sort by

110 publications mentioning hsa-mir-328 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-328. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 273
However, pre-treatment of macrophages with a p38 inhibitor, doramapimod, or a JNK inhibitor, SP600125, prior to NTHi infection, completely blocked the down-regulation of miR-328 expression (Fig 2H). [score:10]
Among these differentially expressed miRNA we selected miR-328, specifically the 3p strand, as a candidate miRNA for further study as its baseline expression was among the highest observed and most significantly down-regulated following infection. [score:8]
We next determined whether miR-328 was involved in dexamethasone -mediated suppression of immunity and bacterial clearance, and if inhibition of this miRNA could enhance bacterial clearance in these immune suppressed mice. [score:7]
Notably from profiling data, miR-328, a highly conserved miRNA, was significantly down-regulated by infection and its basal level are amongst the highest of all down-regulated miRNA, suggesting a key role in the host response to NTHi infection. [score:7]
Similarly, infection of primary lung macrophages by NTHi also downregulated miR-328 expression in vitro. [score:6]
Here we found that p38 and JNK MAPK is activated by NTHi infection, and inhibition of these MAPK signalling prior to bacterial infection prevents the down-regulation of miR-328 levels. [score:6]
This study is the first to identify a role for miR-328 in regulating bacterial infection in the lung and provides proof-of-principle data that targeting specific host miRNAs could lead to future therapeutics to combat multi-drug resistant bacteria and infection in chronic lung diseases and immune-compromised patients. [score:6]
Although the specific targets of miR-328 remain to be elucidated it is likely that this miRNA targets transcripts involved in regulating phagocytosis and controlling the microbicidal activity of the macrophages and neutrophils. [score:6]
Inhibiting miR-328 enhances bacterial clearance in dexamethasone -mediated immune suppressed mice. [score:5]
Inhibition of miR-328 increased expression of bacterial binding molecules CD14, CD36, and CD11b. [score:5]
Inhibition of miR-328 overcomes corticosteroid -induced immune suppression to clear bacteria. [score:5]
This suggests that NTHi suppresses miR-328 expression via activation of the p38 and JNK MAPK pathway. [score:5]
These data indicate that the inhibition of miR-328 was as effective at clearing bacteria in both immune competent and immune suppressed environments. [score:5]
MiR-328 expression is regulated by p38 and JNK MAPK and inhibition increases bacterial clearance in vitro. [score:5]
Administration of ant-328 inhibited expression of miR-328 (Fig 2A). [score:5]
Notably, inhibition of miR-328 in the lung was effective in amplifying the clearance of infection even in mo dels of corticosteroid -induced immunosuppression and cigarette smoke -induced emphysema. [score:5]
Inhibition of miR-328 with ant-328 substantially increased bacterial clearance suggesting that targeting this miRNA could be potentially used as a new approach to anti-microbial therapy. [score:5]
Inhibition of miR-328 function in human macrophages and neutrophils using ant-328 also resulted in increased bacterial phagocytosis, indicating that our studies are potentially translatable into anti-microbial innate host defence pathways in human cells. [score:5]
Thus, it is possible that miR-328 expression could be regulated by other pathways in a more complex in vivo environment. [score:4]
miR-328 regulates bacterial killing pathways and its expression is controlled by p38 and JNK signalling. [score:4]
Inhibition of miR-328 with ant-328 suggests that this microRNA regulates phagocytosis and killing of bacteria by macrophages and neutrophils in vitro. [score:4]
Here we demonstrate a new role in regulating innate immune cell function, wherein suppression of miR-328 improves bacterial clearance in the lungs. [score:4]
Here we demonstrate that down-regulation of miR-328-3p (termed miR-328 hereafter) is a key element of the innate host defence response to NTHi infection, which facilitates bacterial clearance. [score:4]
Adoptive transfer of miR-328 -depleted macrophages or neutrophils increased bacterial clearance in the lung, further supporting our in vitro observations and directly demonstrating that inhibition of miR-328 in these cells amplifies their ability to clear respiratory infections. [score:4]
did not alter miR-328 expression, suggesting that this miRNA was not directly involved in mediating the effects of corticosteroids (Fig 4A). [score:4]
To investigate the signalling pathways involved in the regulation of miR-328 expression, we used specific inhibitors to block the activation of p38, JNK, and ERK MAPK following NTHi infection. [score:4]
In cancer, miR-328 expression is regulated through the ERK1/2 pathway [38]. [score:4]
Macrophages were purified from lungs of naïve mice and pre -treated with a miRNA inhibitor (antagomir (ant)) with perfect complementarity to miR-328 (ant-328). [score:3]
miR-328 is involved in cancer [36– 38], autoimmunity [39], and neuronal disease [40]. [score:3]
Inhibiting miR-328 increases bacterial uptake in human monocyte-derived macrophages and neutrophils. [score:3]
Ant-328 treatment inhibited miR-328 in both dexamethasone and vehicle -treated mice infected with NTHi to similar levels (Fig 4D). [score:3]
Treatment of macrophages with the mimetic to miR-328 had no effect on bacterial clearance likely because the basal expression level of miR-328 in lung macrophages is already high and so any additive effect becomes masked (S6A and S6B Fig). [score:3]
It will be important, however, to study the chronic impact of altering miR-328 function in murine mo dels, and subsequently in human disease. [score:3]
Using a cigarette smoked -induced mo del of experimental COPD [46], we demonstrated that inhibiting miR-328 brought about a 3-fold increase in bacterial clearance. [score:3]
Although speculative, targeting miR-328 may be more broadly applicable and lead to improvement of innate immune cell function in these immune -deficient patients. [score:3]
We next assessed whether inhibition of miR-328 improved NTHi clearance in vivo, which would indicate whether the use of ant-328 would be a potential therapeutic option for respiratory bacterial infection. [score:3]
Inhibition of miR-328 promotes bacterial clearance in a mo del of cigarette smoke -induced emphysema. [score:3]
Inhibiting miR-328 enhances bacterial clearance in cigarette smoke-exposed mice. [score:3]
Inhibiting miR-328 improves NTHi clearance in the lungs in vivo. [score:3]
Exposure of macrophages to NTHi or vehicle (DMSO) plus NTHi led to a significant 2-fold reduction in miR-328 expression (Fig 2H). [score:3]
MiR-328 is down-regulated after NTHi infection. [score:3]
Moreover, pharmacological inhibition of miR-328 profoundly enhances the clearance of the infection by increasing bacterial uptake by phagocytes, the production of reactive oxygen species (ROS), and microbicidal activity. [score:3]
1004549.g003 Fig 3Inhibiting miR-328 improves NTHi clearance in the lungs in vivo. [score:3]
Inhibition of miR-328 function in macrophages (Fig 2D and 2E) and neutrophils (S3D Fig) substantially enhanced phagocytosis of heat-killed NTHi (significantly increased levels of intracellular CFSE). [score:3]
Interestingly, inhibition of microRNA-328 in mouse and human macrophages increases microbicidal activity by amplifying phagocytosis and production of reactive oxygen species. [score:3]
Likewise, the inhibition of miR-328 in neutrophils produced similar results (S3 E Fig). [score:3]
S3 FigInhibition of miR-328 increases phagocytosis and bacterial clearance by neutrophils in vitro. [score:3]
Inhibition of miR-328 in the lungs promotes bacterial clearance. [score:3]
Inhibition of miR-328 increases phagocytosis and bacterial clearance by neutrophils in vitro. [score:3]
Importantly, dexamethasone administration did not alter miR-328 expression levels despite the increased bacterial load in the lungs. [score:3]
Effect of miR-328 inhibition on ROS generation. [score:3]
We validated the miRNA array data for miR-328 using TaqMan PCR and observed a ~2-fold reduction in expression 24 h after infection (Fig 1E). [score:3]
Although inhibition with an antagomir dramatically promoted NTHi clearance, application of a mimetic (increasing miR-328 levels) failed to delay clearance of NTHi. [score:3]
Inhibition of miR-328 function by ant-328 was confirmed during infection (Fig 3F). [score:3]
Similar to the results observed with murine cells, inhibition of miR-328 significantly increased bacterial uptake by human macrophages (Fig 6A) and neutrophils (Fig 6B) in vitro. [score:3]
Inhibition of miR-328 function also resulted in a decrease in pulmonary compliance (Fig 5D) and an increase in pulmonary elastance (Fig 5E). [score:3]
To determine whether the effects of miR-328 inhibition were due to altered phagocytosis of bacteria, or increased permissibility of phagocytes to active infection, we conducted a phagocytosis assay. [score:2]
MiR-328 regulates bacterial clearance by macrophages and neutrophils in vivo To specifically assess the role of miR-328 in macrophage- and neutrophil -mediated bacterial clearance in vivo we conducted adoptive transfer experiments. [score:2]
Collectively, this data suggests that miR-328 regulates bacterial phagocytosis in neutrophils and macrophages at least partly through the control of cell surface bacterial binding proteins. [score:2]
This indicates that miR-328 regulates phagocytosis and killing of bacteria. [score:2]
Inhibition of miR-328 in dexamethasone pre -treated mice reversed the increased bacteria load compared to controls (Fig 4E). [score:2]
MiR-328 expression following NTHi infection in vivo. [score:2]
Inhibition of miR-328 in neutrophils (S3A Fig) resulted in a 3-fold decrease in bacterial load in the culture supernatant as early as 1 h p. i. and a dramatic increase in bacterial uptake compared to Scr control treatment (S3B–S3C Fig, respectively). [score:2]
MiR-328 was inhibited in (A) macrophages or (C) neutrophils for 12 h ex vivo. [score:2]
miR-328 regulates macrophage and neutrophil bacterial phagocytosis. [score:2]
This suggests that NTHi down regulates miR-328 at least in part through p38 and JNK signalling pathways. [score:2]
Collectively, these data suggest that NTHi activates the p38 and JNK signalling pathways, which regulates the cellular levels of miR-328. [score:2]
Here we show that increased production of ROS in ant-328 treated phagocytes, indicating that this bacterial killing mechanism is also regulated by miR-328. [score:2]
Exposure of the lung to ant-328 resulted in significant reduction in the levels of miR-328 (Fig 5A). [score:1]
We speculate that this is because the levels of endogenous miR-328 are very high, hence masking the effect of mimetic treatment. [score:1]
Thus, we next investigated if inhibition of miR-328 improved bacterial clearance in our mo del of cigarette smoke -induced emphysema. [score:1]
To specifically assess the role of miR-328 in macrophage- and neutrophil -mediated bacterial clearance in vivo we conducted adoptive transfer experiments. [score:1]
Interestingly, miR-328 was decreased within 3 h in infected airways and remain decreased over a 48 h period (S2A Fig). [score:1]
MiR-328 expression levels in (A) airways and (B) lung macrophages measured using Taqman qPCR normalised to sno-202 and expressed as fold change compared to control. [score:1]
S6 Fig Primary lung macrophages were isolated from the lungs of naïve mice and pre -treated with miR-328 mimic for 24 h before infection with NTHi at MOI 100. miR-Scr was used as a control. [score:1]
Similarly, levels of miR-328 are diminished and remain lower in macrophages isolated from the NTHi infected lung over a similar time period (S2B Fig). [score:1]
Thus, miR-328 plays a very specific role in the microbicidal activity of these innate immune cells. [score:1]
Effect of miR-328 on lung inflammation in non-infected mice. [score:1]
MiR-328 regulates bacterial clearance by macrophages and neutrophils in vivo. [score:1]
Exposure of macrophages to NTHi and Scr resulted in a decrease in the levels of miR-328 by ~25% as assessed by TaqMan qPCR (Fig 2A) (this level was similar to NTHi exposure alone). [score:1]
Thus, we determined whether miR-328 plays a role in activating these killing pathways in macrophages and neutrophils. [score:1]
High levels of miR-328 are linked to macrophage homeostasis and thus it is only when levels are dramatically decreased by antagomir treatment that the cell becomes activated to clear bacteria. [score:1]
MiR-328 regulates phagocytosis by human macrophages and neutrophils. [score:1]
Effect of miR-328 mimic on bacterial clearance. [score:1]
The complementary antagomir strand of the miR-328-3p sequence obtained from miRbase was synthesised from Sigma-Aldrich with the following chemical modifications 5’mA. [score:1]
Thus miR-328 plays a critical role in the microbial host defence mechanism of innate immune cells by augmenting phagocytosis, the production of ROS and microbicidal activity. [score:1]
To examine the function of miR-328 in microbial host defence responses in the lung, we isolated the two major innate immune cells that respond to infection and were elevated in the lungs; macrophages and neutrophils. [score:1]
This blocked miR-328 function before the cells were infected with NTHi in vitro. [score:1]
[1 to 20 of 88 sentences]
2
[+] score: 197
In our study, KIF23 was found to be inversely related to miR-328 expression by whole geneome gene profiling, and functional studies showed that miR-328 mimics could suppress KIF23 protein levels, furthermore, KIF23 protein expression levels showed negative correlation to miR-328 expression values (Fig. 3& 4, Table 3). [score:9]
In vitro functional analysis showed that ectopic miR-328 expression significantly suppressed U87MG cells proliferation. [score:5]
As shown in Fig. 3, cell growth was significantly suppressed by miR-328 mimics and the maximum inhibition rate was 48 h after transfection. [score:5]
Together, these results indicate that miR-328 is a tumor suppressor and could be a potential target for anti-proliferative therapy. [score:5]
We also show that miR-328 is closely related to cell cycle progression; ectopic miR-328 expression in GBM cells could significantly suppress cell proliferation. [score:5]
Integrated analysis of miR-328 with whole genome gene expression patterns showed that low -expression of miR-328 was tightly associated with the gene sets related to cell cycle. [score:5]
We observed a positive correlation of miR-328 expression with a series of tumor suppressors which mediate cell cycle arrest, including death -associated protein kinase 1 (DAPK1) [32]. [score:5]
And overall survival analysis on primary GBM (pGBM) patients showed that patients with lower than median levels of miR-328 expression were associated with decreased survival time relative to those with miR-328 expression levels higher than the median. [score:5]
Ectopic miR-328 Expression Suppresses Cell Proliferation in GBM. [score:5]
In the microarray cohort, pGBM patients with lower than median levels of miR-328 expression had poorer survival in contrast to those with higher than median levels of miR-328 expression (Fig. 1C) who had longer survival times. [score:5]
Heat map of the gene -expression signature correlated with miR-328 expression. [score:5]
Here, we report that the expression of miR-328 was decreased in GBM samples and in anaplastic gliomas compared with low grade gliomas by using the expression values from microarrays of 198 frozen glioma tissues. [score:4]
MiR-328 expression values showed negative correlation to KIF23 protein expression levels in 60 pGBM samples. [score:4]
By using a p value<0.001, processes mainly related to transcription, the cell cycle processes of M phase, mitosis, cell division, nuclear division and mitosis were significantly enriched in the pGBM samples where miR-328 was down-regulated (Table 2). [score:4]
Next, we performed multivariate Cox proportional hazards analysis incorporating miR-328 expression, KPS, IDH1 mutation and extent of resection. [score:4]
IDH1 mutation, KPS, extent of resection and miR-328 expression were subjected to multivariate Cox proportional hazards analysis, which showed that miR-328 could be used as an independent prognostic biomarker for GBM. [score:4]
Together, these results suggest that miR-328 could be an anti-proliferation target for GBM treatment. [score:3]
As shown in Fig. 1B, miR-328 was significantly down-regulated in GBMs and anaplastic gliomas compared with low grade gliomas. [score:3]
Furthermore, the relationship between miR-328 expression and overall survival was determined through Kaplan-Meier survival curve analysis with a log-rank comparison of 82 pGBM patients. [score:3]
This analysis revealed that miR-328 expression and extent of resection were significantly correlated with survival (Table 1). [score:3]
Furthermore, oncogenes which drive cell proliferation and cell mitosis, including KIF23 [25] and E2F transcription factor 1 (E2F1) [33], were found to negatively correlate with the expression of miR-328. [score:3]
Patients were arranged from left to right by increasing levels of miR-328 expression. [score:3]
GBM patients with lower than median levels of miR-328 expression have poor survival. [score:3]
To investigate the cell biological processes associated with miR-328 expression in pGBM, the integrated analysis of miR-328 expression levels and whole genome gene profiling were performed in 60 pGBM samples. [score:3]
And the levels of miR-328 expression in the “Validation” glioma cohort were detected by TaqMan -based real-time quantification PCR (qRT-PCR). [score:3]
Furthermore, this correlation of miR-328 expression with overall survival was also observed in the independent validation samples (p<0.01) (Fig. 1D). [score:3]
To detect the expression pattern of miR-328 in glioma samples, a microarray of 198 glioma samples (63 low-grade gliomas, 44 anaplastic gliomas and 91 GBMs) was analyzed, just as shown in Fig. 1A. [score:3]
The biologic processes associated with miR-328 low expression in pGBMs. [score:3]
In conclusion, our studies show that miR-328 expression is decreased in GBMs. [score:3]
Furthermore, an independent cohort containing 100 glioma samples were used to validate the expression pattern of miR-328 in gliomas. [score:3]
In addition, the correlation analysis of KIF23 protein levels by IHC and miR-328 expression by qRT-PCR were performed on 60 pGBM tissues. [score:3]
To study the functional role of miR-328 in GBM cell proliferation, miR-328 mimics were transfected into U87MG cells to elevate miR-328 expression levels, while miR-328 NC was used as a negative control. [score:3]
The correlation analysis of miR-328 and whole genome gene expression was performed in 60 pGBM samples with paired miRNA and mRNA profiling (CGGA). [score:3]
Furthermore, to confirm whether miR-328 could be served as an independent prognostic biomarker in GBMs, miR-328 expression was analyzed by univariate Cox regression analysis. [score:3]
Furthermore, in the malignant progression of glioma (primary WHO grade II gliomas spontaneously progress to WHO grade IV secondary GBMs), miR-328 shows reduced expression upon progression [21]. [score:3]
Thus, it is valuable to further confirm the functional role and predictive value of miR-328 expression in human GBM. [score:3]
Expression of miR-328 is Decreased in GBM Tissues and Confers a Poor Prognosis. [score:3]
Both of the cohorts showed that miR-328 expression was significantly decreased in GBMs and anaplastic gliomas relative to low-grade gliomas. [score:3]
0047270.g001 Figure 1 (A) Expression values of miR-328 in the microarray cohort containing 198 frozen glioma tissues. [score:3]
These results suggest that miR-328 might affect malignant progression and function as an anti-oncogene via the suppressing of GBM cell proliferation. [score:3]
However, the expression level of miR-328 and its relationship with pathological features and overall survival in human GBM is still unclear. [score:3]
High levels of miR-328 expression was a “protective” factor in GBM (p<0.01, HR = 0.46, 95%CI = 0.27–0.79). [score:3]
Kaplan-Meier survival analysis of 82 frozen pGBM samples revealed that low expression levels of miR-328 conferred a poor prognosis. [score:3]
MiR-328 is expressed at low levels in many cancers. [score:2]
GBMs and anaplastic gliomas demonstrated a significantly lower levels of miR-328 expression compared with low-grade gliomas (p<0.01). [score:2]
MiR-328, a tumor suppressor, is involved in the aggressive progression of gliomas, which suggests that it may play an important role in the malignant transformation of gliomas [21]. [score:2]
In addition, functional assays showed that miR-328 might serve as a potential anti-proliferation target for GBM therapy. [score:2]
MiR-328 suppresses U87MG cell proliferation in vitro. [score:2]
It has been reported that miR-328 can decrease the chemoresistance of GBM stem cells by down -regulating ABCG2 protein levels [31]. [score:2]
MiR-328 expression values of 198 “Microarray” samples were from Chinese Glioma Genome Atlas (CGGA) (among the 198 “Microarray” samples, 63 samples were diagnosed as low grade gliomas, 44 were anaplastic gliomas and 91 were GBMs). [score:2]
MiR-328 Expression Analysis. [score:2]
The clonogenic assay showed that miR-328 mimics significantly inhibited the formation of cell clones. [score:2]
MiR-328 expression pattern in glioma samples and its association with overall survival time in GBMs. [score:2]
To determine the prognostic value of miR-328 in GBM, we first employed a univariate Cox comparison. [score:1]
Furthermore, multivariate Cox proportional hazards analysis showed that miR-328 could act as an independent prognostic biomarker. [score:1]
In addition, to explore the biological processes of miR-328 in GBMs. [score:1]
Gene ontology analysis suggested that miR-328 was significantly associated with the gene sets related to cell cycle. [score:1]
In this study, we first evaluated the expression levels of miR-328 in 198 frozen glioma samples using microarray technology. [score:1]
The prognostic value of miR-328 was also validated in the independent GBM samples. [score:1]
In addition, miR-328 might be used as an independent prognostic biomarker for GBM. [score:1]
Together, this evidence suggests that miR-328 has an essential role in the original and/or progression of GBM. [score:1]
This analysis indicates that miR-328 might have essential roles in glioma cells proliferation. [score:1]
2′-O-methyl (2′-O-Me) hsa-miR-328 mimic (miR-328 sense oligonucleotide) and miR-328 negative control (NC) were chemically synthesized by Shanghai GenePharma Company (Shanghai, China). [score:1]
To investigate the biological processes that correlate with miR-328 expression in pGBM, miR-328 associated genes were projected to Gene ontology analysis (http://david. [score:1]
The miR-328 mimic sequence is 5′-CUG GCC CUC UCU GCC CUU CCG U-3′, 5′-GGA AGG GCA GAG AGG GCC AGU U-3′, and the NC sequence is 5′-UUC UCC GAA CGU GUC ACG UTT-3′, 5′-ACG UGA CAC GUU CGG AGA ATT-3′. [score:1]
50 cells were seeded onto a culture plate, after adherence, cells were transfected with miR-328 mimics or a negative control. [score:1]
These results indicated that miR-328 could be used as an independent prognostic biomarker for GBM. [score:1]
After treatment with miR-328 mimics for 48 h, cell cycle analysis was applied, in brief, cells were collected, washed with phosphate buffered saline (PBS) and then fixed with 75% ethanol at −20°C for 1.5 h, then cells were suspended in hanks balanced salt solutions (HBSS) containing 50 µg/ml of RNaseA (Boehringer Mannheim, Indianapolis, IN) and 50 µg/ml of propidium iodide (PI) (Sigma-Aldrich), incubated for 1 h at room temperature and then analyzed by FACScan (Becton Dickinson, San Jose, CA). [score:1]
60 pGBM samples with variable miR-328 transcript levels were analyzed by whole genome gene profiling. [score:1]
Multivariable Cox proportional hazard regression analyses of miR-328 expression and clinicopathologic characteristics in relation to overall survival in patients with pGBM. [score:1]
[1 to 20 of 70 sentences]
3
[+] score: 192
Other miRNAs from this paper: hsa-mir-21, hsa-mir-155, hsa-mir-520h
The p38 and JNK pathways are involved in RESV -induced upregulation of miR-328 and suppression of CREB -binding activity of the MMP-2 promoterTo further ascertain the role of MAPK pathways in RESV -mediated miR-328 upregulation and CREB -binding activity suppression, HOS cells were pretreated with a JNK or p38 MAPK inhibitor or transfected with their DN mutants followed by RESV treatment. [score:13]
As shown in Figure 6A, we found that miR-328 was the most highly upregulated miRNA in response to RESV treatment and might target MMP-2. We confirmed miR-328 expression using a qRT-PCR, and miR-328 was significantly upregulated after RESV treatment for 6 h in HOS cells (Supplementary Figure S2C). [score:11]
In addition, this study also identified novel mechanisms of RESV that inhibit MMP-2 through an underlying pathway of suppressing JNK/p38MAPK signals that consequently attenuates CREB-DNA -binding activity and upregulates miR-328 expression. [score:10]
The qRT-PCR data showed that JNK and p38 MAPK inhibitors or mutants only induced miR-328 expression, and a combination of inhibitors or mutants with RESV further enhanced miR-328 upregulation (Figure 7A, B). [score:10]
Combining data from our miRNA screening profiles and miRNA target databases, we found that RESV treatment of osteosarcoma cells upregulated the expression of miR-328 which revealed the suppressive effects on MMP-2 and cell motility. [score:10]
The results showed that RESV suppresses the metastatic potential of human osteosarcomas through transcriptional and epigenetic regulation of MMP-2 by respectively inhibiting CREB-DNA -binding activity and upregulating miR-328. [score:9]
To further verify the direct effect of miR-328 on cell motility, we transiently transfected the miR-328 inhibitor into HOS cells, and found that the miR-328 inhibitor significantly reversed RESV -mediated inhibition of cell invasion (Figure 6D) and migration (Supplementary Figure 4A). [score:8]
Upregulation of miR-328 is involved in RESV -mediated suppression of MMP-2 expression and cell motility. [score:8]
To further ascertain the role of MAPK pathways in RESV -mediated miR-328 upregulation and CREB -binding activity suppression, HOS cells were pretreated with a JNK or p38 MAPK inhibitor or transfected with their DN mutants followed by RESV treatment. [score:8]
Upregulation of miR-328 is involved in resveratrol -mediated suppression of matrix metalloproteinase (MMP)-2 expression and cell motility. [score:8]
Transfection of the miR-328 inhibitor significantly reversed the inhibitory effect of RESV on MMP-2 expression (Figure 6B, upper panel). [score:7]
The p38 and JNK pathways are involved in RESV -induced upregulation of miR-328 and suppression of CREB -binding activity of the MMP-2 promoter. [score:6]
Taken together, our results indicated that p38 MAPK and JNK signaling might play an important role in upregulating RESV -mediated miR-328 and suppressing CREB -binding activity. [score:6]
The p38 and c-Jun N-terminal kinase (JNK) pathways are involved in resveratrol -induced upregulation of miR-328 and suppression of CREB phosphorylation. [score:6]
Furthermore, the endogenous MMP-2 level in HOS cells was respectively up- or downregulated after transfection with an miR-328 inhibitor (Figure 6B, upper panel) or miR-328 mimic (Figure 6B, lower panel). [score:6]
Herein, we first report that RESV showed antimetastasis activities via transcriptional and epigenetic regulation of MMP-2 by respectively altering the CREB-DNA -binding activity and miR-328 expression, which was initiated by inhibition of the p38 MAPK/JNK pathways (Figure 7D). [score:6]
Taken together, our results indicate that RESV suppresses osteosarcoma motility through upregulating miR-328. [score:6]
These results implied that lower miR-328 expression was linked to higher MMP-2 expression and was correlated with osteosarcoma development and metastasis. [score:6]
Moreover, we also observed that the miR-328 expression level in osteosarcoma tissues was lower than that in normal bone tissues and was inversely correlated with the expression level of MMP-2 in osteosarcoma tissues. [score:5]
In contrast, when we transiently (Figure 6E, upper panel) or stably (Figure 6E, lower panel) overexpressed miR-328 into HOS cells, the invasive ability was significantly downregulated compared to control cells, and a similar phenomenon was observed in two other osteosarcoma cell lines, 143B and U2OS (Supplementary Figure S4B). [score:5]
Taken together, these data demonstrated that miR-328 can be induced by RESV in HOS cells and directly represses MMP-2 protein expression through binding to the 3′UTR of the human MMP-2 gene. [score:4]
It was also reported that miR-328 can decrease the chemoresistance of glioblastoma (GBM) and colorectal cancer (CRC) stem cells by downregulating ATP -binding cassette sub -family G member 2 (ABCG2) protein levels [54, 55]. [score:4]
Until now, mir-328 has been recognized as a tumor suppressor or an oncogenic gene in different cancer types. [score:3]
For example, in the A431 human epithelial carcinoma cell line, miR-328 overexpression resulted in reduced cell adhesion, aggregation, and capillary formation by silencing CD44 [53]. [score:3]
In contrast, overexpression of miRNA-328 was reported to increase cell migration and to be associated with brain metastasis in non-small cell lung cancer [56]. [score:3]
pEZX-MR03-miR-328 (Homo sapiens microRNA miR-328 stem-loop expression clone, #HMIR0265), an HIV -based lentiviral vector containing the miR-328 precursor, and pEZX-MR03-control, which instead contains a scrambled sequence, were obtained from GeneCopoeia (Rockville, MD). [score:3]
A qRT-PCR analysis of MMP2 and miR-328 performed in osteosarcoma and normal samples, showed inverse expression levels of MMP2 and miR-328 between osteosarcoma and normal bone tissues (Figure 8B), and a significant negative correlation between MMP-2 and miR-328 was observed in osteosarcomas (Figure 8C). [score:3]
To determine the expression of miR-328 from osteosarcoma patients and cell lines, we used the TaqMan MicroRNA Assay kit (Applied Biosystems, Carlsbad, CA) following the manufacturer's protocol. [score:2]
Next, to examine whether miR-328 regulates the 3′UTR of MMP-2, we constructed a luciferase reporter vector harboring the 3′UTR of MMP-2 and transfected this vector combined with the miR-328 mimic or negative control into HOS cells. [score:2]
The Mir-328 mimic and inhibitor were purchased from GenePharma (Shanghai, China). [score:2]
Figure 7 (A-C) HOS cells were pretreated with SP600125 (5 μM), SB203580 (1 μM), or Ly294002 (20 μM) for 1 h (A, C) or transfected with a dominant negative mutant (DN) of JNK, p38, or Akt for 24 h (B, C) followed by resveratrol (50 μM) treatment for an additional 24 h. miR-328 expression was examined by a qRT-PCR, and CREB phosphorylation was assayed by a. Quantitative results of the p-CREB protein level, which was adjusted with the β-actin protein level. [score:2]
Induction of miR-328 by RESV was also observed in two other osteosarcoma cell lines, 143B and U2OS (Supplementary Figure S3). [score:1]
Clinical significance of matrix metalloproteinase (MMP)-2 and miR-328 in osteosarcomas. [score:1]
Clinical significance of MMP-2 and miR-328 in osteosarcomas. [score:1]
The predicted MMP-2 -binding site of the miR-328 seed location in MMP-2 3′UTR is 817 which was identified by miRanda (http://www. [score:1]
HOS cells were co -transfected with an miR-328 mimic or negative control and vector containing the MMP-2 3′UTR. [score:1]
Results showed that the miR-328 mimic, but not the negative control, decreased luciferase activity (Figure 6C). [score:1]
Then, cells were transfected with 10 μg pEZX-MR03-miR-328 or pEZX-MR03-control together with 10 μg of pCMVΔR8.91 (the packaging vector) and 1 μg of pMD. [score:1]
[1 to 20 of 38 sentences]
4
[+] score: 148
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-127, hsa-mir-34b, hsa-mir-34c
Inhibition of C/EBPα expression down-regulates miR-328 expression. [score:10]
These results suggest that methylated CpG dinucleotides in the miR-328 5’-flanking region suppressed miR-328 expression, leading to BCRP up-regulation in the human placenta. [score:8]
Up-regulation of miR-328 expression by treatment with a DNA demethylating agent in BCRP -expressing cell lines. [score:8]
Other studies demonstrated that miR-328 plays an inhibitory role in the proliferation of cancer cell lines and indicated that the suppression of miR-328 expression provides an advantage for tumor growth [35– 39]. [score:7]
C/EBPα knock-down was associated with an extremely low expression of miR-328, suggesting that C/EBPα is the major activator for miR-328 expression. [score:6]
Cells were cultured in the presence of the transfection mixture for 48 h. After siRNA transfection, cells were harvested to analyze target genes expression levels and miR-328 levels by real-time PCR. [score:5]
On the other hand, methylation in (-3928 to -2197), the region containing the CpG island, strongly suppressed the miR-328 expression. [score:5]
Decreased BCRP expression associated with high miR-328 expression resulting from the demethylation in 5’-flanking region may result in placental function deficit, thus contributing to fetal growth restriction. [score:5]
Before the luciferase analysis, the effect of demethylation on miR-328 expression was tested using BCRP -expressing cells. [score:5]
Studies have also showed that miR-328 is important in regulating BCRP expression, but little is known about its contribution to the variability in BCRP levels among individuals. [score:4]
It was also reported that hypermethylation in the miR-328 upstream region in urine specimens from bladder cancer patients was associated with tumor grade, stage and prognosis, and the reduced expression of miR-328 itself [43]. [score:3]
However, analyzed placental samples in this study had no information about the demographics, because the purpose of this study focused on the association analysis between BCRP and miR-328 expression. [score:3]
It was reported that miR-328 influenced drug efflux by repressing BCRP mRNA expression in breast cancer cells [20]. [score:3]
These results suggest that methylation from bp -3167 to 2184 in the miR-328 5’-flanking region is important for C/EBPα -mediated miR-328 expression. [score:3]
Additional study using larger sample size is needed to determine the role of DNA methylation in the inter-individual differences in miR-328 and BCRP expression. [score:3]
DNA methylation in the miR-328 5’-flanking region is suggested to be associated with an increase of BCRP expression, leading to drug resistance in cancers. [score:3]
Effect of demethylation on miR-328 levels in BCRP -expressing cell lines. [score:3]
To confirm the involvement of C/EBPα in miR-328 expression, C/EBPα siRNA was transfected into BeWo cells. [score:3]
The absence of an association for the -1184CG and -1155CG dinucleotides was consistent with the results of luciferase assays suggesting that miR-328 expression is regulated by C/EBPα independently of DNA methylation. [score:3]
Next, we selected C/EBPα as a candidate transcription factor which binds to the CpG island, and confirmed its involvement in miR-328 expression using C/EBPα siRNA -transfected BeWo cells (Figure 5 ). [score:3]
The expression of mature miR-328 was quantified by quantitative real-time PCR using TaqMan miRNA assays according to the manufacturer’s protocols (Applied Biosystems, Foster City, CA). [score:2]
Effect of C/EBPα knockdown on C/EBPα and miR-328 levels in BeWo cells. [score:2]
Therefore, the DNA methylation pattern of three CpG dinucleotides (-2421CG, -2344CG and -2306CG) plays a major role in regulating the binding of C/EBPα to the miR-328 5’-flanking region, leading to inter-individual differences in miR-328 levels in the human placenta. [score:2]
However, as shown in Figure 12B, miR-328 levels were not directly affected by C/EBPα levels. [score:2]
Influence of methylation patterns and C/EBPα levels on miR-328 levels in the human placenta. [score:1]
All cell lines showed significantly increased miR-328 levels after the treatment (Figure 3 ). [score:1]
Transcription factors capable of binding to the sequence from bp -3928 to -2197 of the miR-328 5’-flanking region were screened using TFSEARCH [45], TRANSFAC ver. [score:1]
We amplified and sequenced the proximal 5’-flanking miR-328 for methylation analysis. [score:1]
Correlation between miR-328 and BCRP mRNA (A) or protein (B) levels in human placentas (n = 20). [score:1]
Confirmation of C/EBPα -binding sites in the miR-328 5’-flanking region. [score:1]
Transcription profiles of deleted sequences of predicted C/EBPα -binding sites in the miR-328 5’-flanking region. [score:1]
Correlation between C/EBPα -binding frequency and miR-328 levels in placental samples (n =20). [score:1]
However, our results are important first step to investigate how DNA methylation in the miR-328 5’-flanking region, and to identify the association between miR-328 and BCRP expression levels in human placenta. [score:1]
A single CpG island was predicted in the miR-328 5’-flanking region. [score:1]
Numbers in the top panel represent nucleotide positions from miR-328. [score:1]
Each BCRP mRNA, BCRP protein and miR-328 level was normalized by the minimum value. [score:1]
0072906.g012 Figure 12 The association between the methylation patterns of the three CpG dinucleotides (-2421CG, -2344CG and -2306CG) which correlated with C/EBPα -binding frequency and miR-328 levels, and BCRP levels was analyzed. [score:1]
In this study, to explore the mechanisms behind the variability in placental BCRP levels, we focused on the association between miR-328 and BCRP levels. [score:1]
BCRP mRNA and protein levels both showed a significantly negative correlation with miR-328 levels (mRNA, Rs = -0.560, P = 0.00526; protein, Rs = -0.730, P = 0.000132) (Figure 1 ). [score:1]
These results suggest that the C/EBPα -binding frequency is a determinant of human placental miR-328 levels. [score:1]
Methylation -dependent C/EBPα -binding to the miR-328 5’-flanking region. [score:1]
Surveyed CpG island in the miR-328 5’-flanking region. [score:1]
We detected one CpG island in the miR-328 5’-flanking region from bp -2459 to -2343 (Figure 2 ). [score:1]
0072906.g001 Figure 1 Each BCRP mRNA, BCRP protein and miR-328 level was normalized by the minimum value. [score:1]
In this study, we focused on the inter-individual variability in BCRP and miR-328 levels in the human placenta. [score:1]
C/EBPα -binding frequency in the miR-328 5’-flanking region. [score:1]
Among six CpG dinucleotides (-2456, -2421, -2344, -2306, -1184, and -1155) within the C/EBPα -binding sites, the methylation levels of the three CpG dinucleotides (-2421CG, -2344CG and -2306CG) proximal to the two C/EBPα -binding sites (-2429 and -2329 bp) were negatively correlated with C/EBPα -binding frequencies and miR-328 levels, but not for -1184CG and -1155CG dinucleotides proximal to the C/EBPα -binding site (-1173 bp). [score:1]
Transcriptional activity in the differentially methylated miR-328 5’-flanking region. [score:1]
We analyzed the relationship between miR-328 and BCRP mRNA and protein levels. [score:1]
We focused on DNA methylation in the miR-328 5’-flanking region. [score:1]
To explore the transcriptional regulation of miR-328, we generated a longer fragment of the miR-328 5’-flanking region (-4230 to +36 relative to the transcription start site of miR-328) using two sets of primers (described as ins1 and ins2 in Table S3 ). [score:1]
Promoter deletion analysis in the miR-328 5’-flanking region. [score:1]
0072906.g013 Figure 13 The relationship between miR-328 and BCRP levels (mRNA and protein) was analyzed using 20 human placental samples. [score:1]
Transcription profiles of some deleted sequences under unmethylated/methylated conditions in the miR-328 5’-flanking region. [score:1]
Schematic representation of identified C/EBPα -binding sites in the miR-328 5’-flanking region. [score:1]
C/EBPα -binding frequency was analyzed in the miR-328 5’-flanking region in BeWo cells using 5-aza-dC. [score:1]
C/EBPα levels showed no correlation with miR-328 levels, indicating they were not crucial to the individual differences in miR-328 levels in the human placenta (Figure 12B ). [score:1]
Correlation between C/EBPα -binding frequency and miR-328 levels in the human placenta. [score:1]
The association between miR-328 and BCRP levels in the human placenta. [score:1]
As shown in Figure 1, miR-328 levels were significantly correlated with BCRP mRNA and protein levels. [score:1]
The relative quantity for miR-328 was determined by the comparative Ct method (2 – ΔΔCt). [score:1]
Effect of methylation patterns (A) and C/EBPα levels (B) on miR-328 levels in placental samples (n = 20). [score:1]
0072906.g008 Figure 8 We analyzed the association between binding frequencies in the regions around the three C/EBPα -binding sites (Figure 9 ) and miR-328 levels in the human placenta (n = 20). [score:1]
BCRP mRNA (upper) and protein (lower) levels in the human placenta and methylation patterns in the miR-328 5’-flanking region. [score:1]
All numbers indicate the relative distance from the 5’ end of the miR-328 transcript. [score:1]
0072906.g006 Figure 6 (A) Schematic representation of predicted binding sites of C/EBPα in the miR-328 5’ flanking region. [score:1]
The relationship between miR-328 and BCRP levels (mRNA and protein) was analyzed using 20 human placental samples. [score:1]
C/EBPα siRNA also significantly diminished miR-328 levels (Figure 5B ). [score:1]
Furthermore, an over 80-fold inter-individual difference was observed in miR-328 levels in the human placentas. [score:1]
These observations are consistent with a previous report showing BCRP mRNA degradation by miR-328 [20, 55]. [score:1]
A single CpG island in the miR-328 5’-flanking region. [score:1]
[1 to 20 of 71 sentences]
5
[+] score: 92
Furthermore, the identification of specific miRNAs (miR-140 and miR-328) that regulate lung development, that show increased expression in lung epithelium as development progresses through saccular and alveolar stages, and that functionally suppress the Fgf9 3’ UTR, link Dicer1 activity to Fgf9 mRNA regulation. [score:9]
Collectively, expression patterns and in vitro suppression of the Fgf9 3’ UTR identified miR-140 and miR-328 as candidate miRNAs that could function in vivo to suppress Fgf9 as lung development progresses from pseudoglandular to canalicular stages. [score:8]
Analysis of expression of these miRs at different stages of lung development showed that miR-140-5p and miR-328-3p were expressed at relatively low levels during the pseudoglandular stage of lung development and at relatively higher levels during the saccular stage, while miR-182-5p showed the opposite profile (Fig 3B– 3D). [score:7]
Importantly, several of these miRNAs (miR-24, miR-140, miR-182, miR-183, miR-328) are expressed in fetal or neonatal lung and their relative expression levels are modulated during lung development [26, 27] or in lung cancer [28– 30]. [score:6]
Our demonstration that miR-140 and miR-328 mimics can directly suppress the Fgf9 3’ UTR, shows the therapeutic potential of supplying critical microRNAs directly to lung epithelium during the period of childhood susceptibility to PPB. [score:5]
Insufficient miR-328 in glioblastomas could lead to increased FGF9 expression and thus provide a mechanism to promote disease progression. [score:5]
MiR-140 and miR-328 regulate in vitro lung development and Fgf9 expression. [score:5]
1005242.g004 Fig 4MiR-140 and miR-328 regulate in vitro lung development and Fgf9 expression. [score:5]
To establish whether miR-140 and miR-328 functionally regulate lung development, lung explant cultures were treated with seed -targeting 8-mer LNA oligonucleotides or single mismatch control LNA oligonucleotides (tiny LNAs) [31]. [score:5]
In malignant gliomas (World Health Organization grade IV astrocytic glioblastomas), miR-328 expression is decreased and is associated with worse prognosis [50]. [score:3]
Target sequences and probe design for analysis of miR-140 and miR-328 activity. [score:3]
Increasing evidence suggests that miR-328 also functions as a tumor suppressor in several types of cancers, including malignant glioma, breast, and colorectal carcinomas [49– 52]. [score:3]
miR-328 was also prominently expressed in E18.5 lung epithelium (S5 Fig). [score:3]
Additionally, miR-328 showed reduced expression when comparing levels in grades II and III astrocytoma to those in secondary grade IV glioblastomas [49]. [score:3]
We also show that the Fgf9 3’ UTR is responsive to conserved miRNA-140, miRNA-328, and miR-182, and that miRNA-140 (and miR-328) is an important regulator of lung development. [score:3]
MicroRNA-328 negatively regulates the expression of breast cancer resistance protein (BCRP/ABCG2) in human cancer cells. [score:3]
At a concentration of 10 nM, tiny LNAs effectively blocked miR-140 or miR-328 ability to suppress Fgf9 3’ UTR activity in vitro (Fig 4A and 4B). [score:3]
Expression of miR-328 in E18.5 lung epithelium. [score:3]
Of these, miR-140, miR-183, and miR-328 suppressed luciferase activity, while miR24 and miR-182 increased luciferase activity (Fig 3F, mouse, and S4A Fig and S4B Fig, human). [score:3]
Mature microRNA mimics for miR-24, miR-140, miR-182, miR-183, and miR-328 were then screened for their ability to regulate luciferase activity of the human or mouse FGF9 3’ UTR. [score:2]
The human and mouse FGF9 3’ UTR are highly conserved and are similarly regulated by miR-140, miR-182, miR-183, miR-328. [score:2]
To demonstrate efficacy of tiny LNAs, HEK293 cells, transfected with pFgf9 UTR and miR-140 or miR-328 mimics, were co -transfected with tiny LNA antagomers. [score:1]
S5 FigHistological sections from an E18.5 wild type mouse lung hybridized with a scrambled LNA in situ probe (left) or with an hsa-miR-328 LNA in situ probe (right). [score:1]
Repression of the Fgf9 3’ UTR by 10 nM miR-140 (A) or 10 nM miR-328 (B) transfected into HEK293 cells with a luciferase reporter construct containing a wild type mouse Fgf9 3’ UTR was blocked by adding 10 nM of the corresponding tiny LNAs to the culture medium. [score:1]
[1 to 20 of 24 sentences]
6
[+] score: 47
We previously demonstrated that miR-328 levels negatively correlated with BCRP mRNA and protein expression levels in the human placenta 7. In addition, we reported that the expression levels of miR-328 were regulated by an epigenetic mechanism 7. The methylation patterns of several CpG dinucleotides proximal to two C/EBPα -binding sites in the miR-328 5′-flanking region negatively correlated with miR-328 levels, and positively correlated with BCRP protein levels in human placental samples 7. Other miRNAs such as miR-519c, miR-520h, and miR-212 also regulate the expression of BCRP 28 29. [score:9]
Some in vitro studies have shown that miR-328 inhibits the expression of BCRP mRNA and protein 28 29. [score:5]
Li et al. reported that miR-519c and miR-328 exerted stronger effects on the regulation of BCRP expression in human breast cancer cells than miR-520h 28. [score:4]
The expression of candidate references was evaluated using the geNorm analysis in order to identify a set of reliable reference miRNAs for a miR-328 relative expression analysis. [score:3]
These results suggest that expression of miR-328 in the intestinal cells is correlated with circulating miR-328 levels (Supplementary Information 5). [score:3]
The aim of the present study was to determine whether total plasma and intestine-derived exosomal miR-328 levels are candidate biomarkers for predicting the functional activity of BCRP in human the intestines. [score:1]
Total plasma exosomal miR-328 levels did not correlate with SASP AUC [0-48] (r [s] = −0.157, P = 0.382, Fig. 4A), whereas the intestine-derived exosomal miR-328 levels positively correlated with SASP AUC [0-48] (r [s] = 0.346, P < 0.05, Fig. 4B). [score:1]
As we described above, large intra-genotype variability in AUC [0-48] still exists in spite of the incorporation of 421C>A into the stratification 6. Specific tissue-derived miR-328 in plasma is an individual continuous value, and, thus, is expected to overcome this disadvantage of SNP stratification. [score:1]
In contrast, miR-328 levels were significantly decreased (P < 0.01) after the treatments with 1% Triton X-100 and RNase A. Transmission electron microscopy images showed that <100 d. nm particles existed in GPA33-immunoprecipitated samples, but not in that after the treatment with 1% Triton X-100 (Supplementary Information 1). [score:1]
In order to confirm that miR-328 is packed into GPA33-immunoprecipitated exosomes, immunoprecipitated samples were treated with RNase A (20 ng/ml, Roche Diagnostics, Indianapolis, IN, USA), 1% Triton X-100 (Promega, Madison, WI, USA), or both at 37 °C for 10 min before miRNA extraction. [score:1]
Hence, we used the geNorm algorithm to quantify exosomal miR-328 in the present study. [score:1]
Since intestinal BCRP plays an important role in the pharmacokinetics of SASP, intestine-derived miR-328 is expected to be a more accurate biomarker. [score:1]
MiR-328 levels in intestine-derived exosomes did not correlate with miR-328 levels in total exosomes (P = 0.572, 4). [score:1]
These results indicate that miR-328 is packaged in intestine-derived exosomes. [score:1]
Threshold cycle values of endogenous candidate miRNAs and miR-328 were shown in 2. GeNorm provides a ranking of 6 reference miRNAs based on the reference miRNA stability measure M. The M value for each miRNA was similar, indicating that the expression of the 5 miRNAs had similar variations (Fig. 3A,B). [score:1]
How to cite this article: Gotanda, K. et al. Circulating intestine-derived exosomal miR-328 in plasma, a possible biomarker for estimating BCRP function in the human intestines. [score:1]
Our study focused on the relationship between intestine-derived exosomal miR-328 levels and intestinal BCRP activity. [score:1]
However, since no concrete conclusions were reached regarding the relationship between miR-328 levels and AUC of SASP, further studies with a larger number of participants are needed in order to improve the precision of BCRP in vivo functions. [score:1]
The relative quantity for miR-328 was determined by the comparative Ct method (2 [–ΔΔCt]) or geNorm analysis. [score:1]
The results of the present study suggest that intestine-derived exosomal miR-328 from plasma is potential biomarker for predicting the functional activity of BCRP in the intestines. [score:1]
In order to confirm whether miR-328 is packed into GPA33-immunoprecipitated exosomes, we examined exosomal miR-328 levels in GPA33-immunoprecipitated samples in the presence of a detergent (1% Triton X-100), RNase A, or both using qRT-PCR. [score:1]
MiR-328 levels in the samples treated with the detergent or RNase A were similar to those in untreated immunoprecipitated samples, while miR-328 levels in the immunoprecipitated samples treated with the detergent and RNase A were significantly decreased (Fig. 2), suggesting that miR-328 is packaged in intestine-derived exosomes. [score:1]
The next important issue in this study is that miR-328 was actually packed into intestine-derived exosomes. [score:1]
Relationship between miR-328 levels in total exosomes or intestine-derived exosomes in plasma and SASP AUC [0-48]. [score:1]
In addition, the intestine-derived exosomal miR-328 levels which were normalized to cel-miR-39 spike-in correlated with SASP AUC [0-48] (r [s] = 0.358, P < 0.05, 3). [score:1]
Relationship between miR-328 levels in intestine-derived exosomes in plasma and SASP AUC [0-48]. [score:1]
Instead of evaluating the correlation between the expression of miR-328 in the intestinal cells and circulating miR-328 levels, we showed secreted exosomal miR-328 levels reflect endogenous miR-328 levels in Caco-2 cells. [score:1]
The results obtained indicated that no correlation existed between SASP AUC [0-48] and miR-328 levels in total plasma exosomes (Fig. 4A). [score:1]
[1 to 20 of 28 sentences]
7
[+] score: 43
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
MiR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572, and miR-663a were downregulated, while miR-101-3p, miR-106b-5p, miR-130a-3p, miR-195-5p, and miR-19b-3p were upregulated. [score:7]
miR-151a-3p (ΔΔCt = -2.01, P = 8.29E-06), MiR-181b-5p (ΔΔCt = -3.39, P = 1.04E-10), miR-320a (ΔΔCt = -2.47, P = 5.02E-12), miR-328 (ΔΔCt = -2.28, P = 4.33E-06), miR-433 (ΔΔCt = -2.33, P = 0.0001), miR-489 (ΔΔCt = -2.10, P = 1.25E-06), miR-572 (ΔΔCt = -2.47, P = 2.66E-08) and miR-663a (ΔΔCt = -2.06, P = 0.00002) were downregulated, while miR-101-3p (ΔΔCt = 1.43, P = 0.003), miR-106b-5p (ΔΔCt = 1.30, P = 0.008), miR-130a-3p (ΔΔCt = 2.35, P = 1.89E-09), miR-195-5p (ΔΔCt = 1.43, P = 0.0016) and miR-19b-3p (ΔΔCt = 1.87, P = 6.88E-09) were upregulated in the ASD individuals. [score:7]
miR-151a-3p, miR-181b-5p, miR-320a, miR-328, miR-433, miR-489, miR-572 and miR-663a were downregulated while miR-101-3p, miR-106b-5p, miR-19b-3p, miR-195-5p, miR-130a-3p and miR-27a-3p were upregulated. [score:7]
The differentially expressed miRNAs in this study, which included miR-101, miR-106b, miR-130a, miR-151a, miR181b, miR-328, miR-433, miR-489 and miR-572, were previously reported to have altered expression in schizophrenia [31- 35], supporting the contention that ASD and schizophrenia share common neurobiological features [36]. [score:5]
Therefore, hsa-miR-181b-5p and hsa-miR-328 in serum may become peripheral biomarkers reflecting the miRNA expression profile of individuals with ASD. [score:3]
However, it was interesting that hsa-miR-181b-5p and hsa-miR-328 in serum showed the same direction of regulation as in the brain. [score:3]
The results of the present and previous studies are summarized in Table  2, in which hsa-miR-181b-5p, hsa-miR-195-5p, hsa-miR-320a and hsa-miR-328 showed the same direction of regulation as in the brain [13] and lymphoblasts [14- 16], while hsa-miR-106b-5p, hsa-miR-19b-30 and hsa-miR-663a did not. [score:3]
The Ct values of nine miRNAs (miR-101-3p, miR-106b-5p, miR-151a-3p, miR-195-5p, miR-19b-3p, miR-27a-3p, miR-320a, miR-328, and miR-489) were in the range of 25–30, while the remaining five miRNAs (miR-130a-3p, miR-181b-5p, miR-433, miR-572, and miR-663a) had Ct values in the range of 30 to 35. [score:1]
[1 to 20 of 9 sentences]
8
[+] score: 41
Dysregulation of IGF1R expression is a feature of the chronic hypoxia mo del of PAH, in which downregulation of miR-328 correlates with upregulation of IGF1R [14]. [score:10]
Consistent with upregulation of miR-223, levels of IGF1R mRNA were downregulated in PA of MCT PAH rats, whereas the decreased miR-328 expression would have been expected to increase IGF1R mRNA levels. [score:9]
Overexpression of miR-328 in transgenic mice suppressed IGF1R expression levels and attenuated hypoxic PH. [score:7]
In the current study, miR-328 expression was modestly reduced in lung, but not PA, of MCT PAH rats, whereas miR-223 was consistently upregulated in all tissues and plasma. [score:6]
Inhibition of miR-145 [12], enhancement of miR-328 expression [14], and enhancement of the miR424/503-FGF axis also attenuated experimental pulmonary hypertension [19, 20]. [score:5]
Although expression of miR-204 and miR-328 was variable in lung and PA of the current study, our findings were generally congruent with published data in human PAH specimens [13, 14]. [score:3]
Expression levels of miR-17-5p, miR-21-5p, miR-126-3p, miR-145-5p, miR-150-5p, miR-204-5p, miR-223-3p, miR-328-3p, miR-424-5p (mmu-miR-322, the mouse/rat ortholog for hsa-miR-424), and miR-503-5p were evaluated. [score:1]
[1 to 20 of 7 sentences]
9
[+] score: 33
Validation in CSF samples showed that expression of miR-328, miR-362-3p miR-486 and miR-451 was significantly upregulated, however; no significant elevation in levels of miR-151-5p, miR-30d and miR-20a was detected. [score:6]
A comparison was performed between the miRNAs upregulated in both MMTBI and STBI group which identified a signature of 10 miRNAs viz miR-151-5p, miR-195, miR-20a, miR-328, miR-362-3p, miR-30d, miR-451, miR-486, miR-505* and miR-92a, with increased expression in both MMTBI and STBI groups (Fig. 2, Common miRNAs in MMTBI and STBI are highlighted in bold in Tables 1 and 2). [score:6]
Normalization with miR-202 showed a significant upregulation of miR-328, miR-362-3p, miR-451 and miR-486 (Fig. 4). [score:4]
Other than miR-151-5p and miR-328, the remaining 8 miRNAs showed a direct and statistically significant correlation with the increased miRNA expression in case of subjects with CT lesions. [score:4]
This analysis identified 30 genes as direct targets for the 8 miRNA candidate miR-151-5p, miR-195, miR-328-3p, miR-362-3p, miR-30d, miR-20a, miR-486 and miR-92a. [score:4]
Specifically, miR-328 was predicted to regulate erythropoietin and erythropoietin receptor which are important mediators of erythropoietin signaling. [score:2]
We randomly selected five miRNAs miR-195, miR-328, miR-362-3p, miR-486 and miR-505* and performed specific miRNA assays to validate their expression. [score:2]
The analysis identified the AUC values as miR-195 (0.81, p value < 0.003), miR-30d (0.75, p value < 0.016), miR-451 (0.82, p value < 0.002), miR-328 (0.73, p value < 0.030), miR-92a (0.86, p value < 0.001), miR-486 (0.81, p value < 0.003), miR-505 (0.82, p value < 0.002), miR-362 (0.79, p value < 0.006), miR-151 (0.66, p value < 0.123), miR-20a (0.78, 0.007). [score:1]
The real time data for miR-151-5p, miR-195, miR-20a, miR-30d, miR-328, miR-362-3p, miR-451, miR-486, miR-505* and miR-92a was normalized using miR-202. [score:1]
There were significant differences between the two groups for all but two of the selected miRNA: miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p < 0.101); miR-92a (p < 0.001); miR-486 (p < 0.006); miR-505 (p < 0.008); and miR-362 (p < 0.035); miR-151 (p < 0.065); and miR-20a (p < 0.012) (Fig. 5). [score:1]
There were significant differences between the two groups for all but two of the selected miRNA (see asterisks): miR-195 (p < 0.001); miR-30d (p < 0.001); miR-451 (p < 0.011); miR-328 (p = 0.101); miR-92a (p < 0.001); miR-486 (p = 0.006); miR-505 (p = 0.008); and miR-362 (p = 0.035); miR-151 (p = 0.065); and miR-20a (p = 0.012). [score:1]
The AUC’s were: miR-195 (0.81), miR-30d (0.75), miR-451 (0.82), miR-328 (0.73), miR-92a (0.86), miR-486 (0.81), miR-505 (0.82), miR-362 (0.79), miR-151 (0.66), miR-20a (0.78). [score:1]
[1 to 20 of 12 sentences]
10
[+] score: 30
The predicted target genes of miRNAs that uniquely expressed in the chronic cases, including miR-885-5p, miR-483-3p, and miR-328, were analysed. [score:5]
One increased miRNA (miR-885-5p) that targets genes of immunologically effective pathways is shown in Fig 2. Other increased miRNAs (miR-483-3p and miR-328) that target genes of immunologically effective pathways are shown in Figs 3 and 4, respectively. [score:5]
Tay et al. demonstrated another role of miR-328 in the regulation of innate immune cell function by showing that suppression of miR-328 improved bacterial clearance in the lungs. [score:4]
One of the 28 miRNAs, miR-328, is involved in cancer [70, 71], autoimmune [72], and neuronal diseases [73]. [score:3]
The miR-328 that increased in the chronic cases was not expressed in the acute cases. [score:3]
In our study, the expression of miR-328 was 2.21-fold in the chronic group compared to in the control group. [score:2]
According to their findings, miR-328 is involved in the regulation of phagocytosis and survival of bacteria through modifying the uptake of live, heat-killed, non-typeable Haemophilus influenzae [74]. [score:2]
According to KEGG pathways analysis, miR-328 was linked to the MAPK signalling pathway, regulation of the actin cytoskeleton, focal adhesion, and the T cell receptor signalling pathway. [score:2]
According to KEGG function annotations, 332 predicted genes have a binding site for miR-328. [score:1]
Thus, based on previous findings, miR-328 may have a strong potential to play a critical role in the microbial host defence of innate immune cells by augmenting phagocytosis as well as the production of ROS and microbicidal activity. [score:1]
Pathway analysis of miR-328 according to KEGG function annotations. [score:1]
Increased miR-328 levels in the chronic cases may be associated with fail of Brucella clearance and establishment of chronicity of Brucella infections. [score:1]
[1 to 20 of 12 sentences]
11
[+] score: 28
Among those significantly differentially expressed miRNAs, five downregulated (miR-26b-5p, miR-200c-3p, miR-203a, miR-223-3p, miR-363-3p) and three upregulated (miR-328, miR-574-3p, miR-1825) miRNAs were selected as a result of detailed literature search for further confirmation with qRT-PCR. [score:9]
For top 10 upregulated microRNAs (hsa-miR-197-3p, hsa-miR-574-3p, hsa-miR-885-5p, hsa-miR-483-3p, hsa-miR-1281, hsa-miR-328, hsa-miR-4254, hsa-miR-4290, hsa-miR-1825, hsa-miR-766-3p), we included those have been shown to be deregulated in cancer, and have either expression data or functional studies in stem cells. [score:7]
Although there was no statistically significant difference in the expression of miR-328 in CD133 [+] samples, its expression had a tendency to be elevated in CD133 enriched cell populations (Additional file 2: Figure S1C, D, Table  2). [score:5]
However, expression levels of miR-223-3p, miR-328, and miR-574-3p were not significantly different between CD133 [+] vs. [score:3]
To validate the differential expression of miR-26b, miR-200c, miR-203, miR-223, miR-328, miR-363-3p, 574-3p, and miR-1825, a total of 25 pairs of CD133 [+] and CD133 [−] cell populations collected from 25 tumor samples including those used in microarray experiments were studied. [score:3]
Only hsa-miR-574-3p, hsa-miR-328, and hsa-miR-1825 met these criteria. [score:1]
[1 to 20 of 6 sentences]
12
[+] score: 28
The up-regulation of miR-328 expression suppresses its target gene SERCA2a (ATPase Sarcoplasmic/Endoplasmic Reticulum Ca2+ Transporting 2) in cardiac myocytes to indirectly activate the calcineurin/NFATc3 signaling pathway, leading to cardiac hypertrophy [33]. [score:11]
In detail, we selected two miRNAs with highest (miR-4750-5p) and moderate (miR-328-5p) fold change among the up-regulated miRNAs and two miRNAs with highest (miR-770-5p) and moderate (miR-564) fold change among the down-regulated miRNAs. [score:7]
In addition, miR-328 was up-regulated in the atria of patients with atrial fibrillation (AF) [52]. [score:4]
The blue and orange lines indicate the two main clusters of samples To validate the data obtained from the miRNA microarray, RT-qPCR was performed to re-examine the expression level of nine miRNAs, namely miR-328-5p, miR-4750-5p, miR-210-5p, miR-423-3p, miR-143-3p, miR-564, miR-770-5p, miR-874-5p and miR-93-5p. [score:3]
In addition, we selected six miRNAs (miR-328-5p, miR-210-5p, miR-423-3p, miR-143-3p, miR-874-5p and miR-93-5p) with low or moderate expression levels based on the array analysis and with known association with cardiac pathologies and its related process [26– 33]. [score:3]
[1 to 20 of 5 sentences]
13
[+] score: 25
We noted that miRNAs (miR-328-5p, miRNA-26a, hsa-miR-4654, miR-4707-5p, miR-4487, miR-24-3p, miR-6824-5p, miR-4740-5p, miR-8074 and, miR-146a-5p) down-regulated in females with OA have a number of TLR related target genes as per miRNA target prediction software’s (targetscan, miRwalk2.0 and microRNA. [score:10]
Estrogen inhibitor (Letrozole) down-regulates (a) miR-26a-5p, (b) miR-146a-5p, (c) miR-328-5p, (d) miR-4654 and up-regulated (e) miR-7107-5p in EVs cargo of human synovial fibroblast cells. [score:9]
Our results show that treatment with an aromatase inhibitor significantly decreases content of miR-26a-5p (p < 0.01), miR-146a-5p (p < 0.07), miR-328-5p (p < 0.01), and miR-4654 (p < 0.01) (Fig.   6). [score:3]
Our results show that aromatase inhibitor treatment decrease content of miR-26a-5p, miR-146a-5p, miR-328-5p, miR-4654, and increased miR-7107-5p in EVs cargo. [score:3]
[1 to 20 of 4 sentences]
14
[+] score: 24
There were no microRNAs regulated after 1 hour in culture, however after 4 hours in culture miR-491-3p, miR-34b, miR-595, miR-328 miR-1281 and miR-483-3p were significantly upregulated, with none being downregulated. [score:8]
However, after 4 hours in culture, significant upregulation was seen for miR-491-3p, miR-34b, miR-595, miR-328, miR-1281 and miR-483-3p, with no microRNAs being significantly downregulated. [score:7]
There are currently only validated targets for one of the microRNAs found to be regulated, miR-328, which targets ABCG2 [51] and CD44 [52]. [score:6]
Of the 6 microRNAs regulated during neutrophil culture, 3 are located within 3kb of known CpG islands (miRs-1281, 34b and 483-3p), and a further one (miR-328) is located within 10kb (CpG “shore”). [score:2]
MiR-328 is in intron 12 on the opposite strand of the ELMO3 gene, miR-483-3p is within the 3′UTR on the opposite strand of IGF2, while miR-595 is in intron 1 of PTRN2. [score:1]
[1 to 20 of 5 sentences]
15
[+] score: 24
Other miRNAs from this paper: hsa-mir-197, hsa-mir-145, hsa-mir-129-2, hsa-mir-505, hsa-mir-1207
The coexpressed mRNAs for miR-328 were enriched for DNA packaging and chromatin assembly (P = 1.73 × 10 [−5]). [score:3]
mRNAs coexpressed with pleiotropic miRNAs were enriched for RNA metabolism (miR-505-5p), ubiquitin -dependent protein catabolism (miR-197-3p, miR-328) and chromatin assembly (miR-328). [score:3]
Gene ontology enrichment analysis (Additional file 1: Table S15) revealed that coexpressed mRNAs for the most pleiotropic miRNAs were enriched for RNA metabolism (miR-505-5p), ubiquitin -dependent protein catabolism (miR-197-3p and miR-328), and chromatin assembly (miR-328). [score:3]
Notably, variants in the primary gene target of miR-328, transcription factor 7-like 2 gene (TCF7L2) [36], have been associated with T2DM in several genome wide association studies [37]. [score:3]
In contrast to the other pleiotropic miRNAs, miR-328 is highly expressed in platelets and has been associated with atrial fibrillation and cardiac hypertrophy, likely through SERCA2A dependent signaling pathways [35]. [score:3]
These highly pleiotropic miRNAs were associated with a large number of mRNAs (1109 mRNAs in total; 396 coexpressed mRNAs for miR-505-5p, 241 for miR-197-3p, 177 for miR-145-5p, and 649 for miR-328). [score:3]
The coexpressed mRNAs for miR-197-3p and miR-328 were enriched for cellular macromolecule catabolism (P = 7.67 × 10 [−7]) and ubiquitin -dependent protein catabolism (P = 1.86 × 10 [−10]). [score:3]
Fifty miRNAs were associated with three or more CM traits and four were associated with four CM traits (miR-197-3p, miR-328, miR-505-5p, miR-145-5p) (Table  3 and Fig.   1). [score:1]
Four mRNAs (FAM13A, CSF2RB, HIST1H2AC, WNK1) were associated with all 6 CM traits (FDR < 0.001) and four miRNAs (miR-197-3p, miR-328, miR-505-5p, miR-145-5p) were associated with four CM traits (FDR < 0.05). [score:1]
miRNAs miR-505-5p, miR-197-3p, miR-145-5p, and miR-328 exhibited significant associations with BMI, SBP, DBP, and TG. [score:1]
[1 to 20 of 10 sentences]
16
[+] score: 21
Recently, Wang and colleagues reported that miR-328 is important in regulating tumor development and invasion by targeting CD44 expression in epithelial carcinoma cell lines [60]. [score:7]
Biochem Biophys Res Commun 60 Wang CH Lee DY Deng Z Jeyapalan Z Lee SC 2008 MicroRNA miR-328 regulates zonation morphogenesis by targeting CD44 expression. [score:6]
Overexpression of miR-328 inhibits cell migration and adhesion and preventing them to expand into the tumor. [score:5]
Another miRNA differentially expressed in the plasma microvesicles is miR-328. [score:3]
[1 to 20 of 4 sentences]
17
[+] score: 19
Other miRNAs from this paper: mmu-mir-298, mmu-mir-328, hsa-mir-298
In vivo, we observed decreased expression levels of miR-298 and miR-328 in the hippocampus of aging APPSwe/PS1 mice [8], which supports further the possibility that the loss of miRNA regulation of BACE1 mRNA translation may lead to higher BACE1 protein expression, an enhanced Aß formation and the development of AD. [score:9]
Reported to regulate BACE1 mRNA translation in the context of AD [8], miR-328 has been shown to have a second function, acting as an RNA decoy by binding to heterogeneous nuclear ribonucleoprotein E2 and lifting its translational repression of an mRNA involved in myeloid cell differentiation [11, 12]. [score:6]
In a recent study from our laboratory, we reported similar observations in an animal mo del of AD (APPSwe/PS1 mice) and demonstrated a role for two miRNAs, i. e. miR-298 and miR-328, in the regulation of BACE1 expression, using mainly transiently transfected murine neuronal N2a cells in culture [8]. [score:4]
[1 to 20 of 3 sentences]
18
[+] score: 19
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-200a, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
The downregulated eca-miR-328 had 204 potential target genes reported by TargetScan and these genes significantly enriched five KEGG pathways, from which the most significant was the regulation of actin cytoskeleton (KEGG: 04810, Hyp* = 0.01) with seven genes: fibroblast growth factor 1 (FGF1) and 11 (FGF11), p21 protein (Cdc42/Rac)-activated kinase 6 (PAK6), integrin alpha 5 (fibronectin receptor, alpha polypeptide) (ITGA5), v-rck sarcoma virus CT10 oncogene homolog (avian) (CRK), WAS protein family member 2 (WASF2), and FYVE, RhoGEF and PH domain containing 1 (FGD1). [score:9]
The most significant up- (eca-miR-122) and down-regulated (eca-miR-328) miRNAs in ponies related to Warmblood are shown on Fig.   7a-b. Fig. 7Significantly differentially expressed miRNA in the serum of ponies. [score:6]
A total of 50 miRNAs in serum proved to be potential biomarkers to differentiate specific breed types, of which miR-122, miR-200, miR-483 were over-expressed and miR-328 was under-expressed in ponies compared to Warmbloods. [score:4]
[1 to 20 of 3 sentences]
19
[+] score: 17
Table S5 Compilation of target genes and/or genes co-regulated with hsa-miR-328, hsa-mir-494, hsa-mir-513 and hsa-mir-638. [score:4]
While lack of available experimental data precluded systematic questioning, we were able to analyze the target and/or co-regulated mRNAs for hsa-miR-328, hsa-miR-494, hsa-miR-513 and hsa-miR-638 (Table S5). [score:4]
Ten most significantly enriched processes for the genes targeted by hsa-miR-328, hsa-miR-494, hsa-miR-513 and hsa-miR-638 were scored and ranked in respect to the obtained p-values. [score:3]
Ontology enrichment analysis for target genes of hsa-miR-328, hsa-miR-494, hsa-miR-513 and hsa-miR-638. [score:3]
hsa-miR-328 Chr16: 67236230–67236251 (−) 16q22.1 Intragenic Locus involved in mitochondrial disorders (CDG2H, MDDS2). [score:1]
To our surprise, despite the fact that most miRNAs are conserved accross metazoans [39], only two of the 13 mitomiRs, i. e hsa-miR-494 and hsa-miR-328, were highly conserved while the others were either human-specific or only conserved in primates (Table 1). [score:1]
While 44 miRNAs showed a greater enrichment in the cytosolic Hy3-labeled RNA fraction, 13 miRNAs were significantly and reproducibly enriched in the mitochondrial Hy5-labeled RNA sample (ranging from 1.5- to 56-fold), namely hsa-miR-1973, hsa-miR-1275, hsa-miR-494, hsa-miR-513a-5p, hsa-miR-1246, hsa-miR-328, hsa-miR-1908, hsa-miR-1972, hsa-miR-1974, hsa-miR-1977, hsa-miR-638, hsa-miR-1978 and hsa-miR-1201 (Figure 5A). [score:1]
[1 to 20 of 7 sentences]
20
[+] score: 17
Two were expressed inversely in the two groups, miR-328-3p was downregulated in both groups, and decreased expression of this miRNA has also been reported in other carcinomas [67, 68]. [score:8]
We detected miRNA-328-3p which was upregulated in both groups. [score:4]
MiR-335-5p, miR-579-3p, and miR-126-5p were shared by the expression profiles of HPV -positive tonsillar tumors and of the HPV immortalized keratinocyte clones, whereas miR-328-3p, miR-34c-3p, and miR-885-5p were shared by the miRNA profiles of HPV -negative tonsillar tumors and the HPV -negative keratinocytes. [score:3]
NT [b] Fold change Fold change hsa-miR-328-3p mir-328 −22.020 −2.806 hsa-miR-34c-5p mir-34 −16.419 4.851 hsa-miR-885-5p mir-885 48.377 −3.725 [a] tHFK HPV-immortalized human foreskin keratinocyte clones, pHFK primary human foreskin keratinocyte clones, iHFK hTERT-immortalized human keratinocyte clones [b] TT+ HPV -positive tonsillar tumors, TT- HPV -negative tonsillar tumors In the groups of HPV -positive tonsillar tumors and HPV-immortalized keratinocyte clones, we also evaluated the influence of HPV status on the changes in the miRNA expression profile. [score:1]
NT [b] Fold change Fold change hsa-miR-328-3p mir-328 −22.020 −2.806 hsa-miR-34c-5p mir-34 −16.419 4.851 hsa-miR-885-5p mir-885 48.377 −3.725 [a] tHFK HPV-immortalized human foreskin keratinocyte clones, pHFK primary human foreskin keratinocyte clones, iHFK hTERT-immortalized human keratinocyte clones [b] TT+ HPV -positive tonsillar tumors, TT- HPV -negative tonsillar tumors In the groups of HPV -positive tonsillar tumors and HPV-immortalized keratinocyte clones, we also evaluated the influence of HPV status on the changes in the miRNA expression profile. [score:1]
[1 to 20 of 5 sentences]
21
[+] score: 17
A total of 3 μL or 6 μL of 10 μM miRNA mimics (mirVana miRNA mimic for hsa-mir-328-3p and hsa-mir-382-5p, Thermo Fisher Scientific), inhibitor (mirVana miRNA inhibitor for hsa-mir-let-7d-5p), or negative controls were diluted in 150 μL serum-free media (the final concentrations were 10 nM and 20 nM, respectively), and then mixed with 9 μl Lipofectamine iRNAiMAX in 150 μL serum free media for 5 minutes at room temperature. [score:5]
We validated the expression of three miRNAs (mir-328, mir-382, and let-7d) by real-time PCR. [score:3]
An increase in mir-328 and mir-382, and a decrease in let-7d expression, were observed in hPSCs co-cultured with Panc-1 or BxPC-3 cells (Figure 1C and Supplementary Figure 1). [score:3]
However, altered mir-328 and mir-382 expression was not observed (Figure 1D). [score:3]
The opposite results were observed for mir-328, and no changes in mir-382 expression were observed. [score:3]
[1 to 20 of 5 sentences]
22
[+] score: 15
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
Ectopic expression of miR-328 in cell lines restored differentiation of leukemic blasts by induction of the survival factor PIM1 and inhibition of the hnRNP E2 interaction with the hematopoietic transcription factor CEBPA. [score:5]
A critical step for the progression to CML blast crisis stage is the down-regulation of miR-328, which is observed in a BCR-ABL dose- and kinase -dependent manner. [score:4]
Eiring AM, et al. miR-328 functions as an RNA decoy to modulate hnRNP E2 regulation of mRNA translation in leukemic blasts. [score:4]
The most frequently deregulated miRNAs in chronic myeloid leukemia include miR-10a, miR-17/92, miR-150, miR-203, and miR-328 [36]. [score:2]
[1 to 20 of 4 sentences]
23
[+] score: 15
A recent study reported that RES administration could inhibit cold exposure -induced cardiac hypertrophy in mice; the hearts of these mice showed the upregulation of hypertrophy-related miR-328, and RES treatment (100 mg/kg/day) for eight weeks inhibited the increase of miR-328, and had a suppressive action of apoptosis of myocardium via inhibition of Bax and caspase-3 activation [91]. [score:12]
In a mo del of cold exposure -induced cardiac hypertrophy in mice, RES has been shown to inhibit the increase of miR-328 involved in cardiac hypertrophy, thereby limiting ultrastructure damage and weakened heart functions [91]. [score:3]
[1 to 20 of 2 sentences]
24
[+] score: 12
Indeed, miR-328 expression leads to PTPRJ downregulation through increasing cell proliferation of cancer cell lines such as HeLa and SKBr3 [8]. [score:6]
Other than promoter hypermethylation [4] and loss of heterozygosity (LOH), observed in colon, lung, mammary, and thyroid tumors [5– 7], we have also previously shown that PTPRJ is a target of miR-328. [score:3]
An inverse correlation between miR-328 and PTPRJ mRNA levels has also been assessed in hepatocellular carcinoma, where PTPRJ expression negatively correlates with the progression of this malignancy [9]. [score:3]
[1 to 20 of 3 sentences]
25
[+] score: 12
Reexpression of miR-328 restores differentiation and impairs blast survival not only through traditional seed sequence dependent posttranscriptional silencing of the prosurvival factor PIM1, but also through interacting with hnRNP-E2 (PCBP2), acting as a decoy to rescue C/EBPa mRNA translation and function [39]. [score:5]
Micro-array, northern blot, and qRT-PCR approach identified miR-328 as downregulated in CML-BC secondary to BCR-ABL activity both in vitro and in vivo [39]. [score:4]
Postulating that miRNA and RBPs may interact, Eiring et al. showed that loss of miR-328 in CML-BC is regulated by hnRNP-E2, as an inverse correlation between the two exist, suggesting hnRNP-E2 may mediate miR-328 activity. [score:2]
Evidence also suggests miRNA may function as a decoy for other noncoding proteins, as discussed for miR-328 in CML-BC [39]. [score:1]
[1 to 20 of 4 sentences]
26
[+] score: 11
Other miRNAs from this paper: hsa-mir-150
In the treatment of breast cancer, As [2]O [3] is an effective therapy partly due to its action where it upregulates miR-328, thereby inducing apoptosis through the inhibition of hERG expression [143]. [score:8]
For example, miR-328 targets hERG, a gene encoding a subunit of a potassium ion channel. [score:3]
[1 to 20 of 2 sentences]
27
[+] score: 11
To estimate the efficiency of RNA silencing, Huh-7 and 9–13 cells were grown in 24-well plates to reach ~70% confluency prior to transfection using Lipofectamine 2000 (Invitrogen) with either psiCHECK (0.4 μg DNA) and psiRluc or psiNeg (0.25–250 ng DNA), or Rluc:miR-328 BS reporter constructs (0.4 ng DNA) and pre-mmu-miR-328 expression construct (250 ng DNA). [score:3]
However, miR-328 mediated silencing of Rluc expression via its WT binding sites was similar in cells harbouring or not the HCV replicon (Fig. 1D), indicating that the intrinsic differences in RNAi efficiency between the host cells are not related to HCV. [score:3]
The pre-miR-328 expression vector was conceived by cloning in psiSTRIKE the pre-mmu-miR-328 sequence (5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagcccctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). [score:3]
The Rluc:miR-328 binding site reporter constructs, in which Rluc is coupled with 1 or 3 copies of perfectly complementary (PC) or natural wild-type (WT) binding sites for mmu-miR-328, were obtained by cloning 1 or 3 copies of the PC (5'-atctcaacggaagggcagagagggccagatctc-3') or WT (5'-atctcgtccctgtggtaccctggcagagaaagggccaatctcaatctc-3') binding sites into the PmeI site of psiCHECK (Promega). [score:1]
We noted a slight intrinsic defect in the efficiency of RNA silencing mediated through recognition by miR-328 of its natural binding site of imperfect complementarity independent of the presence of HCV replicon (see Fig. 1D). [score:1]
[1 to 20 of 5 sentences]
28
[+] score: 11
Other miRNAs from this paper: mmu-mir-328, hsa-mir-3161
There is growing evidence that microRNAs (miRNAs) can target the expression of both oncogenes and tumour suppressor genes and recently miRNA-328 has been reported to decrease Ptprj expression in epithelial cells [46]. [score:9]
In addition to our observation of multiple lncRNAs originating from the Ptprj locus, the potential for RNA regulation of Ptprj was also recently highlighted by a report showing that PTPRJ is negatively regulated by the short RNA microRNA328 [46]. [score:2]
[1 to 20 of 2 sentences]
29
[+] score: 10
The precise role of miR-238 in human cancer is not yet fully elucidated: while it was overexpressed in patients with non-small cell lung cancer brain [48], loss of miR-328 expression occurred in blast crisis chronic myelogenous leukemia [49]. [score:5]
Several microRNAs were strongly down- (miR-22-3p, miR-29c-3p) or upregulated (miR-328, miR-98-5p) by progesterone and might contribute to the observed hormonal effects. [score:4]
The involvement of miR-328 in breast cancer has not been established to date. [score:1]
[1 to 20 of 3 sentences]
30
[+] score: 10
Expression values were calculated by normalizing to miR-328-3p levels in each sample, and the expression levels were determined using the delta- delta Ct method. [score:3]
The Ct values of miR-328-3p in untreated SKG mice and that in ß-glucan -injected SKG mice were quantified. [score:1]
U6 RNA or miR-328-3p was used as a miRNA internal control in the cell line or plasma, respectively. [score:1]
S1 Fig The Ct values of miR-328-3p in untreated SKG mice and that in ß-glucan -injected SKG mice were quantified. [score:1]
The Ct value of miR-328-3p in untreated SKG mice (n = 5) was 30.7 ± 0.85 (means ± S. E. ), and that in ß-glucan -injected SKG mice (n = 5) was 30.6 ± 1.20 (S1 Fig). [score:1]
We used miR-328-3p as miRNA internal control because the levels of miR-328-3p in untreated SKG mice were almost the same as those in ß-glucan -injected SKG mice. [score:1]
The Ct value of miR-328-3p in untreated SKG mice was 30.7 ± 0.85 and that in ß-glucan -injected SKG mice was 30.6 ± 1.20. are presented as the means ± S. E. for each group (n = 5). [score:1]
The Ct value of miR-328-3p in untreated SKG mice and that in ß-glucan -injected SKG mice. [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 10
Another study identified miR-328 in the SP of colorectal cancer cells and demonstrated that expression of miR-328 correlated with high a SP fraction, and that the main targets of miR-328 were the ABCG2 transporter and the MMP16 gene [36]. [score:5]
Consistently, our data showed similarly decreased expression of miR-128a and miR-328, and increased expression of let-7 family in MP of DPCs. [score:5]
[1 to 20 of 2 sentences]
32
[+] score: 9
Restoration of miR-328 expression rescues the differentiation and survival of leukemic blasts by interacting with PCBP2, promoting release of target mRNA CEBPA from PCBP2 -mediated translational inhibition, which is independent of the miRNA seed sequence [48]. [score:9]
[1 to 20 of 1 sentences]
33
[+] score: 9
Other miRNAs from this paper: hsa-mir-21, hsa-mir-221, hsa-mir-222, hsa-mir-451a, hsa-mir-451b
This was evidenced by (a) downregulation of miR-451 leads to the increased metabolism of DOX [22]; (b) downregulation of miR-328 results in increased mitoxantrone sensitivity [23]; and (c) Overexpression of miR-221 and miR-222 in MCF-7 cells confers resistance to tamoxifen [24]. [score:9]
[1 to 20 of 1 sentences]
34
[+] score: 9
This was evidenced by the overexpression of miR-221/222, conferring resistance to tamoxifeninMCF-7 cells, and the down-regulation of miR-451 and miR-328, which could result in increased DOX and mitoxantrone sensitivity, respectively [24, 25, 26]. [score:6]
Pan Y. Z. Morris M. E. Yu A. M. MicroRNA-328 negatively regulates the expression of breast cancer resistance protein (BCRP/ABCG2) in human cancer cells Mol. [score:3]
[1 to 20 of 2 sentences]
35
[+] score: 8
Blood levels of miR-328, which is known to be upregulated in cardiomyocytes after atrial fibrillation [16], were not significantly dysregulated relative to the control group. [score:5]
However, in our study, the expression level of circulating miRNA-328 was not significantly different in AF patients compared to controls (P = 0.39). [score:2]
A study has revealed a four-fold elevation of miR-328 in human atrial samples from AF patients [16]. [score:1]
[1 to 20 of 3 sentences]
36
[+] score: 8
In addition, miRNA-603 and miRNA-328 were upregulated in glioma cells; this overexpression activated Wnt/β-catenin signaling [121], even though miR-328 activity was mediated via inhibition of SFRP1 [122]. [score:8]
[1 to 20 of 1 sentences]
37
[+] score: 8
Our colony formation assay (Figure 2) indicated that miR-503-3p and miR-328-3p had opposing effects on colony formation; the final biological effect of ASC-derived exosomes was inhibition of cancer growth (Figure 1(c)). [score:2]
We used a colony formation assay to examine whether both miR-328-3p and miR-503-3p can suppress cancer stem cell- (CSC-) like phenotypes (Figure 2). [score:2]
After 24 h, 20 nM of scrambled miRNA (miR-NC), miR-328-3p, and miR-503-3p was transfected as described above, and the cells were grown up to 3 weeks by replacing the media with fresh media every 3 days. [score:1]
However, treatment with miR-328-3p increased survival fractions in the four different cancer cell lines. [score:1]
miRNA sequences, used for transfection, are as follows: miRNA-NC sense: 5′- CCUCGUGCCGUUCCAUCAGGUAGUU -3′ miRNA-NC antisense: 5′-CUACCUGAUGGAACGGCACGAGGUU-3′ miR-328-3p sense: 5′-CUGGCCCUCUCUGCCCUUCCGU-3′ miR-328-3p antisense: 5′-ACGGAAGGGCAGAGAGGGCCAG-3′ miR-503-3p sense: 5′-GGGGUAUUGUUUCCGCUGCCAGG-3′ miR-503-3p antisense: 5′-CCUGGCAGCGGAAACAAUACCCC-3′ Cells, transfected as described above, were harvested by Accutase (Thermo Scientific, USA), and total RNA was purified with an RNeasy Mini kit (QIAGEN, GmBH, Germany) following the manufacturer's instructions. [score:1]
miRNA sequences, used for transfection, are as follows: miRNA-NC sense: 5′- CCUCGUGCCGUUCCAUCAGGUAGUU -3′ miRNA-NC antisense: 5′-CUACCUGAUGGAACGGCACGAGGUU-3′ miR-328-3p sense: 5′-CUGGCCCUCUCUGCCCUUCCGU-3′ miR-328-3p antisense: 5′-ACGGAAGGGCAGAGAGGGCCAG-3′ miR-503-3p sense: 5′-GGGGUAUUGUUUCCGCUGCCAGG-3′ miR-503-3p antisense: 5′-CCUGGCAGCGGAAACAAUACCCC-3′ Cells, transfected as described above, were harvested by Accutase (Thermo Scientific, USA), and total RNA was purified with an RNeasy Mini kit (QIAGEN, GmBH, Germany) following the manufacturer's instructions. [score:1]
[1 to 20 of 6 sentences]
38
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-93, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-197, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-194-1, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-26a-2, hsa-mir-372, hsa-mir-374a, hsa-mir-375, hsa-mir-133b, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-486-1, hsa-mir-146b, hsa-mir-494, hsa-mir-503, hsa-mir-574, hsa-mir-628, hsa-mir-630, hsa-mir-449b, hsa-mir-449c, hsa-mir-708, hsa-mir-301b, hsa-mir-1827, hsa-mir-486-2
In this study, both PRKCA and IL1-beta were identified as targets of miR-328, supporting evidence that miR-328 leads to increased migration of NSCLC cells, through this pathway as well [89]. [score:3]
Many of the miR-328 targets control this signaling pathway leading to loss of cell adhesion and increased migration. [score:3]
miR-494, miR-27a, miR-328. [score:1]
Arora et al. found miR-328 to be a marker for patients with higher risk for brain metastases. [score:1]
[1 to 20 of 4 sentences]
39
[+] score: 7
Twelve microRNAs were consistently up-regulated in metastasis (hsa-miR-103, -155, -16, -191, -200c, -21, -24, -26a, -26b, -29a, -31 and 93) and only two were down-regulated (hsa-miR-328 and -566) (Table 2). [score:7]
[1 to 20 of 1 sentences]
40
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-98, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-197, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-187, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-211, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-138-1, hsa-mir-146a, hsa-mir-200c, hsa-mir-155, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-375, hsa-mir-337, hsa-mir-338, hsa-mir-339, hsa-mir-384, hsa-mir-424, hsa-mir-429, hsa-mir-449a, hsa-mir-485, hsa-mir-146b, hsa-mir-494, hsa-mir-497, hsa-mir-498, hsa-mir-520a, hsa-mir-518f, hsa-mir-499a, hsa-mir-509-1, hsa-mir-574, hsa-mir-582, hsa-mir-606, hsa-mir-629, hsa-mir-449b, hsa-mir-449c, hsa-mir-509-2, hsa-mir-874, hsa-mir-744, hsa-mir-208b, hsa-mir-509-3, hsa-mir-1246, hsa-mir-1248, hsa-mir-219b, hsa-mir-203b, hsa-mir-499b
MiRNA expression was also analyzed in exhaled breath condensates from asthmatic patients and control subjects, showing decreased expression of several miRNAs in asthma (miR-1248, let-7a, miR-155, miR-21, miR-328, and miR-133a) [23]. [score:5]
Further research has revealed that miR-328 is involved in the airway epithelial repair and might regulate actin pathway [83]. [score:2]
[1 to 20 of 2 sentences]
41
[+] score: 7
Although two miRNAs, miR-328 and miR-519c, that have been previously described to downregulate human ABCG2 (Pan et al., 2009; To et al., 2009) have no fly orthologs, we report a reduction in miR-100, which is also predicted to bind to the human ABCG2 3′UTR (To et al., 2008). [score:4]
MicroRNA-328 negatively regulates the expression of breast cancer resistance protein (BCRP/ABCG2) in human cancer cells. [score:3]
[1 to 20 of 2 sentences]
42
[+] score: 7
Studies have shown that miRNAs may be involved directly or indirectly in AF by modulating atrial electrical remo deling (miR-1, miR-26, miR-328) [10, 27, 28] or structural remo deling (miR-30, miR-133, mir-590) [7, 30]. [score:3]
However, in the present study we found that the expressions of miR-328 were very low in both the NSR and AF group and were not significantly different between the two groups. [score:3]
Lu et al. [10] found that levels of miR-328 were elevated 3.5- to 3.9-fold in LAAs from dogs with mo del AF and in right atrial appendages from AF patients, detected by both microarray and RT-qPCR. [score:1]
[1 to 20 of 3 sentences]
43
[+] score: 6
Notably, miR-328 expression, previously suggested being higher in FTCs than in FTAs, was found to be upregulated in FTAs but not in FTCs by Nikiforova et al [26]. [score:6]
[1 to 20 of 1 sentences]
44
[+] score: 6
A very recent study demonstrated repression of IcaL by miRNA-328 as an independent mechanism for AF in dog mo dels as well as human atrial samples from AF patients with rheumatic heart disease [9]. [score:3]
In the present study, we did not detect significant differences between AF and SR patients regarding the expressions of miRNA-26, and miRNA-328. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 6
MicroRNA expression profiling identifies miR-328 regulates cancer stem cell-like SP cells in colorectal cancer. [score:4]
Dicer (Iliou et al., 2014) and multiple miRNAs [including, miR-34a (Bu et al., 2013, 2016), miR-106b (Zheng et al., 2015a), miR-140 (Zhai et al., 2015), miR-146a (Hwang et al., 2014), miR-183 (Wellner et al., 2009), miR-200 (Wellner et al., 2009), miR-203 (Wellner et al., 2009), miR-215 (Jones et al., 2015), miR-302b (Zhu et al., 2012), miR-328 (Xu et al., 2012b), miR-363 (Tsuji et al., 2014), miR-371 (Li et al., 2015c) and miR-451 (Bitarte et al., 2011)] reportedly regulate CRC TICs. [score:2]
[1 to 20 of 2 sentences]
46
[+] score: 6
Normalised expression values of a. hsa-miR-138-5p, b. hsa-miR-184, c. hsa-miR-204-5p, d. hsa-miR-29c-3p, e. hsa-miR-328-3p, and f. hsa-miR-501-3p in healthy normal granulosa cells (circle), juvenile-GCT (square) and adult-GCT (triangle) assessed using RT-qPCR. [score:3]
Experimentally supported TarBase targets for all miRNAs but miR-328-3p, which was not present in the database, also confirmed these as significantly converging pathways. [score:3]
[1 to 20 of 2 sentences]
47
[+] score: 5
Other miRNAs from this paper: hsa-mir-181a-2, hsa-mir-181a-1
For example, miRNA MIR328 binds to the 3′ UTR of PAX6 to regulate its expression. [score:4]
However, variation in the miRNA binding site reduces the binding affinity of MIR328, which in turn results in an increase in the abundance of PAX6 transcripts, which is associated with electrophysiological features of Rolandic epilepsy [81]. [score:1]
[1 to 20 of 2 sentences]
48
[+] score: 5
While this finding was not validated by PCR, the possible involvement of mir-328 in myopia development via the regulation of the PAX6 gene and retinoic acid pathway in RPE cells is suggested in a recent in vitro study by Chen et al. [34]. [score:3]
Another micro -RNA, mir-328, showed a modest difference in expression (1.5 fold, p<0.01) in peripheral fetal compared to adult sclera in our microarray analyses. [score:2]
[1 to 20 of 2 sentences]
49
[+] score: 5
mRNA targets of these two groups of miRNAs were identified using Tarbase 48, 49. miRPath was then used with the group of mRNAs targeted by miR-181a-5p, miR-150-5p, miR-145-5p, miR-425, miR199b-5p, miR-328-3p, miR-766-3p, and miR-142-3p to identify a list of enriched mRNA -associated pathways, identified at p < 0.0001 of statistical significance. [score:5]
[1 to 20 of 1 sentences]
50
[+] score: 5
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Among the upregulated miRNAs were miR-124a, miR-155, miR-328, miR-326, miR-302c, miR-345, miR-373*, and miR-210 [54]. [score:4]
In addition, few lymphoma-specific miRNA signature included miR-150, miR-17-5p, miR-145, miR-328, and others [51]. [score:1]
[1 to 20 of 2 sentences]
51
[+] score: 5
Other miRNAs from this paper: mmu-mir-328, ssc-mir-328
PCBP2 is a poly(C) binding protein known to control translation of specific mRNA through competitive binding of C-rich tracts in target genes 5'UTR and mir-328 [49]. [score:5]
[1 to 20 of 1 sentences]
52
[+] score: 4
We identified mir-21, miR-24, miR-328, miR-99b, miR-let-7c and miR-1274B as not regulated between groups, and as potential reference genes for normalization of miRNA expression levels in CSF. [score:4]
[1 to 20 of 1 sentences]
53
[+] score: 4
Using, miR-1237, miR-30a, miR-598, miR-601, miR-205*, and miR-328 exhibited enrichment of seed regions in the set of mRNAs up-regulated 20 hours after IR. [score:4]
[1 to 20 of 1 sentences]
54
[+] score: 4
Liu et al reported that the down-regulation of circulating miR-328 in AML patients correlates with poor clinical outcome, and may provide a diagnostic and prognostic biomarker [93]. [score:4]
[1 to 20 of 1 sentences]
55
[+] score: 4
Analysis of expression profiles of miRNAs obtained from lung tumors samples that are able to develop brain metastasis revealed that miR-328 was associated with higher risk for developing brain metastasis. [score:3]
In vitro studies using lung cancer cells showed that miR-328 enhances cell migration, which confirmed the relevance of miRNAs in NSCLC metastatic process [91]. [score:1]
[1 to 20 of 2 sentences]
56
[+] score: 4
MicroRNA-298 and microRNA-328 regulate expression of mouse beta-amyloid precursor protein-converting enzyme 1. J. Biol. [score:4]
[1 to 20 of 1 sentences]
57
[+] score: 4
miR-328 expression was decreased in subjects with AF in comparison to subjects without AF. [score:3]
Circulating levels of the platelet enriched miR-328 have also been linked to AF in 2445 offspring in the Framingham Heart Study [53]. [score:1]
[1 to 20 of 2 sentences]
58
[+] score: 4
Recent studies have shown that ABCG2 expression is also regulated by miRNAs including miR-328 [61], leading to increased mitoxantrone sensitivity, and by miRNAs from the Ch19q13.42 cluster. [score:4]
[1 to 20 of 1 sentences]
59
[+] score: 4
In contrast, 11 miRNAs (miR-9-5p, miR-184, miR-328-3p, miR-363-3p, miR-372-3p, miR-518d-3p, miR-518f-3p miR-523-3p, miR-618, miR-625-5p, and miR-628-5p) were significantly up-regulated in human oocytes (with respect to FF) (Figure 3B and Supplementary Table S1). [score:4]
[1 to 20 of 1 sentences]
60
[+] score: 4
We determined the expression of angiogenesis-related miRNAs (miR-20a, miR-126, miR-210, miR-221, miR-222, miR-328; Dews et al., 2006; Poliseno et al., 2006; Kuehbacher et al., 2007; Fasanaro et al., 2008; Soeki et al., 2016), inflammation-related miRNAs (miR-21, miR-146a, miR-155; Taganov et al., 2006; Urbich et al., 2008; Wang et al., 2017) and cardiac or muscle-specific/enriched miRNAs (miR-1, miR-133a, miR-133b, miR-208a, miR-208b, miR-378, miR-486, miR-499, miR-940; Chen et al., 2006; Soci et al., 2016; Xu et al., 2016). [score:3]
Relationship between local production of microRNA-328 and atrial substrate remo deling in atrial fibrillation. [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 4
Also, the regulatory relationships identified in Loveday et al. [14] were primarily based on the baseline and the data on hour 8. Therefore, although there exist a few regulatory relationships identified in both our study and Loveday’s (e. g., 'hsa-miR-328’ and 'PSME3’), the majority of the regulatory interactions identified in the two studies are different due to all the reasons described above. [score:4]
[1 to 20 of 1 sentences]
62
[+] score: 4
miRNA seed sequences are required for their function, but recent findings have demonstrated that sequences outside of the seed region may have important roles in miRNA function 1. For example, a hexamer nucleotide in miR-29b is important for its nuclear import 38, and a C-rich element in miR-328 endows the decoy activity through which miR-328 competes with hnRNP E2 for CREBA mRNA binding, resulting in the upregulation of CREBA 39. [score:4]
[1 to 20 of 1 sentences]
63
[+] score: 4
Dis 2009 doi:10.1016 95 Boissonneault V Plante I Rivest S Provost P MicroRNA-298 and microRNA-328 regulate expression of mouse beta -amyloid precursor protein converting enzyme 1J. [score:4]
[1 to 20 of 1 sentences]
64
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-3, hsa-let-7c, hsa-mir-18a, hsa-mir-223, hsa-mir-298
Boissonneault V. Plante I. Rivest S. Provost P. MicroRNA-298 and microRNA-328 regulate expression of mouse beta-amyloid precursor protein-converting enzyme 1 J. Biol. [score:4]
[1 to 20 of 1 sentences]
65
[+] score: 3
24 *** hsa-mir-770-5p 19 *** 75.47 *** hsa-mir-93* 9.5 *** 92.1 - Inhibited differentiation & low cell count *** hsa-let-7b* 4.75 *** 28.64 *** hsa-mir-1224-3p 2.38 *** 51.46 *** hsa-mir-1228 2.38 ** 9.43 *** hsa-mir-1249 1.66 *** 53.17 *** hsa-mir-125a-5p 19 *** 69.8 *** hsa-mir-1260 7.12 *** 61.75 *** hsa-mir-1280 11.88 *** 68.95 *** hsa-mir-129-3p 9.5 *** 65.64 - hsa-mir-1296 9.5 *** 36.36 *** hsa-mir-133a/hsa-mir-133b 42.75 * 0.85 *** hsa-mir-150 4.75 *** 60.37 *** hsa-mir-197 4.75 *** 27.79 *** hsa-mir-204 2.85 *** 27.44 *** hsa-mir-328 0.1 ** 30.87 *** hsa-mir-342-3p 33.25 *** 58. [score:3]
[1 to 20 of 1 sentences]
66
[+] score: 3
Lerman et al. observed the expression of the following miRNAs in psoriatic lesion skin: hsa-miR-149, hsa-miR-150, hsa-miR-210, hsa-miR-220, hsa-miR-326, has-miR-324-5p, hsa-miR-342, hsa-miR-326, hsa-miR-328, hsa-miR-345, hsa-miR-346, and hsamiR-197 [20]. [score:3]
[1 to 20 of 1 sentences]
67
[+] score: 3
Notably, miR-328-5p could interact with 12 circRNAs via 49 binding sites; whereas circRNAs generally interact with 5 miRNAs (Supplementary PDF S2). [score:1]
Moreover, FCHO1as (circRNA-001396), antisense to FCHO1, harbors 13 binding sites for miR-328-5p (Figure 3E); whereas IL4Rex (circRNA-000684), exonic spliced from IL4R, harbors 5 binding sites for miR-185-5p (Figure 3F). [score:1]
Similarly, we found ciRF-1301-3p (circRNA family binding with miR-1301-3p) with 23 members (Figure 3B), ciRF-328-5p (circRNA family binding with miR-328-5p) with 12 members (Figure 3C), cirRF-185-5p (circRNA family binding with miR-185-5p) with 11 members (Figure 3D). [score:1]
[1 to 20 of 3 sentences]
68
[+] score: 3
Studies have shown that miRNAs may be involved directly or indirectly in AF by modulating atrial electrical remo deling (i. e. miR-1, miR-26, and miR-328) or structural remo deling (i. e. miR-30, miR-133, and mir-590). [score:3]
[1 to 20 of 1 sentences]
69
[+] score: 3
For example miR-298, an embryonic-stem-cell-specific miRNA (Houbaviy et al. 2003), has a near match with MCL-1, and miR-328 (neuronally expressed) has a near match with LIMK-1, which is known to be involved in synapse formation and function. [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
Furthermore, it has been reported that several circulating miRNAs, such as miR-133, miR-1291, miR-663b, miR-328, and miR-134, exhibit clinical impact on human myocardial infarction [47, 48]. [score:1]
Likewise, miR-328 can be a potential mediator of atrial remo deling and atrial fibrillation [49]. [score:1]
He F. Lv P. Zhao X. Wang X. Ma X. Meng W. Meng X. Dong S. Predictive value of circulating miR-328 and miR-134 for acute myocardial infarction Mol. [score:1]
[1 to 20 of 3 sentences]
71
[+] score: 3
CD44 is mediated by some miRs via binding to its 3′-UTR region in diverse human diseases; for instance, miR-34a in prostate cancer 13, miR-328 in gastrointestinal cancer 14, and miR-373 and miR-520c in breast cancer 31. [score:3]
[1 to 20 of 1 sentences]
72
[+] score: 3
Similarly, in vivo inhibition of miR-328 by intra-tracheal inoculation of anti-328 resulted in 4-fold enhanced non-typeable Haemophilus influenzae (NTHi) clearance from the lungs as compared to controls (Tay et al., 2015). [score:2]
Antagonism of miR-328 increases the antimicrobial function of macrophages and neutrophils and rapid clearance of nontypeable Haemophilus influenzae (NTHi) from infected lung. [score:1]
[1 to 20 of 2 sentences]
73
[+] score: 3
The Ct values for the miRNAs were approximately 28 (miR-21), 29 (miR-20a), 30 (miR-146a, miR-221), 31 (miR-222), 33 (miR-149*, miR-210, miR-328, miR-1908), and 34 (miR-133a). [score:1]
The other miRNAs (miR-1908, miR-20a, miR-21, miR-133a, miR-210, miR-222, and miR-328) did not change significantly following resistance exercise (Fig. 2). [score:1]
We also selected the following eight miRNAs that were validated in an earlier study: miR-20a, miR-21, miR-133a, miR-146a, miR-210, miR-221, miR-222, and miR-328 [20]. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 3
Wang Y Arsenic trioxide inhibits breast cancer cell growth via microRNA-328/hERG pathway in MCF-7 cellsMol. [score:3]
[1 to 20 of 1 sentences]
75
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
Among these, miR-328, miR-330-3p, miR-221, and miR-125a-5p had their expressions reduced, while miR-192, miR-486-5p, miR-19b, miR-106a, miR-130b, miR-18a, and miR-769-5p displayed increased levels after the intervention. [score:3]
[1 to 20 of 1 sentences]
76
[+] score: 3
As for miR-328, its expression was found to be inversely correlated to ATP -binding cassette subfamily G(ABCG2) levels in human breast cancer cells [28]. [score:3]
[1 to 20 of 1 sentences]
77
[+] score: 3
Indeed, Eiring et al. have recently reported that miR-328 acts as a decoy factor by binding to a repressor ribonucleoprotein, independently from the seed sequence and RISC, and blocking it from translational repression of mRNA involved in myeloid cell differentiation [23, 24]. [score:3]
[1 to 20 of 1 sentences]
78
[+] score: 3
662.00E-03 hsa-miR-432−1.803.00E-03 hsa-miR-1821.662.00E-03 hsa-miR-328−1.643.00E-03 hsa-miR-1441.423.00E-03    hsa-miR-146b1.424.00E-03    hsa-miR-182*1.614.00E-03    hsa-miR-1491.534.00E-03    hsa-miR-1411.674.00E-03    hsa-miR-610 1.34 5.00E-03       Negative Fold-Change indicates over -expression in margins. [score:3]
[1 to 20 of 1 sentences]
79
[+] score: 2
sham rat) Peers' studies hsa-miR-34a-3p 2.63 upUp, Jess Morhayim[15] hsa-miR-433-3p 1.24 up This study hsa-miR-106b 2.24 up This study hsa-miR-23a 0.48 downDown, Sylvia Weilner[27] hsa-miR-328-3p 0.38 down Down, Sylvia Weilner hsa-miR-29b-3p 2.1 up Up, Jess Morhayim hsa-miR-146a-5p 2.68 up Up, Jess Morhayim hsa-miR-148a-3p 1.85 upUp, Cheng[28] We noted that DKK1 played important role in the development of osteoporosis. [score:2]
[1 to 20 of 1 sentences]
80
[+] score: 2
Therefore, an allele-specific regulation of MS4A6A by miR-328-3p may explain part of the observed association with AD. [score:2]
[1 to 20 of 1 sentences]
81
[+] score: 2
Pim-1 has been found to be negatively regulated by some miRNAs, such as miR-15 [7], miR-1 [15], miR-328 [17], miR-33a [18] and miR-210 [19]. [score:2]
[1 to 20 of 1 sentences]
82
[+] score: 2
Other miRNAs from this paper: hsa-mir-224, hsa-mir-449b
Specific miRNAs have been shown to be involved in CSC regulation in CRC, such as miR-328 and miR-449b [29, 30]. [score:2]
[1 to 20 of 1 sentences]
83
[+] score: 2
An assessment of the degree of conservation for structure-specific distribution of microRNAs in Wistar rat, Beagle dog and cynomolgus monkey (see for relative enrichment analysis), revealed high enrichment of nine microRNAs cardiac valves (miR-let7c, mIR-125b, miR-127, mir-199a-3p, miR204, miR-320, miR-99b, miR-328 and miR-744) (Figure 3A) and seven microRNAs in the myocardium (miR-1, mir-133a, miR-133b, miR-208b, miR-30e, miR-499-5p, miR-30e*) (Figure 3A). [score:1]
Conserved microRNA signatures were identified in valves (miR-let-7c, miR-125b, miR-127, miR-199a-3p, miR-204, miR-320, miR-99b, miR-328 and miR-744) and in ventricular-specific regions of the myocardium (miR-1, miR-133b, miR-133a, miR-208b, miR-30e, miR-499-5p, miR-30e*) of Wistar rat, Beagle dog and cynomolgus monkey. [score:1]
[1 to 20 of 2 sentences]
84
[+] score: 2
The remaining three miRNAs, namely hsa-miR-328, hsa-miR-30a, and hsa-miR-30e, showed higher expression in the blood cells of MS patients compared to the blood cells of healthy individuals, as indicated by AUC values higher than 0.7. [score:2]
[1 to 20 of 1 sentences]
85
[+] score: 2
Other miRNAs from this paper: hsa-let-7d, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-21, hsa-mir-22, hsa-mir-30a, hsa-mir-32, hsa-mir-33a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-147a, hsa-mir-34a, hsa-mir-187, hsa-mir-204, hsa-mir-205, hsa-mir-200b, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-138-2, hsa-mir-142, hsa-mir-144, hsa-mir-125b-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-190a, hsa-mir-200c, hsa-mir-155, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-365b, gga-mir-33-1, gga-mir-125b-2, gga-mir-155, gga-mir-17, gga-mir-148a, gga-mir-138-1, gga-mir-187, gga-mir-32, gga-mir-30d, gga-mir-30b, gga-mir-30a, gga-mir-30c-2, gga-mir-190a, gga-mir-204-2, gga-mir-138-2, gga-let-7d, gga-let-7f, gga-mir-146a, gga-mir-205b, gga-mir-200a, gga-mir-200b, gga-mir-34a, gga-mir-30e, gga-mir-30c-1, gga-mir-205a, gga-mir-204-1, gga-mir-23b, gga-mir-142, hsa-mir-449a, hsa-mir-489, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-33b, hsa-mir-449b, gga-mir-146b, gga-mir-147, gga-mir-489, gga-mir-449a, hsa-mir-449c, gga-mir-21, gga-mir-144, gga-mir-460a, hsa-mir-147b, hsa-mir-190b, gga-mir-22, gga-mir-460b, gga-mir-1662, gga-mir-1684a, gga-mir-449c, gga-mir-146c, gga-mir-449b, gga-mir-2954, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, gga-mir-365b, gga-mir-33-2, gga-mir-125b-1, gga-mir-190b, gga-mir-449d, gga-mir-205c
Evidences indicated the miRNAs are crucial regulators in PH induced by hypoxia, and miR-190, miR-328 and miR-138 all help to promote pulmonary vascular remo deling [8– 10]. [score:2]
[1 to 20 of 1 sentences]
86
[+] score: 2
Other miRNAs from this paper: hsa-mir-188, hsa-mir-296, hsa-mir-331, hsa-mir-432
Similarly, hsa-miR-328 has been implicated in the regulation of CD44 [39]. [score:2]
[1 to 20 of 1 sentences]
87
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-100, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-139, hsa-mir-10b, hsa-mir-34a, hsa-mir-182, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-221, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-134, hsa-mir-146a, hsa-mir-149, hsa-mir-150, hsa-mir-154, hsa-mir-320a, hsa-mir-155, hsa-mir-128-2, hsa-mir-200a, hsa-mir-302a, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-302c, hsa-mir-367, hsa-mir-370, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-379, hsa-mir-151a, hsa-mir-135b, hsa-mir-335, hsa-mir-133b, hsa-mir-449a, hsa-mir-451a, hsa-mir-410, hsa-mir-486-1, hsa-mir-146b, hsa-mir-520f, hsa-mir-518d, hsa-mir-517c, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-584, hsa-mir-602, hsa-mir-629, hsa-mir-638, hsa-mir-449b, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-298, hsa-mir-1246, hsa-mir-1908, hsa-mir-718, hsa-mir-2861, hsa-mir-378b, hsa-mir-378c, hsa-mir-4306, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-3976, hsa-mir-4644, hsa-mir-203b, hsa-mir-451b, hsa-mir-4728, hsa-mir-4734, hsa-mir-378j, hsa-mir-6165, hsa-mir-486-2
Singh et al. (2014)MiR-198, MiR-26a, MiR-34a, MiR-49a, let-7a, MiR-328, MiR-130a, MiR-149, MiR-602, MiR-92b The human breast cancer cell lines, culture supernatants from MCF7, and MDA-MB231 cells qRT-PCR analysis, and Western blotting The extracellular vesicles carry oncogenic proteins and miRNAs, which may further be applicable for early detection of breast malignancy as well as delineating the possible role of extracellular vesicles in tumorigenesis and metastasis. [score:1]
[1 to 20 of 1 sentences]
88
[+] score: 1
MicroRNA-328 along with other miRNAs was found to be associated with (non-small) cell lung cancer (NSCLC) metastasis and mediates NSCLC migration [35]. [score:1]
[1 to 20 of 1 sentences]
89
[+] score: 1
org/), a set of miRNAs were predicted to have potential interaction with circUBAP2, including miR-150, miR-135, miR-101, miR-181, miR-23, miR-149, miR-139, miR-491, miR-124, miR-301m miR-328, miR-122, miR-186, let-7, miR-132, miR-191, miR-425, miR-125, miR-149, miR-143, and miR-146a. [score:1]
[1 to 20 of 1 sentences]
90
[+] score: 1
For example, miR-1, miR-133, miR-208a/b, miR-499, and miR-328 have all been shown to modulate the cardiac damage following an acute MI [78, 79, 80]. [score:1]
[1 to 20 of 1 sentences]
91
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-96, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-217, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-145, hsa-mir-152, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-34c, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-335, hsa-mir-133b, hsa-mir-409, hsa-mir-484, hsa-mir-485, hsa-mir-486-1, hsa-mir-490, hsa-mir-495, hsa-mir-193b, hsa-mir-497, hsa-mir-512-1, hsa-mir-512-2, hsa-mir-506, hsa-mir-509-1, hsa-mir-532, hsa-mir-92b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-33b, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-1224, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-802, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-4262, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-203b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-486-2, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Additionally, circulating microRNAs like miR-328-3p, let-7g-5p were shown to be decreased with osteoporotic bone fracture [51]. [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
The best classification accuracy has been obtained by using a subset that consists of 16 miRNAs including hsa-miR-186, hsa-let-7d*, hsa-miR-18a*, hsa-miR-145, hsa-miR-99a, hsa-miR-664, hsa-miR-501-5p, hsa-miR-378*, hsa-miR-29c*, hsa-miR-1280, hsa-miR-365, hsa-miR-1249, hsa-miR-328, hsa-miR-422a, hsa-miR-30 d, and hsa-miR-17*. [score:1]
[1 to 20 of 1 sentences]
93
[+] score: 1
Moderately abundant EC reference genes with mean Cq values between 20 and 25, included miR-18a, miR-133a, miR-197, miR-210, miR-214, miR-328 and RNU44. [score:1]
[1 to 20 of 1 sentences]
94
[+] score: 1
pval miRNA fold change mRNA fold change description mmu-miR-449c-5p Myc −0.89 1.2E-04 1.60E-03 −13.7 7.7 v-myc avian myelocytomatosis viral oncogene homolog mmu-miR-181a-5p Lmo1 −0.73 5.8E-03 1.80E-02 −8.1 5.1 LIM domain only 1 (rhombotin 1) mmu-let-7d-3p Ccnd2 −0.94 6.0E-06 4.00E-04 −77.7 4.3 cyclin D2 mmu-miR-375-3p Specc1 −0.83 7.4E-04 4.40E-03 −7.7 3.8 sperm antigen with calponin homology and coiled-coil domains 1 mmu-miR-92b-5p Notch1 −0.95 3.2E-06 3.10E-04 −108.1 3.5 notch 1 mmu-miR-328-3p Pim1 −0.9 7.6E-05 1.20E-03 −48.1 3.1 Pim-1 proto-oncogene serine/threonine kinase mmu-miR-223-3p Msh2 −0.88 2. 1E-04 2.10E-03 567.7 −3.6 mutS homolog 2 mmu-miR-143-3p Chek2 −0.81 1.3E-03 6.40E-03 6.9 −3.5 checkpoint kinase 2 Due to the similarity of the gene expression patterns, we further investigated whether the bronchial genomic classifier from mice can assist in the diagnosis of lung cancer in humans. [score:1]
[1 to 20 of 1 sentences]
95
[+] score: 1
Other miRNAs, including miR-328 (20), miR-326 (21), and miR-34a (22), have also been shown to modulate chemosensitivity. [score:1]
[1 to 20 of 1 sentences]
96
[+] score: 1
In another study, they indicated that the CD44 3′UTR is also the ceRNA for collagen type 1α1 (Col1α1) mediated by hsa-miR-328-5p and the ceRNA for fibronectin type 1 (FN1) mediated by hsa-miR-512-3p, hsa-miR-491-5p, and hsa-miR-671-5p [40]. [score:1]
[1 to 20 of 1 sentences]
97
[+] score: 1
We first performed first screen by pooling serum samples of 24 healthy subjects and 24 patients with CHD-PAH and fourteen miRNAs (miR-451a, miR-9, miR-424, miR-223, miR-204, miR-150, miR-328, miR-21, miR-34a, miR-34b, miR-26a, miR-27b, miR-126 and miR-20a) changed more than 1.5-fold. [score:1]
[1 to 20 of 1 sentences]
98
[+] score: 1
These studies have described contributions by miR-328 (BC CML), miRs-29a and 142-3p (AML), miR-9 (EVI1 -induced AML), and miR-193a (AML associated with t(8;21)) [20- 23]. [score:1]
[1 to 20 of 1 sentences]
99
[+] score: 1
Other miRNAs from this paper: mmu-mir-328
Antagonism of miR-328 increases the antimicrobial function of macrophages and neutrophils and rapid clearance of non-typeable Haemophilus Influenzae (NTHi) from infected lung. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
Additionally, Wang et al. reported that plasma and whole blood miR-133 and miR-328 levels are increased in AMI patients [32]. [score:1]
[1 to 20 of 1 sentences]