sort by

58 publications mentioning hsa-mir-339

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-339. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 192
Other miRNAs from this paper: rno-mir-339
Overexpression of miRNA-339 Upregulates the Acetylated NF- κB and FOXO1 Expression Level in SH-SY5Y CellsOur results showed that Sirt2 is the direct target of miR-339, indicating that miR-339 can contribute to an upregulation of the acetylated status of Sirt2 target, including NF- κB and FOXO1. [score:16]
Our present data showed that Sirt2 is likely a direct target of miRNA-339, which leads to a better explanation as to why acupuncture upregulated miRNA-339 expression companion with acupuncture downregulation of Sirt2 expression in hypertensive rats. [score:14]
To further validate whether knockdown of miRNA-339 can upregulate Sirt2 expression in rat neurons, we tested the effect of miRNA-339 on Sirt2 expression level in NGF -induced PC12 cells transfected with miRNA-339 inhibitor. [score:11]
Our results showed that Sirt2 is the direct target of miR-339, indicating that miR-339 can contribute to an upregulation of the acetylated status of Sirt2 target, including NF- κB and FOXO1. [score:9]
Overexpression of miRNA-339 Upregulates the Acetylated NF- κB and FOXO1 Expression Level in SH-SY5Y Cells. [score:8]
To further validate whether miRNA-339 could downregulate Sirt2 expression in human neurons, we tested the effect of miRNA-339 on Sirt2 expression level in SH-SY5Y cells transfected with miRNA-339 mimic. [score:8]
To further validate whether miRNA-339 can downregulate Sirt2 expression in rat neurons, we tested the effect of miRNA-339 on Sirt2 expression level in NGF -induced PC12 cells transfected with miRNA-339 mimic. [score:8]
Overexpression of miRNA-339 Downregulates Sirt2 Expression in Rat PC12 Cells. [score:8]
In this paper, we firstly found that one of the acupuncture-regulated targets, Sirt2, is likely a direct target of acupuncture-regulated miRNA-339 in neurons. [score:8]
Overexpression of miRNA-339 Downregulates Sirt2 Expression in Human SH-SY5Y Cells. [score:8]
To validate whether Sirt2 is a likely target of miR-339, we performed computational miRNA target analysis, which showed that miRNA-339 was able to bind to the Sirt2 mRNA 3′-UTR, suggesting this gene might be a potential target for miRNA-339 (Figure 1(a)). [score:7]
Taken together, we proposed that acupuncture exerts its therapeutic effects through a series of biological processes including (Figure 6) (1) changes of miRNAs (such as miR-339); (2) changes of targets (such as Sirt2); and (3) altered expression levels of Sirt2 activating its targets such as NF κB and FOXO1. [score:7]
Knockdown of miRNA-339 Upregulates Sirt2 Expression in Rat PC12 Cells. [score:7]
Cells were seeded in six-well plates at 1 × 10 [5] cells/well and transfected with different concentration of miRNA-339 mimic, miRNA-339 inhibitor, or nontargeting miRNA control (10 and 50 nM) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. [score:5]
Overexpression of miRNA-339 significantly decreased Sirt2 expression in a dose -dependent (Figure 2(a), P < 0.01 versus control) and time -dependent manner (Figure 2(b), P < 0.05 versus control). [score:5]
The nontargeting miRNA control, miR-339 mimic, and miR-339 inhibitor were obtained from Invitrogen. [score:5]
Overexpression of miRNA-339 significantly decreased Sirt2 expression in a dose -dependent (Figure 3(a), P < 0.01 versus control) and time -dependent manner (Figure 3(b), P < 0.001 versus control). [score:5]
In addition, we demonstrated that altered Sirt2 expression by miR-339 activates its targets such as NF- κB and FOXO1 through increasing their acetylation. [score:5]
Moreover, to examine whether miR-339 could repress Sirt2 expression through direct 3′-UTR interaction, we cloned Sirt2 3′-UTR luciferase reporter plasmid and performed reporter analysis in SH-SY5Y cells. [score:4]
Knockdown of miRNA-339 significantly increased Sirt2 expression in a dose -dependent (Figure 4(a), P < 0.01 versus control) and time -dependent manner (Figure 4(b), P < 0.001 versus control). [score:4]
Overexpression and Knockdown of miR-339 via Transfection. [score:4]
There are three transcript isoforms of Sirt2 gene, including isoform 1 (43 kD), isoform 2 (39 kD), and isoform 5, but only 43 kD Sirt2 was affected after miR-339 overexpression or knockdown according to our present data. [score:4]
These data indicated that Sirt2 was likely a direct target of miR-339. [score:4]
Luciferase Assay Implies That Sirt2 Is Likely a Direct Target of miRNA-339 in SH-SY5Y Cells. [score:3]
Our findings implied that acupuncture may act through epigenetic changes and subsequent action on their targets, such as miRNA-339/Sirt2/NF- κB/FOXO1 axis. [score:3]
Our data also showed that miR-339 increased the acetylated NF- κB and FOXO1 expression level. [score:3]
Bioinformatics Studies and Selection of Sirt2 as a Potential Target of miR-339. [score:3]
Our present data demonstrated that cotransfection of miR-339 mimic with Sirt2 3′-UTR reporter resulted in dose -dependent inhibition of luciferase activity in SH-SY5Y cells (Figure 1(b), P < 0.05 versus control). [score:3]
As we expected, overexpression of miRNA-339 significantly increased the acetylation level of NF- κB and FOXO1 in a time -dependent manner (Figures 5(a) and 5(b), P < 0.01 versus control). [score:3]
The bioinformatics study showed that seven miRNAs, including miR-339, were predicted to regulate the human Sirt2 gene by the microRNA. [score:2]
Further studies are needed to validate whether miR-339 increased the acetylated NF κB and FOXO1 by regulating the protein levels, stability, or activity of Sirt2. [score:2]
In this study, we investigated if the regulation of sirtuin 2 (Sirt2) was regulated by miR-339 in human and rat neurons. [score:1]
However, miR-339 failed to repress the activity of Sirt2-3′-UTR reporter with a mutated miR-339 seed sequence (Figure 1(b)). [score:1]
To test this hypothesis, we measured the acetylated status of Sirt2 target (NF- κB and FOXO1) in SH-SY5Y cells treated with miRNA-339 mimic. [score:1]
A possible limitation of the present study was that some physiological level changes of neurons after altering the miR-339 levels are needed to validate the proposed therapeutic role of miR-339/Sirt2/NF κB/FOXO1 axis in response to acupuncture therapy in the future work. [score:1]
): sense, 5- CTAGTTTAACTCTTCCACGCCCGAGGGATCCA-3; and antisense, 5- AGCTTGGATCCCTCGGGCGTGGAAGAGTTAAa-3. SH-SY5Y cells were cultured in six-well plates at 1 × 10 [5] cells/well and transfected with different reporter vectors (300 ng Luc-Empty, 300 ng Luc-Sirt2-3′-UTR, or 300 ng Luc-Sirt2-3′-UTR-mut) and cotransfected with different concentration of miRNA-339 mimic (10 and 50 nM). [score:1]
): sense, 5- CTAGTTTAACTCTTCCACGCCCGAGGGATCCA-3; and antisense, 5- AGCTTGGATCCCTCGGGCGTGGAAGAGTTAAa-3. SH-SY5Y cells were cultured in six-well plates at 1 × 10 [5] cells/well and transfected with different reporter vectors (300 ng Luc-Empty, 300 ng Luc-Sirt2-3′-UTR, or 300 ng Luc-Sirt2-3′-UTR-mut) and cotransfected with different concentration of miRNA-339 mimic (10 and 50 nM). [score:1]
[1 to 20 of 37 sentences]
2
[+] score: 159
339 was upregulated (Fig.   9b), miR-339, -663b, and -95 were downregulated (Fig.   10c) and CCNE2 protein expression was increased (Fig.   10d). [score:9]
339 functions as an “entrapper” for CCNE2 targeting miR-339, -663b, and -95 leading to upregulation of CCNE2 and increased tumor growth and migration Increased expression of uc. [score:8]
MiR-339-5p is downregulated in breast cancer cell lines, where it inhibits cell migration and invasiveness, and represents a marker of bad prognosis when downregulated [41]. [score:8]
As a result, the mRNA of CCNE2 (which we also show is a direct target of miR-339, -663b, and -95) is released from the post-transcriptional regulation exerted by the three miRNAs, and the expression of CCNE2 is increased, leading to increased cell proliferation and motility. [score:7]
339 indirectly affected CCNE2 expression levels by inducing downregulation of miR-339, -663b, and -95. [score:7]
339 overexpressing cells, the upregulation of CCNE2 could be reversed by co-transfection with miR-339, -663b, or -95 (Fig.   7c). [score:6]
We observed downregulation of miR-339, -663b, and -95 when A549, H460, H1299, and LoVo cells were stably expressing uc. [score:6]
339 induces downregulation of miR-339, -663b, and -95, increased (or reduced) levels of the three miRNAs do not affect the expression of uc. [score:6]
339 functions as an “entrapper” for CCNE2 targeting miR-339, -663b, and -95 leading to upregulation of CCNE2 and increased tumor growth and migration This work identifies uc. [score:6]
339 affects the expression of CCNE2 and cancer cell viability by modulating the expression of miR-339, -663b, and -95 through a mechanism that “traps” the miRNA in the uc. [score:5]
First, we transfected A549, H460, and the TP53 -null H1299 cells with a plasmid -expressing wt TP53 or with its empty plasmid counterpart, and determined the effects on miR-339, -663b, and -95 and CCNE2 expression, by qRT-PCR and immunoblotting, respectively. [score:5]
339- miR-339/ -663b/-95-CCNE2 axis in 22 primary NSCLC samples, where we observed that when TP53 was downregulated and uc. [score:4]
339 sequesters miR-339, -663b, and -95 (Figs.   5 and 6) leading to upregulation of CCNE2 (Fig.   7) and increased tumor growth and migration both in vitro and in vivo (Figs.   2 and 3). [score:4]
339 was silenced with two different siRNAs, upregulation of miR-339, - 663b, and -95 was detected in all four tested cell lines, by qRT-PCR (Fig.   5c). [score:4]
When A549 and H1299 cells were transfected with M1 or M2, no downregulation of miR-339, -663b, or -95 was observed (Fig.   8c), suggesting that TREs affect the ability of all three miRNAs (including those whose MBE is distant from the specific TRE) to bind to uc. [score:4]
The expression of miR-339-3p is dysregulated in the more aggressive NSCLC, identified in later years of screening by computed tomography [43], suggesting a role for this miRNA in lung carcinogenesis. [score:4]
To analyze the direct targeting of miR-339-3p, -663b-3p, and -95-5p on the CCNE2 mRNA, the LightSwitch 3′UTR vector containing the CCNE2 3′-UTR was purchased from the LightSwitch 3′UTR Reporter GoClone Collection of SwitchGear Genomics. [score:4]
Our study shows that CCNE2 is directly targeted by miR-339, -663b, and -95. [score:4]
339 that is complementary with miR-339 (Fig.   6b), and used as control a clone with no targeting gRNA (H1299 CTRL clone 18). [score:3]
339 is expressed much less than miR-339, -663b, and -95 in cancer cells (Supplementary Fig.   1a), raising the concern on whether uc. [score:3]
Moreover, miR-339-5p promotes resistance of glioma cells to cytotoxic T-lymphocytes, by targeting ICAM-1 [42]. [score:3]
a qRT-PCR for miR-339, -663b, and -95 in A549, H460, and H1299 cells transfected with a plasmid -expressing TP53 (or its empty plasmid counterpart) and in A549 and H460 cells transfected with an anti- TP53 siRNA (si- TP53) [or its anti-scrambled control (si- SCR)] after 72 h from the transfection. [score:3]
We decided to focus on Cyclin E2 (CCNE2) as it has been shown to have oncogenic role in NSCLC 15– 19, and is also a predicted target for miR-339, -663b, and -95 20– 22. [score:3]
339 as an oncogene in NSCLC by entrapping miR-339, -663b, and -95, and preventing their targeting of oncogenic CCNE2, leading to increased tumor growth and migration. [score:3]
339 also had lower expression of miR-339 and miR-663b, but higher levels of CCNE2 mRNA (Fig.   7d). [score:3]
b qRT-PCR for miR-339, -663b, and -95 in A549, H460, H1299, and LoVo cells infected with a lentiviral vector overexpressing uc. [score:3]
339 knockout NCI-H1299 cell line for miR-339-3p MBE. [score:2]
339 exerts its oncogenic function, at least in part, by entrapping complementary mature miR-339, -663b, and -95 and releasing oncogenic CCNE2 from its miRNA-controlled regulation in NSCLC (Fig.   10e). [score:2]
339 knockout NCI-H1299 cell line for miR-339-3p MBEOne pair of gRNAs were designed by GenScript flanking 24 bp of the core sequence “CCGGCTCCCGGGCCCCGCGGCGCC”. [score:2]
339 structure using the ViennaRNA Package 2, and identified two elements in close proximity with, but located outside of the miR-339 and the miR-663b binding sites, whose deletion completely changed the predicted secondary RNA structure of the uc. [score:1]
339, miR-339, miR-663b, and CCNE2 in two nude mice injected subcutaneously with A549 LV-E or A549 LV- uc. [score:1]
339 harbors three sequences complementary to the mature sequence of miR-339, -663b, and -95, and that uc. [score:1]
Using such rationale and strategy, we designed Δ117-CTCCC-121 for miR-339-3p TRE and Δ249-TCCCG-253 for miR-663b-3p TRE deletions. [score:1]
The precursors of miR-95-5p, -339-3p, and -663b-3p and si-miR-339-3p, -663b-3p, and -95-5p (as well as the scrambled miRNA negative control #1) were purchased from Ambion, and were transfected in cell lines at a final concentration of 100 nM, by using Lipofectamine [®] 2000 (Invitrogen), according to the manufacturer’s instructions. [score:1]
339 transcript is at least in part affected by the presence of the MBE for miR-339 in the uc. [score:1]
For miR-339-3p, probe # 38578-15 (Exiqon) and for miR-663b-3p, probe # 21359-15 (Exiqon) were used. [score:1]
c qRT-PCR for miR-339, -663b, and -95 in the same 22 primary NSCLC samples described in Fig.   9b. [score:1]
339 in H1299 cells wild-type (clone 18) or in clones #20 and #102 of H1299 in which the MBE for miR-339 has been deleted with CRISPR/Cas9 technology. [score:1]
In bold, the predicted miRNA -binding elements (MBEs) for miR-339 or miR-663b. [score:1]
339 and transfected with miR-339, -663b, and -95 or a scrambled miRNA (SCR) for 48 h from transfection. [score:1]
A549, H460, H1299, and LoVo cells were co -transfected with a plasmid carrying the CCNE2 3′-UTR region cloned downstream of the luciferase reporter gene, and miR-339, -663b, -95, or a scrambled miRNA as a control. [score:1]
Of the three interacting miRNAs, miR-339-3p is very conserved among species, miR-95-5p is conserved in humans, pig, dog, cow, and horse, but not in mouse; so it evolved after the mouse appearance, but long before humans, whereas miR-663b-3p is primate specific. [score:1]
H1299 CRISPR clones 20 and 102 (with endogenous deletion of miR-339 MBE on the uc. [score:1]
Retrotranscription of miR-339-3p, -663b-3p, and -95-5p was carried out by using the TaqMan [®] MicroRNA Reverse Transcription kit (Applied Biosystems), according to the manufacturer’s instructions and qRT-PCRs were made in triplicate with the TaqMan [®] Universal PCR Master Mix, no AmpErase [®] UNG reagents (Applied Biosystems), according to the manufacturer’s instructions. [score:1]
339, miR-339, 663b, and CCNE2 mRNA in ex vivo xenografts from mice injected with A549 LV-E or A549 LV- uc. [score:1]
339 transcript with the RNAhybrid algorithm [14] revealed the presence of sequences complementary to three mature miRNAs (namely, miR-339-3p, -663b-3p, and -95-5p from now on referred to as miR-339, -663b, and -95, respectively) in the uc. [score:1]
339 in which the MBEs of miR-339, -663b, and -95 had been deleted (uc. [score:1]
339, miR-339, -663b, and -95 in the immunoprecipitate of uc. [score:1]
The deletion of the miR-339-3p MBE in the uc. [score:1]
339 called M1 and M2, lacking the TRE in the proximity of miR-339 and miR-663b binding sites, respectively (Fig.   8a, b). [score:1]
a qRT-PCR for miR-339, -663b, and -95 in A549, H460, H1299, and LoVo cells infected with LV- uc. [score:1]
339 transfected with miR-339, -663b, and -95 or SCR for 48 h. Data presented as mean ± s. d. of experimental triplicates normalized to SCR. [score:1]
339 in which the miRNA -binding elements of miR-339, -663b, and -95 have been deleted (uc. [score:1]
339, miR-339-3p, -663b-3p, -95-5p, and CCNE2 was obtained through retrotranscription as described above in this section. [score:1]
339 transfected with si- miR-339, -663b, and -95 or si- SCR for 48 h. Data presented as mean ± s. d. of experimental triplicates normalized to si- SCR. [score:1]
339 in A549, H460, H1299, and LoVo cells transfected with miR-339, -663b, and -95 or a scrambled miRNA (SCR) after 48 h from transfection. [score:1]
339 (in red) and miR-339, -663b, and -95 (green). [score:1]
[1 to 20 of 57 sentences]
3
[+] score: 87
Other miRNAs from this paper: mmu-mir-339
Moreover, our previous study revealed that expression of BCL6 was regulated by miR-339-5p [18], but it was unclear whether BCL6 is a direct target gene of miR-339-5p. [score:7]
In conclusion, our current study demonstrated that the reduced miR-339-5p expression [our previous data (ref)] promoted BCL6 expression, which in turn induces cyclinD1 and CXCR4 expression for induction of breast cancer cell proliferation and invasion. [score:7]
Our previous study revealed that expression of BCL6 was down-regulated by miR-339-5p [18]. [score:6]
Forced expression of miR-339-5p reduced the activity of a luciferase reporter gene fused to the full length wild-type BCL6 3’UTR, indicating that miR-339-5p directly targets BCL6 (Figures  6b and c). [score:6]
Expression of miR-339-5p resulted in substantial reduced levels of BCL6 mRNA and protein in T47D cells, while depletion of miR-339-5p expression using miR-339-5p ASO significantly increase in levels of BCL6 mRNA and protein (Figure  6a). [score:5]
To verify BCL6 as the bona fide target of miR-339-5p, qRT-PCR and western blot analyses were performed to detect the expression levels of BCL6 in breast caner cells transfected with either miR-339-5p mimics or miR-339-5p ASO. [score:5]
A previous study has reported that expression of miR-339-5p inhibited breast cancer cell migration and invasion [18]. [score:5]
At the gene level, BCL6 induced CXCR4 and cyclinD1 expression and BCL6 is the target gene of miRNA, miR-339-5p. [score:5]
We first depleted BCL6 expression by siRNA and co -transfected the cells with miR-339-5p ASO and observed that depletion of BCL6 expression significantly abrogated miR-339-5p ASO -induced tumor cell migration and invasion, indicating that BCL6 plays a critical role at the downstream of miR-339-5p (Figure  6d). [score:5]
The bioinformatic analysis and luciferase assay showed that BCL6 expression could be directly targeted by miR-339-5p. [score:5]
BCL6 is a direct target of miR-339-5p. [score:4]
Bioinformatic analysis utilized the algorithm of Targetscan [24] showed that BCL6 mRNA contains a 3’-UTR element complementary to the miR-339-5p binding site. [score:3]
Although miR-339-5p may target different genes, BCL6 is definitely one of them. [score:3]
Our current data on manipulating miR-339-5p expression did alter effects of BCL6 on breast cancer cells. [score:3]
miR-339-5p mimics or miR-339-5p ASO was transiently transfected into T47D cells and subjected to analysis of BCL6 expression. [score:3]
qRT-PCR was then performed to detect expression of BCL6, GAPDH, miR-339-5p, U6, and common tumor-related genes as described previously [15, 17, 18]. [score:3]
At the gene level, BCL6 was a target gene of miR-339-5p. [score:3]
Our luciferase assay indeed confirmed that BCL6 is the target gene of miR-339-5p. [score:2]
miR-339-5p has been implicated in regulation of cell proliferation, migration and invasion in different cancers [18, 35]. [score:2]
A psiCHECK-2 construct containing 3’UTR of BCL6 with a mutated sequence of miR-339-5p was also generated. [score:1]
Briefly, cells (1.0 ×10 [5] /well) were seeded in 6-well plates and transiently transfected with BCL6 small interfering RNA (siRNA) or control scrambled siRNA duplex (GenePharma, Shanghai, China) or with 2’-O methylated single-stranded miR-339-5p antisense oligonucleotides (ASO) vs. [score:1]
After that, psiCHECK-2-BCL6 3’UTR and psiCHECK-2-mut-BCL6 3’UTR were co -transfected with 20 pmol miRNA-339-5p mimics or its negative control into breast cancer cells using Lipofectamine 2000 as described previously [15, 17]. [score:1]
its negative control or miR-339-5p mimics (all from GenePharma) vs. [score:1]
We therefore proceeded to determine whether BCL6 was involved in miR-339-5p -mediated cell migration and invasion. [score:1]
[1 to 20 of 24 sentences]
4
[+] score: 27
The plasma expression level of let-7d, miR-150, miR-339, and miR-342 was down-regulated whilst that of let-7b, and miR-523 was up-regulated in the AML group compared to healthy controls (Figure 1). [score:8]
The plasma expression level of let-7d, miR-150, miR-339, and miR-342 was down-regulated whilst that of let-7b, and miR-523 was up-regulated in the AML group at diagnosis compared to healthy controls. [score:8]
Among these miRs, two were upregulated (Let-7b, miR-523) and four were downregulated (let-7d, miR-150, miR-339, and miR-342). [score:7]
Moreover, we compared the difference in let-7b, let-7d, miR-150, miR-339, miR-342, and miR-523 expression between AML patients and healthy controls and obtained the same differences in their expression regardless of whether cel-miR-39 or miR-16 was used as the normalizer (Figure 3), which further supports that miR-16 is a stable reference in this study. [score:4]
[1 to 20 of 4 sentences]
5
[+] score: 24
Other miRNAs from this paper: hsa-mir-221, hsa-mir-222, hsa-mir-590
We show that ADAR1 affects miR-221 and miR-222 expression but not miR-339 expression. [score:5]
Expression levels of hsa-miR-222, hsa-miR-221 and hsa-miR-339 in ADAR1-KD and Scramble cells A, C, E. and ADAR1-p110 and Mock cells B, D, F. were assessed by qRT-PCR and normalized to U6 expression. [score:5]
Figure 4Expression levels of hsa-miR-222, hsa-miR-221 and hsa-miR-339 in ADAR1-KD and Scramble cells A, C, E. and ADAR1-p110 and Mock cells B, D, F. were assessed by qRT-PCR and normalized to U6 expression. [score:5]
Recent reports indicate that miR-221, miR-222 and miR-339 directly target ICAM1 [28, 29, 43]. [score:4]
Similar results were obtained for hsa-miR-221 (Figures 4C, 4D) while the expression level of hsa-miR-339 did not change (Figures 4E, 4F). [score:3]
It was previously suggested that ICAM1 is regulated by miR-222 and miR-339 in colorectal cancer cells and glioma cells [28] and by miR-221 in cholangiocytes [29]. [score:2]
[1 to 20 of 6 sentences]
6
[+] score: 15
miR-25, miR-32, miR-661 and miR-339–5p target MDM2 to up-regulate p53 protein levels and function [27– 30]. [score:6]
Recently, several miRNAs, including miR-143/145, miR-192/194, miR-339–5p and miR-509-5p have been identified to regulate p53 levels and function through directly targeting MDM2 [27, 29, 30, 48, 49]. [score:5]
miR-339–5p is frequently down-regulated in colorectal cancer and breast cancer [29, 30]. [score:4]
[1 to 20 of 3 sentences]
7
[+] score: 15
In detail, we selected two miRNAs with high fold changes among the up-regulated (miR-625-5p and miR-183-5p) and four miRNAs with high fold changes among the down-regulated ones (miR-181d-5p, miR-206, miR-142-5p and miR-339-5p). [score:7]
The RT-qPCR showed the same direction of expression changes as the microarray analysis for five miRNAs namely miR-181d-5p, miR-142-5p, miR-206, miR-339-5p and miR-625-5p. [score:4]
The RT-qPCR showed the same direction of expression changes as the microarray analysis for six miRNAs namely miR-181d-5p, miR-142-5p, miR-1233-3p, miR-206, miR-339-5p and miR-625-5p. [score:4]
[1 to 20 of 3 sentences]
8
[+] score: 15
mRNA, messenger RNA Table 1circRNA-miRNA-mRNA network elements for those circRNA-miRNA interactions predicted by both miRanda and RNAHybrid, with a miRanda match score > = 180 and mRNA targets that are differentially expressed (uncorrected P < 0.05) with log2(fold change) >= 2 or =< − 2 (high stringency network) Circular RNA microRNA target Number of binding sites predicted Target genes (differentially expressed) X:47,431,299–48,327,824 hsa-miR-139-5p 6 NOTCH1, STAMBP, TPD52 8:144,989,320–145,838,888 hsa-miR-320a 2 METTL7A, PBX3, PLS1, SEC14L1, VCL, VIM, VOPP1, YPEL2 8:144,989,320–145,838,888 hsa-miR-320b 2 RTKN, VCL, VOPP1 X:47,431,299–48,327,824 hsa-miR-449a 1 BAZ2A, MFSD8, NOTCH1, TSN, ZNF551 8:144,989,320–145,838,888 hsa-miR-125a-3p 1 ANKRD62, C15orf40, COL18A1, MFSD11, MPEG1, MUL1, TTC31, WDR12, ZNF641 X:47,431,299–48,327,824 hsa-miR-125a-5p 1 CD34, MEGF9, PANX1, RIT1, TP53INP1 8:144,989,320–145,838,888 hsa-miR-125a-5p 1 CD34, MEGF9, PANX1, RIT1, TP53INP1 X:47,431,299–48,327,824 hsa-miR-324-5p 1 FOXO1, MEMO1, PSMD4, SMARCD2 14:23,815,526–24,037,279 hsa-miR-142-3p 1 BTBD7, CLDN12, CPEB2, CSRP2, DAG1, KIF5B, PTPN23, WHAMM 4:88,394,487–89,061,166 hsa-miR-133b 1 FAM160B1 4:88,394,487–89,061,166 hsa-miR-448 1 DDIT4, PURG 4:88,394,487–89,061,166 hsa-miR-339-5p 1 AXL, HLA-E, METTL7A, ZNF285, ZNRF3 MetaCore pathway analysis on the 255 filtered differentially expressed target genes from the previous analysis revealed 112 perturbed pathways (corrected P < 0.01; Table  2, Additional file  8: Table S5). [score:15]
[1 to 20 of 1 sentences]
9
[+] score: 11
The suitability of candidate EC reference genes was assessed using geNorm and NormFinder software, with hsa-miR-301a and hsa-miR-339-5p found to be the most uniformly expressed EC reference genes on TLDA card A and hsa-miR-425* and RNU24 for TLDA card B. A panel of 18 potential EC reference genes that were not significantly differentially expressed between CD133+ NSCs/ CD133- NPCs and primary human MB specimens was identified. [score:5]
The ranking of the candidate EC reference genes determined by these programs is summarised in Table 3, and consistent results were obtained for both TLDA card A and card B. Normfinder and geNorm identified hsa-miR-301a and hsa-miR-339-5p as the two most uniformly expressed EC reference genes on TLDA card A, closely followed by hsa-miR-210 and RNU48. [score:3]
Our initial statistical analyses identified a number of candidate EC reference genes uniformly expressed across experimental groups, with both NormFinder and geNorm identifying hsa-miR-339-5p and hsa-miR-301a as the most stable EC reference genes for TLDA card A, and hsa-miR-425* and RNU24 as the most stable for TLDA card B. The practical consequences of miRNA normalisation were then evaluated using TLDA card B candidate EC reference genes and miRNAs as a case study. [score:1]
This suggests that the combination of hsa-miR-339-5p and hsa-miR-301a should be used for data normalisation in preference to the single EC reference genes. [score:1]
Based on our findings, EC reference gene pairs hsa-miR-301a and hsa-miR-339-5p and hsa-miR-425* and RNU24 are recommended for the normalisation of miRNAs on TLDA card A and card B, respectively, in primary MB specimens relative to ESC-derived NSCs/ NPCs. [score:1]
[1 to 20 of 5 sentences]
10
[+] score: 9
Of the 16 differentially expressed miRNAs, 14 were downregulated and 2 miRNAs (miR-210 and miR-339-5p) were upregulated. [score:9]
[1 to 20 of 1 sentences]
11
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Using TaqMan miRNA microarray and quantitative real-time RT-PCR, Fayyad-Kazan found that the expression of let-7d, miR-150, miR-339, and miR-342 was down-regulated, and let-7b, and miR-523 was up-regulated in AML patient plasma compared to normal controls. [score:8]
[1 to 20 of 1 sentences]
12
[+] score: 7
A spectrum of miRNAs including miR-337-5p, miR-17-1, miR-15a, miR-491-5p, miR-339, miR-337-3p, miR-241, miR-19a were predicted to down regulate oncogenic targets like TGFβ, BCLXW, BCL-Xl, STATs, c-MYC and SMAD (as represented by red lines). [score:4]
For example, miR-337-5p, miR-17-1, miR-15a, miR-491-5p, miR-339, miR-337-3p, miR-241, miR-19a were found to modulate oncogenic targets including TGFβ, STATs, c-MYC and SMAD. [score:3]
[1 to 20 of 2 sentences]
13
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
The miRNA families that change expression in both mouse and human were: let-7, miR-7, miR-15, miR-101, miR-140, miR-152 (all validated by qPCR, P < 0.05), as well as miR-17, miR-34, miR-135, miR-144, miR-146, miR-301, miR-339, miR-368 (qPCR not performed). [score:3]
The miRNA families that change expression in both mice and rats were: mir-7, mir-9, mir-10, mir-15, mir-17, mir-26, mir-29, mir-30, mir-101, mir-130, mir-181, mir-204, mir-339, mir-340, mir-368, mir-434, mir-467. [score:3]
50E-0367mmu-miR-339-5pmir-3390.206.807.92E-037.53E-028mmu-miR-34c-5pmir-340.246.689.54E-066.88E-0477mmu-miR-34a-5pmir-340.179.541.17E-029.66E-0245mmu-miR-340-5pmir-3400.178.511.71E-032.45E-0217mmu-miR-361-5pmir-3610.247.887.74E-052.90E-0319mmu-miR-376b-3pmir-3680.268.451.05E-043.50E-0356mmu-miR-376a-3pmir-3680.1910.215.63E-036.40E-0223mmu-miR-434-3pmir-4340.2210.461.76E-044. [score:1]
[1 to 20 of 3 sentences]
14
[+] score: 7
In fact, miR-101, miR-210, miR-21a, miR-27b, miR-331, miR-339, miR-484 and miR-8106 were downregulated by Sp110, while miR-142, miR-181a, miR-200c, miR-3473b and miR-451a were upregulated by Sp110 (Fig. 5c,). [score:7]
[1 to 20 of 1 sentences]
15
[+] score: 6
Moreover, we have previously validated that the gelsolin gene, GSN, which has previously been shown to be downregulated in several animal mo dels linked to FD (Chen et al., 2009; Close et al., 2006) is a target of hsa-miR-339-5p. [score:6]
[1 to 20 of 1 sentences]
16
[+] score: 6
The study reported six up-regulated miRNAs in the cells cultivated on ZO [2] ceramics compared to the one cultivated on Ti layer (miR-214, miR-337, miR-423, miR-339, miR-377, and miR-193b), and four down-regulated miRNAs (miR-143, miR-17-5p, miR-24, and miR-22) [29]. [score:6]
[1 to 20 of 1 sentences]
17
[+] score: 6
On the contrary, the miRNAs up-regulated in FF, especially let-7b-5p, miR-15b-5p, miR-24-3p, miR-130b-3p, miR-146b-5p, miR-212-3p, miR-222-3p, miR-223-3p, miR-339-3p and miR-483-5p, with fold change values higher than 100-fold, could be transcribed in somatic follicular cells and move to oocytes by means of exosomes. [score:4]
Interestingly, let-7b-5p, miR-15b-5p, miR-24-3p, miR-130b-3p, miR-146b-5p, miR-212-3p, miR-222-3p, miR-223-3p, miR-339-3p and miR-483-5p showed expression fold changes higher than 100-fold (ln RQ > 4.7) compared to oocytes (Figure 3B and Supplementary Table S1). [score:2]
[1 to 20 of 2 sentences]
18
[+] score: 6
The predicted MREs for the significantly -upregulated circRNAs are listed in Table 2, with hsa-miR-329-5p being the most frequently targeted miRNA by three circRNAs (i. e., hsa_circRNA_104566, hsa_circRNA_104565, and hsa_circRNA_105038) followed by hsa-miR-450b-5p, hsa-miR-205-3p, hsa-miR-95-5p, hsa-miR-339-5p, and hsa-miR-646. [score:6]
[1 to 20 of 1 sentences]
19
[+] score: 6
Two miRNAs, miR-624 and miR-339, were deregulated in ischemic heart disease and coronary artery disease [53, 54]. [score:6]
[1 to 20 of 1 sentences]
20
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-372, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
There were some miRNAs, differently expressed between euploid and aneuploid embryos, such as miR-141, miR-27b, miR-339-3p, and miR-345 that were all upregulated in euploid embryos. [score:6]
[1 to 20 of 1 sentences]
21
[+] score: 6
miR-339-5p regulates the p53 tumor-suppressor pathway by targeting MDM2. [score:6]
[1 to 20 of 1 sentences]
22
[+] score: 5
Alterations in miRNA expression have been observed in CRC, and several dysregulated miRNAs, including miR-625-3p [8], miR-99-5b [9], miR-361-5p [10], miR-17-5p [11], miR-137 [12], miR-95 [13], miR-23a [14, 15], miR-155 [16], miR-150 [17], miR-191[18], miR-339-5p [19], miR-429 [20], miR-345 [21], miR-22 [22], miR-638 [23] and miR-138 [24], have been shown to regulate CRC cell growth, apoptosis and metastasis. [score:5]
[1 to 20 of 1 sentences]
23
[+] score: 5
Date from Wang et al showed that decreased Sirt2 expression by miR-339 activates its targets such as NF-κB and FOXO1 through increasing their acetylation [127]. [score:5]
[1 to 20 of 1 sentences]
24
[+] score: 5
These studies showed that while multiple miRNAs were differentially regulated by ischemia in each mo del, miR-19b,-2*, and miR-339-5p were all significantly upregulated in common to both mo dels (71). [score:5]
[1 to 20 of 1 sentences]
25
[+] score: 5
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
The 3p arms of miR-28 and miR-339 showed higher expressions than the corresponding 5p arms in the metastatic line, whereas they showed lower expressions than the corresponding 5p arms in the non-metastatic line. [score:5]
[1 to 20 of 1 sentences]
26
[+] score: 5
Other miRNAs such as miR-29a, miR-199-5p, miR-339-5p, miR-590-5p and miR-19b-1 are overexpressed in both the training and validation set, but have barely been described in cancer in general and in NSCLC in particular. [score:3]
MiR-339-5p overexpression has been reported in a study performed in the peripheral blood of 100 individuals which included 86 patients with predominantly early-stage NSCLC and 24 healthy donors [73]. [score:2]
[1 to 20 of 2 sentences]
27
[+] score: 5
On the other hand, these 19 miRNAs (hsa-miR106a, hsa-miR-125a, hsa-miR-140, hsa-miR-146a, hsa-miR-146b, hsa-miR-155, hsa-miR-16, hsa-miR-17, hsa-miR186, hsa-miR-191, hsa-miR-197, hsa-miR-200b, hsa-miR-200c, hsa-miR-339, hsa-miR-374, hsa-miR-422, hsa-miR-422, hsa-miR-454, hsa-miR-484 and hsa-miR-590) were up-expressed in VP and ART (block1-group2) and down-expressed in EC and HIV- (block2-group2). [score:5]
[1 to 20 of 1 sentences]
28
[+] score: 4
Patients with and without acute cellular rejection could be discriminated by miR-142-3p (AUC = 0.78, CI [95%] = 0.67 to 0.89), miR-101-3p (AUC = 0.75, CI [95%] = 0.62 to 0.87), miR-424-5p (AUC = 0.73, CI [95%] = 0.60 to 0.86), miR-27a-3p (AUC = 0.72, CI [95%] = 0.59 to 0.85), miR-339-3p (AUC = 0.71, CI [95%] = 0.57 to 0.84), miR-144-3p (AUC = 0.70, CI [95%] = 0.56 to 0.83) and miR-326 (AUC = 0.69, CI [95%] = 0.56 to 0.82). [score:1]
0170842.g002 Fig 2 Patients with and without acute cellular rejection could be discriminated by miR-142-3p (AUC = 0.78, CI [95%] = 0.67 to 0.89), miR-101-3p (AUC = 0.75, CI [95%] = 0.62 to 0.87), miR-424-5p (AUC = 0.73, CI [95%] = 0.60 to 0.86), miR-27a-3p (AUC = 0.72, CI [95%] = 0.59 to 0.85), miR-339-3p (AUC = 0.71, CI [95%] = 0.57 to 0.84), miR-144-3p (AUC = 0.70, CI [95%] = 0.56 to 0.83) and miR-326 (AUC = 0.69, CI [95%] = 0.56 to 0.82). [score:1]
The present study validates that seven microRNAs, miR-142-3p, miR-339-3p, miR-326, miR-144-3p, miR-101-3p, miR-27a-3p and miR-424-5p are present in serum samples from heart transplant patients and adequately distinguish ACR from NR. [score:1]
All seven microRNA tested could significantly discriminate between ACR and NR, with AUC of 0.78, 0,75, 0.73, 0.72, 0.71, 0.70 and 0.69 for miR-142-3p, miR-101-3p, miR-424-5p, miR-27a-3p, miR-339-3p, miR-144-3p, and miR-326, respectively (Fig 2). [score:1]
[1 to 20 of 4 sentences]
29
[+] score: 4
We have also observed site-specific expression for miR-7, miR-31, miR-107, miR-124, miR-183, miR-339, miR-376a and miR-551a, when comparing supratentorial to infratentorial tumors (Table 2). [score:3]
We performed comparisons between the clinicopathological variables and miRNAs and we identified miR-7, miR-31, miR-107, miR-124a, miR-183, miR-339, miR-376a and miR-551a as supratentorial-specific (Table 2). [score:1]
[1 to 20 of 2 sentences]
30
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7e, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-214, hsa-mir-215, hsa-mir-222, hsa-mir-223, hsa-mir-1-2, hsa-mir-15b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-149, hsa-mir-184, hsa-mir-186, hsa-mir-200c, hsa-mir-1-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-624, hsa-mir-650, hsa-mir-651, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-1185-2, hsa-mir-1283-1, hsa-mir-1185-1, hsa-mir-708, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1283-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Overall, the top five up-regulated miRNAs were miR-624, miR-339-5p, miR-191 and miR-651. [score:4]
[1 to 20 of 1 sentences]
31
[+] score: 4
As shown in Table 2, 15 miRNAs (miR-222, miR-320, miR-24, miR-132, let-7b, miR-106a, miR-19b, miR-16, miR-186, miR-339-3p, miR-17, miR-323-3p, miR-197, miR-20a, and miR-382) were down-regulated in Group 2 and were chosen for subsequent verification analysis. [score:4]
[1 to 20 of 1 sentences]
32
[+] score: 4
Five potential candidate miRNAs (miR-103; miR-107; miR-129-5p; miR-136; miR-339-5p) were predicted to have target sites in 3′UTR of VCP mRNA. [score:3]
Five predicted miRNAs (miR-103, miR-107, miR-129-5p, miR-136, miR-339-5p) were transfected in HepG2 cells, respectively, with VCP 3′UTR report. [score:1]
[1 to 20 of 2 sentences]
33
[+] score: 4
Oncogenic miRNAs like hsa-miR-339-5p, hsa-miR-143-5p, hsa-miR-409-3p, hsa-miR-153-3p and hsa-miR-145-5p have been reported to be downregulated in breast cancer [31– 35]. [score:4]
[1 to 20 of 1 sentences]
34
[+] score: 3
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-29c
With the successful implementation of this methodology and comparing with previously published data (~62% to miR-339-5p 45; ~35% to miR-29c 21; ~50% to miR-29a/b-1 16), we obtained the highest decrease ever reported for the hBACE1 expression levels (around 78% to CS/pre-miR-29b and 86% to PEI/pre-miR-29b) in AD mo del cells. [score:3]
[1 to 20 of 1 sentences]
35
[+] score: 3
Other miRNAs from this paper: hsa-mir-338
miR-339-3p was significantly downregulated in the Caki-1 cells as compared with the 786-O cells. [score:3]
[1 to 20 of 1 sentences]
36
[+] score: 3
A recent study has shown that BCL-6 in BC cells could be targeted by miR-339-5p [27]. [score:3]
[1 to 20 of 1 sentences]
37
[+] score: 3
In some cases the free energy is extremely low, the record −42,30 kcal/mol is for a target site for hsa-mir-339 (almost perfect complementary miRNA/mRNA duplex, localized in L2B element). [score:3]
[1 to 20 of 1 sentences]
38
[+] score: 3
Other miRNAs from this paper: hsa-mir-27a, hsa-mir-221, hsa-mir-331, hsa-mir-574, hsa-mir-744
From this dataset, we identified 6 Homo sapiens (hsa)-miRNAs targets that were significantly affected by RSV and were also holding a high degree of homology to the mRNA sequences encoding neurotrophic factors or receptors: miR-27a, miR-221, miR-339-5p, miR-453, miR-574, and miR-744 (Table 1). [score:3]
[1 to 20 of 1 sentences]
39
[+] score: 3
The expression level of mmu-miR-339-5p was significantly increased at the early stage of infection, while no difference was observed after 4-week infection. [score:3]
[1 to 20 of 1 sentences]
40
[+] score: 3
According to our results, we hypothesized that circRNA_001059 may act as an inhibitor of miRNA by binding several specific miRNAs, including miR-30c-1*, miR-30c-2*, miR-122*, miR-139-3p, miR-339-5p and miR-1912. [score:3]
[1 to 20 of 1 sentences]
41
[+] score: 3
Five miRNAs (miRNA-575, miRNA-1914-3p, miRNA-339-5p, miRNA-22-5p, and miRNA-335-5p) displayed similar expression trends in both the chronic and acute infection groups compared with the control group, which indicated that both chronic and acute Brucella infections might share, at least partly, similar regulatory mechanisms. [score:3]
[1 to 20 of 1 sentences]
42
[+] score: 3
10 miRNAs were consistently validated (Fig.   6) to be differentially expressed by HP diet, namely miR-592, miR-488-3p, miR-339-3p, miR-17-5p-1, miR-877-5p, miR-15b-5p, miR-484-1, miR-4745-5p, let-7b-5p and miR-25-3p. [score:3]
[1 to 20 of 1 sentences]
43
[+] score: 2
This can be explained by the additional accessibility criterion of PACMIT as sites considered as created or disrupted by PACMIT may only reveal changes in secondary structures which are not predicted by TargetScan (e. g. the created ssc-miR-339-5p and ssc-miR-4334-3p sites in CREBL1 3′-UTR, and the disrupted ssc-miR-148a, ssc-miR-148b and ssc-miR-152 sites in HSPA1A). [score:2]
[1 to 20 of 1 sentences]
44
[+] score: 2
Another study involving the Sirt2 gene (present in human and rat neurons) responsible for deacetylating histones and promoting chromatin compaction demonstrated that acupuncture epigenetically modifies levels of miR-339 that regulate Sirt2, ultimately interfering with the miRNA-339/Sirt2/NF-B/FOXO1 axis [57]. [score:2]
[1 to 20 of 1 sentences]
45
[+] score: 2
miR-337-5p + ND miR-339-5p + ND miR-34a + + + + + + + +Regulation of p53 -mediated apoptosis [32]. [score:2]
[1 to 20 of 1 sentences]
46
[+] score: 2
Thirteen mRNA were specifically related to homozygous/heterozygous status of KIT mutation: miR-518f, miR-331, miR-628, miR-145, miR-139, miR-335, miR-526b, miR-190, miR-548c, miR-202, miR-339, miR-203, and miR-301b (Anova test p<0.05). [score:2]
[1 to 20 of 1 sentences]
47
[+] score: 1
0074916hsa-miR-16-5p0.0890.0071513hsa-miR-44540.3420.001154hsa-miR-181a-5p0.1060.041029hsa-miR-46440.3580.004136hsa-miR-25-3p0.1290.000127hsa-miR-197-3p0.3590.005471hsa-miR-4653-3p0.1290.000547hsa-miR-15a-5p0.3620.0302713hsa-miR-146a-5p0.1400.002395hsa-miR-2115-3p0.3640.000163hsa-miR-339-5p0.1460.002487hsa-miR-9370.3650.008018hsa-miR-50890.1560.0017917hsa-miR-331-3p0.3740.0010912hsa-miR-493-5p0.1630.0061914hsa-miR-374b-5p0.3800. [score:1]
[1 to 20 of 1 sentences]
48
[+] score: 1
Lakshmanan A. Wojcicka A. Kotlarek M. Zhang X. Jazdzewski K. Jhiang S. M. microRNA-339-5p modulates Na+/I- symporter -mediated radioiodide uptakeEndocr. [score:1]
[1 to 20 of 1 sentences]
49
[+] score: 1
54] miR-101-3p 5.71 ± 0.37 [5.97–5.45] miR-337-5p 2.70 ± 1.139 [1.86–3.54] miR-106a-3p 10.56 ± 0.99 [11.26–9.86] miR-339-5p 3.74 ± 2.02 [5.17–2.31] miR-107 8.38 ± 0.11 [8.31–8.46] miR-33a-3p 3.13 ± 1.58 [2.02–4.24] miR-1179 4.42 ± 0.48 [4.76–4.08] miR-340-5p 4.22 ± 2.40 [2.52–5. [score:1]
[1 to 20 of 1 sentences]
50
[+] score: 1
It has also been observed that several miRNAs such as- miR-208, miR-381 and miR-339 exhibit significant differences by age. [score:1]
[1 to 20 of 1 sentences]
51
[+] score: 1
Among of them, 12miRNAs (hsa-miR-139-5p, hsa-miR-638, hsa-miR-107, hsa-miR-331-3p, hsa-miR-21-3p, hsa-miR-134-5p, hsa-miR-16-1-3p, hsa-miR-339-5p, hsa-miR-106b-5p, hsa-miR-423-3p, hsa-miR-491-3p, hsa-miR-24-3p) were related to cancers. [score:1]
[1 to 20 of 1 sentences]
52
[+] score: 1
In this study, many miRNAs (miR-10a, miR-21, miR-145, miR-212, miR-339, miR-361) responded to capecitabine chemoradiotherapy in individual tumor samples. [score:1]
[1 to 20 of 1 sentences]
53
[+] score: 1
27E-02   MTMR14  8.00E-05 1.00E-021.73E-02 hsa-miR-339-5p ECOP 1.12E-029.00E-051.31E-029.37E-032.31E-03   FURIN  1.00E-04 2.36E-034.27E-02   MTMR14  8.00E-05 3.42E-031.73E-02 hsa-miR-363 ECOP 2.64E-029.00E-051.13E-033.00E-022.31E-03   FURIN  1.00E-04 2.33E-064.27E-02   MTMR14  8.00E-05 5.69E-041.73E-02rs7670734hsa-let-7i TP635.21E-052.20E-028.00E-052.44E-035.08E-053.95E-02 hsa-miR-20b TP63 4. 26E-02 9.45E-051.00E-02  hsa-miR-25 TP63 1.11E-02 1.65E-021.00E-02  hsa-miR-339-5p TP63 1.07E-02 1.31E-025.44E-04  hsa-miR-363 TP63 2.48E-02 1.13E-031.76E-06 rs7677704hsa-let-7i TP635.21E-052.20E-028.00E-052.44E-035.08E-053.95E-02 hsa-miR-20b TP63 4.26E-02 9.45E-051.00E-02  hsa-miR-25 TP63 1.11E-02 1.65E-021.00E-02  hsa-miR-339-5p TP63 1.07E-02 1.31E-025.44E-04  hsa-miR-363 TP63 2.48E-02 1.13E-031.76E-06 rs9312445hsa-let-7i TP635.21E-052.20E-028. [score:1]
[1 to 20 of 1 sentences]
54
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-185, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
Conversely, miR-423-5p had 22,588 counts, while its complementary strand, miR-423-3p, had only 654 reads, and which was shared by miR-22, miR-30a, miR-339, miR-17, miR-24, miR-331, miR-27b and let-7d (detail in Additional file 3: Table S3). [score:1]
[1 to 20 of 1 sentences]
55
[+] score: 1
Of these, 13 miRNAs (hsa-let-7e, hsa-let-7f, hsa-miR-10a, hsa-miR-21, hsa-miR-26a, hsa-miR-99a, hsa-miR-140-3p, hsa-miR-150, hsa-miR-181a, hsa-miR-320, hsa-miR-339-5p, hsa-miR-425, and hsa-miR-582-5p) were repressed in the Beijing/W TB infected group (Fig 1). [score:1]
[1 to 20 of 1 sentences]
56
[+] score: 1
262.8 × 10 [-03]2.0 × 10 [-09]7.4 × 10 [-36]hsa-miR-423-3p0.261.6 × 10 [-02]5.0 × 10 [-13]1.8 × 10 [-03]hsa-miR-12800.294.7 × 10 [-03]8.2 × 10 [-56]8.6 × 10 [-04]hsa-miR-6630.323.5 × 10 [-03]5.9 × 10 [-70]1.8 × 10 [-28]hsa-miR-423-5p0.332.6 × 10 [-02]6.1 × 10 [-96]5.7 × 10 [-36]hsa-miR-99b0.362.4 × 10 [-02]3.4 × 10 [-04]7.6 × 10 [-03]hsa-miR-339-5p0.374.9 × 10 [-02]1.5 × 10 [-35]2.5 × 10 [-07]hsa-let-7a0.372.9 × 10 [-02]1.9 × 10 [-04]3.2 × 10 [-09]hsa-miR-19790. [score:1]
[1 to 20 of 1 sentences]
57
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-328, hsa-mir-337, hsa-mir-338, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
Of most interest are miRNAs: let-7f, let-7i, miR-24, miR-26b, miR-27a, miR-221, miR-30b, miR-337, miR-339-5p, miR-453, miR-520a, miR-574, and miR-744. [score:1]
[1 to 20 of 1 sentences]
58
[+] score: 1
Genovesi et al identified ECs for use in medulloblastoma studies involving TLDA cards, and recommended the combination of miR-301a and miR-339-5p for normalization of card A data, with a combination of miR-425* and RNU24 being used for Card B data analysis [27]. [score:1]
[1 to 20 of 1 sentences]