sort by

169 publications mentioning hsa-mir-335 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-335. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 389
Furthermore, in line with its growth suppression activity in in vitro and in vivo assays, the miR-335 overexpressing cells showed upregulation of p21 [WAF1] (Fig. 3A,B and Supplementary Fig. 2A) and downregulation of CDK4 at protein (Fig. 3C,B and Supplementary Fig. 2B) and mRNA (Fig. 3D) levels. [score:10]
Of note, we found that miR-335 -transfected cells showed downregulation of 5-Aza-dC -induced p16 [INK4A] protein expression (Fig. 4A) suggesting that miR-335 may target p16 [INK4A] directly/indirectly and hence may account for escape of 5-Aza-dC -induced senescence. [score:9]
In the present study, we demonstrated that targeting of CARF by miR-335 resulted in upregulation of p21 [WAF1] and downregulation of cyclin-CDK activity (Fig. 3). [score:9]
miR-335 overexpressing cells showing growth suppression possessed higher level of expression of p21 [WAF1] (A,B) and low level of expression of CDK4 (C,B). [score:9]
Taken together, these data suggested that miR-335 was downregulated in cells that showed senescence upon 5-Aza-dC treatment, and that the overexpression of miR-335 suppressed such effect of 5-Aza-dC. [score:8]
miR-335 overexpression mediated growth suppression involves upregulation of p21 [WAF1]. [score:8]
In this report, miR-335 was shown to target pRB directly and specifically targeting a conserved sequence motif in its 3′ un-translated region 18. [score:8]
Downregulation of miR-335 in a variety of tumors and its tumor suppressor function has recently been emerged in several independent studies that have also demonstrated its multiple gene targets 40 41. [score:8]
Of note, CARF has been shown to act as transcriptional repressor of p21 [WAF1 ] 35 and hence targeting of CARF by miR-335 also accounted for upregulation of p21 [WAF1] (Fig. 3A,B) that occurred contrary to the decreased level of expression of p53. [score:8]
These data suggested that the decrease in p16 [INK4A] protein observed in miR-335 overexpressing cells (Fig. 4A,B) was not due to direct targeting of p16 [INK4A] mRNA by miR-335.p16 [INK4A] is an established inhibitor of cyclin D-CDK4 complex. [score:8]
Contrary to our expectation, we found that miR-335 was downregulated in treated cells (Fig. 1B) suggesting that its upregulation, as detected by miR-array analysis, may have role in escape from senescence. [score:7]
miR-335 overexpressing cells showed downregulation of E2F5 (F) that was abolished by simultaneous knockdown of p21 [WAF1] using p21 [WAF1] specific shRNA-1 (G). [score:7]
Another study also showed that during differentiation of mouse embryonic stem cells, miR-335 is upregulated and causes downregulation of Oct4-pRB axis and pRB dephosphorylation 19. [score:7]
miR-335 overexpressing cells showed downregulation of p16 [INK4A] and pRB. [score:6]
As shown in Fig. 6A–C and Supplementary Fig. 2G, these cells showed down-regulation of CARF at both protein as well as mRNA levels implying that miR-335 targets CARF, and may account for increased level of HDM2 and decreased level of p53 (Fig. 5A,D, respectively). [score:6]
Overexpression of CARF compromised miR-335 induced downregulation of p21 [WAF1] (D). [score:6]
These data suggested that the decrease in p16 [INK4A] protein observed in miR-335 overexpressing cells (Fig. 4A,B) was not due to direct targeting of p16 [INK4A] mRNA by miR-335. [score:6]
Hence CARF -targeting by miR-335 also accounted for downregulation of p16 [INK4A] protein (Fig. 4A,B) in spite of the fact that p16 [INK4A] mRNA was increased in miR-335 and 5-Aza-dC treated cells (Fig. 4C). [score:6]
In view of the literature that miR-335 is silenced by hypermethylation in cancer cells 25 28, we first examined if induction of senescence by 5-Aza-dC involved upregulation of miR-335 expression. [score:6]
miR-335 overexpression caused growth suppression per se, and resistance to 5-Aza-dC induced senescence (E). [score:5]
These results were also supported by qPCR analysis (Fig. 5F) suggesting that miR-335 may target an upstream inhibitor of HDM2, leading to its increased levels that in turn may contribute to decreased level of p53 in miR-335 transfected cells. [score:5]
Scale bars represent 50 μm in A and 20 μm in B. (A) (B) and qPCR (C) analyses for p53 showed decreased level of expression in miR-335 overexpressing cells. [score:5]
How to cite this article: Yu, Y. et al. Loss-of-function screening to identify miRNAs involved in senescence: Tumor suppressor activity of miRNA-335 and its new target CARF. [score:5]
miR-335 overexpression caused growth suppression of cancer cells in vitro and in vivo. [score:5]
Expression analysis of miR-335 in human normal and cancer cells showed its higher level of expression in normal cells (F). [score:5]
Taken together, CARF emerged as a new strong target of miR-335 and warrant further studies for its potential as an important noncoding tumor suppressor in cancer therapeutics. [score:5]
qPCR analysis also revealed decrease in pRB transcript in miR-335 overexpressing cells (Fig. 4F) endorsing that miR-335 targets pRB. [score:5]
miR-335 overexpressing cells showed compromised expression of p53. [score:5]
mRNA expression revealed increased level of p21 [WAF1] and decreased level of CDK4 in miR-335 overexpressing cells (D). [score:5]
miR-335 overexpressing cells showed decrease in CARF expression. [score:5]
We demonstrated that CARF is a new target of miR-335 that mediates its tumor suppressor function (Fig. 7F). [score:5]
Simultaneous knockdown of p21 [WAF1] by shRNA abolished miR-335 -induced decrease in E2F5 (Fig. 3G) resulting in recovery, at least in part, from growth suppression caused by miR-335 (Fig. 3H). [score:4]
In agreement with our findings on identification of miR-335 in retrovirus -induced arbitrary manipulation of genome and cell based functional screening of miRs involved in escape from 5-Aza-dC induced senescence, Gao et al. 13 and Dohi et al. 28 have also reported that miR-335 expression was increased after 5-Aza-dC treatment, endorsing its regulation by methylation. [score:4]
Cells undergoing 5-Aza-dC -induced senescence showed down-regulation of miR-335 (B). [score:4]
Further to confirm, we determined the expression of p16 [INK4A] in control and miRNA -transfected cells by qPCR using three sets of primers and, surprisingly, found increase in p16 [INK4A] transcript not only in 5Aza-dC -treated controls, but also miR-335 overexpressing cells (Fig. 4C). [score:4]
3′UTR reporter assay for CARF, p53 and p21 in control and miR-335 overexpressing cells showed that miR-335 targets CARF (A). [score:4]
We found several miRNAs (miR-101, miR-137, miR-145, miR-335, miR-384, miR-451, miR-545 and miR-558) upregulated in virus-transduced cells that showed resistance to 5-Aza-dC -induced senescence (Fig. 1 and Supplementary Fig. 1A,B). [score:4]
Nevertheless, consistent with its above described growth suppression function, miR-335 expression was ~2–4 fold higher in normal fibroblasts as compared to a variety of cancer cells (Fig. 2F). [score:4]
Of note, CARF silencing by shRNA has earlier been shown to cause tumor suppression in nude mice tumor formation assays 36, in line with tumor suppression obtained with miR-335 in the present study (Fig. 2E). [score:4]
We found that the tumor growth of miR-335 overexpressing cells was suppressed as compared to the control cells. [score:4]
with pRb and phospho-pRB specific antibodies also confirmed their downregulation in miR-335 transfected cells (Fig. 4E). [score:4]
Cell viability analysis also showed that miR-335 transfected cells were less responsive to 5-Aza-dC, particularly at doses higher than 20 μM (Fig. 1D) suggesting that prior upregulation of miR-335 was involved in the escape from 5-Aza-dC induced senescence/growth arrest. [score:4]
siRNA -mediated CARF knockdown, on the other hand, potentiated the effect of miR-335 on p21 [WAF1] expression (Fig. 7E). [score:4]
miR array analysis resulted in identification of miR-335 as one of the upregulated miR in cells that escaped 5-Aza-dC -induced senescence. [score:4]
Treatment of control or miR-335 -transfected cells with 5-Aza-dC and detection of senescent cells by senescence associated β-gal staining revealed that prior upregulation of miR-335 indeed compromised induction of senescence. [score:4]
Of note, target site search for miR-335 on CARF, p53 and p21 [WAF1] 3′UTR gene sequences predicted two sites in CARF (Supplementary Fig. 1D), and none in the p53 and p21 [WAF1] 3′UTR. [score:3]
This was consistent with the findings of Scarola et al. 18 who reported that p53 was not the target of miR-335. [score:3]
miR-335 targets CARF and compromises 5-Aza-dC induced senescence. [score:3]
As shown in Fig. 7C, miR-335 -transfected cells showed decrease in CARF and increase in p21 [WAF1]suggesting that miR-335 targets CARF and caused increase in p21 [WAF1] independent to that of p53. [score:3]
Pleotropic effects of miR-335 demonstrated in the present study (Fig. 7F) and others (as discussed above) may be due to, at least in part, its control on CARF expression that has been shown to impose a dose dependent and contrasting effect on proliferation and malignant transformation of cancer cells 33. [score:3]
In order to finally resolve whether miR-335 directly targets CARF, p53 and p21 [WAF1], we performed reporter assays using 3′UTR regions of these genes. [score:3]
miR-335 compromises 5-Aza-dC induced senescence by inducing growth suppression. [score:3]
In light of the information that miR-335 targets pRB and activates p53 18, we examined the level of p53 in control and miR-335 transfected cells. [score:3]
Schematic presentation of miR-335 targets as resolved in this study. [score:3]
As expected, increase in p21 [WAF1] was associated with decrease in E2F5 in miR-335 overexpressing cells (Fig. 3F). [score:3]
An expression plasmid encoding primary miR-335 was transfected into U2OS cells. [score:3]
In order to further validate, we reconstituted CARF in miR-335 transfected cells and found that an overexpression of CARF abolished the increase in p21 [WAF1] transfected cells (Fig. 7D). [score:3]
miR-335 targets CARF, not p53. [score:3]
On the other hand, prior increase in miR-335 (due to retroviral insertional mutagenesis) and targeting of CARF activated p21 [WAF−1] and resulting in growth arrest (Fig. 7B). [score:3]
Taken together with our findings, it emerged that miR-335 is an important miR that controls cell proliferation by balancing the activities of pRB and p53 tumor suppressor pathways. [score:3]
In view of our above findings, we examined CARF-p53-HDM2-p21 axis in miR-335 overexpressing cells. [score:3]
These data suggested miR-335 effects (such as, decrease in p16 [INK4A] protein, increase in HDM2 and p21 [WAF1]) and outcomes such as growth arrest are determined predominantly by CARF -targeting. [score:3]
Cloning of miR-335, expression plasmid. [score:3]
Accordingly, decrease in p16 [INK4A] in miR-335 overexpressing cells was expected to result in activated cyclin D-CDK4 complex resulting in increased level of phosphorylated pRB in these cells. [score:3]
miR-335 targets CARF and pRB (F). [score:3]
However, as shown in Fig. 3B, downstream effector of p53, p21 [WAF1], showed increase in miR-335 -overexpressing cells. [score:3]
Furthermore, as expected, the growth suppression induced by miR-335 per se (Fig. 2A,E) was associated with substantial resistance to induction of growth arrest/senescence by 5-Aza-dC (Fig. 3E). [score:3]
Senescent cells were collected and subjected to miR-335 expression analysis. [score:3]
The data suggested that miR-335 targets p53 and contributes to escape of cells from 5-Aza-dC -induced senescence. [score:3]
As shown in Fig. 7A, we found that CARF, but not p53 and p21 [WAF1], was the target of miR-335. [score:3]
These data suggested that miR-335 suppressed the growth of cells that may have contributed, at least in part, to escape of cells from 5-Aza-dC induced senescence, as hypothesized above. [score:3]
Stem loop sequence of miR-335 and RNU6B are described in Table 2. Cells were harvested using RIPA buffer (Thermo Scientific, Waltham, MA, USA) supplemented with a protease inhibitor cocktail (Roche). [score:3]
p21 [WAF1] promoter reporter assay in control and miR-335 transfected cells showed upregulation of p21 (B). [score:3]
These data supported our above findings, and excluded p53 and p21 [WAF1] to be a target of miR-335. [score:3]
Growth curve of control and miR-335 overexpressing cells showed slower growth of the latter (A). [score:3]
miR-335 induced suppression of cell growth was also confirmed by in vivo subcutaneous xenografts of control and miR-335 transfected A549 cells in nude mice (Fig. 2E). [score:3]
Such prior induction of miR-335 -induced growth arrest would inhibit the incorporation of 5-Aza-dC into the genome and account, at least in part, for escape of cells from 5-Aza-dC -induced senescence. [score:3]
These data suggested that p21 [WAF1] plays a key effector role in miR-335 -induced growth suppression signaling. [score:3]
miR-335 overexpressing cells, in subcutaneous xenografts in nude mice, showed low tumor forming capacity as compared to the control cells. [score:2]
Cells overexpressing miR-335 showed resistance to 5-Aza-dC -induced senescence as examined by senescence associated β-gal staining (C) as well as cell viability assays (D). [score:2]
siRNA -mediated knockdown of CARF strengthened the miR-335 induced increase in p21 [WAF1] (E). [score:2]
Retardation of cell growth in miR-335 transfected cells was abrogated by shRNA mediated knockdown of p21 [WAF1] (H). [score:2]
Effect of miR-335 on p16 [INK4A] and pRB, resulting in compromised 5-Aza-dC -induced senescenceWe next considered the second possibility that the miR-335 may target essential genes involved in 5-Aza-dC induced growth arrest. [score:2]
In order to clarify the mechanism of the role of miR-335 in escape from 5-Aza-dC induced senescence, we considered two possibilities: (i) based on the fact that incorporation of 5-Aza-dC takes place during replication and DNA synthesis, we hypothesized that miR-335 might cause growth arrest of cells and thus do not allow 5-Aza-dC to be incorporated into the genome, and (ii) miR-335 may target genes that are essential for 5-Aza-dC induced growth arrest. [score:2]
We next considered the second possibility that the miR-335 may target essential genes involved in 5-Aza-dC induced growth arrest. [score:2]
Deletion and hypermethylation of microRNA-335 locus (7q32.2) has been reported in patient-derived metastatic breast and ovarian cancer cells. [score:1]
There was about 50% reduction in the number of SA-β-gal positive cells in miR-335 transfected cells (Fig. 1C). [score:1]
Cells (A549 and A549-miR335 transfected cells. ) [score:1]
However, stable transfections of miR-335 caused decrease in p53 (Fig. 5A–C and Supplementary Fig. 1E) that was attributed to increased level of HDM2 (Fig. 4D–F) (an established antagonist of p53) that is normally repressed by CARF 34. [score:1]
In the present study, we found that the cells induced to senescence (confirmed by SA-β-gal staining) in response to treatment with 5-Aza-dC for 5–7 days showed decrease in miR-335 (Fig. 1B). [score:1]
U2OS control and miR-335 transfected cells were transfected with 1 μg of luciferase constructs (pGL4-p53-3′UTR, pGL4-p21-3′UTR or pMIR-CARF-3′UTR), 100 ng of control vector oligonucleotide (pRL-TK or pMIR-REPORT [TM] β-gal control plasmid) using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). [score:1]
Effect of miR-335 on p16 [INK4A] and pRB, resulting in compromised 5-Aza-dC -induced senescence. [score:1]
In the present study, we aimed to characterize such functions and targets of miR-335. [score:1]
Identification of miR-335. [score:1]
In order to investigate the relevance of miR-335 in proliferation rate of cells, we performed its expression analysis in normal and cancer cells. [score:1]
Of note, two of these miRs (miR-145 and miR-335) have been reported to undergo hypermethylation -mediated silencing in a large variety of cancers 25 28. [score:1]
We examined the levels of pRB and phospho-pRB and found, contrary to the expected, decrease in phospho-pRB in miR-335 derivatives (As shown in Fig. 4D and Supplementary Fig. 2D). [score:1]
As shown in Fig. 5, we found decrease in protein as well as mRNA level of p53 in miR-335 transfected cells (Fig. 5A–C and Supplementary Fig. 2E). [score:1]
Identification of miR-335 in 5Aza-dC induced senescence bypass. [score:1]
Instead, it showed increase that was consequent to decrease in pRB in cells transiently transfected with miR-335. [score:1]
We also found increase in p53 in cells transiently transfected with miR-335 (Supplementary Fig. 1E). [score:1]
miR-335 transfected cells showed lower level of pRB transcript (F). [score:1]
We examined the HDM2 protein, another downstream effector and antagonist of p53, by immunostaining and, and found its elevated level in miR-335 -transfected cells (Fig. 5D,E and Supplementary Fig. 2F). [score:1]
[1 to 20 of 103 sentences]
2
[+] score: 348
CRKL protein expression was significantly suppressed by over -expressing miR-335 in SGC-7901 cells To identify the potential target genes of miR-335, we integrated bioinformatic algorithms using the publicly available database TargetScan (http://www. [score:11]
Cao et al. [5] observed that miR-335 expression was reduced in epithelial ovarian cancer tissue samples, especially in omental metastases, and low miR-335 levels emerged as an independent prognostic factor for poor overall and relapse-free survival; Wang et al. [32] also identified miR-335 as a tumor suppressor by targeting the ROCK1 gene and inhibiting osteosarcoma cell migration and invasion. [score:9]
These study thus clearly suggest that miR-335 may directly regulate CRKL expression by inducing mRNA degradation and translational suppression. [score:9]
We analyzed the correlation between methylation status and miR-335 expression in GC tissues and showed that downregulated expression of miR-335 was significantly correlated with CpG island DNA hypermethylation in the promoter region. [score:8]
Furthermore, we confirmed that miR-335 expression in GC cells was upregulated by the DNA methylation inhibitor 5-aza. [score:8]
Disease-free survival of patients with low miR-335 expression (n = 115) was significantly lower than that of patients with high miR-335 expression (n = 116; log-rank test; P = 0.013). [score:7]
We divided the 231 patients with GC into high-miR-335 -expression (n = 116) and low-miR-335 -expression groups (n = 115), according to miR-335 expression levels above or below the median value, respectively. [score:7]
Overall, these results indicated that CRKL was directly targeted by miR-335, and that CRKL expression in GC was negatively regulated by miR-335. [score:7]
Collectively, down-regulation of miR-335 may thus contribute to gastric carcinogenesis, at least partly via up-regulation of CRKL. [score:7]
Disease-free survival of patients with hypermethylation of miR-335 (n = 127) was significantly lower than that of patients with hypomethylation of miR-335 (n = 104; log-rank test; P = 0.035) To determine if miR-335 expression was associated with GC, we compared miR-335 expression levels in a large cohort of 231 primary GC tissues with levels in pair-matched adjacent non-tumor tissues, using qRT-PCR. [score:6]
In contrast, Xu et al. [34] reported that miR-335 was dramatically downregulated in GC cell lines, and low expression of miR-335 was associated with poor pT stage, poor pN stage, and invasion into lymphatic vessels. [score:6]
This study demonstrated for the first time that miR-335 was dramatically down-regulated in GC, and revealed that low expression of miR-335 was associated with tumor size, venous invasion, peritoneal dissemination, lymph node metastasis, poor pT stage, poor pN stage, poor TNM stage, invasion into lymphatic vessels, and shorter DFS. [score:6]
The results of the current study showed that miR-335 was dramatically downregulated in GC cell lines and tissue specimens, suggesting that low expression of miR-335 was significantly associated with GC. [score:6]
Furthermore, restoration of miR-335 down-regulated CRKL protein expression post-transcriptionally. [score:6]
Overexpression of miR-335 significantly reduced the activity of a luciferase reporter containing the 3′ untranslated region of V-crk avian sarcoma virus CT10 oncogene homolog-like (CRKL). [score:5]
MiR-335 expression was recently shown to be deregulated in several human cancers, and to act as a tumor suppressor in various tumor types [5– 7]. [score:5]
CRKL was predicted as a potential target of miR-335 by bioinformatics analysis (TargetScan, http://www. [score:5]
Over -expression of miR-335 in SGC-7901 cells (SGC-7901/miR-335) significantly decreased the luciferase signal of CRKL/pMIR/WT compared with the negative control (NigmiR), while mutation of the putative miR-335 -binding site abolished this suppressive effect. [score:5]
These results suggest that promoter hypermethylation might repress miR-335 expression, and that low expression might in turn contribute to metastasis, proliferation, and invasion in GC. [score:5]
SGC-7901 and MKN-45 cells were treated with 5-aza at a final concentration of 3 µmol/L, and miR-335 expression was analyzed after 72 h. 5-Aza treatment increased miR-335 expression in SGC-7901 and MKN-45 cells, as confirmed by qRT-PCR (Fig.   4a). [score:5]
Numbers above the blot indicate normalized protein amounts relative to the negative control, as determined by densitometry Fig.  2Kaplan–Meier plots of disease-free survival in relation to miR-335 expression and methylation levels. [score:5]
Restoration of miR-335 expression in GC cells promoted cell apoptosis, inhibited tumor cell migration, invasion, and proliferation, and arrested the cell cycle at G0/G1 phase. [score:5]
a Kaplan–Meier disease-free survival curves in relation to miR-335 expression levels. [score:5]
Overexpression of miR-335 significantly reduced the activity of a luciferase reporter containing the 3′UTR sequence of CRKL, while mutation of the seed region sites in the 3′UTR abolished the regulatory effect of miR-335. [score:5]
In the present study, we investigated the role of miR-335 methylation and expression in GC cell lines and tumor tissues, the clinicopathological and prognostic values of miR-335 methylation and expression in patients with GC, and the functional impact of ectopic miR-335 expression on GC cell invasion, cell cycle, apoptosis, and proliferation. [score:5]
Relative expression of miR-335 in SGC-7901 cells transfected with miR-335 inhibitor was significantly lower than in NC cells. [score:5]
We determined if miR-335 expression was silenced by DNA methylation by examining the reactivation of miR-335 expression in GC and NC cells following treatment with the demethylating agent 5-aza. [score:5]
Clinicopathological analysis also found that miR-335 expression was negatively correlated with tumor size, venous invasion, peritoneal dissemination, lymph node metastasis, poor pT stage, poor pN stage, poor TNM stage, and invasion into lymphatic vessels, while low expression of miR-335 was associated with shorter DFS in GC patients. [score:5]
Overexpression of miR-335 dramatically suppressed endogenous CRKL at the protein level compared with NC, as demonstrated by western blot and qRT-PCR (Fig.   3c–f). [score:4]
MiR-335 expression levels in four GC cell lines were significantly down-regulated compared with levels in normal gastric mucosal epithelial cells (GES-1) (P < 0.01). [score:4]
Downregulation of miR-335 by DNA methylation in GC cell lines and tissues. [score:4]
Downregulation of miR-335 in human GC cell lines. [score:4]
However, the mechanisms responsible for the downregulation of miR-335 are unclear, and may involve various factors, including genetic and epigenetic modifications. [score:4]
We further explored the mechanisms whereby miR-335 regulates tumor invasion, metastasis, proliferation, cell cycle, and apoptosis in GC by identifying miR-335 targets in GC carcinogenesis and progression. [score:4]
We searched for direct target genes by bioinformatics miRNA–mRNA 3′UTR matching, and found that CRKL included a putative miR-335 -binding site within its 3′UTR. [score:4]
The wild-type 3′UTR reporter construct was associated with significantly lower luciferase activity in cells expressing miR-335 compared with those expressing NC miRNA. [score:4]
Low miR-335 expression was significantly associated with tumor size (P = 0.030), venous invasion (P = 0.027), peritoneal dissemination (P = 0.027), lymph node metastasis (P = 0.033), poor pT stage (P = 0.040), poor pN stage (P = 0.038), poor TNM stage (P = 0.005), and invasion into lymphatic vessels (P = 0.041) (Table  1). [score:3]
Relative expression of miR-335 in SGC-7901 cells transfected with miR-335 mimic was significantly higher than in NC cells. [score:3]
Low levels of miR-335 expression and high levels of miR-335 methylation in GC tissues were associated with poor clinical features and prognosis. [score:3]
b Kaplan–Meier disease-free survival curves in relation to miR-335 methylation levels. [score:3]
The cell cycle in SGC-7901 cells was significantly arrested at G0/G1 phase when miR-335 expression was restored, as shown by flow cytometry (Fig.   8a, b). [score:3]
Fig.  1Expression of miR-335 and CRKL in GC cell lines and tissues. [score:3]
Over -expressing miR-335 had no significant effect on CRKL mRNA levels in SGC-7901 cells. [score:3]
CRKL levels in GC cells and role as target of miR-335. [score:3]
The MSP results were used to analyze correlations between miR-335 expression and clinicopathologic features in patients with GC. [score:3]
The apoptosis rates of NC and 5-aza -treated cells were 9.61 and 16.11%, indicating that restoration of miR-335 expression significantly increased apoptosis of GC cells (P < 0.01). [score:3]
Hypermethylation of the miR-335 gene promoter region was associated with tumor size (P = 0.004), miR-335 expression level (P < 0.001), and invasion into lymphatic vessels (P = 0.001) (Table  2). [score:3]
Among a total of 255 genes that were potentially targeted by miR-335 (Fig.   3a), CRKL may contribute to the metastasis, invasion, and proliferation of GC. [score:3]
To validate the miRNA–target interactions, we evaluated CRKL expression in SGC-7901 cells transfected with either miR-335 mimic or NC. [score:3]
d qRT-PCR analysis of miR-335 in SGC-7901 cells transfected with miR-335 inhibitor or NC. [score:3]
Expression of miR-335 in four GC cell lines and 231 GC tissues was determined by real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR). [score:3]
f Effect of miR-335 on CRKL protein expression in SGC-7901 cells detected by western blot analysis. [score:3]
Briefly, SGC-7901 cells were seeded in six-well plates, cotransfected with miR-335 mimic or NC and lentiviral constructs containing the target gene with wild-type or mutated 3′UTR, using Lipofectamine 2000. [score:3]
To the best of our knowledge, this study also provides the first evidence for associations between hypermethylation of the miR-335 promoter region and its expression, and between hypermethylation status and shorter DFS, invasion into lymphatic vessels, and large tumor size, which could be predictive factors for tumor prognosis and biological behavior in GC tissues. [score:3]
However, the mechanisms responsible for the aberrant expression of miR-335 in gastric cancer (GC) remain unknown. [score:3]
We examined the expression levels of miR-335 in five human gastric cell lines (SGC-7901, MKN-45, BGC-823, AGS, and GES-1) by qRT-PCR. [score:3]
a Analysis of miR-335 expression levels in cell lines by qRT-PCR. [score:3]
Moreover, restoration of miR-335 suppressed GC cell proliferation, migration, and invasion, arrested the cell cycle, and increased GC cell apoptosis. [score:3]
Functional studies demonstrated that restoration of miR-335 reduced cell proliferation, migration, and invasion, arrested the cell cycle, and increased GC cell apoptosis, indicating a potentially suppressive role for miR-335 in GC. [score:3]
However, the detailed expression pattern and potential role of miR-335 in GC remains unclear. [score:3]
Tumor suppressor miRNAs, including miR-335, have been reported to be silenced by aberrant DNA hypermethylation. [score:3]
Our experimental results confirmed that CRKL was a target of miR-335 in GC cells. [score:3]
Correlations between methylation status, miR-335 expression levels, and clinicopathologic parameters were analyzed by χ [2] with Mann–Whitney U tests for two groups and Kruskal–Wallis tests for three or more groups. [score:3]
Effects of ectopic miR-335 expression on cell apoptosis, proliferation, migration, and invasion, and cell cycle in SGC-7901 cells. [score:3]
Fig.  3CRKL is a target of miR-335. [score:3]
High miR-335 expression was significantly associated with better DFS (P = 0.013) (Fig.   2a). [score:3]
These results indicated that patients with GC with low miR-335 expression, metastatic lymph nodes, invasion into lymphatic vessels, and large tumor size may have hypermethylation in the miR-335 gene promoter region. [score:3]
The migration and invasive capacities of SGC-7901 cells, assessed by Transwell and wound-healing assays, respectively, were significantly reduced following restoration of miR-335 expression (Figs.   6a, b, 7a, b). [score:2]
The effects of miR-335 on GC cell migration, invasion, and proliferation observed in this study may be partly due to its regulation of CRKL. [score:2]
MiR-335 is transcribed from the genomic region of chromosome 7q32.2 and has been shown to be aberrantly expressed in malignant tumors, and to play crucial roles in tumor initiation and progression [31]. [score:2]
MiR-335 was downregulated in GC cell lines (SGC-7901, MKN-45, BGC-823, and AGS) compared with normal gastric epithelial cells (GES-1) (MKN-45, 0.154 ± 0.016-fold, P < 0.01; SGC-7901, 0.138 ± 0.013-fold, P < 0.01; BGC-823, 0.432 ± 0.076-fold, P < 0.01; AGS, 0.749 ± 0.072-fold, P = 0.01) (Fig.   1a). [score:2]
MiR-335 thus functions as a tumor suppressor in GC. [score:2]
MiR-335 functions as a tumor suppressor and may be silenced by promoter hypermethylation. [score:2]
MiR-335 is involved in suppressing metastasis and invasion in various human cancers. [score:2]
To confirm if CRKL was regulated by miR-335 through direct binding to its 3′UTR, wild-type and mutant CRKL 3′UTRs were constructed and cloned downstream of the luciferase gene in a pGL3-control vector, followed by luciferase assay in SGC-7901 cells. [score:2]
MiR-335 levels were significantly downregulated in GC tissues compared with paired adjacent non-tumor tissues (P < 0.001; Fig.   1b). [score:2]
The cell cycle was significantly arrested in G0/G1 phase by up -regulating miR-335 in SGC-7901 cells. [score:2]
MiR-335 expression levels recovered by 2–3-fold after 5-aza treatment (Fig.   4a). [score:2]
a MiR-335 target-site residues in the CRKL 3′UTR are highly conserved among different species. [score:2]
b Expression levels of MiR-335 in paired GC and adjacent normal tissues. [score:2]
In this study, we focused on miR-335 silencing by methylation in GC cells. [score:1]
We also showed that miR-335 methylation status was associated with tumor size and invasion into lymphatic vessels in a large sample of patients with GC. [score:1]
Hypermethylation of the promoter region of miR-335 was relatively common in GC cell lines, and was also detected in 55% of 231 GC tissue specimens by MSP. [score:1]
DNA methylation status in the CpG islands upstream of miR-335 in GC cell lines and tissues was determined by methylation-specific PCR and bisulfite sequence-PCR. [score:1]
Furthermore, we detected CpG island methylation of miR-335 in GC cell lines by BSP analysis of multiple clones in the cell lines. [score:1]
Yan et al. [33] reported that GC patients with high levels of miR-335 had a high frequency of recurrence. [score:1]
c qRT-PCR analysis of miR-335 in SGC-7901 cells transfected with miR-335 -mimic or NC miRNA. [score:1]
b Direct interaction between miR-335 and CRKL was detected by dual-luciferase reporter assay. [score:1]
Bisulfite sequencing in all four GC cell lines confirmed marked methylation of the promoter region of miR-335 (Fig.   4d). [score:1]
Further studies are therefore needed to clarify the biological functions and mechanisms of miR-335 in GC. [score:1]
Further large-scale and long-term follow-up studies focusing on the methylation status of miR-335 in GC should be undertaken in the future. [score:1]
Hypermethylation of the promoter region may also play an important role in silencing miR-335 in GC. [score:1]
We also investigated the effect of restoration of miR-335 expression on GC cell cycle. [score:1]
Kaplan–Meier estimation indicated that hypomethylation of miR-335 was significantly associated with better DFS (P = 0.035) (Fig.   2b). [score:1]
We confirmed that the promoter of miR-335 lay within the range of the CpG islands. [score:1]
Relative expression levels of miR-335 in human GC tissues and correlation with clinicopathological characteristics. [score:1]
In contrast, there was no significant difference in relative luciferase activities of pGL3-CRKL-MUT reporters in SGC-7901 cells transfected with miR-335 or NC miRNA (Fig.   3b). [score:1]
Cancer-specific methylation was detected in the upstream CpG-rich regions of miR-335, which dramatically silenced its transcriptional activity in GC cell lines and tissues. [score:1]
e Effect of miR-335 on CRKL mRNA levels in SGC-7901 cells detected by qRT-PCR. [score:1]
The relationship between miR-335 expression levels and methylation status in gastric tissues was calculated using χ [2] tests (2 × 2 table, Pearson’s analysis). [score:1]
These data warrant further investigations of the miR-335/CRKL axis as a prospective therapeutic target in the treatment of GC. [score:1]
Quantification of miR-335 by qRT-PCR. [score:1]
The sequence of miR-335 was searched using the University of California Santa Cruz’s Genome Bioinformatics resource [18]. [score:1]
In the present study, we analyzed the methylation status of miR-335 in GC cell lines using BSP and MSP. [score:1]
[1 to 20 of 104 sentences]
3
[+] score: 296
To identify specific gene targets of miR-335 by which it might promote oncogenic behaviors, we searched diverse target prediction databases (TargetScan, Pictar) for theoretical target genes whose downregulation could mediate the observed effects of miR-335. [score:12]
These data indicate that miR-335 may inhibit the expression of Daam1 at posttranscriptional level by directly targeting the 3'-UTR of Daam1 mRNA. [score:8]
We found that miR-335 targeted a potential tumor suppressor Daam1 in astrocytoma cells, which promoted several malignant features such as growth and invasion, whereas miR-335 inhibition could potently induce growth arrest, apoptosis and invasion repression both in vitro and in vivo. [score:7]
MiR-335 inhibition suppresses tumor growth in vivo Based on the in vitro studies, we hypothesized that abolition of miR-335 expression might have anti-tumor effects in vivo. [score:7]
Alternatively, it would be reasonable that the downregulation of DAAM1 could simply cooperate with the concomitant attenuation of other miR-335 targets. [score:6]
Importantly, knockdown of miR-335 exhibited little sign of viability inhibition on normal astrocytes (Figure 2I), suggesting a specific anti-tumor effect of miR-335 inhibition. [score:6]
Consistent with the C6 cells, the expression of miR-335 was markedly upregulated in U87-MG astrocytoma cells (Figure 8A). [score:6]
In addition, the expression of DAAM1 was substantially downregulated after miR-335 transfection (Figure 8G left-panel). [score:6]
Interestingly, the expression of miR-335 was markedly upregulated in C6 cells (Figure 1B). [score:6]
Of particular interest, miR-335 was recently reported to suppress metastasis of human breast cancer via targeting of SO × 4 and tenascin C, however, without affecting its proliferation [17]. [score:5]
In this study, we found that miR-335 targeted a potential tumor suppressor Daam1, which promoted several oncogenic features such as growth and invasion in astrocytoma cells. [score:5]
Furthermore, miR-335 inhibition could effectively suppress growth and induce apoptosis of astrocytoma cells both in vitro and in vivo. [score:5]
Moreover, we also determined the miR-335 expression level in glioblastoma multiforme T98G cell line, and found that it was slightly upregulated compared to HEB (Additional file 2 Figure S7). [score:5]
Effective miR-335 inhibition strongly suppressed cell growth (Figure 2G, H), colony formation (Figure 2C down-panel, 2D) and cell invasion (Figure 2E down-panel, 2F). [score:5]
Similar to targeted therapies that tackle a gain-of-function in cancer, such as EGFR inhibitors, the introduction of the antagonist specific to oncomiRNA miR-335 interferes with the oncogenic properties of astrocytoma cells and induces therapeutic responses. [score:5]
To further discern the regulatory role of endogenous miR-335 in DAAM1 protein expression, we analyzed the protein level of DAAM1 in C6 cells and normal astrocytes in which miR-335 level had been detected by qRT-PCR (Figure 1B). [score:4]
Therefore, we propose that the downregulation of DAAM1 induced by miR-335 may play a predominant role in mediating the pro-invasion effect of miR-335 in astrocytoma cells. [score:4]
Daam1 is a direct target of miR-335. [score:4]
With regard to miR-335, it is normally expressed in a variety of human tissues and deregulated in several types of tumors[31- 34], suggesting complex biological roles of this miRNA during tumorigenesis. [score:4]
MiR-335 inhibition induces apoptosis and suppresses invasion in human U87-MG astrocytoma cells. [score:4]
MiR-335 inhibition suppresses tumor growth in vivo. [score:4]
Figure 9 MiR-335 inhibition induces apoptosis and suppresses invasion of human astrocytoma U87-MG cells. [score:4]
Interestingly, after introducing miR-335 into C6 cells and normal astrocytes, a dramatic downregulation of DAAM1 protein in a dose -dependent manner was concurrent with an unaltered Daam1 mRNA (Figure 4B, C, Additional file 2 Figure S3), indicating a posttranscriptional modulation of miR-335 on Daam1. [score:4]
Ectopic expression of miR-335 in C6 cells dramatically enhances cell viability, colony-forming ability and invasiveness. [score:3]
We found 8 expressed miRNAs (miR-593, miR-129-1, miR-335, miR-182, miR-96, miR-183, miR-29a, miR-29b-1) reside on 7q32, some of which have been investigated, either as oncogenes or tumor suppressor genes [13- 15]. [score:3]
The growth -inhibitory effect of antagomir-335 led us to further investigate whether miR-335 silencing may inhibit cell proliferation and/or induce apoptosis. [score:3]
Loss of function study also showed that inhibition of miR-335 in T98G cells had little effect on their growth (Additional file 2 Figure S8). [score:3]
As expected, we observed a sharp reduction of DAAM1 protein in miR-335 -overexpressed C6 cells (Figure 4G left-panel, 2H). [score:3]
These findings suggest an oncogenic role of miR-335 and shed new lights on the therapy of malignant astrocytomas by targeting miR-335. [score:3]
Based on the in vitro studies, we hypothesized that abolition of miR-335 expression might have anti-tumor effects in vivo. [score:3]
Notably, miR-335 overexpression failed to transform but strongly enhanced the oncogenic properties such as the invasiveness and viability of primary cultured normal astrocytes (Additional file 2 Figure S1). [score:3]
Effect of miR-335 overexpression on endogenous Daam1 mRNA level. [score:3]
All of the above findings seem to demonstrate that antagomir-335 is able to induce apoptosis and suppress invasion in both rat C6 and human U87-MG astrocytoma cells, which indicates the anti-tumor effects of miR-335 abrogation are evolutionarily conserved from rat to human in malignant astrocytoma. [score:3]
To determine the consequence of miR-335 inhibition in astrocytoma cells, we delivered an antagonist specific for miR-335 (antagomir-335) into C6 cells. [score:3]
Among these miRNAs, miR-335 expression between C6 astrocytoma cells and rat normal astrocytes was analyzed by qRT-PCR. [score:3]
All these results suggest that miR-335 may confer a survival advantage to astrocytoma cells and that it might be a novel potential therapeutic target for malignant astrocytoma therapy. [score:3]
Moreover, miR-335 overexpression could also result in marked increase of cell invasiveness (Figure 2E up-panel, 2F). [score:3]
Moreover, the reciprocal expression pattern between endogenous miR-335 and DAAM1 was further confirmed in HEB and U87-MG cells (Figure 8G right-panel). [score:3]
Therefore, we hypothesize that the observed increased expression of miR-335 may partially result from 7q32.2 regional amplification, and miR-335 may act as an early promoter and a biomarker during tumorigenesis of astrocytoma. [score:3]
We found 8 expressed miRNAs (miR-593, miR-129-1, miR-335, miR-182, miR-96, miR-183, miR-29a, miR-29b-1) resided on chromosome 7q32, a hot spot that frequently gained in astrocytoma(Figure 1A). [score:3]
Western blot analysis was used to monitor DAAM1 protein expression in rat astrocytes (B) and C6 cells (C) 72 h after transfection with miR-335 mimics or negative control mimics (NC) at the indicated concentrations. [score:3]
The potential binding sites of miR-335 within Daam1 3'-UTR were obtained by TargetScan and PicTar. [score:3]
Western blot was used to detect the expression of DAAM1 72 h after transfection with 50 nM siDaam1 or miR-335 mimics in C6 cells. [score:3]
Moreover, we further detected the effect of miR-335 on Rb1 expression in astrocytoma cells. [score:3]
Effect of miR-335 on Rb1 expression in C6 and U87-MG astrocytoma cells. [score:3]
Our data showed that the intronic miR-335, flanked by MEST imprinting gene in the 7q32.2 region, was highly expressed in astrocytoma cell lines and tissues. [score:3]
Furthermore, ectogenic expression of miR-335 significantly promoted viability of U87-MG cells in a time -dependent manner (Figure 8B). [score:3]
Furthermore, to determine whether inhibition of miR-335 may have therapeutic effects, C6 cells were injected into nude mice, and tumors thereby generated were treated with antagomir-335 or antagomir-NC for two weeks(Figure 7D). [score:3]
To determine whether Daam1 is a functional target of miR-335 in malignant astrocytoma cells, we investigated whether reduction of Daam1 expression could mimic the growth and invasion-promoting effects of miR-335. [score:3]
Thus, miR-335 might act as an evolutionarily conserved oncomiRNA in astrocytoma pathogenesis and represent a potential therapeutic target for this highly aggressive and, as yet, therapy-refractory tumor. [score:3]
Significantly, the anti-tumor effects also extended to human malignant astrocytoma, indicating the evolutionarily conserved function of miR-335 and a potential application of targeting miR-335 in the therapy of malignant astrocytoma. [score:3]
Effect of miR-335 overexpression on endogenous RASA1 and MAP2 protein levels. [score:3]
MiR-335 is highly expressed in malignant astrocytoma. [score:2]
Figure 1 MiR-335 is highly expressed in astrocytoma. [score:2]
To test whether our findings extend to human astrocytoma cells, we first compared miR-335 expression between human astrocytoma U87-MG cells and human normal astrocyte HEB cells. [score:2]
As Figure 5A shown, knockdown of Daam1 (siDaam1) in C6 cells for 48 h resulted in a major reduction in DAAM1 protein, the repression effect was also observed by miR-335 transfection. [score:2]
MiR-335 expression analysis in human astrocytes HEB and glioblastoma multiform T98G cells. [score:2]
MiR-335, which is transcribed from the genomic region chromosome 7q32.2, has been reported to act as a tumor initiation and metastasis suppressor of breast cancer[16, 17]. [score:2]
Mutation was introduced to the Daam1 3'-UTR sequence in the complementary site for the seed region of miR-335. [score:2]
Taken together, all these data suggest that Daam1 is potentially involved in miR-335-regulated growth and invasion. [score:2]
MiR-335 positively regulates viability and invasion of C6 cells in vitro To elucidate the potential role of miR-335 in astrocytoma pathogenesis, we first performed in vitro gain-of-function analyses by introducing miR-335 mimics into C6 cells. [score:2]
Knockdown of Daam1 mimics the oncogenic effects of miR-335 in C6 cells. [score:2]
Previously reports have shown that microRNA-335 (miR-335) resided on chromosome 7q32 is deregulated in many cancers; however, the biological function of miR-335 in astrocytoma has yet to be elucidated. [score:2]
Expression of mature miR-335 was determined by stem-loop primer SYBR Green quantitive real time-PCR (qRT-PCR) and normalized to U6. [score:2]
Furthermore, it is also demonstrated that miR-335 regulates Rb1 and controls cell proliferation in a p53 -dependent manner[18]. [score:2]
In line with these observations, our data showed that both miR-335 and knockdown of Daam1 (siDaam1) efficiently promoted invasion of C6 and U87-MG astrosytoma cells, and an alteration of cell morphology as well as a loss of actin stress fibers together with induction of actin -positive membrane ruffles were also observed, indicating that the actin rearrangement may contribute to the pro-invasive effect of miR-335 in astrocytoma cells. [score:2]
Accordingly, an enhanced invasiveness was further observed both in miR-335 and siDaam1 treated cells (Figure 5E). [score:1]
Cells were transfected with 50 nM miR-335 mimics for the indicated times. [score:1]
There are 8 miRNAs(miR-593, miR-129-1, miR-335, miR-182, miR-96, miR-183, miR-29a, miR-29b-1) resided on this genomic locus, some of which have been investigated, either as oncogenes or tumor suppressor genes [13- 15]. [score:1]
C6 cells were transfected with 50 nM miR-335 mimics for 72 h. Western blot was used to detect the protein levels of respective genes. [score:1]
Putative miR-335 binding sites in the 3'-UTR of respective genes. [score:1]
This finding is apparently in contradiction with the function of miR-335 as an invasion promoter in malignant astrocytomas. [score:1]
Cells treated with siDAAM1 or miR-335 adopted a stellate morphology and collapsed their actin stress fibers together with increased membrane ruffling. [score:1]
Heretofore, all the results authentically indicate an oncomiRNA character of miR-335 as promoting oncogenic phenotypes in astrocytoma. [score:1]
Ectogenic miR-335 dramatically enhanced cell viability in dose-and time -dependent manners (Figure 2A, B) and significantly promoted colony formation (Figure 2C up-panel, 2D). [score:1]
Intriguingly, genomic copy number analysis revealed statistically significant amplification of miR-335 locus in U87-MG cell line and II-III grade malignant astrocytoma tissues (Additional file 2 Figure S6). [score:1]
We also observed caspase 3/7 activity was markedly enhanced after 72 h antagomir-335 tranfection, confirming miR-335 abrogation could induce caspase -mediated apoptosis in human astrocytoma cells (Figure 9G). [score:1]
Effective Daam1 silencing could dramatically stimulate viability and colony formation of C6 cells, which were similar to that of miR-335 transfection (Figure 5B, C). [score:1]
In addition, a recent study has shown that miR-335 orchestrates cell proliferation, migration and differentiation in human mesenchymal stem cells[19]. [score:1]
These findings suggest that Daam1 repression may contribute to the miR-335 -induced oncogenic features. [score:1]
The miR-335 level is highly elevated in C6 astrocytoma cells and human malignant astrocytomas. [score:1]
Furthermore, caspase 3/7 activity was markedly enhanced in a dose -dependent manner after 72 h antagomir-335 tranfection, confirming miR-335 abrogation -induced apoptosis (Figure 3G). [score:1]
Of note, miR-335 abrogation displayed notable anti-tumor effects both in vitro and in vivo. [score:1]
To elucidate the potential role of miR-335 in astrocytoma pathogenesis, we first performed in vitro gain-of-function analyses by introducing miR-335 mimics into C6 cells. [score:1]
Therefore, it is likely that miR-335 has effects independent of DAAM1. [score:1]
MiR-335 positively regulates viability and invasion of C6 cells in vitro. [score:1]
We also observed that both miR-335 and siDAAM1 efficiently accelerated the invasiveness of U87-MG cells in vitro (Figure 8F). [score:1]
C6 cells were transfected with miR-335 mimics or negative control mimics (NC) for 72 h at the indicated concentrations. [score:1]
Then, a consistent reduction of luciferase activity of the reporter that contained wild-type 3'-UTR of Daam1 mRNA was observed in the condition of extra miR-335 (Figure 4D), while the luciferase activity of mutant reporter was almost unaffected. [score:1]
Conversely, delivery of antagonist specific for miR-335 (antagomir-335) to C6 cells results in growth arrest, cell apoptosis, invasion repression and marked regression of astrocytoma xenografts. [score:1]
Genomic copy number analysis reveals statistically significant amplification of miR-335 locus in U87-MG cell line and II-III grade malignant astrocytoma tissues. [score:1]
C6 cells were transfected with 50 nM miR-335 mimics (E up-panel) or 100 nM antagomir-335 (E down-panel) or their counterpart negative controls. [score:1]
Further investigation reveals that miR-335 targets disheveled -associated activator of morphogenesis 1(Daam1) at posttranscriptional level. [score:1]
Figure 2 Effects of miR-335 on viability and invasion in C6 astrocytoma cells. [score:1]
Moreover, silencing of endogenous Daam1 (siDaam1) could mimic the oncogenic effects of miR-335 and reverse the growth arrest, proapoptotic and invasion repression effects induced by antagomir-335. [score:1]
The predicted miR-335 binding sites were shown (Figure 4A, Additional file 2 Figure S2). [score:1]
Notably, the oncogenic effects of miR-335 and siDAAM1 together with anti-tumor effects of antagomir-335 are also confirmed in human astrocytoma U87-MG cells. [score:1]
To further confirm and extend this finding, we investigated the expression of miR-335 in a subset of human astrocytoma tissues. [score:1]
C6 cells were transfected with 50 nM siDaam1 or miR-335 mimics for the indicated times. [score:1]
We report that miR-335 acts as a tumor promoter in conferring tumorigenic features such as growth and invasion on malignant astrocytoma. [score:1]
All of the above findings together with those observed in C6 cells suggested that miR-335 might act as an oncomiRNA both in rat and human malignant astrocytoma pathgenesis. [score:1]
Importantly, the anti-tumor effects of miR-335 abrogation also extended to human astrocytoma cells. [score:1]
These results raise a possibility that miR-335 might be an oncomiRNA in malignant astrocytoma and might well have a role in malignant astrocytoma pathogenesis. [score:1]
Both miR-335 and siDAAM1 promote growth and invasion of human U87-MG astrocytoma cells. [score:1]
In addition, it is noteworthy that siDaam1 was able to mimic the oncogenic behaviors of miR-335; however, it could only counteract partially the anti-tumor effects of antagomir-335. [score:1]
In summary, our present study uncovered an oncogenic function of miR-335 resided on chromosome 7q32.2 that amplified frequently in astrocytoma, which may provide a novel insight to its molecular etiology. [score:1]
C6 cells were transfected with 50 nM miR-335 mimics for the indicated times. [score:1]
Surprisingly, transient transfection of C6 and U87-MG cells with miR-335 efficiently increased the Rb1 protein levels, as detected by Western blotting (Additional file 2 Figure S9). [score:1]
Moreover, cells transfected with miR-335 or siDAAM1 showed a loss of actin stress fibers, adopting more of a stellate morphology with an increase of actin-rich cell processes and membrane ruffles (Figure 8E). [score:1]
Figure 4. (A) Schematic representation of 3'-UTR of Daam1 mRNA with the putative miR-335 binding sequence. [score:1]
Thus, it is reasonable to assume that astrocytoma cell-specific factors bind and counteract miR-335 function in these cells. [score:1]
Effect of miR-335 abrogation on cell growth. [score:1]
Rat normal astrocytes were transfected with 50 nM miR-335 mimics for 48 h. Daam1 mRNA was detected by qRT-PCR. [score:1]
In our study, we showed that miR-335 strongly promoted growth of C6 and U87-MG astrocytoma cells. [score:1]
These findings suggest an oncogenic role of miR-335 in the molecular etiology of malignant astrocytomas and might provide new insights into the implication for future cancer therapy. [score:1]
Figure 8 Both siDAAM1 and miR-335 promote growth and invasion of human astrocytoma U87-MG cells. [score:1]
Consistently, we also observed a significant higher level of miR-335 in astrocytoma patient samples with respect to their paracancerous counterparts (Figure 1B). [score:1]
Cells transfected with siDaam1 or miR-335 adopted a stellate morphology and collapsed their actin stress fibers together with increased membrane ruffling. [score:1]
MiR-335 mimics, negative control (NC), antagomir-335, antagomir-NC and Daam1 silencing oligonucleotides (siDaam1) (RiboBio, China) were transfected using Lipofectamine RNAiMAX (Invitrogen) according to manufacturer suggested procedures. [score:1]
Cells were transfected with 50 nM miR-335 for 48 h. Rb1 protein was detected by Western blot. [score:1]
Figure 5 SiDaam1 mimics the oncogenic effects of miR-335 in C6 cells. [score:1]
[1 to 20 of 121 sentences]
4
[+] score: 118
The GARP 3′-UTR is directly targeted by miR-24 and −335Analysis of reporter luciferase activity in HEK293 T cells co -transfected with the GARP 3′-UTR, wild-type or miRNA site- deleted, and either miR-24 (Figure  4C) or miR-335 (Figure  4D), showed a direct and specific targeting of the GARP 3′-UTR by these miRNAs, leading to reduced luciferase expression. [score:9]
Nevertheless, this finding indicates that miR-335 can down-regulate FOXP3 expression, although not to the level of non-Treg cells, demonstrating that FOXP3 expression must be controlled by combined inputs from several pathways, including miR-335. [score:8]
Lentiviral expression of miR-335 in fresh Treg cells significantly reduces FOXP3 transcriptionTo study the effect of over -expression of miR-335 in Treg cells, specifically on FOXP3 expression, lenti-miR-335 was used to transduce Treg cells (Figure  5); transduced Treg cells were FACS-sorted based on GFP positivity. [score:7]
Together, these results demonstrate a specific role for miR-335 in the regulation of FOXP3 expression through direct binding to its target site. [score:7]
of miR-24 and −335 in Treg cells significantly reduces GARP expressionEfficient ex vivo transduction of Treg cells using lenti-miR-24 and lenti-miR-335 (Figure  5) showed that miR-24 and −335 expression significantly reduced GARP expression levels by 3.21- and 1.96-fold, respectively (Figure  6C). [score:7]
Analysis of reporter luciferase activity in HEK293 T cells co -transfected with the GARP 3′-UTR, wild-type or miRNA site- deleted, and either miR-24 (Figure  4C) or miR-335 (Figure  4D), showed a direct and specific targeting of the GARP 3′-UTR by these miRNAs, leading to reduced luciferase expression. [score:6]
Interestingly, using 3′-UTR cloning, site-directed mutagenesis and miRNA co-transfection experiments, we demonstrated that miR-335 negatively regulates FOXP3 expression in a direct and specific manner. [score:6]
MiR-24 (C) and miR-335 (D) specifically targets GARP 3′UTR and negatively regulate luciferase reporter expression. [score:6]
Efficient ex vivo transduction of Treg cells using lenti-miR-24 and lenti-miR-335 (Figure  5) showed that miR-24 and −335 expression significantly reduced GARP expression levels by 3.21- and 1.96-fold, respectively (Figure  6C). [score:5]
To study the effect of over -expression of miR-335 in Treg cells, specifically on FOXP3 expression, lenti-miR-335 was used to transduce Treg cells (Figure  5); transduced Treg cells were FACS-sorted based on GFP positivity. [score:5]
Clearly, the expression levels of miR-335 in transduced Treg cells were higher than the physiological level observed in non-Treg cells, but this resulted from our inability to adjust the levels of expression of the transgene. [score:5]
A 249-bp fragment of FOXP3 3′-UTR encompassing the miR-335 potential target site and a 300-bp fragment of CTLA-4 encompassing the miR-9 and miR-155 potential target sites were cloned downstream of the Renilla luciferase gene (Eco RI/Xho I sites) in the psiCHECK-1 plasmid (Promega, Mannheim, Germany) and designated as psiCHECK 3′-UTR WT. [score:5]
A 249-bp fragment of the 3′-UTR of FOXP3 containing the miR-335 target sequence was cloned into a psiCHECK-1 vector downstream of the Renilla luciferase gene (psiCHECK-UTRwt). [score:3]
FOXP3 is directly regulated by miR-335. [score:3]
These results demonstrate that FOXP3 expression is controlled by miR-335. [score:3]
Moreover, transducing lenti-miR-335 in natural Treg cells leads to the negative regulation of FOXP3 expression compared with lenti-miR-Ctrl transduced cells. [score:3]
Lentiviral expression of miR-335 in fresh Treg cells significantly reduces FOXP3 transcription. [score:3]
QuikChange site-directed mutagenesis were performed using the following primers (5′ to 3′): FOXP3 (miR-335 site deleted 3′UTR): GCCCCCCAGTGGGTGTCCCGTGCAG (forward) CTGCACGGGACACCCACTGGGGGGC (reverse) CTLA-4 (miR-9 site deleted 3′UTR): GGGAATGGCACAGCAGGAAAAGGG (forward) CCCTGCCTTTTCCTGCTGTGCCATTCCC (reverse) CTLA-4 (miR-155 site deleted 3′UTR), GGGATTAATATGGGGATGCTGATGTGGGTCAAGG (forward) CCTTGACCCACATCAGCATCCCCATATTAATCCC (reverse)GARP 3′UTR 2070-bp encompassing the miR-24 and −335 potential target sites were cloned downstream the Firefly luciferase gene (AsiSI/Xho1 sites) in the pEZX-MT01 plasmid (Labomics, Nivelles, Belgium) and designed as pEZX-MT01 3′-UTR WT. [score:3]
Similarly, we found miR-24 and miR-335 target sites in the GARP 3′-UTR. [score:3]
QuikChange site-directed mutagenesis were performed using the following primers (5′ to 3′): FOXP3 (miR-335 site deleted 3′UTR): GCCCCCCAGTGGGTGTCCCGTGCAG (forward) CTGCACGGGACACCCACTGGGGGGC (reverse) CTLA-4 (miR-9 site deleted 3′UTR): GGGAATGGCACAGCAGGAAAAGGG (forward) CCCTGCCTTTTCCTGCTGTGCCATTCCC (reverse) CTLA-4 (miR-155 site deleted 3′UTR), GGGATTAATATGGGGATGCTGATGTGGGTCAAGG (forward) CCTTGACCCACATCAGCATCCCCATATTAATCCC (reverse) GARP 3′UTR 2070-bp encompassing the miR-24 and −335 potential target sites were cloned downstream the Firefly luciferase gene (AsiSI/Xho1 sites) in the pEZX-MT01 plasmid (Labomics, Nivelles, Belgium) and designed as pEZX-MT01 3′-UTR WT. [score:3]
In parallel, in the same way we cloned this FOXP3 3′-UTR fragment with a deleted miR-335 target site (psiCHECK-UTR del). [score:3]
We could identify putative miRNA target sites in the FOXP3 and CTLA-4 3′-UTRs by both programs—miR-335 in the FOXP3 3′-UTR and both miR-9 and −155 in the CTLA-4 3′-UTR. [score:3]
MiR-9, miR-24, miR-155 and miR-335 detection by TaqManTaqMan miRNA assays (Applied Biosystems) used the stem loop method [64, 65] to detect the expression level of mature miR-9, miR-24 miR-155 and miR-335. [score:2]
TaqMan miRNA assays (Applied Biosystems) used the stem loop method [64, 65] to detect the expression level of mature miR-9, miR-24 miR-155 and miR-335. [score:2]
Relative miR-335 and GARP expression in CD8 [+]CD25 [+] Treg cells transduced by lenti-miR-335 compared with CD8 [+]CD25 [+] Treg cells transduced by lenti-miR-Ctrl. [score:2]
Relative miR-335 and FOXP3 expression in CD8 [+]CD25 [+] Treg cells transduced by lenti-miR-335 compared with CD8 [+]CD25 [+] Treg cells transduced by lenti-miR-Ctrl, as determined by relative qRT-PCR. [score:2]
PCR primers used for amplification of the FOXP3 and CTLA-4 3′-UTR were as follows (5′ to 3′): FOXP3 primers: GCGCCTCGAGTCACCTGTGTATCTCACGCATA (forward) GCGCGAATTCGAGCTCGGCTGCAGTTTATT (reverse) CTLA-4 primers: GCGCCTCGAGAGGAGCTCAGGACACTAATA (forward) GCGCGAATTCAATTGGGCCCATCGAACT (reverse) QuikChange site-directed mutagenesis (deletion) of miR-9, miR-24, miR-155 and miR-335 target sites in psiCHECK 3′-UTR WT was performed according to manufacturer's protocols (Stratagene, La Jolla, CA) and designated as psiCHECK-UTR del. [score:1]
PCR primers used for amplification of the FOXP3 and CTLA-4 3′-UTR were as follows (5′ to 3′): FOXP3 primers: GCGCCTCGAGTCACCTGTGTATCTCACGCATA (forward) GCGCGAATTCGAGCTCGGCTGCAGTTTATT (reverse) CTLA-4 primers: GCGCCTCGAGAGGAGCTCAGGACACTAATA (forward) GCGCGAATTCAATTGGGCCCATCGAACT (reverse) QuikChange site-directed mutagenesis (deletion) of miR-9, miR-24, miR-155 and miR-335 target sites in psiCHECK 3′-UTR WT was performed according to manufacturer's protocols (Stratagene, La Jolla, CA) and designated as psiCHECK-UTR del. [score:1]
Reporter plasmids (psiCHECK, psiCHECK 3′-UTR WT, psiCHECK 3′-UTR deleted, pEZX-MT01, pEZX-MT01 3′-UTR GARP WT, pEZX-MT01 GARP 3′-UTR deleted) (100 ng) were co -transfected in HEK293T and HeLa cells along with miR-9, miR-24, miR-155, and miR-335 -mimic/miR -negative control -mimic at a final concentration of 10 μM (mirVana miRNA mimic, Life Technologies, Gent, Belgium) and control firefly plasmid pGL3-CMV for the psiCHECK vectors only (100 ng) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's gui delines. [score:1]
MiR-9, miR-24, miR-155 and miR-335 detection by TaqMan Real-time PCR. [score:1]
[1 to 20 of 30 sentences]
5
[+] score: 101
Other miRNAs from this paper: hsa-mir-15b
In order to further verify that miR-335-5p and miR-15b-5p can inhibit TRIM29 expression, the expression level of TRIM29 was examined in 5-8F cells with miR-335-5p and/or miR-15b-5p down-regulation or overexpression. [score:12]
These results demonstrate that TRIM29 is a target for miR-335-5p and miR-15b-5p, and that TRIM29 over -expression is caused by downregulation of miR-335-5p and miR-15b-5p in NPC. [score:8]
In our previous microRNA-sequencing analysis, the expression of miR-335-5p and miR-15b-5p was found to be obviously down-regulated in NPC cell lines CNE2 and C666-1 compared with non-neoplastic NP69 cells (Supplementary Table 2), while TRIM29 was overexpressed in the two NPC cell lines. [score:7]
Upregulated TRIM29 is caused by downregulated miR-335-5p and miR-15b-5p in NPC. [score:7]
Among the deregulated microRNAs, miR-335-5p and miR-15b-5p expression was found to be significantly down-regulated in CNE2 and C666-1 compared with NP69. [score:6]
Western blot analysis reveals when miR-335-5p and/or miR-15b-5p expression is suppressed, TRIM29 protein is increased. [score:5]
D. Representative immunoblots of TRIM29 protein expression after treatment with miR-335-5p and miR-15b-5p mimics or inhibitors in 5-8F cells. [score:5]
These results reveal that reduced expression of miR-335-5p and miR-15b-5p result in over -expression of TRIM29 in NPC. [score:5]
As expected, TRIM29 is predicted as a target of miR-335-5p and miR-15b-5p in TargetScan and miRanda databases because the sequences of both miRNAs are complementary to the sequences (seed sequences) in the 3′UTR of TRIM29 (Figure 2B). [score:5]
Moreover, the bioinformatic method and luciferase reporter assay demonstrate that TRIM29 was a validated target of miR-335-5p and miR-15b-5p, and knockdown of endogenous miR-335-5p and miR-15b-5p increased protein expression of TRIM29 in NPC cells. [score:5]
miR-335-5p and miR-15b-5p regulates TRIM29 expression at the post-transcriptional level. [score:4]
B. Predicted miR-335-5p and miR-15b-5p target sequences in the 3′UTRs of TRIM29. [score:3]
MiR-335-5p and miR-15b-5p expression was significantly reduced in NPC than that in NP tissues (p < 0.001, independent Student's t-test). [score:3]
Figure 2 A. miR-335-5p and miR-15b-5p expression levels were validated in snap-frozen human NPC (n = 25) and non-cancerous nasopharynx tissues (n = 17) by using quantitative real-time PCR analysis. [score:3]
A. miR-335-5p and miR-15b-5p expression levels were validated in snap-frozen human NPC (n = 25) and non-cancerous nasopharynx tissues (n = 17) by using quantitative real-time PCR analysis. [score:3]
Oligonucleotides containing the wild-type (WT) or mutant (MT) puptative miR-335-5p or miR-15b-5p binding sites of the 3′-untranslated regions (3′-UTR) of the TRIM29 mRNA were ligated into the pMIR-REPORT vector (Ambion, Carlsbad, CA), respectively. [score:3]
These results imply that TRIM29 may be a target of miR-335-5p and miR-15b-5p. [score:3]
MiR-335-5p and miR-15b-5p mimics and inhibitors were synthesized by Ribo (Guangzhou, China), respectively. [score:3]
As shown in Figure 2C, miR-335-5p or miR-15b-5p overexpression markedly decreases the luciferase activity in 5-8F cells co -transfected with miR-335-5p or miR-15b-5p and reporter gene vector containing the wild-type 3′-UTR sequences of TRIM29 (pMIR-wt-TRIM29-3′-UTR), when compare with the negative control (NC) miRNA. [score:3]
C. Relative luciferase activity of wt or mutant reporter plasmid co -transfected into 5-8F cells with miR-335-5p or miR-15b-5p mimics together with the negative control, or with miR-335-5p or miR-15b-5p inhibitors with the negative control. [score:3]
Moreover, 5-8F cells co -transfected with a antagomiR-335-5p or antagomiR-15b-5p and wild type 3′-UTR (pMIR-wt-TRIM29-3′-UTR) have a significantly increased luciferase activity compared with the cells co -transfected with a negative control miRNA and wild type 3′-UTR (Figure 2C), indicating that the antagomiRs have inhibited functions of endogenous miR-335-5p and miR-15b-5p. [score:2]
We thus tested whether miR-335-5p and miR-15b-5p could target the 3′-UTR of TRIM29 with dual luciferase reporter assay. [score:2]
When co -transfected with mutated 3′-UTR sequence of TRIM29 (pMIR-mt-TRIM29-3′-UTR) and miR-335-5p or miR-15b-5p into 5-8F cells, luciferase activity was not changed in these cells compared with the cells transfected with control sequence, indicating that the two miRNAs can directly bind to the seed sequences of TRIM29 3′-UTR. [score:1]
[1 to 20 of 23 sentences]
6
[+] score: 93
Notably, MM patients overexpressing miR-335/ MEST also upregulated genes promoting cell proliferation, a finding apparently in contradiction with the function of miR-335 as an apoptosis permissive factor and cell cycle suppressor, as demonstrated in cortical neurosphere cultures [41]. [score:8]
The results, normalized for the expression of the housekeeping Z30 small nucleolar RNA, are reported in additional file 2. Specifically, we found appreciable levels of expression for miR-335, miR-342-3p, and miR-628, whereas mir-561 and mir-559 were moderately expressed. [score:7]
The expression levels of the six genes are shown in Fig. 1. Table 1 Selected HG-U133A probes with average fold-change higher than two in HMCLs HG-U133A probe Host gene Host gene intron Intron length (bp) Strand direction miRNA Location Fold-change 222156_x_at CCPG1 intron 5 4,903 - miR-628 15 q21 2.3 217838_s_at EVL intron 3 25,879 + miR-342 14q32 2.7 204235_s_at GULP1 intron 1 90,649 + miR-561 2q32 4.3 204237_at GULP1 4 215913_s_at GULP1 2.5 202016_at MEST intron 2 1,632 + miR-335 7q32 4.8 201839_s_at TACSTD1 intron 5 1,874 + miR-559 2p 9.7 211828_s_at TNIK intron 21 5,584 - miR-569 3q26 3 213107_at TNIK 2.4 213109_at TNIK 2.3 Figure 1 Host gene expression levels. [score:6]
The expression levels of the six genes are shown in Fig. 1. Table 1 Selected HG-U133A probes with average fold-change higher than two in HMCLs HG-U133A probe Host gene Host gene intron Intron length (bp) Strand direction miRNA Location Fold-change 222156_x_at CCPG1 intron 5 4,903 - miR-628 15 q21 2.3 217838_s_at EVL intron 3 25,879 + miR-342 14q32 2.7 204235_s_at GULP1 intron 1 90,649 + miR-561 2q32 4.3 204237_at GULP1 4 215913_s_at GULP1 2.5 202016_at MEST intron 2 1,632 + miR-335 7q32 4.8 201839_s_at TACSTD1 intron 5 1,874 + miR-559 2p 9.7 211828_s_at TNIK intron 21 5,584 - miR-569 3q26 3 213107_at TNIK 2.4 213109_at TNIK 2.3 Figure 1 Host gene expression levels. [score:6]
Notably, we found that the fraction of primary myeloma samples overexpressing miR-335/ MEST also showed upregulation of genes implicated in actin polymerization and microtubule -based processes. [score:6]
Specifically, our data showed that miR-335, miR-342-3p, and miR-561 were overexpressed in a fraction of the pathological samples with respect to normal plasma cells, without correlation to any of the known genetic alterations frequently found in MM; this finding may provide further evidence of the genetic complexity of this disease. [score:5]
For three miRNAs, miR-335, miR-342-3p, and miR-561, we demonstrated coordinated expression with their cognate protein-coding genes MEST, EVL, and GULP1; conversely, we did not find correlated expression of miR-628 and miR-559 and their host genes CCPG1 and TACSTD1. [score:5]
One can speculate that miR-342-3p and EVL deregulation may target plasma cell homing into the bone marrow and/or interactions with the bone marrow microenvironment, much the same as for miR-335. [score:4]
In addition, despite the fact that miR-335 deregulation in melanoma and ovarian carcinoma was reported to be concordant with CN gain [39], neither miR-335 nor miR-342-3p and miR-561 expression levels were significantly correlated with their corresponding locus CN in our panel of HMCLs tested by SNPs arrays. [score:4]
Transcriptional profile associated with miR-335, miR-342-3p, and miR-561 overexpression. [score:3]
The predicted putative miRNA targets and the transcriptional profiles associated with the primary tumors suggest that MEST/miR-335 and EVL/miR-342-3p may play a role in plasma cell homing and/or interactions with the bone marrow microenvironment. [score:3]
This approach led to the identification of three miRNAs (miR-335, miR-342-3p, and miR-561) that were differentially expressed, along with their corresponding host genes, in the dataset of HMCLs. [score:3]
Notably, although we tested only a limited number of samples, we found a significant correlation in expression with the corresponding host genes for miR-335, miR-342-3p, and miR-561 (R = 0.95 at p value = 5.03E-09, R = 0.7 at p value = 5E-03, and R = 0.78 at p value = 2E-04, respectively). [score:3]
Expression levels of miR-335, miR-342-3p, and miR-561 correlate with those of their corresponding host genes in HMCLs. [score:3]
Specifically, miR-335 was shown to suppress metastasis by altering cell morphology and decreasing cell motility, which would limit metastatic migration [40]. [score:3]
Interestingly, miR-335 and miR-342-3p were recently reported to be involved in human cancer; depleted expression of miR-335 was found to be associated with metastatic processes in human breast cancer. [score:3]
We evaluated the expression levels of the corresponding intronic miRNAs and identified a significant correlation between the expression levels of MEST, EVL, and GULP1 and those of the corresponding miRNAs miR-335, miR-342-3p, and miR-561, respectively. [score:3]
miR-335, miR-342-3p, and miR-561 are overexpressed in primary MM tumors. [score:3]
A regression analysis of Q-RT-PCR miRNA values and microarray expression levels of matching host genes, conducted with R packages/software, revealed a significant correlation with the corresponding host genes for miR-335, miR-342-3p, and miR-561 (R higher than 0.6 in all cases with a p value < 0.005; see Fig. 2), but not for miR-559 (R = 0.12 at p value = 0.60) or miR-628 (R = 0.32 at p value = 0.15). [score:3]
As described in additional file 3, the bioinformatic target prediction for miR-335, miR-342-3p, and miR-561 suggests that they might play an important role in proliferation, cell cycle control, cellular migration, and angiogenesis. [score:3]
In agreement with these data, bioinformatic tools predicted that a set of genes involved in actin cytoskeleton organization and biogenesis (DAAM1, ARPC5L, JAG1, MAP2, and RASA1) were putative miR-335 targets (additional file 6). [score:3]
miR-335, miR-342-3p, and miR-561 deregulations are not associated with genomic alterations. [score:2]
Specifically, we found the following pairs of host genes and intronic miRNAs: CCPG1 (cell cycle progression 1) and miR-628; GULP1 (engulfment adaptor PTB domain containing 1) and miR-561; MEST (mesoderm specific transcript homolog, mouse) and miR-335; EVL (Enah/Vasp-like) and miR-342-3p; TACSTD1 (tumor -associated calcium signal transducer 1) and miR-559; and TNIK (TRAF2 and NCK interacting kinase) and miR-569 (details in Table 1). [score:1]
Notably, miR-335, miR-342-3p, miR-561, and miR-559, but not miR-628, are sense oriented with respect to the corresponding host gene. [score:1]
As specified in Table 1, miR-335, miR-342-3p, miR-561, and miR-559 are all sense oriented, whereas miR-628 is in an antisense orientation with respect to its host gene. [score:1]
Therefore, one can speculate that miR-335 may be involved in MM in the physiological mechanisms reported to be altered in breast cancer, possibly influencing different processes such as plasma cell homing into the bone marrow and/or interactions with the bone marrow microenvironment. [score:1]
[1 to 20 of 26 sentences]
7
[+] score: 75
In addition, miR-335 is involved in inhibiting metastasis of NB [17], is transcriptionally repressed by N-myc, and has been shown to play a tumor suppressor role by directly targeting genes like TGF-β [18]. [score:8]
To investigate the role for miR-335 in non-neuronal cells, we down-regulated expression of this miRNA and measured expression of its predicted target genes and other genes that regulate cell differentiation. [score:7]
Downregulation of miR-335 in non-neuronal cells modulates expression levels of HAND1 and JAG1, known modulators of neuronal differentiation. [score:6]
A. Quantitative changes in miR-335, HAND1, and JAG1 expression in miR-335 inhibitor -treated SH-EP1 cells. [score:5]
Short-term (4 day) down-regulation of miR-335 in S-type SH-EP1 cells did not result in any obvious morphological changes. [score:4]
However, reduction in miR-335 altered expression of key regulators of neuronal differentiation, HAND1 and JAG1. [score:4]
Down-regulation of miR-335 also decreases levels of JAG1, a known ligand for Notch 1 (Figure 4A). [score:4]
Three miRNAs, miR-21, miR-221 and miR-335, show elevated expression in non-neuronal S cells and are barely detectable or very low levels in neuroblastic cells (Figure 2A, B, C). [score:3]
Furthermore, neuroblastic cells that do not express miR-335 have the highest levels of HAND1 and non-neuronal S-cells that have the highest levels of miR-335 show least amount of HAND1 (Figure 2C and Figure 4B), suggesting miR-335 may play a critical role in NB differentiation. [score:3]
Thus, reciprocal expression of miR-124 and miR-335 seems critical for NB differentiation. [score:3]
BrdU -induced S cell differentiation significantly increases expression of S-type-specific miRNAs - miR-21, miR-221 and miR-335 - by 13.0-, 20.0-, and 55.9-fold (P < 0.01), respectively (Figure 3A). [score:3]
miRNA inhibitors for miR-375, miR-335, and control oligos (100 nM) (Ambion, Austin, TX) were transiently transfected into BE(2)-C or SH-EP1 cells for 48 hrs using Lipofectamine 2000 (Invitrogen Corp. [score:3]
The majority of these miRNAs are highly expressed in the S-type cell containing mix and five out of top seven candidates that showed the highest fold change were selected for further analysis (miR-21, miR-31, miR-222, miR-221 and miR-335). [score:3]
Figure 4 MiR-335 regulates expression of HAND1 and JAG1- modulators of neuronal differentiation. [score:3]
HAND1 levels, a proposed target of miR-335 (miRNA. [score:3]
Previous reports accessing miRNAs in primary tumors showed that reduced levels of miR-335 expression are associated with favorable prognosis of patients [19, 20], suggesting its potential use as both a prognostic and therapeutic agent. [score:3]
org), increased upon suppression of miR-335 levels (Figure 4A). [score:3]
The expression of three miRNAs, miR-21, miR-221 and miR-335, are exclusive to non-tumorigenic NB cell phenotype. [score:3]
validation confirmed that increased levels of miR-21, miR-221 and miR-335 are associated with the non-neuronal phenotype, whereas increased levels of miR-124 and miR-375 are exclusive to neuroblastic cells. [score:1]
This finding suggests that miR-335 may also contribute to the non-tumorigenic properties of S-type cells. [score:1]
Evidence suggests miR-335 maintains the non-neuronal features possibly by blocking neuronal differentiation. [score:1]
Functional role for miR-335 in S-cell phenotype. [score:1]
[1 to 20 of 22 sentences]
8
[+] score: 67
The expression level of each miRNA in 0 <  N ≤ 2 group was defined as 1. Up-regulation of miR-34a-5p and miR-630 are closely related to a higher severity score of nuclear cataract, while down-regulation of miR-335-3p is associated with the increase of nuclear opacity (mean ± SD, n = 3). [score:9]
Ultimately, according to the miRNAs’ fold change and expression level, five up-regulated miRNAs (miR-630, miR-222-5p, miR-210-3p, miR-34a-5p and miR-34b-5p) and two down-regulated miRNAs (miR-335-3p and miR-15b-3p) were chosen for microarray validation by RT-PCR (Table  1). [score:9]
Up-regulation of miR-34a-5p and miR-630 and down-regulation of miR-335-3p are related with the progression of age-related nuclear cataract and the underlying mechanism awaits further functional research to reveal. [score:7]
b Quantitative real-time RT-PCR validation of five up-regulated and two down-regulated miRNAs (mean ± SD, n = 3) Table 1 Fold change of the seven selected miRNAs and their forward primer sequences used for RT-PCR miRNA Name Fold Change Forward Primer for RT-PCR miR-630 4.14 GCGAGTATTCTGTACCAGGGAAGGT miR-222-5p 3.84 CGCTCAGTAGCCAGTGTAGATCCT miR-210-3p 3.23 CTGTGCGTGTGACAGCGG miR-34a-5p 2.59 CTGGCAGTGTCTTAGCTGGTTGT miR-34b-5p 2.44 GCGTAGGCAGTGTCATTAGCTGATTG miR-335-3p 0.45 CGGCGTTTTTCATTATTGCTCCTGACC miR-15b-3p 0.33 CGGGCGAATCATTATTTGCTGCTCTA To identify the connections between the grading of nuclear opacity and expression levels of miRNAs, Pearson correlation coefficient was introduced (Fig.   3). [score:7]
As Fig.   4 showed that, after 24 h of H [2]O [2] treatment, the expression levels of miR-630 and miR-34a-5p were elevated while miR-335-3p was down-regulated. [score:6]
Fifty-four target genes of miR-335-3p were clustered in the process of response to stress Fig. 6 Network of the miRNAs and their target genes in the process of response to stress. [score:5]
Although the function of miR-335-3p in cataract formation is unclear, the results of our experiment, for the first time, offered evidence that down-regulation of miR-335-3p may be the cause or effect of age-related nuclear cataract. [score:4]
c Target selection of miR-335-3p. [score:3]
RT-PCR of the clinical samples showed that the expression levels of miR-34a-5p, miR-630 and miR-335-3p were closely related with the severity of nuclear opacity. [score:3]
For miR-34a-5p, miR-630 and miR-335-3p, close relations (R = 0.691, 0.617, − 0.594) between LOCSIII grading and their expression levels were found and they were statistically significant (P < 0.001). [score:3]
Some believed that miR-335-3p is an oncogene for its effect on induction of multidrug resistance [39] and cancer -associated fibroblasts [40], while others viewed miR-335-3p as a tumor suppressor [41, 42]. [score:3]
The selected miRNAs were further validated by clinical samples from age-related nuclear cataract patients, which suggest that miR-34a-5p, miR-630 and miR-335-3p might be potential regulators of cataract formation. [score:2]
Among them, miR-630 and miR-335-3p are first reported in the field of cataract research. [score:1]
Meanwhile, in miR-335-3p, higher grading correlated with lower levels of miR-335-3p (0 < N ≤ 2 as control, P < 0.05). [score:1]
Opinions about the role of miR-335-3p in tumor progression are controversial. [score:1]
Among the seven selected miRNAs, which were validated in HLE-B3 cells by RT-PCR, three of them were proven to be correlated with age-related nuclear cataract and they are miR-34a-5p, miR-630 and miR-335-3p. [score:1]
Specific probes of miR-34a-5p, miR-630 and miR-335-3p were used in FISH and the sequences are 5’-ACAACCAGCTAAGACACTGCCA-3′ for miR-34a-5p, 5’-ACCTTCCCTGGTACTGAATACT-3′ for miR-630 and 5’-GGTCAGGAGCAATAATGAAAAA-3′ for miR-335-3p. [score:1]
Validation of the levels of miR-34a-5p, miR-630 and miR-335-3p by FISH. [score:1]
[1 to 20 of 18 sentences]
9
[+] score: 46
Other miRNAs from this paper: hsa-mir-129-2, mmu-mir-129-2, mmu-mir-335
Instead, our study suggests one possible epigenetic modification mechanism for SOX4 expression in pancreatic cancer via repressed expression level of miR-129-2 and miR-335, which would otherwise target SOX4 transcript at its 3′ UTR for degradation [17], [50]. [score:7]
We clearly demonstrate that the level of miR-129-2 expression or of miR-335 is inversely correlated with SOX4 expression in most patients with pancreatic cancer in a statistically significant way. [score:5]
Expression of SOX4 in pancreatic cancers correlates with poor survival, and is strongly associated with co-repressed expression of microRNA-129-2 and microRNA-335. [score:5]
Intriguingly, re-introduction of miR-129-2 into PDAC cell lines had mild suppressive effect on the level of SOX4 mRNA (Fig. 5C), suggesting functional redundancy with other microRNAs such as miR-335. [score:3]
Moreover, the repressed expression of miR-335 in pancreatic carcinoma samples was positively correlated with the decreased level of miR-129-2 (Fig. 5B, right plot), indicating a concomitant repression of miR-129-2 and miR-335 in pancreatic cancers. [score:3]
Co-repressed miR-129-2 and miR-335 are associated with expression of SOX4, which correlates with shorter survival in patients with pancreatic cancer. [score:3]
Accordingly, we examined the expression levels of miR-129-2, miR-335, and SOX4 in twenty-three paired human pancreatic tumors and normal tissues. [score:3]
Right plot: the expression level of miR-335 in pancreatic carcinoma samples is positively correlated with the level of miR-129-2 in a linear regression way. [score:3]
Elevation of SOX4 expression associated with repressed miR-129-2 or miR-335 is reported in gastric-, endometrial-, and breast cancers [17]– [19]. [score:3]
It would be interesting to investigate whether collaborative interaction between suppressed miR-129-2 and suppressed miR-335 in pancreatic epithelial cells could achieve robust induction of SOX4 in initiating or maintaining PDAC tumorigenesis. [score:3]
Pearson correlation analysis further demonstrated that the relative expression level of SOX4 in pancreatic carcinomas (normalized with the value derived from non-tumor tissues) was inversely correlated with that of miR-129-2 and miR-335, respectively, in a statistically significant way (Pearson correlation coefficient R = −0.4991, P = 0.0154 for LogmiR-129-2 vs logSOX4; R = −0.724, P = 0.0005 for logmiR-335 vs logSOX4) (Fig. 5B, left and central plot). [score:3]
The SOX4 transcript is a target of both miR-129-2 and miR-335. [score:3]
The elevation of SOX4 has been reported to be a consequence of miR-129-2 repression in endometrial, gastric, and bladder cancer [17], [18], [51], [52], or as a consequence of miR-335 repression in metastatic breast cancer [50], suggesting the miR-129-2/SOX4 or miR-335/SOX4 regulatory axis as a general strategy for tumor formation or progression. [score:2]
[1 to 20 of 13 sentences]
10
[+] score: 45
Notably, we found that miR-335 suppression inhibited leucine -dependent increases in FOXO1 and SLC2A2 gene expression. [score:7]
Finally, following miR-335 suppression, SLC2A2 expression was reduced by 50% (P ≤0.01) in the presence and absence of leucine, but FOXO1 expression was unchanged (Figure  5E). [score:7]
Further, miR-335 upregulation combines with increased expression of interleukin-6 and tumor necrosis factor-α during inflammation of human visceral adipose tissue in obesity-related IR [48], and occurs in parallel with that of PPARγ after the induction of 3 T3-L1 adipocyte differentiation [41]. [score:6]
Moreover, leucine supplementation alters the expression of several small RNA species including miR-143, miR-335 and miR-92b*, which target main gene regulators of these effects. [score:6]
As expected, the expression of miRNA-143 was reduced 1.5-fold (P ≤0.05), while that of miRNA-92b* and miR-335 was upregulated 1.8- and 1.5-fold (P ≤0.05) at 2.5 mM of leucine, respectively (Figure  5B). [score:6]
Finally, differential expression of specific target genes measured after inhibition of miR-143 (C), miR-92b* (D) and miR-335 (E) using selective siRNAs. [score:5]
In particular, expression of miR-143, miR-17-92b and miR-335 are significantly altered in diet -induced obese mice [46], during 3 T3-L1 adipocyte differentiation [47], and in human adipose tissues inflammation [48]. [score:3]
We validated the expression of leucine -dependent microRNAs in HepG2 cells, including miR-143, miR-92b*, miR-335, miR-181d, miR-3185 and miR-4763 by real-time PCR (qPCR) (Table  1). [score:3]
The cDNA synthesis was carried out with 2 μg total RNA using a miScript II RT Kit (Qiagen, Hilden, Germany), and expression of the miR-143, miR-92b*, miR-335, miR-181d, miR-3185 and miR-4763 was assayed with a a miScript SYBR Green PCR kit (Qiagen, Hilden, Germany). [score:2]
[1 to 20 of 9 sentences]
11
[+] score: 35
This study describes how p19 affects the RNA world and shows that: i) miR-342, miR-206, miR-330, miR-138 and miR-99b are upregulated by p19 but not by p19W164A mutant; ii) anti-miR-206 can restore the G2 phase in the presence of p19; iii) p19 and p21Q61L regulate their own alternative splicing; iv) miR-206 and miR-138 are differentially regulated by p19 and p21 H-Ras and v) P19G12S Costello mutants show a clear upregulation of miR-374, miR-126, miR-342, miR-330, miR-335 and let-7. These results allow us to conclude that the H-Ras G12S mutation plays an important role in miRNA expression and open up a new line of study to understand the consequences of this mutation on Costello syndrome. [score:13]
These miRNAs included miR-342 and miR-330, which are already known to be upregulated by p19 overexpression (Fig.   1), miR-126 and miR-335, which significantly reduce the ability of CN34-LM1 and CN34-BoM1 cells to metastasize to the lung [23], miR-374, which is known to be associated with aggressive small cell lung cancer [26], and let-7, which targets Ras genes [27]. [score:8]
Those results showed that miR-330, miR-335 and miR-374 are statiscaly and significally overexpressed in those CS patients cells, and thus they are putative cadidates to be miRNAs overexpressed in CS patients (R. García-Cruz and K. Sol-Church, personnel communication). [score:5]
Thus, p21 was found to upregulate miR-374, miR-126, miR-342, miR-335 and let-7 but not miR-330, and p21G12S was found to have the same effect as p21 on miR-374, miR-342 and miR-126. [score:4]
In contrast, p21G12S (column 5) was found to have no effect on miR-335 and let-7 but upregulates miR-330, whereas p21 does not. [score:4]
miR-335, miR-206 and miR-126 have been shown to significantly reduce the ability of certain cells to metastasize to the lung [23, 35]. [score:1]
[1 to 20 of 6 sentences]
12
[+] score: 35
MiR-335-5p and miR-579-3p were upregulated in both groups, whereas miR-126-5p was upregulated in clinical samples and downregulated in the mo del system. [score:10]
Another highly upregulated miRNA was the tumor suppressor-like miR-335, linked to longer survival in cervical cancer patients [40, 41]. [score:6]
For some of these miRNAs the deregulated expression was not confirmed in all samples; miR-21 was deregulated in 50 % of FFPE samples, miR-335 in 54 %, miR-141 in 59 % and miR-221 in 67 %. [score:5]
From the group of the miRNAs specific for HPV -positive tonsillar tumors, the upregulated miR-125b-2*, miR-21, and miR-335 were selected (Additional file 10: Figure S4). [score:4]
The deregulated expression of the other miRNAs was confirmed (miR-9 in 100 %, miR-141 in 59 %, miR-200a in 87 %, miR-125b-2* in 89 %, miR-335 in 54 %, miR-221 in 67 %, miR-20b in 93 % of HPV -positive tumors and in 87 % of HPV -negative tumors, and miR-210 in 100 % of tumors of both etiologies). [score:4]
MiR-335-5p, miR-579-3p, and miR-126-5p were shared by the expression profiles of HPV -positive tonsillar tumors and of the HPV immortalized keratinocyte clones, whereas miR-328-3p, miR-34c-3p, and miR-885-5p were shared by the miRNA profiles of HPV -negative tonsillar tumors and the HPV -negative keratinocytes. [score:3]
MiR-335 was also upregulated in the mo del system of HPV-immortalized keratinocyte clones. [score:3]
[1 to 20 of 7 sentences]
13
[+] score: 34
In X trisomy cells miR-335-5p has elevated expression and its target genes BNC1, LMCD1 are down-regulated whereas SLC2A14 showed no change in expression. [score:10]
It seems that gene BNC1 and SLC2A14 are not targets of miR-335-5p in the human fibroblast cells used for this study or alternatively a complex interplay of a network of interactions is tuning the gene expression regulation (Supplementary Table S6, Fig. 4C). [score:6]
Furthermore after transfection of miR-335-5p mimic, gene HOXC4 showed an increased expression in 45,X cells while no alteration in expression was seen in case of 46,XX and 47,XXX cells. [score:5]
Similarly upon transfection of miR-335-5p mimic, amongst its validated target genes, only LMCD1 showed significant down regulation in X monosomy and normal (46,XX) cells but no change in 47,XXX, in comparison to mock transfected cells. [score:4]
Transfection experiments demonstrate that in X aneuploidy miR-125a-5p and miR-335-3p can regulate the expression of a few genes. [score:4]
In 47,XXX cells however, transfection of miR-335-5p mimic did not alter the expression of HDAC4 gene (Fig. 4C). [score:3]
Thus in case of miR-335-5p only gene LMCD1 was observed to show the expected results in X monosomy and normal cells. [score:1]
These cells were transfected with Qiagen micro RNA mimics for hsa-hsa-miR-125a-5p (MSY0000443), hsa-miR-335-5p (MSY0000765) and All Stars negative control siRNA (1027281) using HiPerFect transfection reagent (Qiagen Cat. [score:1]
[1 to 20 of 8 sentences]
14
[+] score: 34
Other miRNAs from this paper: mmu-mir-335
Our results about the reduced expression of miR-335-5p in SMA cells during differentiation are novel and important, as they indicate a possible role for this miRNA in SMA disease in humans, specifically in cells which are committed towards motor neurons. [score:5]
In this study, we analyze the molecular and phenotypic characteristics, in terms of gene expression and cell cycle proliferation, of SMA and wild type hiPSCs during their differentiation towards early motor neurons, and we confirm the under expression of miR-335-5p in SMA cells, associated to a reduced expression of early MN markers. [score:5]
This suggests a possible correlation between miR-335-5p expression and the ability of hiPSCs to enter the early stages of differentiation towards motor neurons. [score:3]
In particular, miR-335-5p results downregulated more than two-fold in SMA samples compared to WT ones after 14 days of differentiation, and even more strongly reduced after 22 days (Figure 3). [score:3]
In fact, human iPSCs before differentiation do not show any differences in miR-335-5p expression, which become evident during EBs differentiation. [score:3]
To further corroborate these data and considering our previous results [8], we also evaluated the expression of miR-335-5p in hiPSCs and followed it up along the in vitro differentiation steps from hiPSCs to EBs, at the same time points where we observed the differential expression of early MN markers. [score:3]
We have recently shown that miR-335-5p, already identified to control self-renewal or differentiation of mESCs [7], is differentially expressed in SMN∆7 SMA versus wild type (WT) neural progenitor cells derived from E13.5 mice spinal cords, and probably correlated to the increased proliferation activity observed in SMA cells [8]. [score:3]
RT-qPCR revealed that, while miR-335-5p expression does not differ between SMA and WT hiPSCs, a significant difference is evident at both 14 and 22 days of differentiation. [score:3]
In particular, miR-335-5p, associated with self-renewal, resulted as underexpressed in the SMA mo del of murine neural precursors. [score:3]
All primer sequences for molecular analyses are reported in Table 1. For miRNA expression, total RNA extracted as reported above, was reverse transcribed using the miR-335 and snRNA U6 Taqman assays (Life Technologies Corporation). [score:1]
All primer sequences for molecular analyses are reported in Table 1. For miRNA expression, total RNA extracted as reported above, was reverse transcribed using the miR-335 and snRNA U6 Taqman assays (Life Technologies Corporation). [score:1]
These observations deserve further deepening in order to unravel if miR-335-5p reduction not only marks the differentiation of SMA neural precursors, but most importantly if it is causally related to their pathological phenotype. [score:1]
[1 to 20 of 12 sentences]
15
[+] score: 33
MiR-206, miR-31, miR-21, miR-335-5p, miR-27a, miR-142-5p and miR-223 were significantly up-regulated afterwards muscle damage respect damaged muscle. [score:4]
As shown in Figure S1, dysregulation of miR-15b was extended to TA of the mdx mouse and higher expression levels of miR-221 and miR-335-5p were confirmed in dystrophic DIA. [score:4]
More importantly, miRNAs recently associated to muscle regeneration such as miR-31, miR-206 and miR-335-5p were confirmed over-expressed after acute damage [16]. [score:3]
Data obtained evidenced a group of miRNAs whose expression does not change during muscle repair afterwards acute damage (miR-15b, miR-17, miR-128a, miR-221, miR-199a-5p miR-199b and miR-199b*) (Table 1), and a group of miRNAs that are triggered afterwards CTX delivery (miR-206, miR-31, miR-21, miR-335-5p, miR-27a, miR-142-5p and miR-223) (Table 1), suggesting major involvement of the latter in muscle regeneration. [score:3]
We identify fourteen miRNAs associated to dystrophic fibres (miR-15b, miR-17, miR-21, miR-27a, miR-31, miR-128a, miR-142-5p, miR-199a-5p, miR-199b, miR199b*, miR-206, miR-221, miR-223 and miR-335-5p) that may mediate muscle regeneration and remo delling in animal mo dels of MDs and acute muscle damage, and confirm over -expression of the previously identified regeneration -associated myomiR-206. [score:3]
Dystrophic muscle fibres isolated from different animal mo del of MDs were commonly characterized by the over -expression of several miRNAs (miR-15b, miR-21, miR-27a, miR-31, miR-128a, miR-142-5p, miR-199a-5p, miR-199b, miR199b*, miR-206, miR-221, miR-223 and miR-335-5p) with an expression profile strictly dependent on muscle impairment and damage accumulation (Figure 7). [score:3]
Otherwise the expression profile of miR-15b, miR-221, miR-21, miR-199a and miR-335-5p was strictly related to the muscle-type considered (Figure S1). [score:2]
The expression levels of miR-21, miR-142-5p, miR-199a-5p, miR-199b*, miR-206, miR-223 and miR-335-5p were instead strictly related to the type of muscle considered, underling a relationship with muscle-type dependent impairment (Figure 2B). [score:2]
In particular, the dysregulation was limited to miR-199b*, miR-31, miR-142-5p and miR-221 in dystrophic TPZ; to miR-128a, miR-21, miR-221 and miR-35-5p in dystrophic DIA; and to miR-15b, miR-17, miR-27a, miR-142-5p, miR-128a, miR-335-5p, miR-21, miR-31 in dystrophic VA (Figure 3B). [score:2]
Fourteen miRNAs were found dysregulated in dystrophic muscle fibres of the mdx mouse with differences linked to the originating muscle (miR-206, miR-199a-5p, miR-223, miR-199b, miR-199b*, miR-21, miR-221, miR-17, miR-15b, miR-31, miR-128a, miR-142-5p, miR-335-5p and miR-27a). [score:2]
In support to this: miR-335 and miR-21 were found in human mesenchymal stromal cells [50] and in mesenchymal stem cells (MSCs) together with miR-21, miR-27a, miR-128a, miR-199b [51] miR-15b, miR-17, miR-21, miR-27a, miR-31, miR-199a, miR-199b, miR-221 and miR-335-5p were found in MSCs and in MSC secreted microparticles [49], [52], [53]. [score:1]
In agreement with data already published characterizing the miRNome of mdx and DMD muscle [15], [16], [17], the over -expression of several miRNAs (miR-21, miR-31, miR-199a-5p, miR-199b, miR-142-5p, miR-221, miR-223 and miR-335-5p) was confirmed in murine dystrophic single muscle fibres. [score:1]
Only 7 of the 14 miRNAs associated to dystrophic fibres (miR-206, miR-31, miR-21, miR-335-5p, miR-27a, miR-142-5p and miR-223) were triggered by CTX injury. [score:1]
MiR-15b, miR-17, miR-31, miR-128a, miR-142-5p and miR-335-3p were specifically induced in single muscle fibres of dystrophic DIA (Figure 1). [score:1]
This study demonstrated a common signature of DMD and ischemic muscle, outlining three different families of DMD-signature miRNAs: inflammatory (miR-222 and miR-223), degenerative (miR-1, miR-29c, and miR-135a) and regenerative (miR-31, miR-34c, myomiR-206, miR-335, miR-449, and miR-494). [score:1]
[1 to 20 of 15 sentences]
16
[+] score: 32
A recent study by Tome et al [90] supports this view since they found miR-335-5p down-regulation was required to permit MSC differentiation toward the osteogenic or adipogenic lineage; over -expression of this miRNA inhibited MSC differentiation. [score:8]
While miR-335* has not been reported in cartilage until now, one previous study has shown down-regulation of the miR-335-5p strand in de-differentiated chondrocytes [89]. [score:4]
In addition to miR-335 and miR-138, there are a number of other differentially-expressed miRNAs identified in the present study that will be worth pursuing in the context of cartilage biology; some of these are generally not well-reported in the literature and their functional roles in normal tissue development and homeostasis are unknown so far (e. g. miRs- 301, 502, 532, 660, 1244, 1247, 1290, 1291). [score:4]
miR-335-5p and the less abundant 3p strand (miR-335*) showed significantly high fold changes in differential expression patterns in our studies (Tables 2, 3, 4 ). [score:3]
It will be interesting to determine how modulation of miR-335/335* expression affects chondrocyte differentiation. [score:3]
Unpublished observations in our laboratory have shown a sharp decrease in miR-335-5p expression during TGF-β3 induced chondrocyte differentiation of human MSCs. [score:3]
Although expression levels of miR-335* were generally lower than miR-335-5p, detection of this “minor” strand suggests that it may be functional in the context of cartilage biology. [score:3]
These findings suggest a potential role for the 5p strand of miR-335 in regulating genes to maintain a more progenitor phenotype. [score:2]
However, another study reported opposite effects of miR-335-5p in regulating osteogenesis [91], but this may be explained by the fact that cell lines were used here as opposed to primary MSCs. [score:2]
[1 to 20 of 9 sentences]
17
[+] score: 31
The inhibition of cell migration by miR-335 is in good agreement with previous findings [50, 54] and underlines that our magnetic non-viral vector is an ideal system to deliver and release miR, thereby efficiently blocking translation of target mRNAs. [score:7]
Interestingly, 72 h after MNP–mediated transfection miR-335 expression remained at the same level, whereas miR expression after PEI alone–mediated transfection was decreased and was more than 3-fold lower compared to magnetic polyplex transfection. [score:4]
Moreover, miR-335 was found to be upregulated during myogenic differentiation in vitro and was induced during the regenerative phase after ischemia [30]. [score:4]
Processing of precursor miR into mature strand was monitored 5, 24 and 72 h after transfection in hMSCs and relative expression of a mature miR-335 was quantified by real-time PCR (Figures 5A and S1; Table S1). [score:3]
In order to test if the released and processed mature miR-335 is functional, we investigated the expression levels of its known target genes tenascin C (TNC) [50] and Runt-related transcription factor 2 (RUNX2) [29] 5, 24 and 72 h after transfection (Figure 6A,B; Tables S2 and S3). [score:3]
It has been shown that miR-335 is regulating genes responsible for proliferation, differentiation and migration in hMSCs [29]. [score:2]
In this work we investigated the intracellular processing of precursor miR-335 to a mature strand as well as efficient knockdown of known target genes comparing the performance of PEI - mediated transfection and MNP -mediated transfection. [score:2]
Due to its critical role in hMSCs, we used miR-335, which is encoded in the second intron of the mesoderm-specific transcript (MEST) gene. [score:1]
Cy™3 labeled Pre-miR™ Negative Control #1 (Ambion, Austin, TX, USA) was used for uptake efficiency studies; hsa-miR-335-5p Pre-miR™ miRNA Precursor (Ambion) and Negative Control #1 Pre-miR™ (Ambion) were used for functional studies. [score:1]
hsa-miR-335-5p Pre-miR™ miRNA Precursor (Ambion) was labeled with Cy™5 dye using Label IT [®] miRNA Labeling Kit, Version 2 (Mirus Bio LLC, Madison, WI, USA) according to the manufacturer’s protocol. [score:1]
A significant increase of miR-335 level was observed already 5 h after transfection. [score:1]
Maximal values of mature miR-335 were reached at 24 h time point. [score:1]
Transfection complexes were formed either with hsa-miR-335-5p Pre-miR™ miRNA Precursor (Ambion) or with scrambled Negative Control #1 Pre-miR™ (Ambion). [score:1]
[1 to 20 of 13 sentences]
18
[+] score: 30
To obtain more insights about the miR-335 loss consequences, authors transfected MDA-MB-231 cells with an anti-miRNA antagomir targeting either miR-335, miR-199a* or a control sequence, and found that inhibition of miR-335 enhanced the lung-colonizing ability of cells. [score:5]
These experimental evidences indicated that miR-335 suppresses metastasis and migration by targeting the progenitor cell transcription factor SOX4 and TNC messenger RNAs. [score:5]
Then, they profiled LM2 cells overexpressing miR-335 and identified 756 genes whose expression was decreased when compared with control LM2 cells, including genes previously implicated in extracellular matrix and cytoskeleton control (type 1 collagen COL1A1) and signal transduction (receptor-type tyrosine protein phosphatase PTPRN2, c-Mer tyrosine kinase (MERTK) 21 and phospholipase PLCB1), as well as in cell migration, such as the tenascin C (TNC), an extracellular matrix glycoprotein of stem cells niches [56] and the SRY-box containing transcription factor SOX4 [57]. [score:4]
The team led by Joan Massague found that miR-335, miR-126, and miR-206 are metastasis-suppressors. [score:3]
Interestingly, miR-126 restoration reduced overall tumor growth and proliferation, whereas miR-335 inhibited metastatic cell invasion. [score:3]
Authors performed array -based miRNA profiling in MDA-MB-231 breast cancer cell derivatives highly metastatic to bone and lung, and found a signature of six genes (miR-335, miR-126, miR-206, miR-122a, miR-199a*, and miR-489) whose expression was highly decreased in metastatic cells. [score:3]
Restoring the expression of miR-335, miR-126 or miR-206 in LM2 cells decreased the lung colonizing activity of these cells by more than fivefold. [score:3]
In addition, low expression of miR-335 or miR-126 in primary tumors from patients was associated with poor distal metastasis-free survival. [score:3]
Consequently, loss of miR-335 leads to the activation of SRY-box containing SOX4 and TNC, which are responsible for the acquisition of metastatic properties. [score:1]
[1 to 20 of 9 sentences]
19
[+] score: 29
Finally, linking differentially expressed miRNAs to their potential differentially expressed target using the algorithm published by Kertesz et al [25] identified a total of 11 potential miRNA-mRNA pairs: COL21A1 (collagen, type XXI, alpha 1; targeted by hsa-miR-155), CYP46A1 (cytochrome P450, family 46, subfamily A, polypeptide 1; targeted by hsa-miR-342-3p), KCNJ1 (potassium inwardly-rectifying channel, subfamily J, member 1; targeted by hsa-miR-155), MADCAM1 (mucosal vascular addressin cell adhesion molecule 1; targeted by hsa-let-7i), MRPS26 (mitochondrial ribosomal protein S26; targeted by hsa-miR-15a), OR2T29 (olfactory receptor, family 2, subfamily T, member 29; targeted by hsa-miR-143), RPS9 (ribosomal protein S9; targeted by hsa-miR-132), SLC10A1 (solute carrier family 10 (sodium/bile acid cotransporter family), member 1; targeted by hsa-miR-31), SLC16A8 (solute carrier family 16, member 8 (monocarboxylic acid transporter 3); targeted by hsa-miR-31), SNTG1 (syntrophin, gamma 1; targeted by hsa-miR-21) and TRPC5 (transient receptor potential cation channel, subfamily C, member 5; targeted by hsa-miR-335). [score:29]
[1 to 20 of 1 sentences]
20
[+] score: 29
This deviant DNA methylation causes damping of miRNA tumour suppressors such as let-7, miR-101, and miR-202 that target MYCN; miR-9 that targets tyrosine kinase (Trk) C, RE-1 silencing transcription factor (REST), DNA -binding protein inhibitor (ID2), and Matrix metalloproteinase-14 (MMP-14); miR-34a that targets E2F transcription factor 3 (E2F3), B-cell lymphoma 2 (Bcl-2) and MYCN; miR-340 that targets SRY (sex determining region Y)-box 2 (SOX2); miR-184 that targets v-akt murine thymoma viral oncogene homolog 2 (Akt2); and miR-335 that targets Mitogen-Activated Protein Kinase 1 (MAPK1), leucine-rich repeat 1 (LRG1), and Ser/Thr Rho kinase 1 (ROCK1) [101] (Figure 1). [score:17]
MYCN can down-regulate the epigenetically controlled miR-335, a tumour suppressor miRNA, leading to over -expression in target genes of the Transforming Growth Factor beta (TGF-β) non-canonical pathway, inhibiting both the migration and invasion of NB cells [42]. [score:12]
[1 to 20 of 2 sentences]
21
[+] score: 28
d Main pathway influenced by genes targeted by miR-199a-5p, and miR-22 KEGG pathway analysis showed that the predicted target genes related to miR-98, miR-375, and miR-335 were involved in cytokine-cytokine receptor interaction, calcium signaling pathway, glycan structures - biosynthesis 1, melanoma, and Wnt signaling pathway (Fig.   3c), whereas the predicted target genes of miR-199a-5p and miR-22 were related to MAPK signaling pathway, chronic myeloid leukemia, melanogenesis, insulin signaling pathway, and prostate cancer (Fig.   3d). [score:7]
d Main pathway influenced by genes targeted by miR-199a-5p, and miR-22 KEGG pathway analysis showed that the predicted target genes related to miR-98, miR-375, and miR-335 were involved in cytokine-cytokine receptor interaction, calcium signaling pathway, glycan structures - biosynthesis 1, melanoma, and Wnt signaling pathway (Fig.   3c), whereas the predicted target genes of miR-199a-5p and miR-22 were related to MAPK signaling pathway, chronic myeloid leukemia, melanogenesis, insulin signaling pathway, and prostate cancer (Fig.   3d). [score:7]
a Main biological processes influenced by genes targeted by two or more miRNAs (miR-98, mir-375, and miR-335). [score:3]
c Main pathway influenced by genes targeted by two or more miRNAs from miR-98, mir-375, and miR-335. [score:3]
a Relationships among the target genes predicted by miR-98, miR-375, and miR-335. [score:3]
GO analysis showed that the most significant biological processes for miR-98, miR-375, and miR-335 include positive regulation of transcription from RNA polymerase II promoter, regulation of transcription, DNA -dependent and ubiquitin -dependent protein catabolism, platelet-derived growth factor receptor signaling pathway, embryonic hindgut morphogenesis (Fig.   3a). [score:3]
Eight miRNAs (miR-223, miR-98, miR-15b, miR-199a-5p, miR-19b, miR-22, miR-451, and miR-101) were involved in HBV-unrelated HCC, 5 miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) were involved in HBV infection, and 7 miRNAs (miR-150, miR-342-3p, miR-663, miR-20b, miR-92a-3p, miR-376c-3p and miR-92b) were specifically altered in HBV-related HCC. [score:1]
Five miRNAs (miR-98, miR-375, miR-335, miR-199a-5p, and miR-22) matched the criterion. [score:1]
[1 to 20 of 8 sentences]
22
[+] score: 28
Among the other miRNAs expressed in association with Zr levels, we found that miR-152, miR-494 and miR-335 had hundreds of potentially regulated targets, demonstrating that they might have a relevant role in the context we are studying. [score:6]
As expected by the large number of predicted targets, miR-152, miR-335 and miR-494 resulted to share targets such as the cytokine receptor KIT, the Rho -dependent Protein Kinase (ROCK-1), proteins belonging to the tyrosine phosphatase family (PTPN11 and PTPN14) and proteins belonging to the Rho Guanine Nucleotide Exchange Factor (ARHGEF2, ARHGEF12 and ARHGEF17). [score:5]
The common targets we identified for miR-152, miR-494 and miR-335 seem to be largely involved in the regulation of inflammatory processes. [score:4]
In the present study on an obese population, we found that the exposure to Zr levels traced in hair is associated with a distinct signature of 7 miRNAs (miR-99b, miR-142-5p, miR-152, miR-193a-5p, miR-323-3p, miR-335, miR-494) expressed in peripheral blood. [score:3]
The seven miRNAs (miR-99b, miR-142-5p, miR-152, miR-193a-5p, miR-323-3p, miR-335, miR-494) associated with Zirconium levels with FDR P < 0.1, were selected for downstream target prediction analysis. [score:3]
Cellular location of targets shared by miR-152, miR-335 and miR-494. [score:3]
More specifically, we identified that miR-152, miR-494 and miR-335 had the largest number of potentially regulated mRNAs that were 254, 208 and 105 respectively. [score:2]
Using an FDR linear step-up adjustment for multiple comparisons (FDR P < 0.1), we found 7 miRNAs (miR-99b, miR-142-5p, miR-152, miR-193a-5p, miR-323-3p, miR-335, miR-494) specifically associated with Zr levels traced in the hair (Table 2). [score:1]
Seven miRNAs (miR-99b, miR-142-5p, miR-152, miR-193a-5p, miR-323-3p, miR-335, miR-494) resulted specifically associated with Zr levels. [score:1]
[1 to 20 of 9 sentences]
23
[+] score: 27
Since miR-335 and miR-125 are both downregulated across numerous highly metastatic cell lines and exhibit abilities to suppress metastasis of breast cancer cells, further exploration of either miRNA would be beneficial for breast cancer therapeutics research. [score:6]
Thus, inhibition of miR-335 levels results in enhanced expression of SOX4. [score:5]
miR-335 suppresses metastasis and migration by targeting the progenitor cell transcription factor SOX4 and the extracellular matrix component tenascin C (TNC). [score:5]
Moreover, evidence supports that miR-335 and miR-126 function as tumor suppressive miRNAs [78]. [score:3]
Moreover, miR-335 is restored, metastatic cell invasion is inhibited, and cells show reduced tumor growth and proliferation when miR-126 is restored. [score:3]
Both miR-335 and miR-126 expression are lost in most primary breast carcinomas of patients who relapse. [score:3]
miR-335 regulates a set of genes that collectively are associated with distal metastasis. [score:2]
[1 to 20 of 7 sentences]
24
[+] score: 27
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30a A notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
Figure 4. The ‘extended VCR’ of stratum 2 (shared by Homo and Pelodiscus sequences): (a) miR-16 target site (also shown in Fig. 2e) and nearby target sites for miR-376a, miR-335-3p, miR-493 and miR-379 (the Xenopus sequence contains a 44-bp insertion at the site of the asterisk that includes two target sites for miR-335-3p are shown in red); (b) conserved pair of target sites for miR-320a and miR-182; (c) conserved triplet of target sites for miR-378, miR-99a and miR-30aA notable feature of stratum 2 is a pair of complementary sequences, 800 nucleotides apart, that are predicted to form the stems of a strong double helix (18 bp, –32.3 kcal/mol). [score:11]
miR-335 is a paternally expressed imprinted microRNA located in the second intron of its MEST host gene [40, 41]. [score:3]
This ‘extended VCR’ contains a remarkable concentration of predicted binding sites for microRNAs, including miR-335-3p [38], miR-376a [26] and miR-493 [39]. [score:1]
miR-335 is well conserved in armadillo and elephant MEST genes but absent from the MEST genes of opossum and platypus. [score:1]
[1 to 20 of 5 sentences]
25
[+] score: 26
Both miR-335-5p and miR-574-3p have been reported to be important in bone and cartilage development and differentiation through the regulation of the Wnt pathway and SOX9 expression, respectively 21, 22. [score:5]
The miRNA pattern of expression remained similar to previous experiments with increased levels of mir-214, miR-335-5p, and miR-574-3p in the diseased state. [score:5]
MicroRNA 205-5p was decreased 2.68-fold (95% CI 2.17–2.89) in diseased mice compared to controls, whereas miR-214 and miR-335-5p were increased 2.37- (95% CI 1.81–2.93) and 2.69-fold (95% CI 2.12–3.26), respectively, in diseased mice. [score:4]
Our studies revealed plasma miR-205-5p was downregulated in GEMM mice with OS compared to wild-type littermate controls, whereas levels of miR-214 and miR-335-5p were significantly higher in GEMM mice. [score:3]
Three of the four miRNAs (miR-205-5p-5p, miR-214, and miR-335-5p) were validated in an independent set of diseased and wild-type mice to be statistically significant (P < 0.05) using a two-sample, two-tailed Student’s t-test comparing the 2 [−ΔCq] values of the two groups MicroRNA-574-3p was not statistically significant in final statistical analysis, but was included in simultaneous studies based on preliminary results (P =  0.15) (Fig. 1). [score:3]
As shown in Figure 5A, the areas under the curves (AUCs) were 0.70 (95% CI 0.576–0.827), 0.8 0(95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively. [score:1]
Therefore, we monitored the levels of miR-205-5p, miR-214, miR-335-5p, and miR-574-3p prior to and serially after transplantation of OS cells. [score:1]
The ΔCq cut-points were 8.34 for miR-205-5p, 10.31 for miR-214, 9.78 for miR-335-5p and 6.08 for miR-574-3p. [score:1]
Four miRNAs (miR-205-5p-5p, miR-214, miR-335-5p, and miR-574-3p) were chosen as candidate miRNAs based on reports in published literature, the presence of a conserved known human homologue, and the fold change in the global qPCR analysis. [score:1]
While our study is the first report of plasma miR-205-5p, miR-214, miR-335-5p, and miR-574-3p to be used as biomarkers, the literature supports that each of these miRNAs may have an important biologic function in OS. [score:1]
Areas under the curve (AUCs) were 0.70 (95% CI 0.576–0.827), 0.80 (95% CI 0.699–0.909), 0.78 (95% CI 0.661–0.898), and 0.88 (95% CI 0.794–0.957) for miR-205-5p, miR-214, miR-335-5p, and miR-574-3p, respectively. [score:1]
[1 to 20 of 11 sentences]
26
[+] score: 26
We also found a novel site of RNA editing in KMT2C (Lysine (K) methyl transferase 2 C); a novel development stage- and brain-specific maternally-expressed gene, DUSP22 (Dual specificity phosphatase 22); and a novel development stage-specific paternally-expressed miRNA, miR-335, in the PFC of both offspring. [score:7]
Finally, we identified a development stage-specific paternally-expressed miRNA, miR-335 (Fig.   8), which was paternally-expressed in the adult PFC but paternally-biased in the fetal PFC. [score:6]
The PFC from the offspring without and with ASD consistently showed paternal expression of miR-335, which further extends a previous finding showing mouse miR-335 is paternally-expressed [50]. [score:5]
Sanger sequencing was performed to analyze allele-specific miR-335 expression in the PFC of the offspring without and with ASD, fetal PFC, and blood from the parents of the fetus. [score:3]
Figure 8 miR-335 is paternally expressed in the PFC of the offspring without and with ASD. [score:3]
KMT2C, DUSP22 and miR-335 are autism susceptibility genes and miRNAs. [score:1]
Moreover, we identified novel allele-specific genes such as DUSP22 and miRNAs such as miR-335 in both the offspring with and without ASD, as well as a mono-to-biallelic switch for LRP2BP and ZNF407 in the offspring diagnosed with ASD. [score:1]
[1 to 20 of 7 sentences]
27
[+] score: 23
Other miRNAs from this paper: hsa-mir-204
The results showed that miR-204-5p was significantly up-regulated, whereas miR-335-3p was significantly down-regulated, in women with osteoporotic hip fractures compared to those with hip OA but no osteoporosis (Figure 3A and 3B). [score:6]
Significant upregulation of miR-204-5p and downregulation of miR-335-3p were observed in women with osteoporotic hip fractures, when compared to those with hip osteoarthritis without osteoporosis. [score:6]
As listed in Table 2, KLF7 and SOX11 were the predicted targets of miR-204-5p, while KIAA1462 and SVIP were targets of miR-335-3p. [score:5]
Differentially expressed miR-204-5p and miR-335-3p in osteoporotic hip bone. [score:3]
The network analysis revealed 10 out of 22 genes involved in a network associated with cancer, endocrine system disorders, organismal injury and abnormalities, and three of the four putative targets (KLF7, SOX11 and SVIP) by miR-204-5p and miR-335-3p predictions were involved. [score:3]
[1 to 20 of 5 sentences]
28
[+] score: 23
Although, miR-335 has been identified as a metastasis-suppressing microRNA in human breast cancer [34], it also suppresses the proliferation, and invasion of breast cancer cells by targeting EphA4 [35]. [score:7]
Overexpression of miR-335 induces cell proliferation and tumor growth to colorectal carcinoma cells [33]. [score:3]
Of these 67 mRNAs found to be associated with polysomes in cells treated with cyclopamine, 22 mRNAs are targets of hsa-miR335-5p. [score:3]
Conversely, when we look at the DOWN-P group (161 mRNAs), 19 mRNAs were observed to be targets of hsa-miR335-5p. [score:3]
That is, 32.8% of that set of mRNAs that increases in the polysomes with the treatment with the drug cyclopamine were regulated by hsa-miR335-5p. [score:2]
Thus, these in silico data show that hsa-miR335-5p may be a regulator during the activation or blockade of the Hh pathway. [score:2]
In silico, we identified potential miRNAs, such as miR335 that regulated these mRNAs associated with polysomes and modulated the Hh pathway. [score:2]
Our data shows that hsa-miR-29a, hsa-miR-3127, hsa-miR-375, hsa-miR-6756, hsa-miR-335, hsa-miR-92a, hsa-miR-150, hsa-miR-215, hsa-miR-155, hsa-miR-193b, hsa-miR-24, and hsa-miR-149 are strong candidates for further studies on the Hh signaling pathway in ADSCs. [score:1]
[1 to 20 of 8 sentences]
29
[+] score: 22
Note, up-regulation of liver tissue specific hsa-miR-335 was reported for murine mo dels of NAFLD, e. g. the leptin deficient ob/ob, the leptin-receptor -deficient db/db and KKAy44 mice. [score:4]
Apart from common DIS regulated genes the transcription factors FOXO1 and FOXA2 and the insulin induced gene 2 are specific targets of miR-335-5p; note polymorphisms of INSIG2 are associated with severe obesity. [score:4]
It is of considerable importance that hsa-miR-335 is a major regulator for lipid accumulation and adipose tissue differentiation in mice 27 and the transcription factors FOXO1 and FOXA2, the insulin induced gene 2 and the low density lipoprotein receptor LDLR were equally regulated by miR-335. [score:3]
Furthermore, the patatin-like phospholipase domain-containing protein 3 is a target of miR-335-5p and a single nucleotide polymorphism of this gene is strongly associated with NAFLD of different grades 36. [score:3]
Alike, individual networks for top regulated miRNAs were considered and as an example Fig. 6 depicts hsa-miR-124-3p and hsa-miR-335 regulated DIS genes after single and repeated treatment of rats with 17 drugs for up to 28 days. [score:2]
The frequency by which individual miRNAs target steatosis related genes was considered; Fig. 3a depicts hsa-mir-335-5p and has-miR-124-3p as top ranking. [score:2]
For instance, the anti-fibrotic miR-335-5p as well as miR-30a-5p are known to repress lipid biosynthesis, lipoprotein secretion and autophagasome formation and were significantly regulated as was mir-21 and mir-335 which are mechanistically linked to hepatic triglyceride and cholesterol metabolism. [score:2]
Nonetheless, when the frequency of DIS associated miRNAs were considered hsa-miR-335 was most frequently regulated across a wide range of dissimilar drugs. [score:1]
Green and orange colored bars refer to transcriptional repression of genes induced by has-miR-335-5p and hsa-miR-124-3p after single and repeat treatment of rats with N = 17 steatotic drugs. [score:1]
[1 to 20 of 9 sentences]
30
[+] score: 22
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-200a, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
Our analysis indicates that, about 3594 genes could be targeted by the eleven up-regulated miRNAs (bta-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-4286, miR-885, miR-196a, miR-23b-3p, bta-miR-199c and miR-3431) whereas 1163 genes could be targeted by the three down-regulated miRNAs (bta-miR-335, miR-200a and bta-miR-2299-5p) in linseed oil -treated cows. [score:11]
Out of this number, 11 were up-regulated (bta-miR-4286, miR-885, miR-199c, miR-199a-3p, miR-3431, miR-98, miR-196a, miR-378, miR-23b-3p, miR-148b and miR-21-5p) while only 3 were down-regulated (miR-200a, miR-335 and miR-2299-5p) (Table  2). [score:7]
miR-335 is up-regulated in response to lipid loading and is highly abundant in liver and adipose tissues of obese mice, suggesting a role in lipid metabolism [74]. [score:4]
[1 to 20 of 3 sentences]
31
[+] score: 22
The constitutive expression of miR-335 targets more than 62 genes [103] including the transcription factor SOX4 and the extracellular matrix component tenascin C. Thus, a down-modulation of this miR and consequently, increased expression of target genes is associated with enhanced risk of mammary tumor spreading and formation of metastasis. [score:9]
Of interest, a functional role in the regulation of a neoplastic development and the formation of metastases has also been attributed to miRs in breast cancer cells, particularly miR-21 and miR-205 for tumor development and miR-126 and miR-335 for breast cancer metastases. [score:4]
Indeed, different states of MSC activation are relayed by variable expression levels of certain miR including miR-335. [score:3]
Whereas different amounts of miR-335 determine the activation status of MSC, certain expression levels of this miR also contribute to metastasis of breast cancer cells. [score:3]
High levels of miR-335 expression contribute to a potentially non-activated (silenced) MSC state of auto-maintenance and low amounts of miR-335 suggest an activated state leading to proliferation, migration and differentiation in MSC [103] (Figure 1). [score:3]
[1 to 20 of 5 sentences]
32
[+] score: 21
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Down-regulation of miR-335 was found to be significantly associated with lymph node metastasis, invasion of lymphatic vessels, cell invasion and metastasis through targeting of BCL-w and SP1 (specificity protein 1) [82, 83]. [score:6]
Yang B. Huang J. Liu H. Guo W. Li G. miR-335 directly, while miR-34a indirectly modulate survivin expression and regulate growth, apoptosis, and invasion of gastric cancer cells Tumour Biol. [score:6]
In GC, high expression of miR-195 [58], miR-199a [39, 58, 62, 63, 64, 65], miR-1952 [58], miR-335 [82, 83], miR-375 [39, 74, 86, 87, 88], miR-451 [58, 94, 95, 96] and miR-4512 [39], and low expression of miR-142-5p [39] are more likely to indicate relapse or recurrence of GC patients. [score:5]
Li H. Xie S. Liu M. Chen Z. Liu X. Wang L. Li D. Zhou Y. The clinical significance of downregulation of mir-124–3p, mir-146a-5p, mir-155–5p and mir-335–5p in gastric cancer tumorigenesis Int. [score:4]
[1 to 20 of 4 sentences]
33
[+] score: 21
To confirm the microarray hybridization results, qRT-PCR was performed on 8 up-regulated miRNAs (miR-335, miR-146b-5p, miR-26b, miR-30b, miR-21, miR-378, miR-143 and miR-148a) [10] and 3 down-regulated miRNA (miR-155,miR-221, and miR-1275), chosen on the basis of their levels of expression on the microarray and their biological significance. [score:9]
Additionally, our group [7] has also suggested that inhibited miR-26b inhibits adipogenic differentiation in human preadipocytes, and miR-335, as a potential adipogenic miRNA, is involved in adipose tissue inflammation and is highly expressed in mature 3T3-L1 [21]. [score:7]
Between mature adipocytes and SVCs/hMSCs-Ad, miR-146b-5p and miR-335 were found to be differentially expressed with a fold change >10 (Supplementary Table 1). [score:3]
Therefore, our present and previous studies bring in valuable information with respect to human obesity pathology because we have demonstrated that miR-148a, miR-146b, miR-26b and miR-335 are dysregulated in the process of adipocyte differentiation. [score:2]
[1 to 20 of 4 sentences]
34
[+] score: 20
For instance, miR-335-5p (targeting Wnt inhibitor DDK1) [33], miR-196a (targeting the chondrogenic transcription factor HOXC8) [34], miR-29b (targeting inhibitors of osteoblast differentiation TGF-β3, activin receptor type-2A and beta-catenin-interacting protein 1) [35] and miR-21 (targeting the inhibitory Smad7) [36], may promote osteogenesis by down -regulating the translation of inhibitors for osteogenesis and the bone formation process. [score:20]
[1 to 20 of 1 sentences]
35
[+] score: 19
Emerging evidence demonstrates that miRNAs are critical regulators of lipid synthesis and FAO [81] resulting in defective cell metabolism and carcinogenesis [82] directly targeting key enzymes or transcription factors as oncogenes and tumor suppressors [81] as shown in Table  1. Table 1 miRNAs involved in cancer metabolic plasticity MiRNAs Target Reference miR-122 Cholesterol biosynthesis 88– 90 miR-370 Fatty acid oxidation, CPT1A [91] miR-378/378* Lipid metabolism, CrAT 92, 93 miR-335 Lipid metabolism and adipogenesis [94] miR-205 Lipid metabolism [95] miR-143 Adipocyte differentiation [96] miR-27 Adipolysis [97] miR-33a/b Cholesterol efflux and β-oxidation 98– 100 miR-185 Lipogenesis and cholesterogenesis [101] miR-342 Lipogenesis and cholesterogenesis [101] miR-124 CPT1A [27] miR-129 CACT 27, 102 MiR-122 was the first miRNA identified as tissue-specific, and it is the most abundant in liver involved in lipid metabolic reprogramming [83]. [score:9]
Nakanishi N The up-regulation of microRNA-335 is associated with lipid metabolism in liver and white adipose tissue of genetically obese miceBiochem. [score:4]
The expression of MiR-335 is modulated by lipid loading, resulting in overexpression in liver and adipose tissue of obese mice [93]. [score:4]
MiR-143, miR-27, miR-335, miR-14, and miR-205 have been recently associated with lipid metabolism and adipocyte differentiation [91]. [score:1]
However, the role of miR-335 in triggering lipid metabolism still remains unknown. [score:1]
[1 to 20 of 5 sentences]
36
[+] score: 19
Figure  9a shows miR-335 that suppresses BC metastasis by targeting SOX4 and Tenascin-C which promote cancer cell migration, invasion and ultimately metastasis [326– 328]. [score:5]
miR-21 BCL-2,PTEN, PDCD4,TPM1, maspin Migration, invasion[318, 319] miR-335 SOX4, Tenascin-C Migration, invasion[326– 328] miR-10b HOXD10, RhoC Migration, invasion[320, 321] let-7 H-RAS, HMGA2, LIN28, PEBP1 Proliferation, differentiation[322, 323] miR-200 BMI2, ZEB1, ZEB2, Sec-23a Migration[324]The most used experimental technique for determining miRNA targets is the transfection of mimic miRNAs or of miRNA inhibitors [329]. [score:5]
miR-21 BCL-2,PTEN, PDCD4,TPM1, maspin Migration, invasion[318, 319] miR-335 SOX4, Tenascin-C Migration, invasion[326– 328] miR-10b HOXD10, RhoC Migration, invasion[320, 321] let-7 H-RAS, HMGA2, LIN28, PEBP1 Proliferation, differentiation[322, 323] miR-200 BMI2, ZEB1, ZEB2, Sec-23a Migration[324] The most used experimental technique for determining miRNA targets is the transfection of mimic miRNAs or of miRNA inhibitors [329]. [score:5]
a) Deletions of miR-335 produces effect that appear as promoting migration, invasion, and metastasis. [score:1]
miR-21 BCL-2,PTEN, PDCD4,TPM1, maspin Migration, invasion[318, 319] miR-335 SOX4, Tenascin-C Migration, invasion[326– 328] miR-10b HOXD10, RhoC Migration, invasion[320, 321] let-7 H-RAS, HMGA2, LIN28, PEBP1 Proliferation, differentiation[322, 323] miR-200 BMI2, ZEB1, ZEB2, Sec-23a Migration[324] Combination of miRNA and mRNA has still to be deeply explored in diagnostic and prognostic studies. [score:1]
miR-335 is silenced through CN deletions [328]. [score:1]
miRNAs with a role in metastasis in BC include miR-7 [138, 139], miR-17/20 [140, 141], miR-22 [142– 144], miR-30 [145, 146], miR-31 [147– 149], miR-126 [150], miR-145 [151], miR-146 [152], miR-193b [153], miR-205 [154], miR-206 [155], miR-335 [156], miR-448 [157], miR-661 [158] and let-7 [159]. [score:1]
[1 to 20 of 7 sentences]
37
[+] score: 17
Among those miRNAs, the low expression levels of miR-335 were associated with very poor overall metastasis-free survival in comparison with patients whose tumors expressed a high level of this miRNA [99] (Table  2). [score:5]
It was demonstrated that miR-335 suppressed migration/invasion through targeting the progenitor cell transcriptional factor SOX4 and extracellular matrix component tenascin C (TNC) [99]. [score:5]
BRMS1 was shown to act as a repressor for metastasis-promoting miRs such as miR-10b, miR-373 and miR-520c and an activator for metastasis-suppressing miRs miR-146a/b, miR-335 and miR-21 [109] (Figure  4). [score:3]
Tavazoie and colleagues showed that restoring the expression of miR-335, miR-126 or miR-206 through retroviral transduction significantly reduced the ability of CN34-LM1 and CN34-BoM1 cells to metastasize to lung and bone, respectively [99]. [score:3]
Primary tumors with low levels of miR-335 and miR-126 have a higher probability of developing metastasis at secondary sites in breast cancer patients [99]. [score:1]
[1 to 20 of 5 sentences]
38
[+] score: 17
The invasion of MDA-MB-231 and BT-20 cells is diminished by over -expression of c-Met -targeting miR-335 [7]. [score:5]
It is also shown that TCDD and MCDF down-regulate SOX4 in MDA-MB-231 and BT474 by inducing miR-335 [25]. [score:4]
Zhang and colleagues [25] suggest that both TCDD and MCDF induce miR-335 targeting the pro-metastatic mediator SRY-related HMG-box4 (SOX4). [score:3]
For example, TCDD and MCDF induce SOX4 -targeting miR-335 in MDA-MB-231 and BT474 cells in vitro [25]. [score:3]
These effects are abrogated by Ahr knockdown and mitigated by miR-335 antisense in Ahr agonists -treated cells. [score:2]
[1 to 20 of 5 sentences]
39
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
miR-335 was up-regulated in pediatric AML patients both in bone marrow and serum [139], and high serum miR-335 was associated with poor relapse-free and overall survival after patients received 10 days of induction chemotherapy [139]. [score:4]
Interestingly, miR-335 was reported to be involved in the regulation of target genes in several oncogenic signaling pathways, such as p53, MAPK, TGF-b, Wnt, ERbB, mTOR, Toll-like receptor and focal adhesion [141]. [score:4]
In contrast, deregulation of the expression of miR-9, miR-33, miR-92a, miR-142-3p, miR-146a, miR-181a/c, miR-210, miR-215, miR-369-5p, miR-335, miR-454, miR-496, miR-518d, and miR-599 was associated with an unfavorable long-term clinical outcome in ALL patients [65, 67– 73]. [score:4]
In addition, high expression of miR-335 in the bone marrow was indicative of poor Ara-C -based chemotherapy response, lower relapse-free survival and overall survival in AML patients [140]. [score:3]
Lin X, et al. High serum microRNA-335 level predicts aggressive tumor rogression and unfavorable prognosis in pediatric acute myeloid leukemia. [score:1]
[1 to 20 of 5 sentences]
40
[+] score: 15
miR-335 over -expression inhibited invasion and metastasis of MDA-MB-231 LM2 cells in vivo (Tavazoie et al., 2008). [score:5]
The mechanistic connection between AhR and miR-335 was demonstrated by the fact that AhR knockdown abolished the effects of TCDD and MCDF on miR-335 and SOX4 expression as well as the interaction of miR-335 with the SOX4 3′-UTR region (Tavazoie et al., 2008). [score:4]
Both TCDD and MCDF induced miR-335 and decreased SOX-4 expression, whereas MCDF also inhibited MDA-MB-231 LM2 metastasis to the lungs in in vivo tail vein injection assays. [score:4]
In fact, functional interactions between AhR and miR-335 have been described in breast cancer. [score:1]
miR-335 is an anti-metastatic miRNA that can be induced by TCDD and 6-methyl-1,3,8-trichlorodibenzofuran (MCDF) in estrogen receptor (ERα) -negative breast cancer cells. [score:1]
[1 to 20 of 5 sentences]
41
[+] score: 15
MnSOD is a potential target of miR-335, and thioredoxin reductase 2, another antioxidant gene, is a potential target of miR-34a [19]. [score:5]
h Bar graphs showing renal miR-335 expression. [score:3]
Oxidative stress can also be modulated by miRs, such as miR-34a and miR-335, which can promote a senescent profile in mesangial cells obtained from young animals, by antioxidant inhibition [19, 29]. [score:3]
Also on D2, the expression of miR-29b and miR-335 (Fig.   4g, h) did not differ significantly among the IRI, IRI + huMSC and control groups: 7.7 ± 6.8, 5.1 ± 4.3 and 2.2 ± 2.0, respectively, for miR-29b; and 0.5 ± 0.0, 0.2 ± 0.1 and 1.1 ± 0.4, respectively, for miR-335. [score:3]
The miRs studied were miR-29a, miR-29b, miR-335 and miR-34a (Applied Biosystems; Thermo Fisher Scientific). [score:1]
[1 to 20 of 5 sentences]
42
[+] score: 14
For instance, the miRNA miR-335-5p, the top hub node in the network is already known to be a key regulator in suppressing breast cancer metastasis and migration through regulation of targets SOX4 and TNC [52]. [score:7]
The patients with high expression of miR-335 and miR-16 had significantly better survival rates compared to patients with low expression. [score:4]
For instance, Cell-cycle sub-network is mainly regulated by E2F family of TFs (E2F1, E2F2, E2F4, and E2F5), SMAD family of TFs (SMAD2, SMAD3, SMAD4) and miRNAs has-miR-335-5p, has-miR-26b-5p and has-miR16-5p. [score:2]
Further examination of network identified hub miRNAs (hsa-miR-335-5p, hsa-miR-124-3p, hsa-miR-26b-5p, and hsa-miR-16-5p) and TFs (SP1, TCF12, JUN, MYOD1). [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 14
Another hallmark of OA is miRNA-335-5p downregulation in OA MSCs; something that can be therapeutically harnessed in the future, in the field of regenerative medicine. [score:4]
A distinguishing feature of OA MSCs is the down-regulation of miRNA-335-5p. [score:4]
Tornero-Esteban P. Rodriguez-Rodriguez L. Abasolo L. Tome M. Lopez-Romero P. Herranz E. Gonzalez M. A. Marco F. Moro E. Fernandez-Gutierrez B. Signature of microRNA expression during osteogenic differentiation of bone marrow MSCs reveals a putative role of miR-335-5p in osteoarthritis BMC Musculoskelet. [score:3]
Given the role of unbalanced subchondral bone remo deling in the pathogenesis of OA, and the putative therapeutic value of manipulating MSCs in this process [119], miRNA-335-5p -dependent pathways could possibly be therapeutically harnessed in regenerative medicine. [score:1]
Certain OA-related miRNAs, i. e., miRNA-33a, miRNA-455-3p, miRNA-140, and miRNA-335-5p, are actually embedded within the intronic regions of human SREBP-2, COL27A1, WWP2, and MEST, respectively. [score:1]
Of note, the miRNA-335-5p-coding region is actually an intronic miRNA (Figure 1). [score:1]
[1 to 20 of 6 sentences]
44
[+] score: 14
Of these 16 miRNAs, 9 were downregulated (let-7d, miR-106b, miR-122a, miR-141, miR-183, miR-195, miR-200a, miR-335, mir424) and 7 were upregulated (miR-100, miR-199a, miR-296, miR-29a, miR-29c, miR-99a, mir-494). [score:7]
There was little overlap between the targets identified with the two different databases and only 7 targets (FAM44B, BACH1, BCL6, HMGA2, CALU, FGF2, and TNKS2) for 7 miRNAs (let-7 family, miR-98, miR-155, miR-195, miR-346, miR-206, miR-335) were shared between these two databases when the top 3 targets were examined. [score:7]
[1 to 20 of 2 sentences]
45
[+] score: 14
Several examples of miR entities (“let-7i” and “low miR-335 levels”) and disease entities (“colorectal cancer metastasis”, “overall survival”, and “relapse-free survival”) are highlighted in the following sentence fragments: “ let- 7i is associated with colorectal cancer metastasis” and “ low miR- 335 levels in EOC were associated with shorter overall survival and relapse- free survival”Linking entities are cellular processes or target genes through which the miRs association with the disease can be explained. [score:7]
Several examples of miR entities (“let-7i” and “low miR-335 levels”) and disease entities (“colorectal cancer metastasis”, “overall survival”, and “relapse-free survival”) are highlighted in the following sentence fragments: “ let- 7i is associated with colorectal cancer metastasis” and “ low miR- 335 levels in EOC were associated with shorter overall survival and relapse- free survival” Linking entities are cellular processes or target genes through which the miRs association with the disease can be explained. [score:7]
[1 to 20 of 2 sentences]
46
[+] score: 13
Protein-coding genes that interact with each other according to STRING, are associated with schizophrenia and regulated by mir-335 or mir-26b, are shown in Fig.   3. The network contains two main hubs, AKT1 and GABBR1, which, although do not have a direct interaction, both interact with ATF2. [score:3]
We also added the ratio of targets for the top microRNA, miR-335-5p and also for the top five (in Fig.   1). [score:3]
Fig. 3Protein targets of mir-335 and mir-26b and their known interactions according to STRING v9.1 [8], constructed by Cytoscape. [score:3]
What is more, the top microRNA in the set, miR-335, regulates 394 of the 1547 differentially methylated genes (25 %) (Additional file 2: Table S1) whereas it regulates 70 of the 253 (28 %) Genecards genes and 8 of the 19 Malacards genes (42 %) (Table  1). [score:3]
First 10 miRNAs: miR-335-5p, miR-26b-5p, miR-16-5p, miR-124-3p, miR-92a-3p, miR-484, miR-155-5p, let-7b-5p, miR-193b-3p, miR-21-5p. [score:1]
[1 to 20 of 5 sentences]
47
[+] score: 13
Further we observed that miR-335 is up-regulated in low LDL-C baboons but is not expressed in high LDL-C animals. [score:6]
Studies also indicate that the up-regulation of miR-335 and −122 is associated with lipid metabolism in obese mice [30, 31] and chimpanzee [32]. [score:4]
Further, increased expression of miR-335 is associated with elevated lipid metabolism in obese mice [31]. [score:3]
[1 to 20 of 3 sentences]
48
[+] score: 12
Transfection of pre-miR-335 precursor suppressed gastric cancer cell invasion and metastasis by targeting BCL-w and specificity protein 1 (SP1) but has no significant effects on cell proliferation (Ref. [score:5]
Clinicopathological characteristic miRNAs Overall survival and recurrence: miR-10b, miR-21*, miR-214*, miR-335*, miR-375(78, 94, 121, 122, 123, 124, 125, 126, 127, 128) Tumor-suppressor-miRs: Let-7a*, Let-7 g*, miR-125a*, miR-126, miR-146a, miR-142-5p, miR-223, miR-338, miR-433 *miRNAs are also reported to be aberrantly expressed in human ovarian cancer. [score:3]
Low expression of miR-335 was significantly associated with lymph-node metastasis and invasion of lymphatic vessels. [score:3]
In addition, frequently recurring high levels of miR-335 and poor overall survival correlated significantly with high levels of individual miRNAs in patients with gastric cancer (Refs 94, 128). [score:1]
[1 to 20 of 4 sentences]
49
[+] score: 12
Similarly, Heyn et al. described the importance of miR-335 in breast cancer development, since it targets the BRCA1 regulatory cascade [32]. [score:5]
Among these, 15 miRNAs (miR-143, miR-146a, miR-181a, miR-204, miR-222, miR-27a, miR-335, miR-433, miR-491, miR-502, miR-521, miR-92a, miR-127, miR-135b and miR-451) target 211 mRNAs when the confidence limit was set as “Experimentally Observed” only. [score:3]
Gong et al. reported that miR-335 inhibits small cell lung cancer bone metastasis via IGF-IR and RANKL pathways [33]. [score:3]
Another study identified miR-335 as an independent prognostic marker in epithelial ovarian cancer [34]. [score:1]
[1 to 20 of 4 sentences]
50
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-30a, hsa-mir-31, hsa-mir-96, hsa-mir-99a, hsa-mir-16-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-182, hsa-mir-183, hsa-mir-211, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-184, hsa-mir-190a, hsa-mir-195, rno-mir-322-1, rno-let-7d, rno-mir-335, rno-mir-342, rno-mir-135b, hsa-mir-30c-1, hsa-mir-299, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, hsa-mir-382, hsa-mir-342, hsa-mir-135b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-26a, rno-mir-26b, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-96, rno-mir-99a, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-132, rno-mir-143, rno-mir-145, rno-mir-183, rno-mir-184, rno-mir-190a-1, rno-mir-191a, rno-mir-195, rno-mir-211, rno-mir-217, rno-mir-218a-2, rno-mir-218a-1, rno-mir-221, rno-mir-222, rno-mir-299a, hsa-mir-384, hsa-mir-20b, hsa-mir-409, hsa-mir-412, hsa-mir-489, hsa-mir-494, rno-mir-489, rno-mir-412, rno-mir-543, rno-mir-542-1, rno-mir-379, rno-mir-494, rno-mir-382, rno-mir-409a, rno-mir-20b, hsa-mir-542, hsa-mir-770, hsa-mir-190b, hsa-mir-543, rno-mir-466c, rno-mir-17-2, rno-mir-182, rno-mir-190b, rno-mir-384, rno-mir-673, rno-mir-674, rno-mir-770, rno-mir-31b, rno-mir-191b, rno-mir-299b, rno-mir-218b, rno-mir-126b, rno-mir-409b, rno-let-7g, rno-mir-190a-2, rno-mir-322-2, rno-mir-542-2, rno-mir-542-3
Among the miRNAs examined, 79 miRNAs (24%) responded to the hyperandrogenic condition and interestingly, 80% of which were upregulated compared to the control group supporting the notion that hyperandrogenic condition down-regulates androgen receptors in the granulosa cells [35] which could be mediated by these upregulated miRNAs (rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p). [score:9]
A list of differentially expressed miRNAs (Fold change ≥ 2 and their corresponding P value) is presented in Figure  4. Beside this group, miRNAs which were also highly abundant in DHT -treated ovaries are rno-miR-221, rno-miR-222, rno-miR-25, rno-miR-26b, rno-miR-379*, rno-let-7d, rno-miR-24, rno-miR-673, rno-miR-26b, rno-miR-335, rno-miR-382*, rno-miR-412, rno-miR-99a*, rno-miR-543, rno-miR-674-3p, rno-miR-409-3p. [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 12
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
The miR146b-5p [61] and miR-335 [62] miRNAs have been shown to be metastasis suppressors in breast and colon cancers, facilitating the metastatic phenotype at reduced levels [63]. [score:3]
[1 to 20 of 2 sentences]
52
[+] score: 11
Despite strong correlations between fat weight and miR-335 expression in obese mice, there are no experimentally validated targets of miR-335 in adipocytes. [score:5]
In three murine mo dels of obesity including leptin deficient ob/ob mice, leptin receptor deficient db/db mice and KKAy44 mice, miR-335 was found to be upregulated [63]. [score:4]
During adipocyte differentiation miR-335 is strongly induced, suggesting miR-335 may play a role increasing the mature adipocyte population [63]. [score:1]
To date miR-335 has not been identified in miRNA profiling of adipose tissue from obese humans (Table 1). [score:1]
[1 to 20 of 4 sentences]
53
[+] score: 11
Further, an up-regulated expression level of miRNA-335 was determined in murine liver and white adipose tissue. [score:6]
Nakanishi N. Nakagawa Y. Tokushige N. Aoki N. Matsuzaka T. Ishii K. Yahagi N. Kobayashi K. Yatoh S. Takahashi A. The up-regulation of microRNA-335 is associated with lipid metabolism in liver and white adipose tissue of genetically obese mice Biochem. [score:4]
miRNA-335 is involved in increased body, liver and white adipose tissue weight and in heightened cholesterol- and hepatic triglyceride levels [58]. [score:1]
[1 to 20 of 3 sentences]
54
[+] score: 11
We identified that the change in the miRNA expression profile of MIR335 (p-value < 0.808) results in the significant change in the gene expression profile of PTPMT1 (p-value < 8.4☓10 [-4]) between normal liver cells and liver cancer cells (Fig.   4). [score:5]
Dysregulations of MIR141 and MIR335 contributes to dysfunction of DNA damage response and cell proliferation in human HCC, respectively Moreover, we also identified that 5 genes have basal level difference between Hepatocellular Carcinomas (HCCs) and normal cells, including ELAVL1 (P-value < 3.69☓10 [-5]), JMJD1C (P-value < 3.59☓10 [-11]), GADD45A (P-value < 7.32☓10 [-11]), EIF2AK3 (P-value < 5☓10 [-5]), and GSN (P-value < 1.19☓10 [-2]), which is mainly due to DNA methylation of the corresponding genes (Fig.   4). [score:2]
Dysregulation of MIR335 contributes human HCC cell proliferation. [score:2]
Therefore, we suggested that dysregulation of MIR335 contributes human HCC cell proliferation. [score:2]
[1 to 20 of 4 sentences]
55
[+] score: 10
MiRNA prediction tools included: miRanda [34], RNA22 [35], TargetScan [36], and MiRWalk [37] Combined with CD133 molecular regulation and human umbilical cord blood mononuclear cell s expressed miRNA two aspects of information, the final confirmation of the following 12 miRNA [19]: hsa-miR-29a-3p, hsa-miR-29b-3p, hsa-miR-200c-3p, hsa-miR-4423-5p, hsa-miR-335-3p, hsa-miR-142-3p, hsa-miR-142-5p, hsa-miR-22-3p, hsa-miR-30a-5p, hsa-miR-30e-5p, hsa-miR-377-3p and hsa-miR-4739 (Supplementary Table  2). [score:6]
Combined with CD133 molecular regulation and human umbilical cord blood mononuclear cells expressed miRNA two aspects of information, the final confirmation of the following 12 miRNA [19]: hsa-miR-29a-3p (Fig.   4A), hsa-miR-29b-3p (Fig.   4B), hsa-miR-200c-3p (Fig.   4C), hsa-miR-4423-5p (Fig.   4D), hsa-miR-335-3p (Fig.   4E), hsa-miR-142-5p (Fig.   4G), hsa-miR-22-3p (Fig.   4H), hsa-miR-30a-5p (Fig.   4I), hsa-miR-30e-5p (Fig.   4J), hsa-miR-377-3p (Fig.   4K) and hsa-miR-4739 (Fig.   4L) showed no difference between CD133+HUCB-MNC cells and CD133−HUCB-MNC cells. [score:4]
[1 to 20 of 2 sentences]
56
[+] score: 10
There were however seven microRNAs (miR-335-3p, miR-128, miR-224-5p, miR-28-5p, miR-191-5p, miR-423-3p, and miR-181a-5p) with a statistically significant upregulation in the controls. [score:4]
Two of these seven microRNAs, miR-335-3p, and miR-181a-5p are also validated extracellular matrix targeting microRNAs [30, 31, 70– 72]. [score:3]
Chen C Wu CQ Zhang ZQ Yao DK Zhu L Loss of expression of miR-335 is implicated in hepatic stellate cell migration and activationExp Cell Res. [score:3]
[1 to 20 of 3 sentences]
57
[+] score: 10
Previous studies have demonstrated that rifampin also inhibited anti-angiogenesis by regulating the expression of multiple miRNAs (miR-34b, miR-886-3p, miR-218, miR-576-3p, miR-200c, miR-616, miR-660, miR-335, miR-92a), and further induced the gene expression of BIRC3, CAV1, CAV2, FN1, ITGA1 and THBS1. [score:8]
The results suggest that miR-335 influences drug metabolism through negative regulation of CYP2E1, which is a drug metabolizing enzyme that is affected by rifampin treatment. [score:2]
[1 to 20 of 2 sentences]
58
[+] score: 10
PEG1 is a known downstream target of PAX3 and it is likely that the PAX3-FKHR fusion in ARMS might influence the transcription of PEG1 and miR-335 in ARMS. [score:3]
The first significant study of miRNAs in chondrosarcoma tissue samples and cell lines revealed downregulation of let-7a, miR-100, miR-136, miR-222, miR-335, and miR-376a compared to normal chondrocytes (Yoshitaka et al., 2013; Nugent, 2014). [score:3]
The other myomiR, miR-335, is overexpressed in ARMS (Yan et al., 2003). [score:3]
miR-335 is located within intron 2 of PEG1 that plays a role in muscle differentiation. [score:1]
[1 to 20 of 4 sentences]
59
[+] score: 10
For example, conserved helix-loop-helix ubiquitous kinase (CHUK), which is also known as IKK1, a protein kinase that plays an important role in pancreatic cancer and prostate cancer by regulating the NF-kB transcription factor, has two in dels that may disrupt targeting by miR-223; RB1 contains one in del in target site of miR-335; STAT3 contains two in dels in target sites of miR-9 and miR-125b; and FOXO1 and EFGR have in dels in target sites of miR-9 and miR-7 respectively. [score:10]
[1 to 20 of 1 sentences]
60
[+] score: 9
42) 13 hsa-mir-199b dbDEMC, HMDD, miR2Disease 38 hsa-mir-206 dbDEMC 14 hsa-mir-181a dbDEMC, miR2Disease 39 hsa-mir-192 dbDEMC 15 hsa-mir-29a dbDEMC, HMDD, miR2Disease 40 hsa-mir-335 literature 16 hsa-let-7e dbDEMC 41 hsa-mir-365 literature 17 hsa-mir-107 HMDD 42 hsa-mir-30a miR2Disease 18 hsa-mir-18a higher RWRMDA (No. [score:9]
[1 to 20 of 1 sentences]
61
[+] score: 9
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-210, hsa-mir-215, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-369, hsa-mir-371a, hsa-mir-340, hsa-mir-133b, hsa-mir-146b, hsa-mir-519e, hsa-mir-519c, hsa-mir-519b, hsa-mir-519d, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-499a, hsa-mir-504, hsa-mir-421, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-190b, hsa-mir-301b, hsa-mir-302e, hsa-mir-302f, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-371b, hsa-mir-499b
Overexpression of both forms in vitro led to premature cellular senescence, whereas antisense -mediated knockdown of miR-335 and miR-34a in old cells delayed cellular senescence [76]. [score:4]
Bai X. Y. Ma Y. Ding R. Fu B. Shi S. Chen X. M. miR-335 and miR-34a Promote renal senescence by suppressing mitochondrial antioxidative enzymes J. Am. [score:3]
Two miRNAs have been reported which regulate these enzymes; miR-335 and miR-34a. [score:2]
[1 to 20 of 3 sentences]
62
[+] score: 9
Of interest, a functional role in the regulation of epithelial-to-mesenchymal transition and a neoplastic development in breast tissue has also been attributed to miR-335 [136]. [score:3]
A proposed MSC mo del suggested that high miR-335 expression contributes to a potential non-activated (silenced) MSC auto-maintenance state, in contrast to low levels of miR-335 which produce an activated state leading to proliferation, migration and differentiation in MSC [132]. [score:3]
MSC within a primary culture can also exhibit different states of activation which can be related to the expression levels of certain micro RNAs (miR) including miR335 [132]. [score:3]
[1 to 20 of 3 sentences]
63
[+] score: 8
RT-qPCR was performed to evaluate the expression levels of hsa_circ_0043497 (A) and its top 5 predicted miRNA targets (miR-335-3p, miR-186-5p, miR-380-5p, miR-296-3p and miR-522-3p) (B), hsa_circ_0001204 (C) and its top 5 predicted miRNA targets (miR-612, miR-657, miR-362-3p, miR-377-3p and miR-136-5p) (D) in ten human MDMs after 24 h of infection with H37Rv. [score:5]
The potential miRNAs targets of hsa_circ_0043497 include miR-335-3p, miR-186-5p, miR-380-5p, miR-296-3p and miR-522-3p. [score:3]
[1 to 20 of 2 sentences]
64
[+] score: 8
In contrast, in the expression of miR-21 and miR-335 peaked later on day 8, decreasing slightly thereafter, resulting in higher expression (Figure  4B). [score:5]
Furthermore, expression of miRNAs miR-21 and miR-335 associated with elevated chemoresistance [42- 44] was increasing in 2D culture until day 4 and then constantly decreasing until day 10. [score:3]
[1 to 20 of 2 sentences]
65
[+] score: 8
Downregulation of tenascin-C by miR-335 or shRNA in human cancer cells in a mouse xenograft mo del inhibits metastasis formation [7], and in tenascin-C -deficient mice, metastasis formation of tenascin-C positive cancer cells is also suppressed [9]. [score:8]
[1 to 20 of 1 sentences]
66
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-328, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Recently, ethanol was shown to decrease the expression of miR-335 and miR-9 in the fetal neural stem-cell population and this altered microRNA expression was suggested to be due to hypo-methylation was extensive studied and reviewed before [112, 121, 145, 146, 147, 148]. [score:5]
Ethanol exposure to neurons in culture decreased the expression of miR-9, miR-21, miR-153 and miR-335 [110, 111, 112]. [score:3]
[1 to 20 of 2 sentences]
67
[+] score: 8
Moreover, Mir34c and Mir335, along with Mir206, are up-regulated following myoblast differentiation in vitro (Greco et al., 2009), whereas Mir214 promotes cell cycle exit and skeletal muscle differentiation (Juan et al., 2009, Liu et al., 2010). [score:3]
Interestingly, we observed an up-regulation of factors that favor muscle differentiation and maturation, including myoD1, myogenin, Il4, Mir24, Mir206, Mir34c, Mir335, and Mir214. [score:3]
We observed that Mir24, Mir34c, Mir335, and Mir214 were significantly up-regulated in the diaphragm of moAb-Il6r -treated mdx mice compared to untreated mdx littermates (Fig.  4G–M). [score:2]
[1 to 20 of 3 sentences]
68
[+] score: 8
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
The retinoblastoma binding protein 8 gene (RBBP8) is a predicted target of miR-31, miR-126, miR-130a, and miR-335 and is a putative tumor suppressor. [score:5]
On the other hand, Clusterin (CLU) is a predicted target of miR-99a, miR-100, miR-126, and miR-335 and is commonly associated with tumorigenesis and malignant progression in part through TGF-miR-135a, miR-135b, miR-181a, and miR-181b [65]. [score:3]
[1 to 20 of 2 sentences]
69
[+] score: 8
In addition, miR-335 may also directly target RUNX2 [34] or increase the expression of chondrogenic marker genes [35]. [score:6]
The functional roles of miR-335-5p are, however, controversial. [score:1]
Interestingly, microRNAs with the highest changes were related to the osteogenesis of BMSC, including has-miR-146a, has-miR-135b, miR-378, miR-335-5p and miR-210. [score:1]
[1 to 20 of 3 sentences]
70
[+] score: 8
Importantly, the observed changes in miRNA expression (e. g., miR-150 and miR-335) were found immediately after the start of mutant Atxn1 expression in SCA1 mice and prior to phenotypic onset, showing that the deregulation of miRNA expression in the cerebellum of transgenic mice contributes to the early pathogenesis of SCA1. [score:8]
[1 to 20 of 1 sentences]
71
[+] score: 7
Dysregulation of the microRNA let-7e and down-regulation of miR-30c, miR-130a, and miR-335 indicate direct involvement of some miRNAs in the development of chemoresistance [15]. [score:7]
[1 to 20 of 1 sentences]
72
[+] score: 7
Recent studies indicate that the up-regulation of miR-335 and 122 is associated with lipid metabolism in obese mice [18, 19]. [score:4]
We also detected expression of miRNA-335 and 122, which are associated with lipid metabolism [19]. [score:3]
[1 to 20 of 2 sentences]
73
[+] score: 7
On the other hand, HDAC inhibition also determined coherent up- or down-modulation of several miRNAs directly involved in positive (e. g. mir-129-3p, mir-193b, mir-370) or negative (e. g. mir-196b, mir-335, mir-370) control of cell cycle [44], [45], [46], [47], [48], [49], thus suggesting the existence of an epigenetically regulated negative loop protecting CD34 [+] cells from unrepressed cellular growth, and reinforcing the anti proliferative effect exerted by small cyclin/CDK inhibitors such as p14 [ARF], p16 [INK4] and p21 [Cip1/Waf1] gene products (Figure 2E). [score:7]
[1 to 20 of 1 sentences]
74
[+] score: 7
Notably, MYCN has been recently discovered to bind and transcriptionally downregulate another epigenetically controlled miRNA, miR-335, which in turn regulates genes in the TGF-β non-canonical pathway, such as the Rho -associated coiled-coil containing protein (ROCK1), MAPK1 and putative member LRG1, leading to inhibition of invasiveness and migratory potential of NB cells [117]. [score:7]
[1 to 20 of 1 sentences]
75
[+] score: 7
When the same mo del was analyzed by Zhou et al. [19], peritoneal fibrotic tissues displayed upregulation in 8 miRNAs (miR-205, miR-664, miR-352, miR-146b-5p, predicted miR-160, miR-132, miR-15b, and let-7d) while 15 were downregulated (miR-335, miR-923, miR-801, miR-200a, miR-801, miR-30a, miR-193a-3p, miR-193b, miR-29b, miR-203, miR-148a, miR-709, miR-192, miR-15a, and miR-26b) [19]. [score:7]
[1 to 20 of 1 sentences]
76
[+] score: 7
The most significantly upregulated human miRNAs were miR-513a-3p, miR-298, and miR-206; whereas miR-99a, miR-200 family, miR-199b-5p, miR-100, and miR-335 were the most significantly downregulated miRNAs. [score:7]
[1 to 20 of 1 sentences]
77
[+] score: 7
Regeneration-miRNAs were up-regulated (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), while degenerative-miRNAs (miR-1, miR-29c, and miR-135a) were down-regulated in mdx mice and in DMD patients’ muscles. [score:7]
[1 to 20 of 1 sentences]
78
[+] score: 6
Other miRNAs from this paper: hsa-mir-155, hsa-mir-584, hsa-mir-543
Recent studies have demonstrated that eNOS expression is negatively regulated by a reduction of its mRNA stability via the biogenesis of miRNAs such as miR-155, miR-335, miR-543 and miR-584, 9, 36, 37 which target the eNOS 3′-UTR. [score:6]
[1 to 20 of 1 sentences]
79
[+] score: 6
For example, upregulated mRNAs showed underrepresented binding for the tumor suppressive let-7 miRNA family and for the metastasis repressor miR-335. [score:6]
[1 to 20 of 1 sentences]
80
[+] score: 6
The fact that miR-335 knockdown reverses the effects of miR-21 knockdown in the cell proliferation and death also supports this possibility (Sathyan et al., 2007). [score:3]
In a comprehensive miRNA profiling study using a neurosphere mo del of alcohol exposure, Miranda and his colleagues found a reduction in expressions of miR-21, miR-335, miR-9, and miR-153 24 h after exposure (Sathyan et al., 2007). [score:3]
[1 to 20 of 2 sentences]
81
[+] score: 6
detected the expression profile of miRNAs from blood samples of influenza A H1N1 virus-infected patients and then exhibited that the expression levels of 193 miRNA molecules were altered in all influenza patients, of which 16 highly dysregulated miRNAs (miR-1260, miR-1285, miR-18a, miR-185*, miR-299-5p, miR-26a, miR-30a, miR-335*, miR-34b, miR-519e, miR-576-3p, miR-628-3p, miR-664, miR-665, miR-765 and miR-767-5p) were able to provide a clear distinction between infected and healthy individuals [39]. [score:6]
[1 to 20 of 1 sentences]
82
[+] score: 6
miR-324, together with four other miRNAs that show isoform differences in tumor versus non-tumor samples (miR-106b, miR-335, and miR-411), also exhibited variations in the major arm of the pre-miRNA expressed as a miRNA (Table S2, S3, S4, S6). [score:3]
In particular, 5′ end sequence heterogeneity may have functional implications as there are observable differences in the dominant isoforms for a few miRNAs (miR-335, miR-106b, miR-324) expressed in glioblastomas. [score:3]
[1 to 20 of 2 sentences]
83
[+] score: 6
Breast cancer metastatic process has been connected with up-regulation of miR-10b [44] and with loss of expression of miR-126 and miR-335 [45]. [score:6]
[1 to 20 of 1 sentences]
84
[+] score: 6
For example, hsa-miR-335*, recently implicated in breast tumor suppression [38], is substantially linked to targets in Module 7, which in turn are significantly enriched in genes with transcriptional regulatory roles. [score:6]
[1 to 20 of 1 sentences]
85
[+] score: 6
Kim Y, Kim H, Park D, Jeoung D. miR-335 Targets SIAH2 and Confers Sensitivity to Anti-Cancer Drugs by Increasing the Expression of HDAC3. [score:5]
These include miR-145, let-7d, miR-335, miR-98, miR-181a, miR-200a, miR-373*, miR-575, miR-335, miR-96-5p, miR-190a, miR-29c-3p, and miR-219-5p [7, 8, 13, 14]. [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 6
Finally, we performed a miRNA target enrichment analysis of the list of switch genes by using miRTarBase [62] and we found miR-335 and miR-215 as the most enriched miRNAs with the highest number of targets among switch genes (Supplementary Table  S11). [score:5]
Interestingly, miR-335 is capable of inducing glioma cell differentiation by activating cAMP/protein kinase A (PKA) pathway [83], while the induction of miR-215 serves for maintaining glioblastoma stem-like cells [84]. [score:1]
[1 to 20 of 2 sentences]
87
[+] score: 6
Although miR-126 inhibits tumor growth and cell proliferation, miR-335 specifically suppresses metastatic invasion by repressing the transcription factor SOX4 and the extracellular matrix protein tenascin C. A further involvement of miR-126 in the metastatic setting was recently defined by the Tavazoie group (72). [score:5]
Another important study in the comprehension of miRNA involvement in metastatic spread came from the Massague lab, which has discovered that miR-335, miR-126, and miR-206 are lost in human lung and bone metastatic cells (71). [score:1]
[1 to 20 of 2 sentences]
88
[+] score: 5
IPA analyses predicted GRIN2A (miR-4449); IRAK3 (miR-4674); MAPT (miR-146a); ADAM19, BDNF (miR-335) and mTOR, TARDPB (miR-100) as targets of our deregulated miRNAs from set A (S4 Dataset). [score:4]
After substitution of missing values by group mean, miR-4449, miR-1274a, miR-146a, miR-335 and miR-100 were found as reliable candidates with RF ≥ 0.8 (Fig 2B). [score:1]
[1 to 20 of 2 sentences]
89
[+] score: 5
Other miRNAs from this paper: hsa-mir-338
Wang et al. [36] affirmed that TUG1 might affect ROCK1 expression, which could mediate migration/invasion to influence prognosis, by working as a ceRNA manner by targeting miR-335-5p. [score:5]
[1 to 20 of 1 sentences]
90
[+] score: 5
Of significant interest are miRNAs with pro-fibrotic effect (miR-32, miR-155 and miR-15b*) exhibiting an increased expression, and miRNAs with an anti-fibrotic effect (miR-18a, miR-18*, miR-19a*, miR-19b-1*, miR-200a* and miR-335*) showing lower expression in cirrhotic livers (data not shown) [42- 44]. [score:5]
[1 to 20 of 1 sentences]
91
[+] score: 5
For example, miR-335 was shown to influence HSC migration and activation via, at least in part, inhibition of tenascin-C (TNC) expression [22]. [score:5]
[1 to 20 of 1 sentences]
92
[+] score: 5
In G1 (down-regulated), the stages from 35 to 63 dpc showed the most significant differences between breeds, in which miR-20, miR-499, miR-451 and miR-335 had drastic changes. [score:4]
By contrast, in G1 (down), 35–63 dpc showed the most significant differences between breeds; in this group, miR-20, miR-451, miR-499 and miR-335 showed drastic changes. [score:1]
[1 to 20 of 2 sentences]
93
[+] score: 5
miRNAs, such as miR-335, are known to target SOX4, suppressing metastasis and migration in breast cancer [3]. [score:5]
[1 to 20 of 1 sentences]
94
[+] score: 5
Further, 6 miRNAs (miR-302b-3p, miR-335-5p, miR-338-3p, miR-34c-5p, miR-29c-3p and miR-34a-35p) with more verified target genes and TFs than others in lung cancer review literatures were screened, suggesting these 6 miRNAs might play critical roles in the suppression of lung cancer metastasis by curcumin. [score:5]
[1 to 20 of 1 sentences]
95
[+] score: 5
Conversely, miR-335 suppressed invasion through the TGF-β pathway [16], and miR-9 and miR-542-5p over -expression in human NB primary tumors associated to a better survival [12, 18, 23], making unlikely a positive role in the human metastatic process. [score:5]
[1 to 20 of 1 sentences]
96
[+] score: 4
Yan et al. demonstrated that deregulated miR-335 that targets MAPK1 was implicated in poor outcome of pediatric acute lymphoblastic leukemia [28, 39, 40]. [score:4]
[1 to 20 of 1 sentences]
97
[+] score: 4
Lynch et al. demonstrated that LRG1, regulated by a potent suppressor miR-335, was involved in cell migration, invasion and metastasis [21]. [score:4]
[1 to 20 of 1 sentences]
98
[+] score: 4
In addition, miR-335 and miR-126 are also reported to be associated with the ability of breast cancer cells to metastasize to the lung and bone by directly suppressing the ECM component tenascin c (TNC) (77). [score:4]
[1 to 20 of 1 sentences]
99
[+] score: 4
Another microRNA, miR-335, has been identified as metastasis suppressor microRNA in human breast cancer [39]. [score:3]
Likewise, the microRNAs miR-200c, miR-205, miR-206 and miR-335 previously reported to be involved in invasion and metastasis [38- 40] are reduced in the 3D stem cell promoting cultures in 293T cells. [score:1]
[1 to 20 of 2 sentences]
100
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Ethanol exposure down-regulate miR-21, miR-335, miR-9, and miR-153 (Sathyan et al., 2007). [score:4]
[1 to 20 of 1 sentences]