relevant to vertebrate nervous system development, the highly conserved let-7a microRNA would constitute a key regulator of neural cell proliferation and differentiation [55] and has been tightly associated with the occurrence of NTDs [29]. [score:3]
Depending on the experimental mo dels used, it was reported that let-7a could act through various pathways involving the participation of transcription factors such as Abrupt, Sox2, Tlx, or cell cycle regulators such as CDK/Cyclin complexes [56, 57], contributing to the overall effect of let-7 on increasing the number of cells in the G1 phase of the cell cycle. [score:2]
In the present study, we chose to further investigate the well-established target of let-7, Trim71 (also called Lin41), which is required for embryonic development and proper neural tube closure [29, 58]. [score:2]
Taken together, the positive impact observed after folic acid supplementation and following siRNA strategy, along with the associated normalization of let-7a and miR-34a, strengthen the potential role of these microRNAs and their related signaling pathways in the developmental defects consecutive to gestational methyl donor deficiency. [score:2]
Taken together, our data therefore suggest that the alterations observed in let-7 and miR-34 pathways in response to methyl donor deficiency may participate to a disruption of the proliferation/differentiation balance, resulting in improper development of the central nervous system, and influencing the occurrence of NTDs. [score:2]
Statistically significant differences between MMD and MDD-B9: * P < 0.05, ** P < 0.01 We chose to investigate Trim71, which is a key effector of the let-7 microRNA pathway, that promotes cell proliferation and inhibits differentiation to control various developmental processes [45]. [score:2]
The detrimental role of increased let-7a in folate -deficient progenitors was further supported by cell morphology of differentiating progenitors (Fig. 6d–f). [score:1]
By using the microarray approach, the identification of new putative target genes affected in response to methyl donor deficiency via let-7 and miR-34 warrants further investigations. [score:1]
Silencing Let-7a and miR-34a Restores Their Related Pathways and Contributes to Rescue Cells Exposed to Folate Deficiency. [score:1]
In order to identify further mechanisms underlying the effect of maternal B-vitamin status on neural tube and brain development, in line with potential epigenetic dysregulations, we investigated the participation of let-7 and miR-34 as well as their related pathways in the consequences of methyl donor deficiency both in vivo on a validated rat mo del of maternal deficiency [30, 31] and in vitro in hippocampal progenitors [32]. [score:1]
f Representative influence of let-7 siRNA on cell morphology at 13 h after induction of differentiation. [score:1]
Products of RT reaction (1.33 μL) were used in a real-time PCR reaction, which also included 10 μL of the TaqMan Universal Master Mix II, and 1 μL TaqMan miRNA assay containing the sequence-specific primers of either the target miRNA (let-7: UGAGGUAGUAGGUUGUAUAGUU, miR-34: UGGCAGUGUCUUAGCUGGUUGU) or the U6SnoRNA (CACGAATTTGCGTGTCATCCTT) used as an endogenous control for normalization. [score:1]
Slides were then redehydrated and prehybridized in hybridization buffer with 0.5 nm specific probe (LNA -modified and digoxygenin (DIG)-labeled oligonucleotide, Exiqon, Copenhagen, Denmark) complementary to let-7a (AACTATACAACCTACTACCTCA ) or miR-34a (ACAACCAGCTAAGACACTGCCA). [score:1]
The in situ detection of let-7a and miR-34a was performed on paraffin-embedded sections from normal and methyl donor -deficient brain tissues by locked nucleic acid (LNA)-oligo in situ hybridization, as previously described by Kloosterman et al. [40]. [score:1]
[1 to 20 of 42 sentences]
7
[+] score: 131
We further verified that let-7a, c, d, e, and i were down-regulated in the acute ischemic tissue and forced overexpression of let-7e inhibited β [1]-AR expression and knockdown of this miRNA by AMO-let-7e increased β [1]-AR expression in neonatal rat cardiomyocytes. [score:13]
In this study, we, for the first time, displayed the involvement of let-7, a conserved and abundant miRNA in the heart [30], in the up-regulation of β [1]-AR in AMI in rats, which provides new insight into the mechanisms for regulation of β [1]-AR expression and overexpression of miRNA let-7e potentially inhibited AMI -induced arrhythmia in rat. [score:11]
On the basis of these data, one would expect that down-regulation of let-7 should also influence expression of β [2]-AR in addition to up-regulation of β [1]-AR. [score:9]
Up-regulation of β [1]-AR and down-regulation of let-7 in infarcted heartsWe first compared the expression levels of β [1]-AR between the infarcted and non-infarcted LV tissues in a rat mo del of AMI. [score:8]
Fig. 1Up-regulation of β [1]-AR and down-regulation of let-7 in rat mo dels of acute myocardial infarction (AMI). [score:7]
Up-regulation of β [1]-AR and down-regulation of let-7 in infarcted hearts. [score:7]
First, our data revealed that let-7 was significantly down-regulated, along with selectively increase in β [1]-AR expression, in the infarcted area of LV tissue. [score:6]
Regulation of β [1]-AR by let-7 in cardiomyocytes in vitroThe reciprocal alterations of β [1]-AR and let-7 in terms of their expression in AMI suggest a targeting relationship between them. [score:6]
As expected, all three miRNAs significantly inhibited luciferase activity, indicating that ADRB1 3′UTR is direct target of let-7 family. [score:6]
The reciprocal alterations of β [1]-AR and let-7 in terms of their expression in AMI suggest a targeting relationship between them. [score:5]
To exploit this notion, we performed miRNA gene target prediction using TargetScan 6.0 database, and we indeed identified a binding site in the 3′UTR of β [1]-AR mRNA for all members of the let-7 family, which is highly conserved among human, rat and mouse (Fig. 2A). [score:5]
Fig. 2Predicted seed -binding sites of let-7 in β [1]-AR 3′UTR and verification of β [1]-AR as a target for let-7. (A) Alignment of the sequences of let-7 family (bottom) with their target sites in the 3′UTRs of human, rat and mouse β [1]-AR mRNA (top). [score:5]
In silico prediction with Targetscan and miRanda showed that ADRB1 is a target of let-7; the seed sequence is conserved among species, such as rat, mouse and human beings. [score:5]
Clearly, mechanisms other than let-7 may also participate in the regulation of β [2]-AR expression in the heart. [score:4]
We then studied the expression of let-7, a cardiac-enriched miRNA, in the infarcted rat heart with miRCURY Array microarray version 11.0 containing 349 mature rat miRNAs. [score:3]
Targetscan predicts the presence of a putative binding site for let-7 in the 3′UTR of ADRB1 mRNA, the gene encoding β [1]-AR, which is highly conserved among mammals. [score:3]
Similarly, let-7a expression decreased by 41.6%±3.8%, let-7c by 31.6%±2.9%, let-7d by 28.6%±5.7%, let-7e by 39.2%±5.5% and let-7i by 51.3%±10.3% after 24 hrs of AMI (Fig. 1D). [score:3]
However, we definitely could not rule out other molecular targets of let-7, which are involved in its antiarrhythmic effect in the rats with AMI. [score:3]
Second, we experimentally established β [1]-AR as a target gene for the members of the let-7 family. [score:3]
let-7a expression decreased by 44.6%±1.3%, let-7c by 21.1%±1.5%, let-7d by 69.3%±9.3%, let-7e by 36.2%±10.9% and let-7i by 46.9%±2.9% in the infarcted area of rat heart with 6hrs of AMI (Fig. 1D). [score:3]
Study also demonstrated that the let-7 family shares the same downstream targets in human embryonic stem cells [40]. [score:3]
Construction of plasmid carrying the 3′UTR of β [1]-adrenergic receptor (ADRB1) and luciferase assayTargetscan predicts the presence of a putative binding site for let-7 in the 3′UTR of ADRB1 mRNA, the gene encoding β [1]-AR, which is highly conserved among mammals. [score:2]
Regulation of β [1]-AR by let-7 in cardiomyocytes in vitro. [score:2]
We also demonstrated that β [1]-AR is a target gene for let-7 revealed by luciferase reporter assay and analysis. [score:2]
All these data indicate the specificity of let-7 action on ADRB1 3′UTR (Fig. 2B and C). [score:1]
A segment containing the let-7 miRNA binding sites flanked by the Hand lll and Sac I restriction sites and a scramble sequence as a negative control (NC) were synthesized by Invitrogen. [score:1]
The results from let-7e are most likely applicable to other members of the let-7 family based on their same mechanism of action conferred by their same seed site. [score:1]
The let-7 family includes let-7a, b, c, d, e, f, g and i and they all share an identical seed motif thereby presumably possessing the same cellular functions. [score:1]
A variety of studies have demonstrated that let-7, an abundant and conserved miRNA, participates in various pathophysiological processes, such as cancer growth and formation [37] and axon regeneration [38]. [score:1]
Levels of let-7a/c/d/e/i, miR-1 and β [1]-AR mRNA were determined using SYBR Green I incorporation methods on ABI 7500 fast Real Time PCR system (Applied Biosystems), with U6 as an internal control of miRNA or GAPDH as an internal control of β [1]-AR mRNA. [score:1]
let-7 family shares the same seed sequence (5′ GAGGUAG 3′) and are highly conserved across species in both their sequences and functions [39]. [score:1]
[1 to 20 of 31 sentences]
8
[+] score: 109
Interestingly, 24 hours after treatment with 50 ng/ml of NGF, let-7a expression was ~ 5-fold upregulated in differentiated PC12 cells (p < 0.05). [score:6]
The expression of miR-16, let-7a and miR-34a was consistently upregulated in neural differentiation mo dels. [score:6]
After returning to basal levels at day 2, let-7a expression was again significantly upregulated at day 3 and 6, by 2.6- and 3.5-fold, respectively (p < 0.05), slightly decreasing at day 8 (p < 0.01). [score:6]
In addition to regulating apoptosis by targeting caspase-3 [10], it was also demonstrated that let-7 family members regulate RAS and HMGA2 oncogene through the 3'UTR [53- 55]. [score:5]
Let-7a, a member of the let-7 family, is associated with apoptosis by directly targeting caspase-3 [10]. [score:4]
In contrast, proapoptotic miRNAs are usually downregulated in cancer, and include miR-15, miR-16, the let-7 family and members of the miR-34 family. [score:4]
Similarly, let-7a was highly upregulated, particularly at 21 days of retinoic acid treatment (p < 0.05). [score:4]
In conclusion, the identification of miR-16, let-7a and miR-34a, whose expression patterns are conserved in mouse, rat and human neural differentiation, implicates these specific miRNAs in mammalian neuronal development. [score:4]
Similarly, let-7a was significantly upregulated following induction of differentiation, increasing almost 4- and 3-fold at 6 and 12 hours, respectively (p < 0.05). [score:4]
In general, let-7 family members were upregulated at 3 days, and decreased at 8 days of differentiation. [score:4]
Figure 6 Differentiation of PC12 and NT2N cells were associated with modulated levels of miR-16, let-7a and miR-34a expression. [score:3]
Similarly to miR-16 and let-7a, a decrease in miR-34a expression occurred from day 6 to day 8. Figure 2 Apoptosis -associated miRNAs are modulated during mouse NS cell differentiation. [score:3]
This suggests that let-7a expression is associated with a general mechanism of differentiation rather than differentiation of specific cell types. [score:3]
Therefore, it is possible that additional mechanisms exist to antagonize let-7a and miR-16 expression during NS cell differentiation. [score:3]
In conclusion, our results demonstrate that apoptosis -associated miRNAs are differentially expressed during neural differentiation, in the absence of cell death, and identify miR-16, let-7a and miR-34a as important players. [score:3]
Importantly, although highly modulated during cell differentiation, both let-7a and miR-16 were significantly expressed in neurospheres (data not shown). [score:3]
A and B) miR-16, let-7a and miR-34a expression during PC12 and NT2N differentiation, respectively. [score:3]
Under identical conditions, let-7a expression remained elevated throughout the time course (p < 0.05). [score:3]
miR-16 and let-7a expressions in cells treated with 5 and 50 ng/ml NGF were also significantly different from NGF untreated cells at day 4 (p < 0.05) and day 2 (p < 0.01), respectively. [score:3]
Similarly to miR-16 and let-7a, a decrease in miR-34a expression occurred from day 6 to day 8. Figure 2 Apoptosis -associated miRNAs are modulated during mouse NS cell differentiation. [score:3]
Our results showed that the differential expression of miR-16, let-7a and miR-34a during mouse NS cell differentiation was not associated with cell death. [score:3]
In the present study, let-7a expression was shown to be cyclic during mouse NS cells differentiation, and corresponded to the onset of neurogenesis and gliogenesis. [score:3]
In fact, increased let-7a expression during ES cells, PC12 and NT2N differentiation also underscores the important role of let-7a during general differentiation. [score:3]
C) Expression of miR-16, Let-7a and miR-34a at 4 and 8 days of ES cell differentiation and in control (DMSO -treated) and LY411575 -treated rosette cultures at 8 days. [score:3]
Surprisingly, increased differentiation after replating was associated with a significant decrease in both miR-16 and let-7a expression by ~ 2 (p < 0.05) and 5-fold (p < 0.001), while miR-34a increased by 4.5-fold (p < 0.05), compared with non-replated cells. [score:2]
However, the mechanism by which let-7a regulates cell differentiation is unknown. [score:2]
In fact, at this stage of differentiation, expression levels of miR-16, let-7a and miR-34a were increased when compared with day 4 (Figure 5B). [score:2]
Our results are supported by the previous report showing that let-7a is a critical regulator of neuronal differentiation [12, 13]. [score:2]
Expression of specific proapoptotic (miR-16, let-7a and miR-34a) and antiapoptotic miRNAs (miR-20a and miR-19a) were analyzed by quantitative Real Time-PCR from 10 ng of total RNA using specific Taqman primers and GAPDH for normalization. [score:2]
To further validate the role of the proapoptotic miRNAs, miR-16, let-7a and miR-34a in neural cell differentiation, we investigated whether they were upregulated in other neural differentiation mo dels, including mouse ES cells, PC12 and NT2N cell lines. [score:2]
These results strongly suggested that modulation of miR-16, let-7a and miR-34a was most likely due to cell differentiation rather than cell death. [score:1]
In contrast to let-7a and miR-16, miR-34a was barely detected in undifferentiated cells, supporting its specific involvement in cell differentiation. [score:1]
Let-7 was first identified in Caenorhabditis elegans and reported to control the timing of fate specification during larval development [11]. [score:1]
Figure 5 miR-16, let-7a and miR-34a are increased during mouse ES cell differentiation. [score:1]
The let-7 family consists of eleven very closely related genes [51]. [score:1]
Next, we characterized the expression of proapoptotic miRNAs, including miR-16, let-7a and miR-34a in distinct mo dels of neural differentiation, including mouse embryonic stem cells, PC12 and NT2N cells. [score:1]
In addition, let-7a was also implicated in neuronal differentiation [12, 13]. [score:1]
Based on a possible link between miR-16, let-7a and miR-34a with known apoptotic molecules that have already been associated with differentiation, we decided to validate microarray data for the three proapoptotic miRNAs throughout mouse NS cell differentiation by quantitative real time-PCR (Figure 2). [score:1]
[1 to 20 of 38 sentences]
9
[+] score: 93
Ectopic Lin28B expression decreases the accumulation of let-7 family miRNAs and promotes Müller cells de-differentiation in vivoTo further verify that Lin28B expression down-regulation in dystrophic retinas causes let-7 family molecule accumulation, we used an adenoviral expression system to overexpress Lin28B in the retina by delivering Ad/Lin28B into the subretinal space of RCS-p+ rats at p21. [score:12]
To further verify that Lin28B expression down-regulation in dystrophic retinas causes let-7 family molecule accumulation, we used an adenoviral expression system to overexpress Lin28B in the retina by delivering Ad/Lin28B into the subretinal space of RCS-p+ rats at p21. [score:10]
We tested the expression level of Lin28B usingting since previous studies have shown that the developmentally regulated RNA -binding protein, Lin28, selectively repressed the expression of let-7 microRNA [36]. [score:7]
Downregulation of Lin28B may upregulate let-7 family molecules. [score:7]
The expression of most let-7 miRNA family molecules was increased, especially let-7e and let-7i, which were upregulated 4 times and 12 times, respectively in dystrophic rat retinas. [score:6]
The expression of Lin28 was significantly increased in the retina of zebra fish after injury, which promoted Müller cells to proliferate and de-differentiate into retinal progenitors by negatively regulating the expression of microRNA let-7 [25, 26]. [score:6]
These data suggested that reduced expression of Lin28B may increase expression of the let-7 family in Müller cells from RCS-p+ rat retinas. [score:5]
Recently, it revealed that the let-7 family regulated posttranscriptional genetic circuits involved in the heterochronic pathway that regulated developmental timing and aging in C. elegans [48]. [score:4]
These data provide a point for further studies to uncover the underlying mechanisms of the Lin28B and let-7 signaling pathway mediated de-differentiation and proliferation of Müller cells with the ultimate aim of developing endogenous stem cells for regeneration and repair of retinal degenerative diseases. [score:3]
Considering the growing evidence implicates that miRNAs have a variety of effects on glia including development, differentiation, activation [45], as well as cell fate determination [46, 47], we performed microRNA array analysis of RCS rat retinas and found that let-7 miRNA family molecules seemed to have a strikingly different expression pattern in RCS-p+ rats compared with control rats. [score:3]
Figure 3(A) Relative quantitative analysis showed that most members of the let-7 family, except let-7a and let-7f at p15, were upregulated at p15 and p30 in RCS-p+ rats' retina compared with controls. [score:3]
In teleost fish, let-7a and let-7f miRNA expression was dramatically reduced with injury in Müller cell derived progenitors so that the injured retinas were able to regenerate and be completely repaired by de-differentiated Müller cells [26]. [score:3]
MicroRNA let-7 was involved in cell differentiation and inhibited tumorigenesis. [score:3]
The deficiency of let-7 can stimulate DNA replication and cell division [27], so it suggested that let-7, miR-125, and miR-9 were the key regulators of retinal progenitor cells in the early to late developmental stages [28, 29]. [score:3]
The majority of the let-7 family was enriched and upregulated during the early stages of retinal degeneration, p15 and p30, in retina of RCS-p+ rats compared with controls. [score:3]
Ectopic Lin28B expression decreases the accumulation of let-7 family miRNAs and promotes Müller cells de-differentiation in vivo. [score:3]
Figure 5Ectopic Lin28B expression decreases the accumulation of let-7 family miRNAs and promotes Müller cells de-differentiation in vivo(A– B3) against GS (blue) and in situ hybridization with LNA let-7e or let-7i probes (red) at 2 weeks after subretinal space injection of Ad/Lin28B or Ad/GFP (green) in RCS-p+ rats. [score:3]
The prominent genes regulated by let-7 consist of those involved in executing cell-fate decisions, oncogenes and cell-cycle factors [47]. [score:2]
Recent studies have found that Lin28, miRNA -binding proteins, directly block the biogenesis of let-7 miRNAs post-transcriptionally by binding to the terminal loop region of the let-7 primary or precursor miRNAs (pri- or pre-miRNAs) of miRNAs in mammalian cells [36, 50– 53]. [score:2]
The major functions of the let-7 family include regulation of cell cycle progression and cell proliferation. [score:2]
The intrinsic timing mechanism that controls the developmental decline in neuronal regeneration depends on the progressive increase of let-7 in neurons [49]. [score:2]
Our results are in accordance with previous studies on zebrafish which demonstrated that Lin28 and let-7 were involved in the de-differentiation of Müller cells after retina injury [26]. [score:1]
[1 to 20 of 22 sentences]
10
[+] score: 58
Amongst them let-7 family miRNA that were reported to be broadly expressed across all differentiated tissues and their expression is tightly controlled during embryonic stem cells differentiation. [score:5]
It is clearly demonstrated that LPS -induced neurotoxicity suppresses let-7 family miRNAs expression, an effect that is ameliorated by co-administration of either cur or VPA. [score:5]
Recently, alteration of miR- let-7 members expression has also been reported in several other neurodegenerative diseases including schizophrenia, AD and addiction (Beveridge et al., 2010; Hollander et al., 2010; Santarelli et al., 2011; Wang et al., 2011). [score:5]
Evidently the distinguished pattern of let-7 five members’ expression in each group is directly correlated to the genetic remo deling activity that is exerted by LPS, Cur, or VPA. [score:4]
Also we are interested in studying the expression profiles of lethal-7 (let-7) miRNAs family members as signaling molecules in regulation of inflammatory enzymes cyclooxygenase-2 (COX-2) and inducible nitric oxide synthase (iNOS). [score:4]
miRNA let-7 family members are highly expressed in central nervous system and were shown to play crucial role in cell development and differentiation. [score:4]
Also we shed the light on the role of five let-7 family in VPA-Cur mediated mechanism of actions as novel therapeutic targets. [score:3]
FIGURE 7 Quantitative real time RT-PCR analyses of let-7 miRNAs family expression profile in different experimental groups. [score:3]
Interestingly we observed an overall altered expression profile in the five types of let-7 miRNAs in induced versus protected and treated rats. [score:3]
Therefore we analyzed the expression profile of five members of let-7 family (a, b, c, e, and f) in the different experimental groups. [score:3]
However, let-7a, b, and c levels were undetectable when assessed using qRT-PCR in induced group, a significant expression was observed in Co-Cur and Co-VPA administered groups, which suggest their implication in neural protection. [score:3]
We provide strong evidence for meaningful changes in five let-7 members miRNA expression during induction, progression, and treatment with Cur and VPA as the most salient feature. [score:3]
This explains the observation of let-7a, b, and c disappearance in induced group that was accompanied with threefold induction inCOX-2 level as well as up to threefold induction in iNOS expression compared to mock-Trx. [score:2]
MODULATION OF FIVE MEMBERS OF let-7 FAMILY miRNAs. [score:1]
The results show that let-7 a, b, and c were under detection level in LPS induced rats, an effect that was countered by either co-VPA or co-Cur incorporation (Figure 7). [score:1]
In our study, we screened in particular, five types of let-7 miRNAs family which are; let-7a, let-7b, let-7c, let-7e, and let-7f for possible modulation during the course of induction, protection, and treatment. [score:1]
Completed reductions (under detection limit) in let-7a, b, and c levels were observed in LPS -induced rats, the effect that was ameliorated by co-administration of VPA or Cur (** p < 0.001). [score:1]
Our work thus clearly indicates that miRNAs such as let-7 members deserve further functional exploration to deepen our understanding of molecular mechanisms driving not only neuroinflammation but also other neurodegenerative disorders. [score:1]
Co-administration of either Cur or VPA a particular differential expression was observed in all investigated members of let-7 miRNAs confirming their function as important players in neuro-protection. [score:1]
Treatment of induced rats with VPA or Cur alone did not induce let-7 a, b, and c in the same pattern as their combination did which indicate the synergistic effect VPA-Cur treatment. [score:1]
In our study we measured the alterations in the expression levels of five different types of let-7 miRNAs (Let-7 a, b, c, e, and f). [score:1]
group which confirms the implication of these let-7 members in self-healing mechanism. [score:1]
Evidently we observed significant elevations in let-7 a, c, and f in self-rec. [score:1]
Moreover VPA+Cur combination for treating induced rats significantly (* p < 0.01) induced the five members of let-7 family in comparison to LPS -induced rats. [score:1]
[1 to 20 of 24 sentences]
11
[+] score: 58
Protein kinase B or Akt, a key protein involved in the activation of PI3K-Akt pathway and is crucial in promoting cell survivability [43], is inhibited by the key microRNAs (miR-22, miR-214, miR-125a-3p, miR-320 and let-7 family) that are down-regulated with the addition of IGF-1. Chen et al. reported that down-regulation of miR-133b significantly overexpressed Akt1 mRNA, which increased T24 bladder cancer cell proliferation and reduced cell apoptosis [44]. [score:11]
However, BMSC-derived NPCs with addition of IGF-1 showed 12 microRNAs which include miR-22, miR-1224, miR-125a-3p, miR-214, miR-320, miR-708 and miR-93 were consistently down-regulated and only miR-496 remained up-regulated compared to Group C from Day 1 to Day 5. The let-7 family (let-7b, let-7c, let-7d, let-7e and let-7i) were constantly down-regulated in both groups. [score:9]
The genes up-regulated by down-regulation of miR-22 (A); miR-125a-3p (B); let-7 family (C); miR-214 (D); and miR-320 (E) were analyzed using GeneMANIA web tool with default weighting method (i. e., weighting based to maximize connectivity between input genes). [score:7]
MicroRNAs Query Genes miR-22 Myc; Ets1; Tp53; Agt; Esr1; Pten; Akt1 miR-214 Bcl2; Adora1; Myc; Neurod1; Dhcr24; Kras; Fgfr1; Apc; pcgfr1; Prnp; Akt1 miR-125a-3p Bcl2; Egfr; Tp53; Apc; Akt1; Rela miR-320 Bcl2; Adora1; Acvr1; Neurod1; Dhcr24; Tp53; Hmox1; Nol3; Pten; Akt1; Cebpb Let-7 Family Cdkn1a; Tnf; Bcl2; Adora1; Egfr; Myc; Il10; Acvr1; Sycp3; Neurod1; Dhcr24; Cdkn1b; SMAD3; Kras; ras3; Neurod1Birc2; Tp53; Kcnh8; FN1; Fgfr1; Clu; Fas; Pten; Akt1; Rela; Cebpb We assessed the predicted target genes of the down-regulated microRNAs with the KEGG database. [score:6]
Besides, Cimadamore et al. reported that LIN28 binds to precursor let-7 microRNA and blocks the production of mature let-7i microRNAs, inhibiting neuronal differentiation by targeting MASH1 and NGN1 genes [25]. [score:5]
ijms-16-09693-t006_Table 6 Table 6Pathways of predicted target genes for down-regulated microRNAs in Group A, Group B and Let-7 Family. [score:5]
In Groups A and B, let-7 family microRNAs were observed to be consistently down-regulated. [score:4]
This process suggests that the down-regulation of the let-7 microRNA family promotes cell proliferation during early neurogenesis. [score:4]
Query genes for individual microRNA are listed in Table 5. The major targeted genes by all or four out of five key microRNAs (miR-22, miR-214, miR-125a-3p, miR-320 and let-7 family) included Akt1, Tp53, Pten and Bcl2. [score:3]
Cimadamore F. Amador-Arjona A. Chen C. Huang C. T. Terskikh A. V. SOX2–LIN28/let-7 pathway regulates proliferation and neurogenesis in neural precursors Proc. [score:2]
Additionally, the statistical significant pathways (FDR < 0.01) involving cell proliferation and survivability related to this study are listed in Table 6. The significance levels of the related pathways were compared with pathways targeted by specific let-7 microRNAs independently to exclude the possibility that those pathways are due to let-7 microRNAs alone. [score:2]
[1 to 20 of 11 sentences]
12
[+] score: 40
Mean ± SEM, *p < 0.05, N = 3–6 per group Since ethanol increases TLR7 expression, let-7 release, and HMGB1 release, we hypothesized that the ethanol -induced increase in TLR7 expression primes TLR7 signaling and increases vulnerability to neurotoxicity due to TLR7 activation. [score:5]
Many miRNAs, including let-7 isoforms, are upregulated in the brains of humans and mice after chronic alcohol [8, 9]. [score:4]
HMGB1 is known to be secreted in microvesicles [42, 56] and might escort let-7 to microvesicles for secretion, rather than to the Ago2 -associated RISC complex, where it would subsequently act intracellularly to regulate the stability target mRNAs. [score:4]
Thus, we hypothesized that ethanol would increase TLR7 and let-7 expression in vitro contributing to neuroimmune activation. [score:3]
Our findings indicate that alcohol causes microglia to release let-7 and HMGB1 in MVs while concomitantly increasing TLR7 expression, leading to neurodegeneration. [score:3]
Studies utilizing miRNA profiling find increased expression of several let-7 isoforms in human and rodent brain after chronic alcohol [8, 9]. [score:3]
Let-7 release in MVs in particular has also been implicated in multiple inflammatory pathologies related to cancer, cardiovascular disease, and neurodegeneration [6, 53, 54]. [score:2]
Further, ethanol increased let-7b binding to the danger signaling molecule high mobility group box-1 (HMGB1) in MVs, while reducing let-7 binding to classical chaperone protein argonaute (Ago2). [score:1]
Ethanol caused a threefold increase in MV let-7b from BV2 microglia (Fig.   4b) but not SH-SY5Y neurons (Fig.   4c), suggesting microglia are the source of secreted let-7. Ethanol also caused a dose -dependent increase in media HMGB1 (Fig.   4d). [score:1]
We identify a role of let-7 in the pathology of alcoholism that involves inter-cellular signaling through TLR7, rather than its intracellular function involving mRNA stabilization. [score:1]
Thus, ethanol increases TLR7 -induced neurodegeneration, through induction of TLR7, let-7 release, and HMGB1 secretion. [score:1]
Therefore, we think the requirement for HMGB1 involves facilitating the interaction of let-7 with TLR7, rather than a requirement for co-stimulation of TLR4 by HMGB1. [score:1]
Thus, we report here the identification of a novel inter-cellular communication mechanism in the pathology of alcohol abuse, whereby ethanol causes the release of HMGB1-let-7 complexes in MV from microglia. [score:1]
siRNA against TLR7 mRNA (siTLR7) prevented let-7 induced neurotoxicity. [score:1]
The miR let-7 is an endogenous ligand for TLR7 that results in neurodegeneration [6] and let-7 isoforms are increased in the brains of human alcoholics [9]. [score:1]
We then asked which cell type was responsible for microvesicular let-7 and HMGB1 release. [score:1]
The endogenous TLR7 agonist miR let-7 has been found to cause neurodegeneration [6]. [score:1]
Fig. 8 Proposed mechanism of HMGB1 and let-7 release in microvesicles. [score:1]
Ethanol increases the binding of let-7 with HMGB1 in microvesicles. [score:1]
Other let-7 family members in addition to other pro-inflammatory miRNAs were assessed and are shown in Additional file 4: Table S1. [score:1]
Thus, sensitization of TLR7 signaling with either IMQ or let-7 results in increased neurotoxicity to ethanol. [score:1]
Our findings suggest that recurrent TLR7 activation by ethanol -induced microglial let-7 and HMGB1 release contributes to the progressive neurodegeneration associated with alcoholism. [score:1]
Ethanol increases TLR7 activation and releases of HMGB1-miR-let-7 complexes in microglia-derived vesicles that cause neurotoxicity via TLR7 activation. [score:1]
[1 to 20 of 23 sentences]
13
[+] score: 36
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This is consistent with current mo dels of let-7 function which indicate that the family members are barely detectable during embryonic development before being up-regulated in differentiated cells where they are likely to possess highly redundant roles through targeting of an overlapping set of mRNAs [33]. [score:7]
Similarly, dysregulation of let-7 leads to a less differentiated cellular state and the development of cell -based diseases such as cancer [51, 52]. [score:5]
It remains to be determined whether the 8 let-7 family members that are expressed in the epididymis have different activities or whether they collectively target a similar cohort of genes. [score:5]
For instance, among the 66 uniformly expressed miRNAs for which IPA assigned functions, we identified 12 candidates that have been implicated in androgen regulation, including: let-7a-5p, miR-15a-5p, miR-17-5p, miR-19b-3p, miR-23a-3p, miR-24-3p, miR-27b-3p, miR-30a-5p, miR-34a-5p, miR-140-5p, miR-193a-3p, miR-205-5p (S1 Fig). [score:4]
Of these family members, previous work has shown that 5 (let-7a/b/c/d and let-7f) are wi dely expressed in newborn, young adult, and aged human epididymides [8]. [score:3]
Nevertheless, it is tempting to speculate that the redundancy in let-7 expression may contribute to the stringent molecular mechanisms that help the epididymis evade tumorigenesis. [score:3]
Among these members, let-7a/b/c/d/e/f, and let-7i are ubiquitously expressed in the adult mouse, rat and human epididymis. [score:3]
Let-7 (lethal-7) is a founding member of the miRNA family that was originally described in Caenorhabditis elegans, where it controls the timing of terminal differentiation, acting as a key regulator of multiple genes required for exit from the cell cycle (reviewed by [33]). [score:2]
The role of let-7 in cell differentiation and cancer. [score:1]
The let-7 miRNA family has since been shown to display a remarkable level of sequence and functional conservation across the animal kingdom, with 14 and 13 different family members represented in mouse and human, respectively [33]. [score:1]
Interestingly, among the conserved miRNAs found in all epididymal regions, we identified 8/14 and 4/7 members of the let-7 family (let-7a—let-7f, let-7i) and miR-30 (miR-30a— miR-30d) family, respectively. [score:1]
The let-7 family of microRNAs. [score:1]
[1 to 20 of 12 sentences]
14
[+] score: 36
[#] p < 0.05, [##] p < 0.01, [###] p < 0.001 versus NC+KA or Scr+KA group Recent studies demonstrated that H19 could regulate gene expression by acting as competing endogenous RNA for miRNA let-7, resulting in the derepression of several protein-coding genes targeted by let-7 18, 22, 23, as H19 harbors both canonical and non-canonical -binding sites for the let-7 family [23]. [score:6]
[#] p < 0.05, [##] p < 0.01, [###] p < 0.001 versus NC+KA or Scr+KA group According to the prediction of miRNA target gene, Casp3 is one of the potential downstream target genes of the let-7 family. [score:5]
[#] p < 0.05, [##] p < 0.01, [###] p < 0.001 versus NC+KA or Scr+KA groupAccording to the prediction of miRNA target gene, Casp3 is one of the potential downstream target genes of the let-7 family. [score:5]
H19 regulates gene expression by acting as a competing endogenous RNA for let-7 in SE -induced neural damage during epileptogenesis. [score:4]
The expression levels of the let-7 family members were examined in CA3 subfield of the hippocampus from rats at 1 day after SE. [score:3]
b The expression levels of let-7 family members (let-7a, let-7b, let-7d, let-7e, let-7g, and let-7i) in CA3 subfield of hippocampus from sham-operated and KA -induced epileptic rats at 1 day after surgery as determined using qPCR (n = 7–8). [score:3]
The relative H19 levels were normalized to GAPDH and the relative expression levels of let-7 family members were normalized to U6. [score:3]
The bioinformatics analysis also revealed putative complementary sequences for let-7 family members (let-7a, let-7b, let-7d, let-7e, let-7g, and let-7i) in rat H19 (Fig.   5a). [score:1]
Gao Y The H19/let-7 double -negative feedback loop contributes to glucose metabolism in muscle cellsNucleic Acids Res. [score:1]
and luciferase assays demonstrate that vertebrate H19 harbors binding sites for the miRNA let-7 family and can bind to let-7 directly to modulate its availability [23] The results from the present study are consistent with the reports. [score:1]
a Bioinformatics-predicted binding sites for eight let-7 subtypes (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, and let-7i) in rat H19. [score:1]
Fig. 5 a Bioinformatics-predicted binding sites for eight let-7 subtypes (let-7a, let-7b, let-7c, let-7d, let-7e, let-7f, let-7g, and let-7i) in rat H19. [score:1]
Kallen AN The imprinted H19 lncRNA antagonizes let-7 microRNAsMol. [score:1]
Nucleotides of the miRNA let-7 seed region (positions 2–8) are marked in red. [score:1]
[1 to 20 of 14 sentences]
15
[+] score: 32
We performed network analyses using top 10 identified miRNAs (up-regulated: let-7i, let-7c, let-7a, miR-124, miR -145, miR-143, miR-34a, miR-466; down-regulated: miR-21, miR-146b) to predict their potential target transcripts. [score:9]
The TGFBR1 gene, which mediates the action of TGF-β, is a predicted target gene of the let-7/miR-98 family according to TargetScan 4.2 (containing conserved sites for let-7a-g and i, and for miR-98). [score:5]
A likely scenario, in the early stage, is that let-7 expressed higher and miR-21 level is lower, which inhibits TGF-β signaling that is necessary for lung regeneration. [score:5]
Taken together, the changes in let-7 and miR-21 expression level create an unopposed profibrotic balance in RILI development. [score:4]
Whereas in the late stage, let-7 expressed at a relatively low level and miR-21 level is higher, which may allow an enhanced TGF-β signaling activity that is necessary for lung fibrosis. [score:3]
B: microRNAs let-7i, let-7a, let-7c, miR-34a, miR-124, miR-145, and miR-143 were up regulated; miR-21 was down regulated 12 weeks post-irradiation vs. [score:3]
Regulation of TGFBR1 by let-7 and SMAD7 by miR-21, which was suggested by our results, may further fine-tune the TGF-β signaling activity to the necessary level at each RILI developmental stage. [score:3]
[1 to 20 of 7 sentences]
16
[+] score: 28
The down-regulated miRNAs included miR-24, miR-26a, miR-126, and Let-7a, b, c, f. The up-regulated miRNAs were composed of miR-344, miR-346, miR-99a, miR-127, miR-128b, miR-135b, and miR-30a/b. [score:7]
Sod2 was inversely correlated with Let-7a, b, c, f. We also identified the inverse correlation of many up-regulated miRNAs and down-regulated mRNAs. [score:7]
Among these miRNAs, Let-7 is involved in the airway inflammation by directly regulating IL-13 expression [51]. [score:5]
The down-regulated miRNAs included miR-24, miR-26a, miR-126, and Let-7 family members. [score:4]
We also found that Let-7 family was down-regulated in ARDS. [score:3]
Let-7 is also a regulator of apoptosis in tumors [44]. [score:1]
While Sod2 was inversely correlated with Let-7a, b, c, f., Ebf1 and Apc were inversely correlated with miR-24 and miR-26a, respectively. [score:1]
[1 to 20 of 7 sentences]
17
[+] score: 28
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Thus, miRNA families (e. g., miR-1 and miR-122) that are specifically or highly expressed in any one of the 3 tissues, or miRNAs that are expressed ubiquitously (e. g., let-7 and miR-26) in all 3 tissues, show a far greater frequency than other miRNAs. [score:5]
Interestingly, the expression abundance varies among the let-7 family members (Tables 1 and 2); let-7a and let-7j, each have 80 reads; similarly, let-7b, let-7c and let-7e have almost the same number of reads (63–64); let-7d, let-7f and let-7j have 18 to 32 reads; and let-7h, let-7i and let-7k have a lower number of reads (5–9) (Tables 1 and 2). [score:3]
For instance, let-7 is represented by 445 reads and miR-26 by 177 reads (Tables 1 and 2), and these two miRNAs are ubiquitously expressed in the heart, liver and thymus (Figure 3A and 3B). [score:3]
Hence the let-7 miRNA family is represented by 11 members, and this study provides the evidence for the expression of all 11 let-7 family members in pig. [score:3]
Here, we found evidence for the expression of all 10 let-7 members in pig. [score:3]
Additionally, many other miRNAs, such as let-7, miR-98, miR-16, miR22, miR-26b, miR-29c, miR-30c and miR126, were also expressed abundantly in thymus (Figure 3). [score:3]
Similarly, let-7, miR-98, miR-16 and miR-130a are abundantly expressed in 13 of the 14 tissues (except in pancreas) (Figure 3A). [score:3]
let-7, miR-98, miR-130a and miR-16 showed uniform levels of expression in 13 different tissues but were hardly detected in pancreas (Figure 3A). [score:3]
The miR-98 sequence differs from that of the let-7 family by one nt at position 11 from the 5' end, thus miR-98 is also a member of the let-7 family. [score:1]
The let-7 family has 10 members in diverse animal species (miRBase). [score:1]
[1 to 20 of 10 sentences]
18
[+] score: 27
The most downregulated miRNA during EB formation was miR-let-7a, which is of interest because let-7 has been shown to regulate developmental timing in Caenorhabditis elegans [22]. [score:6]
RISC -mediated target RNA cleavage activity was determined by in vitro cleavage of a [32]P-target mRNA that perfectly matched the miR-302b or let-7 sequence. [score:5]
RISC activity of miR-302b, a representative miRNA expressed in hES cells and not in HeLa cells, and let-7a was analyzed by incubating cell extracts with a [32]P-cap-labeled substrate mRNA that was perfectly complementary to miR-302b or let-7a. [score:3]
0002820.g004 Figure 4(A) Northern blot analysis of miR-302b and miR let-7a expression in hES and HeLa cells, respectively. [score:3]
Fig 4A demonstrates the specific expression of miR-302b and let-7 in hES and HeLa cells, respectively. [score:3]
Conversely, let-7 RISC in HeLa extracts cleaved let-7 target RNA while hES RISC did not show detectable activity in this experiment. [score:3]
Conservation of miRNAs was analyzed as described in Fig 1. (A) Northern blot analysis of miR-302b and miR let-7a expression in hES and HeLa cells, respectively. [score:3]
Since let-7a is abundant in HeLa, we selected let-7 as a control in our experiments. [score:1]
[1 to 20 of 8 sentences]
19
[+] score: 26
In our miRNA-analysis, let-7a, let 7c and let-7f had the greatest amount of experimentally verified target mRNAs among the dysregulated genes supporting the role of Let-7 family of miRNAs as a putatively important regulator of cardiac hypertrophic response through their gene target [59]. [score:7]
In addition, the analysis of regulatory pathways as well as miRNA-mRNA interactions predict that Nrf2 and IRF transcription factors as well as the let-7 family of miRNAs are playing roles in the regulation of mechanical stretch induced gene expression response in cardiomyocytes and these may help in elucidating the genes and regulatory pathways underlying cardiac hypertrophy. [score:6]
In contrast, the dysregulated miRNA, let-7a, had 18 target mRNAs among the stretch-regulated genes at the 48 hours timepoint (Fig.   8C). [score:5]
Putative stretch regulated targets for (A) let-7f, (B) let-7c and (C) let-7a were obtained from the IPA-analysis. [score:4]
At 24 hours, five miRNAs (rno-miR-214, rno-miR-99a, rno-miR-363*, rno-miR-100 and rno-miR-340–5p) and at 48 hrs 6 miRNAs (rno-miR-34b, rno-miR-500, rno-miR-24-1*, rno-miR-29b, rno-miR-199a-3p, rno-let-7a) showed the most prominent dysregulation (P < 0.001) (Fig.   7B). [score:2]
At present, little is known about the role of Let-7 family of miRNAs in stretched cardiomyocytes but analyses of mechanosensitive miRNAs associated with muscular dystrophies indicated that the let-7 family was dysregulated in mice with muscular dystrophies with myositis (mdm-mice) [61]. [score:2]
[1 to 20 of 6 sentences]
20
[+] score: 24
As shown in the Venn diagram in Fig.   7, notably, 23 of the 28 upregulated miRNAs in DIO + LFD mice (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were downregulated in the DIO mice. [score:7]
Notably, 23 circulating miRNAs (mmu-miR-16, mmu-let-7i, mmu-miR-26a, mmu-miR-17, mmu-miR-107, mmu-miR-195, mmu-miR-20a, mmu-miR-25, mmu-miR-15b, mmu-miR-15a, mmu-let-7b, mmu-let-7a, mmu-let-7c, mmu-miR-103, mmu-let-7f, mmu-miR-106a, mmu-miR-106b, mmu-miR-93, mmu-miR-23b, mmu-miR-21, mmu-miR-30b, mmu-miR-221, and mmu-miR-19b) were significantly downregulated in DIO mice but upregulated in DIO + LFD mice. [score:7]
All Let-7 family members are believed to have similar functions because they share a common seed region (nucleotides 2–8), which mediates interactions between miRNA and target mRNAs [25]. [score:3]
Among them, five members of the Let-7 family (mmu-let-7a, mmu-let-7b, mmu-let-7c, mmu-let-7f, and mmu-let-7i) were dysregulated in response to obesity and weight reduction following LFD feeding. [score:2]
Mice with global overexpression of Let-7 are viable, but they have reduced body size and weight [25]. [score:2]
Some of the circulating miRNAs identified in this study have also been reported in the adipose tissue of DIO mice or implicated in adipogenic processes [11– 13], including Let-7, miR-103, miR-15, the miR-17-92 cluster (miR-17, miR-20a, and miR-92a), miR-21, miR-221, and miR-30b. [score:1]
In mice, 12 genes encode members of the Let-7 family, which includes nine slightly different miRNAs (Let-7a, Let-c, and Let-7f [all encoded by two genes], and Let-7b, Let-7d, Let-7e, Let-7g, Let-7i, and miR-98 [all encoded by one gene]). [score:1]
Furthermore, Let-7 transgenic mice exhibit impaired glucose tolerance because of diminished glucose -induced insulin secretion, and anti-miR–induced silencing of Let-7 has been proven to improve blood glucose levels and insulin resistance in obese mice [25]. [score:1]
[1 to 20 of 8 sentences]
21
[+] score: 22
Tsp-let-7 showed very low expression in NBL stage, whereas tsp-miRNA-100 was detected in rather high abundance at the same development stage. [score:4]
Further, MiR-100 and let-7, the two conserved miRNA in metazoa, play a role in regulation of developmental timing [18], [42], [45]. [score:3]
First, the above miRNAs identified in sequencing were all amplified by qRT-PCR (Fig. 6A) and except the tsp-let-7 which was found less expressed in NBL, the qRT-PCR results were all consistent with the TPM values of sequencing results. [score:3]
The following forward primers were designed to confirm the sequencing results of miRNAs that showed differential expression patterns: tsp-miR-100 5′-AAC CCG TAG ATC CGA ACT TGT GT-3′; tsp-let-7 5′-TGA GGT AGT AGG TTG TAT AGT T-3′; tsp-miR-228 5′-AAT GGC ACT GGA TGA ATT CAC GG-3′; tsp-miR-1 5′-TGG AAT GTA AAG AAG TAT GTA G-3′; tsp-miR-31 5′-AGG CAA GAT GTT GGC ATA GCT GA-3′; tsp-novel-108 5′-CTT GGC ACT GTA AGA ATT CAC AGA-3′; tsp-novel-83 5′-TTG AGC AAT TTT GAT CGT AGC-3′; tsp-novel-46 5′-TGG ACG GCG AAT TAG TGG AAG-3′; tsp-novel-86 5′-TGA GAT CAC CGT GAA AGC CTT T-3′; tsp-novel-21 5′-TCA CCG GGT AAT AAT TCA CAG C-3′. [score:2]
The biological function of miRNAs was first demonstrated in C. elegans, where two miRNAs (Let-7 and Lin-4) were shown to be regulators for stage-specific differentiation of the worm [17], [18]. [score:2]
The oligonucleotide probes used for hybridization are as follows: tsp-mir-100 probes: 5′ACACAA*GTTC*GGATCT*AC*GGGTT3′ tsp-let-7 probes: 5′AACTAT*ACA*ACCT*ACT*ACCTCA3′ tsp-novel-108 probes: 5′TCT*GT*GAATTCTT*ACA*GTGCCAAG3′ tsp-novel-83 probes: 5′GCTAC*GATC*AA*AATT*GCTCAA3′ (LNA (Locked nucleic acid) substitutions are indicated by a “*”). [score:1]
0026448.t001 The sequencing data showed that, of the 21 conserved miRNAs, tsp-let-7 and tsp-miR-87 were found to locate only in the 3′ arm of their pre-miRNAs, and tsp-miR-31 was located only in the 5′ arm of the hairpin structures. [score:1]
Five conserved miRNAs (tsp-miR-228, tsp-miR-100, tsp-let-7, tsp-miR-1 and tsp-miR-31) and five novel miRNAs (tsp-novel-108, tsp-novel-83, tsp-novel-46, tsp-novel-86 and tsp-novel-21) with relatively higher TPM values identified by sequencing were validated by qRT-PCR and Northern blot. [score:1]
0026448.t001The sequencing data showed that, of the 21 conserved miRNAs, tsp-let-7 and tsp-miR-87 were found to locate only in the 3′ arm of their pre-miRNAs, and tsp-miR-31 was located only in the 5′ arm of the hairpin structures. [score:1]
The reason for tsp-let-7 being found less common in NBL is not known. [score:1]
The oligonucleotide probes used for hybridization are as follows: tsp-mir-100 probes: 5′ACACAA*GTTC*GGATCT*AC*GGGTT3′ tsp-let-7 probes: 5′AACTAT*ACA*ACCT*ACT*ACCTCA3′ tsp-novel-108 probes: 5′TCT*GT*GAATTCTT*ACA*GTGCCAAG3′ tsp-novel-83 probes: 5′GCTAC*GATC*AA*AATT*GCTCAA3′ (LNA (Locked nucleic acid) substitutions are indicated by a “*”). [score:1]
Their homologs, tsp-miRNA-100 and t sp-let-7, were found throughout the life cycle of T. spiralis. [score:1]
The abundance of tsp-miRNA-100 was almost identical with that of tsp-let-7 in both Ad and ML stage, indicating that miRNA-100 may be more functional in NBL stage. [score:1]
[1 to 20 of 13 sentences]
22
[+] score: 21
More importantly, the miRNAs analyzed in this study not only included the miRNAs like Let-7a, miR-15b, miR24, miR-100 and miR-125 which may suppress the expression of cyclins A and B, and miRNAs such as Let-7a, miR24 and miR-125 which may regulate activity of CDK1, but also miRNAs such as miR-181a, miR-221 and miR-222 which can target CDK inhibitors [30– 32]. [score:10]
To investigate whether miRNAs have a role in the cell cycle regulation of splenocytes following aniline exposure, the expression of miRNAs, including Let-7a, miR-15b, miR24, miR-100, miR-125, miR-181a, miR-221 and miR-222 which are known to mainly control G2/M phase regulators [30– 32], was analyzed by using real-time PCR and the results are presented in Fig 7. Aniline exposure led to significantly decreased expression of Let-7a (decreased 82%), miR-15b (decreased 62%), miR24 (decreased 78%), miR-100 (decreased 63%), miR-125 (decreased 86%), whereas miR-181a, miR-221 and miR-222 increased by 155%, 78% and 56%, respectively, in comparison to controls (Fig 7). [score:5]
Therefore, greater decreases in Let-7a, miR-15b, miR24, miR-100 and miR-125 expression and significant increases in miR-181a, miR-221 and miR-222 levels in the spleens following aniline treatment may be mechanistically important in generalizing that aniline exposure leads to increased cyclin A, cyclin B, CDK1, and decreased p21, p27, thus triggering the splenocytes to go through G2/M transition. [score:3]
Real-time PCR analysis of miRNAs Let-7a, miR-15b, miR24, miR-100 and miR-125 (A), and miRNAs miR-181a, miR-221 and miR-222 (B) expression in rat spleens following aniline exposure. [score:3]
[1 to 20 of 4 sentences]
23
[+] score: 20
Importantly, while the expression of certain miRNAs was found to overlap across the two different populations (i. e., miR-122, miR-192 and Let-7a) the expression of other miRNAs was found to be differentially regulated. [score:6]
Interestingly, also the ubiquitously expressed miRNA Let-7a (P = 0.03) is significantly up-regulated in the serum of these animals, but with different dynamics compared to liver-enriched miRNAs (Fig. 6, top row). [score:5]
A second a group of miRNAs whose expression is higher in the vesicles-enriched pellets (i. e., Let-7a, miR-15b, -142-3p and -98, Fig. 5, right column) and a third group of miRNAs which presents comparable expressions in both groups (i. e., miR-15a, -16, -155, -21, -18a and RNU6, Fig. 5, middle column). [score:5]
It was found that the expression of miR-122 (P = 0.0001), miR-192 (P = 0.004), miR-194 (P = 0.03)] and Let-7a (P = 0.006) followed the same pattern as observed for vesicles -associated miRNAs (top rows in Figs 6 and 7), suggesting that these miRNAs do undergo comparable modulation in both fractions. [score:3]
Significantly, in a previously published study from Arroyo et al. 18 Let-7a and miR-98 were found enriched in the vesicle-enriched and in the vesicle -depleted fractions of the serum respectively. [score:1]
[1 to 20 of 5 sentences]
24
[+] score: 19
For example, let-7e* was down-regulated in malignant mesothelioma (Guled et al. 2009), and let-7a was up-regulated in lung, lymphoma, and ovarian cancers (Boyerinas et al. 2010). [score:7]
As shown in Table 1, expression of 13 miRNAs was > 2 times higher or lower than in controls (p < 0.05), including only two miRNAs (rno-let-7a and rno-miR-28) that were up-regulated. [score:6]
The let-7 family of miRNAs, which is functionally conserved from worms to humans, is important to normal development and differentiation and has been reported to be deregulated in various cancers (reviewed by Boyerinas et al. 2010). [score:3]
Caspase-3, Dicer, and Myc have been confirmed to be let-7a targets (Boyerinas et al. 2010). [score:3]
[1 to 20 of 4 sentences]
25
[+] score: 18
Althogether these studies strongly suggest that an up-regulation of most, if not all, members of the let-7 and miR-7 families and of the miR-132/212 cluster marks hypothalamus development while miR-9, miR-124a, miR-145 and miR-219 displayed nucleus-specific regulations of expression. [score:8]
Let-7b, miR-124a and miR-9 displayed no expression differences in MPN between P15 and P30 while let-7a, miR-7, miR-132, miR-145 and miR-219 displayed up-regulations. [score:6]
Our data also established the up-regulation of all members of the let-7 and miR-7 gene families, as well as that of the four miRNAs encoded by the miR-132/212 cluster, i. e. miR-132-3p, miR-132-5p, miR-212-3p and miR-212-5p, when comparing stages P14 and P28. [score:4]
[1 to 20 of 3 sentences]
26
[+] score: 17
A strong decrease of let-7 expression levels has been associated with an aberrant overexpression of HMGA1 and HMGA2 in several human highly malignant carcinomas (58, 59). [score:5]
Moreover, HMGA2 overexpression correlated with low levels of let-7, a miRNA able to target and repress HMGA2, and with p53 (40). [score:5]
A more recent study confirmed that HMGA2 is highly expressed in metastatic lung adenocarcinoma, where it contributes to cancer progression and metastasis by acting as a competing endogenous RNA for let-7 miRNA family (47). [score:3]
Moreover, it is worthy to note that the 3′-UTR of HMGA2 carries as many as seven let-7 binding sites, then taking also part in the modulation of HMGA1 expression levels (47). [score:3]
Several recent reports have highlighted the post-transcriptional repression of HMGA proteins by non-coding RNAs and, in particular, numerous miRNAs with this activity have been identified (let-7a, miR-15, miR-16, miR-26a, miR-34b, miR-196a2, miR-326, miR-432, miR-548c-3p, miR-570, miR-603) (53, 54). [score:1]
[1 to 20 of 5 sentences]
27
[+] score: 15
Among the miRNAs, miR-214, miR-199a-5p, miR-150, miR-199a-3p, miR-351, miR-145, miR-764, miR-497 and miR-92b were upregulated, whilst miR-7a, miR-325-5p, miR-485, miR-708, miR-344-3p, let-7f, miR-26b, miR-129, miR-29c and let-7a were downregulated. [score:7]
Frost and Olson (24) demonstrated that both global and pancreas-specific overexpression of let-7 in mice resulted in impaired glucose tolerance and reduced glucose -induced pancreatic insulin secretion. [score:3]
Inhibition of the let-7 family prevents impaired glucose tolerance in mice with diet -induced obesity, partially by improving insulin sensitivity in the liver and muscle (24). [score:3]
Among the 19 miRNAs, four miRNAs have already been reported to be correlated to diabetes in previous studies, including miR-29c, let-7a, let-7f and miR-7 (23– 25). [score:1]
These miRNAs include miR-214, miR-199a-5p, miR-150, miR-351, miR-145, miR-92b, miR-7a, miR-485, miR-708, let-7f, miR-26b, miR-129, miR-29c and let-7a. [score:1]
[1 to 20 of 5 sentences]
28
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, hsa-mir-335, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
In breast cancer cells, over -expression of miR-221, miR-222, let-7 and miR-20b is associated with reduced of ERα protein content, signaling and expression of ERα target genes [47- 49]. [score:7]
It has been reported that the expression of miR-143, let-7a, miR-15b is under negative control of follicle stimulating hormone (FSH) during follicular development [36] and may be involved in FSH -induced rat granulosa cell progesterone production [37]. [score:4]
These include rno-miR-195, rno-miR-125a-5p, rno-let-7a, rno-miR-16, rno-miR-30b-5p, rno-let-7c, rno-let-7b, rno-miR-125b-5p, rno-miR-221, rno-miR-222, rno-miR-26a, rno-miR-322, rno-miR-23a, rno-miR-191, rno-miR-30 family, rno-miR-21, rno-miR-126, rno-miR-23b, rno-miR-145 and rno-miR-494. [score:1]
[1 to 20 of 3 sentences]
29
[+] score: 12
BDNF regulates protein synthesis via let-7. BDNF stimulation upregulates Lin28, an RNA binding protein that can bind precursors of let-7, preventing them from being processed by the Dicer–TRBP machinery. [score:5]
The resulting diminished levels of mature let-7 miRNAs relieve repression of mRNAs with let-7 binding sites and permit their translation (32). [score:3]
In addition, let-7 regulates dendritic spine density along the length of neurons (33). [score:2]
Let-7 is involved in neurogenesis (30) as well as neuronal development and function (31). [score:1]
These include: let-7a, miR-124, miR-125a-5p, and miR-132. [score:1]
[1 to 20 of 5 sentences]
30
[+] score: 11
Six candidate miRNAs that are predicted to target caspase-3 (let-7, miR-138, miR-30b, miR-129, miR-203, and miR-219-5p) and have an aggregate Pct greater than 0.2 were selected (Fig.   1c). [score:3]
Since we did not examine the effect of other let-7 family members on caspase-3 expression in the present study, it is difficult to draw any conclusion on the specificity of let-7b in MSCs. [score:3]
Furthermore, members of the let-7 family—namely let-7a, let-7e, and let-7 g—have also been reported to target caspase-3 in cancer cells, PC12 cells, and endothelial cells, respectively [26, 34, 35]. [score:3]
Aside from the miRNAs that are not members of the let-7 family, the predicted binding sequence of let-7 family members (a, b, c, d, e, f, g, and i) to the 3′ UTR of human caspase-3 is identical. [score:1]
This is one of the limitations of the present study, and specific roles of individual let-7 family members on the cell survival, especially of MSCs, will be an interesting subject of further study. [score:1]
[1 to 20 of 5 sentences]
31
[+] score: 11
Of these miRNAs, rno-miR-129-1-3p, rno-miR-153-3p, rno-miR-29b-3p, rno-miR-29c-3p and rno-miR-451-5p were down-regulated, whereas rno-let-7a-1-3p, rno-miR-322-5p, rno-miR-3574 and rno-miR-628 were observed to be highly upregulated with p < 0.01 (Fig.   3). [score:7]
Other miRNAs that were abundantly expressed after FNS include the let-7 family members. [score:3]
9 miRNAs (rno-miR-129-1-3p, rno-miR-153-3p, rno-miR-29b-3p, rno-miR-29c-3p, rno-miR-451-5p, rno-let-7a-1-3p, rno-miR-322-5p, rno-miR-3574 and rno-miR-628) showed statistically significant change. [score:1]
[1 to 20 of 3 sentences]
32
[+] score: 11
miR-224, let-7a, and let-7d were downregulated in colon cancer tissues, and upregulation of miR-224 or let-7a attenuated colon cancer growth [52– 55]. [score:7]
The upregulated miRNAs in the colon tissues of UC rats changed by HM were miR-149-5p, miR-351-5p, let-7d-5p, miR-98-5p, let-7a-5p, miR-3559-5p, let-7f-1-3p, miR-3596b, miR-224-5p, miR-411-3p, miR-184, miR-26b-3p, and miR-92b-3p. [score:4]
[1 to 20 of 2 sentences]
33
[+] score: 11
miRs 99a, 29a, 210 and let-7a were upregulated whereas miRs 28, 133b, 378, 24, 450a, and 434 were downregulated (Tables 1 and S1). [score:7]
Following 10 days of bedrest, 15 miRs were downregulated in biopsies from the vastus lateralis, including miR-23a and miR-206, and let-7 family members [13]. [score:4]
[1 to 20 of 2 sentences]
34
[+] score: 11
In endometriosis, the upregulation of H19 expression was shown to promote endometriotic stromal cell proliferation through the downregulation of let-7 to target IGF1R [12]. [score:11]
[1 to 20 of 1 sentences]
35
[+] score: 10
For example, rno-miR-1-3p, rno-let-7 family, rno-miR-29a-3p, rno-miR-133a-3p, rno-miR-499-5p and rno-miR-140-3p are most highly expressed in both HF and control group in our study, which was consistent with the previous studies that rno-miR-133, rno-miR-1 and rno-miR-499 are highly expressed in the heart[26], and miR-1, let-7 and miR-133 are highly expressed in the murine heart[27]. [score:7]
The most highly expressed miRNAs were rno-miR-1-3p, rno-let-7 family, rno-miR-29a-3p, rno-miR-133a-3p, rno-miR-499-5p and rno-miR-140-3p in both HF and control group. [score:3]
[1 to 20 of 2 sentences]
36
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-182, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, mmu-mir-297a-1, mmu-mir-297a-2, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-138-2, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-138-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, rno-mir-301a, rno-let-7d, rno-mir-344a-1, mmu-mir-344-1, rno-mir-346, mmu-mir-346, rno-mir-352, hsa-mir-181b-2, mmu-mir-10a, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-362, mmu-mir-362, hsa-mir-369, hsa-mir-374a, mmu-mir-181b-2, hsa-mir-346, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-10a, rno-mir-15b, rno-mir-26b, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-34b, rno-mir-34c, rno-mir-34a, rno-mir-106b, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-181a-1, hsa-mir-449a, mmu-mir-449a, rno-mir-449a, mmu-mir-463, mmu-mir-466a, hsa-mir-483, hsa-mir-493, hsa-mir-181d, hsa-mir-499a, hsa-mir-504, mmu-mir-483, rno-mir-483, mmu-mir-369, rno-mir-493, rno-mir-369, rno-mir-374, hsa-mir-579, hsa-mir-582, hsa-mir-615, hsa-mir-652, hsa-mir-449b, rno-mir-499, hsa-mir-767, hsa-mir-449c, hsa-mir-762, mmu-mir-301b, mmu-mir-374b, mmu-mir-762, mmu-mir-344d-3, mmu-mir-344d-1, mmu-mir-673, mmu-mir-344d-2, mmu-mir-449c, mmu-mir-692-1, mmu-mir-692-2, mmu-mir-669b, mmu-mir-499, mmu-mir-652, mmu-mir-615, mmu-mir-804, mmu-mir-181d, mmu-mir-879, mmu-mir-297a-3, mmu-mir-297a-4, mmu-mir-344-2, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-493, mmu-mir-504, mmu-mir-466d, mmu-mir-449b, hsa-mir-374b, hsa-mir-301b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-879, mmu-mir-582, rno-mir-181d, rno-mir-182, rno-mir-301b, rno-mir-463, rno-mir-673, rno-mir-652, mmu-mir-466l, mmu-mir-669k, mmu-mir-466i, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-1193, mmu-mir-767, rno-mir-362, rno-mir-504, rno-mir-582, rno-mir-615, mmu-mir-3080, mmu-mir-466m, mmu-mir-466o, mmu-mir-466c-2, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466p, mmu-mir-466n, mmu-mir-344e, mmu-mir-344b, mmu-mir-344c, mmu-mir-344g, mmu-mir-344f, mmu-mir-374c, mmu-mir-466b-8, hsa-mir-466, hsa-mir-1193, rno-mir-449c, rno-mir-344b-2, rno-mir-466d, rno-mir-344a-2, rno-mir-1193, rno-mir-344b-1, hsa-mir-374c, hsa-mir-499b, mmu-mir-466q, mmu-mir-344h-1, mmu-mir-344h-2, mmu-mir-344i, rno-mir-344i, rno-mir-344g, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-692-3, rno-let-7g, rno-mir-15a, rno-mir-762, mmu-mir-466c-3, rno-mir-29c-2, rno-mir-29b-3, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Our previous studies demonstrated that an irreversible let-7 downregulation is a necessary step for MCS to display its full carcinogenic effect [98, 104]. [score:4]
Conversely, the let-7 irreversible downregulation is a hallmark of malignant lung cancer, including adenocarcinoma in mice [6, 102] and nonsmall cell lung cancer (NSCLC) in humans [103]. [score:4]
An important difference between benign and malignant lung lesions induced by MCS is the maintenance of let-7 homeostasis. [score:1]
The data obtained in the present study provide evidence that the let-7 family, whose a-f isoforms were spotted on the microarray used, was not altered in either microadenoma or adenoma. [score:1]
[1 to 20 of 4 sentences]
37
[+] score: 10
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-21, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-33a, hsa-mir-98, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-141, mmu-mir-194-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-203a, hsa-mir-211, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-200b, mmu-mir-300, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-21a, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-343, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, mmu-mir-200c, mmu-mir-218-1, mmu-mir-218-2, mmu-mir-33, mmu-mir-211, mmu-mir-29b-2, mmu-mir-135a-2, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-326, hsa-mir-135b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-21, rno-mir-26b, rno-mir-27b, rno-mir-27a, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-33, rno-mir-98, rno-mir-126a, rno-mir-133a, rno-mir-135a, rno-mir-141, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-203a, rno-mir-211, rno-mir-218a-2, rno-mir-218a-1, rno-mir-300, hsa-mir-429, mmu-mir-429, rno-mir-429, hsa-mir-485, hsa-mir-511, hsa-mir-532, mmu-mir-532, rno-mir-133b, mmu-mir-485, rno-mir-485, hsa-mir-33b, mmu-mir-702, mmu-mir-343, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, hsa-mir-300, mmu-mir-511, rno-mir-466b-1, rno-mir-466b-2, rno-mir-532, rno-mir-511, mmu-mir-466b-4, mmu-mir-466b-5, mmu-mir-466b-6, mmu-mir-466b-7, mmu-mir-466b-8, hsa-mir-3120, rno-mir-203b, rno-mir-3557, rno-mir-218b, rno-mir-3569, rno-mir-133c, rno-mir-702, rno-mir-3120, hsa-mir-203b, mmu-mir-344i, rno-mir-344i, rno-mir-6316, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-3569, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, rno-mir-466b-3, rno-mir-466b-4, mmu-mir-203b
miRNA-target prediction showed that MRAK088388 and N4bp2 had the same MRE for miR-29b-3p, whereas MRAK081523 and Plxna4 had the same MRE for let-7. To identify the ceRNA interaction between MRAK088388 and N4bp2, as well as between MRAK081523 and Plxna4, we detected whether they are co-expressed in lung tissues by using qRT-PCR. [score:5]
Let-7 isoform let-7d expression significantly decreases and has a key regulatory function in IPF [46], but the function of let-7i has not been reported. [score:4]
By the same method, we found that MRAK081523 and Plxna4 had the same MREs for miR-218, miR-141, miR-98 and let-7. Plxna4 reportedly promotes tumour progression and tumour angiogenesis by enhancing VEGF and basic fibroblast growth factor signalling [44]. [score:1]
[1 to 20 of 3 sentences]
38
[+] score: 9
Experimentally, over -expression of let-7 can inhibit lung cancer cell growth in vitro. [score:5]
The reduction in the expression of let-7 in human lung cancers is correlated to increased death rates in patients [62]. [score:3]
This discovery shows that let-7 may have potential clinical value in treating lung cancers. [score:1]
[1 to 20 of 3 sentences]
39
[+] score: 9
Other miRNAs from this paper: cel-let-7, cel-lin-4, hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-29a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-29b-1, mmu-mir-101a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-132, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-199a-1, hsa-mir-199a-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-199a-2, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-128-1, hsa-mir-132, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-138-1, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-92a-2, rno-let-7d, rno-mir-7a-1, rno-mir-101b, mmu-mir-101b, hsa-mir-181b-2, mmu-mir-17, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-101-2, cel-lsy-6, mmu-mir-181b-2, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7a-2, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-29b-2, rno-mir-29a, rno-mir-29b-1, rno-mir-29c-1, rno-mir-92a-1, rno-mir-92a-2, rno-mir-101a, rno-mir-128-1, rno-mir-128-2, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-199a, rno-mir-181a-1, rno-mir-421, hsa-mir-181d, hsa-mir-92b, hsa-mir-421, mmu-mir-181d, mmu-mir-421, mmu-mir-92b, rno-mir-17-2, rno-mir-181d, rno-mir-92b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, mmu-mir-101c, mmu-let-7j, mmu-let-7k, rno-let-7g, rno-mir-29c-2, rno-mir-29b-3, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
We speculate that some of the developmentally regulated microRNAs we describe in this report play roles in the control of mammalian brain development, possibly by controlling developmental timing, by analogy to the roles of the lin-4 and let-7 microRNAs in C. elegans. [score:5]
In C. elegans, lin-4 and let-7 act in developmental timing, and the microRNA lsy-6 controls neuronal asymmetry [19]. [score:2]
A second heterochronic gene, let-7, encodes another small non-coding RNA that is conserved in flies and mammals [5]. [score:1]
Like the lin-4 and let-7 genes, other microRNAs encode 21-25-nucleotide RNAs derived from longer transcripts that are predicted to form stem-loop structures. [score:1]
[1 to 20 of 4 sentences]
40
[+] score: 9
Given that let-7 family members are normally ascribed a tumor suppressor function, the authors speculated that a high let-7a/low miR-206 ‘signature’ might designate colon tumors with a unique phenotype in terms of cancer progression, compartmentalization, or microenvironment [33]. [score:3]
This subset of cancers would differ from the more typical scenario involving increased miR-206 and reduced let-7a expression. [score:3]
Loss of let-7a, and of other let-7 family members, coincided with changes in other high-abundance miRNAs in the heterocyclic amine -induced rat colon tumors examined here [24]. [score:1]
Interestingly, the latter report noted, in contrast to the current study, that miR-206 levels were more typically attenuated whereas let-7a was increased in the cancers. [score:1]
In a recent investigation of carcinogen -induced rat colon tumors [24], we identified a loss of multiple let-7 family members coinciding with increased expression of miRNA -binding proteins Lin28A/Lin28B, as well as the stem-cell factors c-Myc, Sox2, Oct-3/4, and NANOG. [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 9
The top pathways that were identified to be affected by the altered miRNA expression profile in the Cd -treated HepG2 cells were focal adhesion and the MAPK signaling pathway, and members of the let-7 miRNA family are known to serve a tumor suppressor role [58, 59]. [score:5]
Fabbri et al. treated HepG2 human hepatoma cells with 10 µM Cd for 24 h and reported decreased expression of 12 miRNAs, including members of the let-7 family (let-7a, let-7b, let-7e, and let-7g) and miR-455-3p [58]. [score:3]
Boyerinas B. Park S. M. Hau A. Murmann A. E. Peter M. E. The role of let-7 in cell differentiation and cancerEndocr. [score:1]
[1 to 20 of 3 sentences]
42
[+] score: 9
On the one hand, previous studies have suggested that let-7 can suppress the expression of MOR [43], and our previous results suggest miR-365 can modulate morphine tolerance by targeting the beta-arrestin 2 protein [11]. [score:7]
Among ncRNAs, some studies have reported that miRNAs are involved in the development of morphine tolerance [7, 8], including the let-7 family, miR-23b [9], miR-133b, miR-339 [10], miR-365 [11] and miR-219-5p [12]. [score:2]
[1 to 20 of 2 sentences]
43
[+] score: 9
These comparisons revealed that the highly expressed miRNAs from our study were also reported in the study by Timo Brandenburger et al. [20]; they showed that miR-124, the let-7 family and miR-34b-3p belonged to the group of highly expressed miRNAs in the rat spinal cord. [score:5]
Ventral combined with dorsal root avulsion resulted in a sustained upregulation of 10 miRNAs, including miR-19b-3p, miR-20b-5p, miR-21-5p, miR-27a-3p, miR-29b-3p, miR-106b-3p, miR-142-3p, miR-322-5p, miR-352, and let-7a-5p (Figure  2E). [score:4]
[1 to 20 of 2 sentences]
44
[+] score: 8
Among them, miR-27a-3p, let-7a-5p, miR-10b-5p, and miR-23b-3p have been shown to function as regulators of spinal cord development and remo deling, and have been implicated in diseases of the spinal cord [20, 21]. [score:5]
Nine of the miRs (miR-200b-3p, miR-27a-3p, let-7a-5p, miR-21-5p, miR-10b-5p, miR-23b-3p, miR-221-3p, miR-100-5p, and miR-28-5p) were differently expressed at both 24 and 72 hours after reperfusion. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 8
Metformin treatment has been shown to inhibit c-myc expression by up -regulating let-7 family (tumor suppressor) [11]. [score:8]
[1 to 20 of 1 sentences]
46
[+] score: 7
By using in vivo administration of siRNA targeting 2 different hepatocyte-expressed genes in the mouse and hamster liver, they did not observe any effect on endogenous miRNAs that are known to be expressed in hepatocytes (miR122, miR16, let-7a) and concluded that gene silencing using siRNA can be achieved without alteration of cellular miRNA biogenesis and function [25]. [score:7]
[1 to 20 of 1 sentences]
47
[+] score: 7
All let-7 family members show anti-viral properties during flavivirus infection [34], and in human cell culture, let7-c targets IL-10 to reduce IL-10 expression levels [39]. [score:5]
Most have not been associated with virus infection; however three, miR-122, miR-324 and let-7, have been identified in studies of host responses to viruses [34– 36]. [score:1]
Let-7 family miRNAs have also been shown to have immunomodulatory function. [score:1]
[1 to 20 of 3 sentences]
48
[+] score: 7
Because the target genes of let-7 (MOR) and miR-23b (MOR1) interact with the target gene of miR-365 (β-arrestin 2), we cannot rule out that there may be a relationship between these miRNAs and miR-365. [score:5]
Previous studies have reported that multiple miRNA -based pathways, such as let-7 and miR-23b, contributed to morphine tolerance 10 27, and some of these show the same deregulation pattern of miR-365. [score:2]
[1 to 20 of 2 sentences]
49
[+] score: 7
Our previous study has reported that after sciatic nerve injury, the differentially expressed let-7 miRNAs regulate SC phenotype by directly targeting NGF and affect sciatic nerve regeneration 20. [score:7]
[1 to 20 of 1 sentences]
50
[+] score: 7
The let-7a and miR-9 miRNAs were also among those identified in the random control set, and we excluded them as their dysregulation might be related to a more general cell proliferation/differentiation mechanism relevant in several disease processes, but not specifically related to BOS. [score:4]
The following miRNAs, also present in the VTMs list of Fig 5, were found by RT-PCR to be dysregulated in mouse lung tissue: miR-21, miR-146, miR-20, miR-302, miR-19, miR-98, let-7a, miR-15a. [score:2]
The factors present in both lists were: let-7a, miR-34a, miR-21 and miR-9 family. [score:1]
[1 to 20 of 3 sentences]
51
[+] score: 7
Wang S Let-7/miR-98 regulate Fas and Fas -mediated apoptosisGenes Immun. [score:2]
Su J Chen P Johansson G Kuo ML Function and regulation of let-7 family microRNAsMicrorna. [score:2]
MiR-98 is one of the members of the let-7 miRNA family, which is first discovered to control the developmental timing of cell differentiation and proliferation in C. elegans 12, 13. [score:2]
Therefore, let-7/miR-98 miRNAs are considered as an oncomir family crucial in regulating cell cycle and apoptosis [15]. [score:1]
[1 to 20 of 4 sentences]
52
[+] score: 7
Both in silico analyses using a variety of prediction algorithms, as well a large body of experimental literature [35]– [42] indicated that Let-7 and miR1 target multiple components of the IGF signaling cascade, ranging from mRNA binding proteins that coordinate the translation of IGFs to members of the IGF family, their receptors and downstream signaling pathways. [score:5]
Our two presumptive IGF pathway interacting miRNAs, Let-7 and miR1 as well as our control, miR124, represent three members of a small family of five miRNAs that have been conserved throughout bilaterian evolution (from invertebrates to mammals) [47], and the functions of the Let7 family, in particular, exhibit strong evolutionary conservation [43]. [score:1]
J Cell Mol Med 43 Roush S Slack FJ 2008 The let-7 family of microRNAs. [score:1]
[1 to 20 of 3 sentences]
53
[+] score: 7
Among these let-7a, let-7g, miR-125b-2*, -130a, -192, -196a*, -23a, -26b, 30b, -30c, -30e*, -320b, -320d, -340, -381, -488, -652 and -92a were also reported to exhibit similar expression patterns between human [15] and rat stroke mo dels [14, 16]. [score:3]
Additionally when the patients were grouped based on the TOAST classification, as large artery (LA), cardioembolic (CE) and small vessel (SV), 57 miRNAs (let-7a, let-7d*, let-7g, let-7i, miR-126, -1261, -1299, -130a, -1321, -135b, -184, -187*, -18a*, -208a, -214, -20a, -22*, -26b, -26b*, -27a*, -30b, -30c, -30e*, -320b, -320d, -324-5p, -331-3p, -340, -342-3p,-361-5p, -363, -370, -381, -422a, -423-3p, -494, -501-5p, -502-3p, -505*, -525-5p, -549, -552, -553, -574-3p, -574-5p, -585, -602, -611, -617, -627, -629, -675, -7, -886-5p, -92a, -93* and -96) were identified to be significantly dysregulated among them. [score:2]
let-7d*, miR-125b-2*, -1261, -1299, -130a, -1321, -208a, -22*, -23a, -27a*, -320b, -320d, -30c, -340, -422a, -423-3p, -488, -502-5p, -549a, -574-3p, -574-5p, -617, -627, -886-5p, -92a and -93* were unique for acute stroke while let-7a, let-7g, miR-129-5p, -192-5p, -196a*, -26b, -30b, -30e*, -370, -381, -493*, -525-5p, -652, -920, -933 and -96 were unique for “recovered” stroke patients (Figure 3; highlighted in bold). [score:1]
Setting cycle threshold values (C [T]) of 32 as a cut-off, a final panel of 32 miRNAs (let-7a, let-7d*, let-7g, let-7i, miR-126, -130a, -187*, -18a*, -20a, -22*, -26b, -30b, -30c, -30e*, -320b, -320d, -324-5p, -331-3p, -340, -342-3p, -361-5p, -363, -422a, -423-3p, -501-5p, -502-3p, -505*, -574-3p, -675, -886-5p, -92a and -93*) that could significantly distinguish the stroke etiology was obtained. [score:1]
[1 to 20 of 4 sentences]
54
[+] score: 7
Interestingly, a recent study demonstrated that loss of let-7 up-regulates EZH2 in prostate cancer with the acquisition of cancer stem cell signatures [60], suggesting that let-7 functions to promote cell differentiation through repression of EZH2 in prostate cancer. [score:4]
For example, many target genes of miRNAs let-7, mir-1, and mir-145 were hypermethylated in cells cultured under AR-inducing conditions for 3 days compared to 1 day (Table S6), suggesting a promoting role of these microRNAs in secretory differentiation of prostatic epithelial cells. [score:2]
Our results indicate that let-7 may play a similar role in normal prostatic epithelial cells. [score:1]
[1 to 20 of 3 sentences]
55
[+] score: 6
Although it has been reported that brain-specific miR-124, miR-125b and let-7 are expressed in mouse and rat eye lenses [27– 30], no studies have involved the spatial and temporal expression profiles of miRNAs in lens development and cataractogenesis. [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
The let-7 family was the second miRNA family identified as a regulator of developmental timing and cell proliferation; however, it is becoming more apparent that they also mediate immune responses and adjust inflammation [41]. [score:3]
Guo et al. have reported that let-7b, a member of the let-7 family, has differential expression patterns in inflamed tissues compared with healthy controls [43]. [score:2]
Pobezinsky et al. discovered that the let-7 miRNA is pivotal for the terminal differentiation and cytokine effector function of natural killer T cells [42]. [score:1]
[1 to 20 of 3 sentences]
57
[+] score: 6
Other miRNAs from this paper: rno-let-7a-2
Shi Y Arsenic trioxide inhibits cell growth and motility via up-regulation of let-7a in breast cancer cellsCell Cycle 2017 47. [score:6]
[1 to 20 of 1 sentences]
58
[+] score: 6
A number of miRNAs are expressed at high intensities throughout the perinatal period, but are not regulated from E20 to P2 (listed with decreasing expression level: miR-298, -494, -292-5p, -503, -290, -320, let-7c, -327, -185, let-7b and let-7a). [score:6]
[1 to 20 of 1 sentences]
59
[+] score: 6
27, 28 Kallen et al. [29] reported that the increased expression of paternally imprinted H19 lncRNA may act as a sponge for let-7, thereby explaining the downregulation of this miRNA in non-small-cell lung cancer types. [score:6]
[1 to 20 of 1 sentences]
60
[+] score: 6
On the other hand, corresponding ethanol effects in the ventral striatum revolved around cell death processes with inhibition of RNAs including MAP3K2 and upregulation of RNAs like let-7 (Figure 5, left). [score:6]
[1 to 20 of 1 sentences]
61
[+] score: 6
Interestingly, in 2014, Fu et al. reported that let-7a, miR-9, and miR-129-5p each had two target sites in FOXP2, and three mutant luciferase reporter constructs with mutations in one or two target sites were made. [score:6]
[1 to 20 of 1 sentences]
62
[+] score: 5
As positive controls, differentiation miRNA let-7 showed lower expression while miR-17 showed higher expression in c-kit(+) progenitors (Figure 1E). [score:5]
[1 to 20 of 1 sentences]
63
[+] score: 5
It was found to be a putative target for let-7 family members, miR-26ab, miR-181 family, miR-150, miR-27b, miR-23ab, miR-425, miR-125a-5p, and miR-128ab. [score:3]
According to our in silico analysis, Ppar γ is likely regulated by microRNAs like let-7 family members, miR-30 family members, miR-27b, miR-23ab, miR-93, miR-25, miR-128ab, miR-320, and miR-135. [score:2]
[1 to 20 of 2 sentences]
64
[+] score: 5
In the PH-group, 49 miRNAs were significantly deregulated (e. g., rno-miR-26a/b, rno-miR-125b-5p and various members of the let-7 family), showing an expression change to at least ≤ 0.8 or ≥ 1.2 compared to normal healthy liver [6], while 45 miRNAs showed significant expression changes in liver samples of animals undergoing SL (Table 1). [score:5]
[1 to 20 of 1 sentences]
65
[+] score: 5
The expression of let-7a was non-region-specific. [score:3]
0124450.g004 Fig 4 (A) The expression of miR-200a, miR-200b, miR-200c, miR-141, miR-429, miR-664, miR-327 and let-7a was examined from the IS, Cap, Cor and Cau epididymis of 5 SD rats by qPCR and compared with microarray results. [score:2]
[1 to 20 of 2 sentences]
66
[+] score: 5
For example, Let-7 binds to 3′-UTR of MOR to repress its expression [12]. [score:2]
In a previous study, we demonstrated the deregulation of nine different miRNAs in rat spinal cord after chronic morphine injection, including let-7, miR-365 and miR-219-5p (miR-219) [4]. [score:2]
In addition to let-7 and miR-23b, other miRNAs involved in morphine tolerance include miR-124, miR-190, miR-103 and miR-93-5p [14– 17]. [score:1]
[1 to 20 of 3 sentences]
67
[+] score: 4
Aranha et al. [20] showed that miR-16, let-7a and miR-34a, whose expression patterns are conserved in mouse, rat and human neural differentiation, are involved in mammalian neuronal development. [score:4]
[1 to 20 of 1 sentences]
68
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-28, hsa-mir-29b-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-145a, mmu-mir-150, mmu-mir-10b, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-10a, hsa-mir-10b, hsa-mir-199a-2, hsa-mir-217, hsa-mir-218-1, hsa-mir-223, hsa-mir-200b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-150, hsa-mir-195, hsa-mir-206, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-22, mmu-mir-29c, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-331, mmu-mir-331, rno-mir-148b, mmu-mir-148b, rno-mir-135b, mmu-mir-135b, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-10a, mmu-mir-17, mmu-mir-28a, mmu-mir-200c, mmu-mir-218-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, mmu-mir-217, hsa-mir-29c, hsa-mir-200a, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-135b, hsa-mir-148b, hsa-mir-331, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-10a, rno-mir-10b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-22, rno-mir-28, rno-mir-29b-1, rno-mir-29c-1, rno-mir-124-3, rno-mir-124-1, rno-mir-124-2, rno-mir-133a, rno-mir-143, rno-mir-145, rno-mir-150, rno-mir-195, rno-mir-199a, rno-mir-200c, rno-mir-200a, rno-mir-200b, rno-mir-206, rno-mir-217, rno-mir-223, dre-mir-7b, dre-mir-10a, dre-mir-10b-1, dre-mir-217, dre-mir-223, hsa-mir-429, mmu-mir-429, rno-mir-429, mmu-mir-365-2, rno-mir-365, dre-mir-429a, hsa-mir-329-1, hsa-mir-329-2, hsa-mir-451a, mmu-mir-451a, rno-mir-451, dre-mir-451, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-10b-2, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-17a-1, dre-mir-17a-2, dre-mir-21-1, dre-mir-21-2, dre-mir-22a, dre-mir-22b, dre-mir-29b-1, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-133a-2, dre-mir-133a-1, dre-mir-133b, dre-mir-133c, dre-mir-143, dre-mir-145, dre-mir-150, dre-mir-200a, dre-mir-200b, dre-mir-200c, dre-mir-206-1, dre-mir-206-2, dre-mir-365-1, dre-mir-365-2, dre-mir-365-3, dre-let-7j, dre-mir-135b, rno-mir-1, rno-mir-133b, rno-mir-17-2, mmu-mir-1b, dre-mir-429b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-133c, mmu-mir-28c, mmu-mir-28b, hsa-mir-451b, mmu-mir-195b, mmu-mir-133c, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, rno-let-7g, rno-mir-29c-2, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
They demonstrated that there is a relationship between the expression profiles and the staged embryo temporal regulation of a large class of miRNAs, such as members of the let-7 family. [score:4]
[1 to 20 of 1 sentences]
69
[+] score: 4
We extracted 60 different human miRNAs that co-occur with this target gene from 79 PubMed abstracts, and some of them (e. g. hsa-let-7a, hsa-miR-30b, hsa-miR-183) are consistent with microarray -based results discussed by Shalgi et al. [44]. [score:3]
lin-4 and let-7 miRNAs are the apparent exceptions to the generic scheme [7]. [score:1]
[1 to 20 of 2 sentences]
70
[+] score: 4
For example, evidence indicate that let-7, miR-140 and miR-92a are crucial for skeletal development [4– 5]; and deficiency of these miRNAs suppress the proliferation as well as the differentiation of growth plate chondrocytes, leading to a dramatic growth defect [4– 5]. [score:4]
[1 to 20 of 1 sentences]
71
[+] score: 4
The graph shows the effect of let-7a miRNA overexpression on pRL-let7a positive control vector. [score:3]
G. pR-let7 is a luciferase reporter vector with two sites for let-7a miRNA localized at the 3'UTR. [score:1]
[1 to 20 of 2 sentences]
72
[+] score: 4
Let-7a was used as a control as it is one of the highly expressed miRNAs in rat brain which was observed to be unaltered after focal ischemia (Dharap et al., 2009). [score:3]
The sequences (5′–3′) of the amplified miRNA transcripts are AUU GGC UAA AGU UUA CCA CGA U(rno-miR-29c) and UGA GGU AGU AGG UUG UAU AGU U (rno-Let-7a). [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 4
Recent studies have partially verified this hypothesis; e. g., let-7 miRNA expression can be observed in ESC and progenitor cells, but is absent in breast cancer stem cells. [score:3]
The reintroduction of let-7 into these cells causes differentiation and reduction of proliferation and tumor-forming ability. [score:1]
[1 to 20 of 2 sentences]
74
[+] score: 4
Other miRNAs from this paper: rno-let-7a-2, rno-mir-21
Moreover, many studies focused on sevoflurane -induced NSC degeneration, Yi et al. 23 showed that sevoflurane inhibited embryonic stem cell self-renewal and subsequent differentiation by regulating the let-7a-Lin28 signaling pathway. [score:4]
[1 to 20 of 1 sentences]
75
[+] score: 4
Let-7 miRNA have been predicted or experimentally confirmed in a wide range of species including human to C. elegans. [score:1]
hsa-miR-mit-5 has three hits found, that is, hsa-let-7a, hsa-let-7f, and hsa-let-7g, whereas hsa-miR-mit-4 and hsa-miR-mit-6 do not have any similarity with human miRNA. [score:1]
The hsa-miR-mit-2 has three matches with let-7 human miRNA, that is, hsa-let-7i, hsa-let-7b, and hsa-let-7g. [score:1]
The miRNA let-7 family was well represented. [score:1]
[1 to 20 of 4 sentences]
76
[+] score: 4
Worringer KA Rand TA Hayashi Y Sami S Takahashi K Tanabe K The let-7/LIN-41 pathway regulates reprogramming to human induced pluripotent stem cells by controlling expression of prodifferentiation genesCell Stem Cell. [score:4]
[1 to 20 of 1 sentences]
77
[+] score: 3
A previous study demonstrates that signal transducers and activators of transcription 3 (STAT3)-coordinated Lin-28-let-7-HMGA2 and miR-200-ZEB1 circuits initiate and maintain oncostatin M -driven EMT 5. The interplay of these EMT activators, such as HMGA2 and ZEB1 6– 8, represses E-cadherin expression. [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
Qian P et al also observed that the p44/42 MAPK-matrix metalloproteinase (MMP)-2/MMP-9 pathway can be used to enhance mammary carcinoma cell migration and invasion consequent to let-7 g depletion by increasing the expression of Gab2 and fibronectin1 (40). [score:3]
[1 to 20 of 1 sentences]
79
[+] score: 3
Guo WT Wang XW Yan YL Li YP Yin X Zhang Q Suppression of epithelial-mesenchymal transition and apoptotic pathways by miR-294/302 family synergistically blocks let-7 -induced silencing of self-renewal in embryonic stem cellsCell Death Differ. [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
Other miRNAs shown to regulate neuronal lineage commitment include members of the let-7 family and miR-125b (Leucht et al., 2008; Rybak et al., 2008). [score:2]
A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. [score:1]
[1 to 20 of 2 sentences]
81
[+] score: 3
Four of the 18 novel miRNAs were among the 50 most highly expressed miRNAs in the rat DRG (mmu-miR-486-5p, rnoH-miR-148a-3p, rnoH-let-7 g and rnoH-miR-676-3p, set in italics in Additional file 1: Table S1). [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
Members of the let-7 family of miRNAs (7a, 7c, 7f, and 7b) exhibit the highest expression levels throughout the life span. [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
2) Some miRNAs, including let-7 family (let-a, -b and -c), miR-16, miR-23b, miR-26, miR-31 and miR-375, were always highly expressed either before or after transdifferentiation (data not shown). [score:3]
[1 to 20 of 1 sentences]
84
[+] score: 3
However, the differences were subtle (fold-change less than 2) and only data for one miRNA (let-7a) were resistant to correction for multiple testing in one region (the hypothalamus). [score:1]
The selected miRNAs were rno-let-7a (part # 4373169), rno-miR-132 (part # 4373143), rno-miR-206 (part # 4373092) and rno-miR-320 (part # 4395388). [score:1]
The within-region variability of miR-132 (sd = 0.38 and 0.37), miR-320 (sd = 0.38 and 0.44), miR-497 (sd = 0.47 and 0.27) and let-7a (sd = 0.40 and 0.55) did not differ from the regional average of the hippocampus (sd = 0.39) and the hypothalamus (sd = 0.43) respectively (P-values from 0.13 to 0.95). [score:1]
[1 to 20 of 3 sentences]
85
[+] score: 2
Li S Let-7 microRNAs regenerate peripheral nerve regeneration by targeting nerve growth factorMol. [score:2]
[1 to 20 of 1 sentences]
86
[+] score: 2
Mir-98 is a member of the let-7 family, highly conserved across species in sequence and function and involved in the developmental timing of cell fates (reviewed [40]). [score:2]
[1 to 20 of 1 sentences]
87
[+] score: 2
In cancer cells, miR-326 [17], miR-34a [18], miR-206 [19], let-7 [35] have been shown to regulate the Notch signaling pathway. [score:2]
[1 to 20 of 1 sentences]
88
[+] score: 2
For the strain-specific miRNA expression, i. e. mir-34a and let-7a, we applied the miRNA taqman assay according to the manufacturer's gui delines, with 5 ng total RNA as input material. [score:2]
[1 to 20 of 1 sentences]
89
[+] score: 2
Several candidate therapeutic miRNAs have progressed into clinical and preclinical development; for example, antisense miR-122 is being developed as a treatment for hepatitis C virus, miR-208/499 for chronic heart failure, miR-195 for myocardial infarction and miR-34 and let-7 for cancer 10, 11. [score:2]
[1 to 20 of 1 sentences]
90
[+] score: 2
Numerous miRNAs have been identified in nearly all metazoan genomes examined since the discovery of the two first miRNAs, lin-4 and let-7 [12, 15, 16], and many studies have reported that miRNAs can influence hormone regulation. [score:2]
[1 to 20 of 1 sentences]
91
[+] score: 2
The miRNA family, let-7i and let-7 have been found to regulate the key features of breast cancer stem cells like a self-renewal, multipotent differentiation and tumorigenicity [29]. [score:2]
[1 to 20 of 1 sentences]
92
[+] score: 2
16.5 fmol (equivalent to 1*10 [9] copies) of synthetic miRNAs (Let-7a, Let-7b, Let-7c, Let-7d, Let-7e and Let-7f) were spiked into 50 ng of yeast RNA. [score:1]
Top and middle panels; Two members of the Let-7 family (Let-7a and Let-7e) were spiked into yeast total RNA and 10 ng of yeast total RNA containing 2*10 [8] copies of the selected miRNA (or 3.3 fmol) were reversed transcribed using the miQPCR. [score:1]
[1 to 20 of 2 sentences]
93
[+] score: 1
The first two miRNAs, lin-4 and let-7, were discovered in the Caenorhabditis elegans [13], [14]. [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
We found four microRNAs (LET-7, MIR-100, MIR-125, and MIR-126) that could detect teratomas and had previously been associated with oncogenic transformations (Gu et al., 2015, Wu et al., 2015). [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
Circulating let-7 levels in plasma and extracellular vesicles correlate with hepatic fibrosis progression in chronic hepatitis c. Hepatology 64, 732– 745. [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
In the 3′UTR sequences of the collagen-1 and collagen-4 mRNA, potential binding sites for the members of the let-7 family were detected. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
Kallen AN The imprinted h19 lncrna antagonizes let-7 micrornasMol. [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
Let-7a gene knockdown protects against cerebral ischemia/reperfusion injury. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
For example, the miR-125 and let-7 microRNAs are dramatically induced at puparium formation, in tight temporal synchrony with the 20E primary-response E74A mRNA, but do so in a manner that is independent of either 20E or EcR [24]. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
Recent research showed that hypothalamus let-7, miR-148a, miR-124, miR-107 and miR-370 were confirmed to be related to EA tolerance (Cui et al., 2017). [score:1]
[1 to 20 of 1 sentences]