sort by

72 publications mentioning hsa-mir-381

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-381. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 544
Then, according to the expression level of miR-381 mRNA and TMEM16A protein, we diveded 103 gastric cancers into four groups, miR-381 low expression and TMEM16A high expression (miR-381-/TMEM16A+), miR-381 low expression and TMEM16A low expression (miR-381-/TMEM16A-), miR-381 high expression and TMEM16A high expression (miR-381+/TMEM16A+), miR-381 high expression and TMEM16A low expression (miR-381+/TMEM16A-), and their association with lymph node metastasis and overall survival (OS) was analyzed. [score:19]
Our results showed that miR-381 overexpression could notably down-regulate mesenchymal markers, vimentin, fibronectin, N-Cadherin, but up-regulated epithelial marker E-Cadherin, and enforced TMEM16A expression could partially rescue the expression of these EMT markers (Fig.   6f). [score:13]
In this study, the oncological significance of miR-381 in gastric cancer was investigated and it was demonstrated that: (1) miR-381 expression was significantly decreased in gastric cancer tissues and cell lines, (2) low expression of miR-381 was associated with lymph node metastasis, advanced tumor stage and poor prognosis of gastric cancer patients, (3) down-regulation of miR-381 contributed to gastric cancer proliferation and metastasis in vitro and in vivo, (4) TMEM16A was a direct target of miR-381 and they were inversely correlated with each other in clinical gastric cancer specimens, (5) TMEM16A mediated the functional effects of miR-381 on migration and invasion rather than proliferation of gastric cancer, (6) miR-381 acted as a suppressor gene miRNA partially through suppressing TGF-β signaling pathway and EMT. [score:13]
Consistently, in the present study, we found that miR-381 directly targeted 3′UTR of TMEM16A and negatively modulated the expression of TMEM16A in gastric cancer, moreover, enforced overexpression of TMEM16A effectively reversed the tumor suppressive functions of miR-381 on gastric cancer migration and invasion. [score:10]
c Protein expression of TGF-β1 and TGF-β2 in gastric cancer cells down-regulated in miR-381 overexpression group, and further decreased in TMEM16A overexpression group. [score:10]
After identifying TMEM16A was a direct target of miR-381, our studies further showed that miR-381 abolished TGF-β synthesis and secretion, and subsequently down-regulated the expression of EMT phenotype. [score:9]
We found that ectopic expression of miR-381 reduced the TMEM16A protein expression, while co-transfection of TMEM16A overexpression TMEM16A plasmids could recover the TMEM16A expression (Fig.   5a). [score:9]
a Western blot analysis showed that ectopic expression of miR-381 reduced the TMEM16A protein expression, while co-transfection of TMEM16A overexpression TMEM16A plasmids could recover the TMEM16A expression. [score:9]
In lung adenocarcinoma [11], epithelial ovarian cancer [12], colon cancer [13, 14], breast cancer [15], hepatocellular carcinoma [16] and pituitary tumor [17], miR-381 is down-regulated and suppresses the malignancy of these tumors, suggesting that miR-381 may have potential roles as a tumor-suppressor miRNA. [score:8]
TMEM16A was identified as a direct target of miR-381 and the expression of miR-381 was inversely correlated with TMEM16A expression in gastric cancer tissues. [score:8]
These data demonstrated that miR-381 could inhibit TGF-β signaling pathway and down-regulate EMT phenotype partially through targeting TMEM16A, and miR-381/TMEM16A/TGF-β/EMT axis contributed to the migration and invasion of gastric cancer cells. [score:8]
Mechanically, miR-381 could suppress TGF-β signaling pathway and down-regulate EMT phenotype by targeting TMEM16A. [score:8]
Compared to negative control, miR-381 overexpression significantly reduced TGF-β1 and TGF-β2 levels, while co-transfection of TMEM16A overexpression could rescue the down-regulation of TGF-β1 and TGF-β2 levels partially (Fig.   6a). [score:7]
Li et al. [22] found a high expression of miR-381 in osteosarcoma and the association with an inferior prognosis, and suppression of miR-381 expression increased the sensitivity of osteosarcoma cells to cisplatin. [score:7]
In this study, we found that miR-381 inhibited the metastasis of gastric cancer through targeting TMEM16A expression. [score:7]
These data indicated that miR-381 reduced TGF-βs secretion partially through targeting TMEM16A, and miR-381 inhibited TGF-βs synthesis via other pathways rather than targeting TMEM16A. [score:7]
To explore the expression pattern of miR-381 in gastric cancer, we first downloaded microRNA array expression profile datasets GSE26595 and GSE28700 from the open Gene Expression Omnibus (GEO) database. [score:7]
Based on relative expression in cancer/adjacent non-tumor < or >0.5, the 103 gastric cancer cases were divided into two groups: the miR-381 high expression group (n = 41) and the miR-381 low expression (n = 62). [score:7]
However, supplement of TMEM16A -overexpressing did not reverse the inhibition of gastric cancer cell proliferation induced by the miR-381 overexpression (Fig.   5d and e). [score:7]
MiR-381 may function as a tumor suppressor by directly targeting TMEM16A and regulating TGF-β pathway and EMT process in the development of progression of gastric cancer. [score:7]
Inhibition of miR-381 sensitized glioblastoma cells to temozolomide (TMZ) by inhibiting the mTOR pathway through targeting NEFL [63]. [score:7]
Furthermore, co-transfection of TMEM16A overexpression reverted the suppressive effects of miR-381 overexpression on the migration and invasion of gastric cancer cells (Fig.   5b and c). [score:7]
CDS coding sequence, 3′UTR 3′-untranslated region, EMT epithelial-mesenchymal transition In this study, we finds for the first time that miR-381 is decreased in gastric cancer and its down-regulation is asociated with poor clinical features of gastric cancer patients. [score:6]
Up-regulation of miR-381 expression could abrogated cancer cells proliferation, invasion and migration in various solid tumors [11– 17]. [score:6]
Patient groups were separated based on expression status of miR-381 and TMEM16A To further confirm that TMEM16A was negatively regulated by miR-381 in gastric cancer, we examined the expression of TMEM16A protein using immunohistochemistry in gastric cancer tissues. [score:6]
Moreover, miR-381 inhibited TGF-β signaling pathway and down-regulated epithelial–mesenchymal transition (EMT) phenotype partially by mediating TMEM16A. [score:6]
Patient groups were separated based on expression status of miR-381 and TMEM16A To further confirm that TMEM16A was negatively regulated by miR-381 in gastric cancer, we examined the expression of TMEM16A protein using immunohistochemistry in gastric cancer tissues. [score:6]
Hou et al. [48] found that the expression levels of transcriptional factors Sox9 and Runx2 are positively correlated with transcription of miR-381, indicating they may regulate expression of miR-381. [score:6]
Fig. 3Overexpression of miR-381 inhibits gastric cancer growth and metastasis in vivo. [score:5]
To further confirm TGF-β was involved in the suppressive effect of miR-381 on migration and invasion, recombinant purified TGF-β was added to miR-381 overexpression group. [score:5]
The expression of miRNA was normalized to U6 snRNA; c Relative miR-381 expression levels in gastric cancer tissues and adjacent non-tumor tissues. [score:5]
Mechanistically, we confirm that miR-381 suppressed invasion and migration and EMT of gastric cancer cells by targeting TMEM16A partially through TGF-β signaling pathway (Fig. 7). [score:5]
Kaplan–Meier survival analyses showed that gastric cancer patients with low miR-381 expression had a significantly shorter overall survival and progression-free survival time than those patients with high miR-381 expression (P = 0.024, P = 0.037, respectively) (Fig.   1e and f). [score:5]
On the contrary, the expression of miR-381 is elevated in glioma [18, 19], synovial sarcoma [20], epitheliod sarcoma [21] and osteosarcoma [22], and silencing miR-381 inhibits the glioma growth [18] or increases the sensitivity of osteosarcoma cells to chemotherapeutic drugs [22]. [score:5]
Ming J, Zhou Y, Du J, Fan S, Pan B, Wang Y, Fan L, Jiang J. miR-381 suppresses C/EBPalpha -dependent Cx43 expression in breast cancer cells. [score:5]
Overexpression of miR-381 inhibits tumor growth and metastasis in vivo. [score:5]
Supplement of TGF-β significantly reverted the ability of invade and migrate in gastric cancer cell which were inhibited by miR-381 overexpression (Fig.   6d and e). [score:5]
We found ectopic expression of miR-381 in AGS and BGC-823 cells could significantly inhibit cell invasion and migration. [score:5]
These results suggested that the increase of TMEM16A expression by inhibition of miR-381 has a critical role in promoting gastric cancer invasion and metastasis. [score:5]
Moreover, the expression of miR-381 was inversely related to the level of TMEM16A expression in gastric cancer tissues (Fig.   4f, Table  2). [score:5]
Surprisingly, miR-381 overexpression could significantly abolish the mRNA expression of TGF-β1 and TGF-β2. [score:5]
Compared to the negative control group, both the TMEM16A mRNA and protein level was markedly down-regulated in miR-381 overexpression group (Fig.   4c and d). [score:5]
showed that miR-381 overexpression significantly reduced wide-type TMEM16A luciferase activity, while had no inhibition effect on the mutant-type TMEM16A luciferase activity in AGS and BGC-823 cells (Fig.   4b). [score:5]
Therefore, we explored whether miR-381 suppressed TGF-βs signaling pathway via targeting TMEM16A. [score:5]
MiR-381 suppresses TGF-β signaling pathway and down-regulates EMT phenotypes. [score:5]
It was consistent with our previous finding that knockdown of TMEM16A did not affect proliferation of gastric cancer cells, suggesting that miR-381 stimulated gastric cancer cell proliferation through any other targets rather than TMEM16A. [score:4]
Down-regulation of miR-381 is associated with adverse clinicopathological features and poor prognosis. [score:4]
In addition, miR-381 contributed to respiratory infection through increasing the activity of NF-κB signaling by directly targeting IκBα [64]. [score:4]
These results indicated that TMEM16A was a direct target of miR-381. [score:4]
Fig. 4TMEM16A is a direct target of miR-381 in gastric cancer cells. [score:4]
All the above results indicated that miR-381 was down-regulated in gastric cancer. [score:4]
In epithelial ovarian cancer, miR-381 targeted YY1 and regulated p53 and Wnt signaling [12]. [score:4]
For instance, Twist, an important inducer of EMT, was found to be directly targeted by miR-381 [14]. [score:4]
As expected, down-regulation of miR-381 was observed in 81 (78.6%) cases of gastric cancer tissues, which was markedly lower than that in adjacent non-tumor tissues (Fig.   1b and c). [score:4]
Compared with that in tissues of low expression of miR-381, the expression of TMEM16A potein was significantly lower in tissues with a high level of miR-381 (Fig.   4e). [score:4]
TMEM16A is a direct target of miR-381. [score:4]
These results confirmed that miR-381 was one of the upstream regulators of TMEM16A and by which exerted its suppressive role in gastric cancer. [score:4]
In regard to the upstream regulatory mechanisms of miR-381, Liang et al. [17] reported that P53 binds to the promoter of miR-381, activating miR-381 transcription and inducing its expression. [score:4]
f MiR-381 expression was inversely related to TMEM16A expression in gastric cancer tissues. [score:4]
Fig. 7Mo del for miR-381 -mediated inhibition of cell proliferation and migration via its regulation of the TMEM16A and TGF-β signaling pathway. [score:4]
MiR-381 expression was analyzed using bioinformatic software on open microarray datasets from the Gene Expression Omnibus (GEO) and confirmed by quantitative RT-PCR (qRT-PCR) in human gastric cancer tissues and cell lines. [score:4]
The expression of miR-381 is dysregulated in various cancer types. [score:4]
Chi-square test was used to compare the levels of miR-381 expression and various clinicopathological parameters of gastric cancer patients. [score:3]
To validate that TMEM16A was a direct target gene of miR-381, luciferase assay were performed. [score:3]
However, the expression level of miR-381 was not significantly associated with gender, age at surgery, tumor size, histological type. [score:3]
These findings showed the complexity of miRNAs including miR-381 in cancers, more than that, suggesting that therapies targeting miRNAs must consider their potential dual role in cancers. [score:3]
Our findings elucidated the detailed roles of miR-381 in gastric cancer and further contribute to offering the effective therapeutic targets for the treatment of gastric cancer. [score:3]
Functionally, miR-381 was found to inhibit the proliferation, migration and invasion of gastric cancer cells both in vitro and in vivo. [score:3]
b Overexpression of miR-381 significantly decreased the luciferase activity that carried wild type (WT) but not mutant type (MUT) 3′-UTR of TMEM16A in gastric cancer cells. [score:3]
Moreover, overexpression of miR-381 can lead to significantly reduced tumor weight to the negative control group mice (Fig.   3b). [score:3]
First, AGS and BGC-823 cells, which were lower expression of miR-381, were transfected with agomiR-381. [score:3]
In glioma, miR-381 increased the proliferation of tumor cells by targeting LRRC4 and this action is associated with inducing MEK/ERK and AKT signaling [18]. [score:3]
Taken together, these data indicated that miR-381 inhibited growth and metastasis of gastric cancer cells in vivo. [score:3]
On the other hand, we transfected MKN-28 and SGC-7901 which expressed relative higher levels of miR-381 using antagomiR-381. [score:3]
With regard to miR-381, it has been wi dely reported as a potential tumor suppressor miRNA in previous studies. [score:3]
Consistent with these studies, the present study found that miR-381 was markedly decreased in gastric cancer, and miR-381 expression prohibited gastric cancer cells proliferation, invasion and migration in vitro and in vivo and predicted favorable prognosis. [score:3]
The results showed that miR-381 was significantly down-regulated in gastric cancer tissues compared with adjacent non-tumor tissues in both GSE26595 and GSE28700 (Fig.   1a) (P < 0.01, P < 0.01, respectively). [score:3]
The correlation between miR-381 expression and clinicopathological characteristics was shown in Table  1. Low miR-381 expression was positively associated with present lymph node metastasis, advanced tumor stage (P = 0.002, P = 0.000, respectively). [score:3]
In cell level, miR-381 expression was decreased in AGS, SGC-7901, BGC-823, MKN-45 cell lines than that in the normal gastric epithelial cell line GES-1 (Fig.   1d). [score:3]
Ectopic expression of miR-381 of the two gastric cancer cell lines was confirmed by qRT-PCR after transfection (Additional file 1: Figure S1). [score:3]
However, multivariate cox regression analysis failed to identify miR-381 expression as an independent prognostic factor for gastric cancer patients (data not shown). [score:3]
In fact, there were many miRNAs like miR-381 have been demonstrated to play both tumor-suppressing and tumor-promoting roles that depend on the cancer types. [score:3]
MiR-381 was mapped to the chromosomal 14q32.31 locus where existed a cluster of miRNAs, such as miR-154 and miR-377, which have been reported to act as a tumor suppressor in several cancers [9]. [score:3]
QTR-PCR was used to comfirmed the decrease expression of miR-381 (Additional file 2: Figure S2). [score:3]
Our data also found that miR-381 could impair the expression of EMT phenotype through miR-381/TMEM16A/TGF-β axis. [score:3]
MiR-381 was significantly down-regulated in gastric cancer tissues and cell lines. [score:3]
These studies indicated the complicated role and mechanism of miR-381 depending on different cancer types and molecular targets. [score:3]
Collectively, miR-381 may serve as a novel therapeutic target for treating gastric cancer. [score:3]
a Bioinformatic analysis of the level of miR-381 expression of GSE26595 and GSE28700 datasets showed that miR-381 was significantly lower in gastric cancer tumors (T) than in non-tumor tissues (N). [score:3]
As expected, inhibition of miR-381 markedly faciliated the proliferation, migration and invasion of MKN-28 and SGC-7901 cells (Fig.   2e-h). [score:3]
In the present study, miR-381 did not only influence the secretion but also the synthesis of TGF-β, suggesting that other molecules or pathways than targeting TMEM16A were involved in the influence of miR-381 on TGF-β. [score:3]
Cell count and MTT assay showed that the cancer cells proliferation was dramatically inhibited in miR-381 overexpression group compared to that in the negative control group (Fig.   2a and b). [score:3]
MiR-381 was notably decreased in gastric cancer clinical specimens and cell lines, and decreased expression of miR-381 was associated with adverse clinicopathological features and poor prognosis of gastric cancer patients. [score:3]
Confirmation of miR-381 overexpression in gastric cancer cells. [score:3]
QOE3.1 software was used to analyze the expression of miR-381 in gastric cancer tissues and adjacent non-tumor tissues. [score:3]
MicroRNA-381 (miR-381) has been reported to play suppressive or promoting roles in different malignancies. [score:3]
Confirmation of miR-381 low -expression in gastric cancer cells. [score:3]
These results proved that miR-381 inhibited proliferation, invasion and migration of gastric cancer cells in vitro. [score:3]
The tumor growth curve indicated that tumors in miR-381 overexpression group grew much more slowly than tumors in the negative control group (Fig.   3a). [score:3]
However, the expression level, biological function, and underlying mechanisms of miR-381 in gastric cancer remain poorly understood. [score:3]
Low expression of miR-381 was negatively related to lymph node metastasis, advanced tumor stage and poor prognosis. [score:3]
Tang et al. [18, 19] showed that miR-381 expression was increased in glioma and promoted tumor cell pathological malignant progression. [score:3]
The miR-381 expression level were explored in primary gastric cancer tissues and paired non-tumor tissues. [score:3]
In protein level, TGF-β1 and TGF-β2 were significantly decreased in miR-381 overexpression group compared with the negative control group. [score:2]
The number of invasive and migrated cells in the miR-381 ectopic expression group was notably decreased compared with the negative control group in two gastric cancer cell lines (Fig.   2c and d). [score:2]
MicroRNA-381 (miR-381), located in a cluster within the 14q32.31 chromosomal region where miRNAs have been revealed to regulate cellular behaviors that are key to tumorigenicity [9, 10]. [score:2]
However, other pathways by which miR-381 regulated EMT have been reported. [score:2]
MiR-381 inhibits gastric cancer cell proliferation, invasion and migration in vitro. [score:2]
However, little is known about the roles of miR-381 in the development of gastric cancer and the molecular mechanisms by which miR-381 exerts its functions. [score:2]
Histological analysis revealed that the number of metastatic nodules was significantly reduced in the lung of mice injected with miR-381 overexpression cells compared to that with negative control cells (Fig.   3c). [score:2]
Based on these findings, we speculated that miR-381 might play a crucial role in gastric cancer development. [score:2]
However, the regulation of miR-381 has not been thoroughly studied. [score:2]
MiR-381/TMEM16A may be a novel therapeutic candidate target in gastric cancer treatment. [score:2]
QRT-PCR analysis of miR-381 transfection efficiency after antagomiR-381 and negative control transfection in MKN-28 and SGC-7901 cell lines. [score:1]
Indeed, several signaling pathways were reported to be involved in the functional role of miR-381. [score:1]
The agomiR miR-381 (agomiR-381), antagomiR miR-381 (antagomiR-381) and their negative control (Con) Oligonucleotides were purchased from Shanghai GenePharma Co. [score:1]
To evaluate the in vivo effects of miR-381 on tumor metastasis, nude mice were injected intravenously in the tail vein with miR-381 overexpression or negative control gastric cancer cells respectively. [score:1]
The wild-type TMEM16A-3′UTR (WT) and mutant TMEM16A-3′UTR (MUT) containing the putative binding site of miR-381 were chemically synthesized and cloned into the downstream of the firefly luciferase gene in a pGL3-promoter vector (Ambion). [score:1]
QRT-PCR analysis of miR-381 transfection efficiency after agomiR-381 and negative control transfection in AGS and BGC-823 cell lines. [score:1]
Combination analysis of miR-381 and TMEM16A revealed the improved prognostic accuracy for gastric cancer patients. [score:1]
Therefore, the functional roles of miR-381 in human cancers varied between different cancer types. [score:1]
TMEM16A mediates the functional effects of miR-381 on migration and invasion in gastric cancer cells. [score:1]
In vitro and in vivo experiments demonstrated that miR-381 impedes gastric cancer proliferative and metastatic behaviors. [score:1]
The results showed that miR-381-/TMEM16A+ group was associated with a significantly higher metastasis rate (Fig.   4g). [score:1]
Moreover, miR-381 increased the sensitivity of renal cancer cells to 5-fluorouracil (5-FU) [41] and modulated the multidrug resistance (MDR) phenotype in leukemia cells and increased their drug uptake [42]. [score:1]
Moreover, miR-381-/TMEM16A+ predicted poor prognosis, while miR-381+/TMEM16A- indicated relative favorable prognosis (Fig.   4h). [score:1]
Red arrows show the position of lung metastasis According to bioinformatic databases (miRanda), there was a binding site of miR-381 in TMEM16A 3′-UTR (Fig.   4a). [score:1]
However, the potential role of miR-381 as a onco-miRNA also has been uncovered. [score:1]
To further validate the findings, we detected miR-381 in 103 paraffin embedded gastric cancer tissues and paired adjacent non-tumor tissues through qRT-PCR. [score:1]
Fig. 5TMEM16A mediates the effects of miR-381 on migration and invasion in gastric cancer cells. [score:1]
The relative expression level of miR-381 in each matched cancer and adjacent non- tumor tissue was calculated by the 2 [-ΔΔCT] method. [score:1]
[1 to 20 of 131 sentences]
2
[+] score: 397
B. Western blot analysis showing that the protein expression of NEFL was downregulated in U251 cells after miR-381 was overexpressed, whereas the expression of phosphorylated ribosomal protein S6 and p70S6k was upregulated. [score:13]
We observed that NEFL was inversely correlated with miR-381 expression in the analyzed astrocytomas (n=15) (Spearman's correlation, r = −0.8179) (Fig. 3H), which suggested that NEFL acts as a putative tumor suppressor in glioma and that both downregulated NEFL and upregulated miR-381 expression are involved in gliomagenesis. [score:13]
We also showed that miR-381 targets the LRRC4 gene, a known tumor suppressor of glioma, that overexpression of LRRC4 downregulates the expression of miR-381, and that the interaction between miR-381 and LRRC4 is involved in glioma growth [17]. [score:12]
More importantly, the inhibition of NEFL expression by siRNA recovered TMZ resistance after upregulating NEFL expression, which induced TMZ sensitivity, by transfection of an miR-381 inhibitor. [score:12]
Restoration of NEFL expression using a pcDNA3.1/NEFL vector suppressed p70S6k phosphorylation in U251 cells (Fig. 7A), whereas downregulation of NEFL expression by miR-381 resulted in increased phosphorylation of ribosomal protein S6 and p70S6k in U251 cells (Fig. 7B). [score:10]
As shown in (Fig. 1C), the relative levels of ANXA1, NEFL, GFAP, HSPA8, Septin 2 and Cath D expression to the levels of the GAPDH control were upregulated in U251-LNA-anti-miR-381 -transfected cells, compared to U251-LNA-anti-miR-NC cells, but NEFL expression was particularly upregulated. [score:10]
Our data suggested that targeted inhibition of miR-381 enhances the sensitivity of cells to TMZ in glioblastoma by inhibiting stemness factors and that NEFL regulates the expression of stemness factors. [score:10]
Targeted inhibition of miR-381 increases the sensitivity of glioblastoma cells to TMZ by upregulating NEFL expression. [score:10]
These data suggested that targeted inhibition of miR-381 enhances the sensitivity of glioblastoma cells to TMZ by inhibiting NEFL -mediated expression of stemness and multidrug resistance factors. [score:9]
Our data demonstrated that either suppressing miR-381 or enforcing NEFL expression inhibited the expression of multidrug resistance factors (ABCG2, ABCC3, and ABCC5) in glioblastoma cells in the presence of TMZ. [score:9]
Fifteen of the 39 proteins were significantly upregulated in U251 cells transfected with LNA-anti-miR-381 inhibitor as the ratio of the protein in U251-LNA-anti-miR-381 to that in U251-LNA-anti-miR-NC was ≥ 2 (P ≤ 0.05), while 24 out of 39 proteins were significantly down-regulated (P ≤ 0.05). [score:9]
We identified NEFL as a novel target of miR-381 that was apparently downregulated in GBM, and we showed that inhibition of miR-381 enhanced the sensitivity of NEFL -mediated stemness factors to TMZ in GBM. [score:8]
In summary, our present research shows that miR-381 is a good target for glioma therapy, and that targeted inhibition of miR-381 enhances the sensitivity of GBM to temozolomide through the regulation of stemness factors by NEFL. [score:8]
Western blotting analysis indicated that ANXA1, NEFL, GFAP, HSPA8, Septin 2 and Cath D were upregulated, while AST1 and CALD1 were downregulated in LNA-anti-miR-381 -treated U251 cells. [score:7]
Interestingly, miR-381 overexpression increased the expression of multidrug resistance factors and stemness factors that were blocked by NEFL overexpression combined with TMZ treatment (Fig. 6C and 6D). [score:7]
NEFL overexpression significantly prevented the proliferation of U251 cells in the presence of TMZ; however, this inhibited proliferation was restored by miR-381 overexpression (Fig. 6B). [score:7]
Our research indicated that either suppressing miR-381 or enhancing NEFL expression sensitizes glioblastoma cells to TMZ by inhibiting stemness factors (ALDH1, CD44, CKIT, KLF4, Nanog, Nestin, and SOX2). [score:7]
As shown in (Fig. 6A), the overexpression of NEFL in U251 cells significantly increased their chemosensitivity to TMZ treatment, whereas miR-381 overexpression inhibited their chemosensitivity. [score:7]
LNA-anti-miR-381 downregulated the expression of multidrug resistance factors (ABCG2, ABCC3, and ABCC5) and stemness factors (CD44, CKIT, KLF4, Nanog, and Nestin2) in these cells (Fig. 5C and D). [score:6]
In this study, we found that targeted inhibition of miR-381 promotes the effects of TMZ and that transfection of LNA-anti-miR-381 in combination with TMZ treatment more potently inhibits cell proliferation compared to TMZ treatment alone. [score:6]
In contrast, the relative levels of AST1 and CaMBP expression to GAPDH control levels were downregulated in U251-LNA-anti-miR-381 cells. [score:6]
Quantitative real time (qRT) PCR and western blotting analysis indicated that the expression of the NEFL mRNA and protein was downregulated in miR-381 -treated U251 cells (Fig. 2C and D) but was increased in LNA-anti-miR-381 -transfected cells (Fig. 2E and F). [score:6]
Interestingly, when NEFL expression was interfered with during the LNA-anti-miR-381 treatment, the expression of the multidrug resistance factors (ABCG2, ABCC3, and ABCC5) and stemness factors (CD44, CKIT, KLF4, Nanog, and Nestin2) (Fig. 5C and D) was restored. [score:5]
Thus, the miR-381-NEFL axis is critical for TMZ resistance in GBM, and targeted inhibition of miR-381 or NEFL restoration may offer a new strategy to overcome chemoresistance of glioblastoma to TMZ treatment. [score:5]
Silencing the expression of NEFL inhibited the effects of LNA-anti-miR-381 chemosensitivity enhancement (#, p <0.05) (Fig. 5A). [score:5]
The differentially expressed protein NEFL has been thought to be a putative target of miR-381 by miRanda (Fig. 2A). [score:5]
Thus, it is important to note that targeted inhibition of miR-381 offers a new modulation strategy to overcome chemoresistance of glioma to TMZ treatment. [score:5]
First, we examined the effects of targeted inhibition of miR-381 on the increased sensitivity of glioblastoma cells to TMZ. [score:5]
D: Western blot analysis showing the protein expression of NEFL after miR-381 mimics were transfected into U251 cells for 48 h. miR-381 decreased the protein expression of NEFL; GAPDH was used as a loading control. [score:5]
F: Western blot analysis showing the protein expression of NEFL after LNA-anti-miR-381 was transfected into U251 cells for 48 h. LNA-anti-miR-381 increased the protein expression of NEFL; GAPDH was used as a loading control. [score:5]
Silencing the expression of NEFL inhibited the effects of LNA-anti-miR-381. [score:5]
To test this hypothesis, we examined the status of the mTOR pathway and the effects of altered NEFL expression in U251 cell lines overexpressing NEFL (Fig. 7A) or miR-381 (Fig. 7B). [score:5]
We found that inhibition of miR-381 decreased the proliferation and enhanced the sensitivity of U251 cells to TMZ (Fig. 5B), while silencing the expression of NEFL with siRNA resisted the sensitizing effects of LNA-anti-miR-381 to TMZ (Fig. 5B). [score:5]
LNA-anti-miR-381 oligonucleotides inhibited the proliferation of glioblastoma cells in vitro and the growth of intracranial transplanted glioblastoma mo del in vivo, as determined by magnetic resonance imaging [18], which suggests that miR-381 is a good target for glioma therapy. [score:5]
To our knowledge, this is the first report to show that miR-381 regulates the chemosensitivity of glioblastoma cells to TMZ treatment through expressing NEFL. [score:4]
Differentially expressed proteins regulated by LNA-anti-miR-381. [score:4]
These results suggest that miR-381 directly targets NEFL by binding to its seed region in their 3′-UTRs. [score:4]
These two independent lines of evidence demonstrated that these proteins were regulated by LNA-anti-miR-381 inhibitor in glioblastoma cells. [score:4]
Based on research suggesting that miR-381 promotes the growth of glioblastoma cells [17, 18], we performed 2D-DIGE and MALDI-TOF mass spectrometry to screen differentially expressing proteins regulated by miR-381. [score:4]
C: RT-qPCR analysis showing the mRNA level of NEFL after miR-381 mimics were transfected into U251 cells for 24 h. miR-381 downregulated the mRNA level of NEFL. [score:4]
Considering that NEFL is a direct target of miR-381, we focused on the relationship between LNA-anti-miR-381, NEFL, and TMZ chemosensitivity. [score:4]
E: RT-qPCR analysis showing the mRNA level of NEFL after LNA-anti-miR-381 was transfected into U251 cells for 24 h. LNA-anti-miR-381 upregulated the mRNA level of NEFL. [score:4]
C: RT-qPCR analysis showing that the mRNA levels of multidrug resistance factors (ABCG2, ABCC3, ABCC5) were repressed in U251 cells after NEFL overexpression and were restored by miR-381. [score:3]
Notably, miR-381 expression is significantly higher in drug-resistant than in drug-sensitive ovarian cancer tissues. [score:3]
miR-381 inhibited the effects of NEFL. [score:3]
H: Spearman's correlation analysis was used to determine the correlation between the expression levels of NEFL and miR-381 in human astrocytomas; Spearman's correlation, r =-0.8179 (n=15). [score:3]
Moreover, the miR-381-NEFL axis is critical for TMZ resistance in GBM and may potentially serve as a novel therapeutic target for glioma. [score:3]
A: U251 cells were transfected with either empty vector or NEFL and were forced to overexpress miR-381. [score:3]
NEFL is a new target molecule of miR-381. [score:3]
Our previous study showed that relative to normal adult brain, miR-381 was highly expressed in different brain cancer subtypes, including GBM[17]. [score:3]
NEFL is a target molecule of miR-381. [score:3]
Our previous research indicated that miR-381 is highly expressed in different grades of astrocytomas. [score:3]
Figure 6A: U251 cells were transfected with either empty vector or NEFL and were forced to overexpress miR-381. [score:3]
As shown in (Fig. 1A), 39 matched protein spots had significant differences in the signal intensity between the U251 cells transfected with LNA-anti-miR-381 or LNA-anti-miR-NC, suggesting that these proteins were differentially expressed. [score:3]
Here, we explored the effects of miR-381 inhibition on the chemosensitivity of GBM cells to TMZ. [score:3]
As expected, suppression of miR-381 by LNA-anti-miR-381 significantly increased the chemosensitivity of U251 cells to TMZ treatment (*, p <0.05) (Fig. 5A). [score:3]
Moreover, we analyzed the expression pattern of miR-381 in tissues using in situ hybridization (Fig. 3G). [score:3]
Correspondingly, overexpression of miR-381 disrupted the sensitization of glioblastoma cells to TMZ. [score:3]
Furthermore, silencing miR-381 inhibits the growth of intracranially transplanted GBM in rats, as determined by magnetic resonance imaging [18]. [score:3]
To verify their differential expression, the U251-LNA-anti-miR-NC and U251-LNA-anti-miR-381 cell lysates were analyzed by immunoblotting using antibodies against annexin I (ANXA1), neurofilament, light polypeptide 68 kDa (NEFL), glial fibrillary acidic protein (GFAP), heat shock 70 kDa protein 8 isoform 1 (HSPA8), aspartate aminotransferase 1 (AST1), Septin 2, Cathepsin D (Cath D) and caldesmon 1 isoform 2 (CALD1). [score:3]
The results showed that NEFL decreased the proliferation and enhanced the sensitivity of U251 cells to TMZ, while miR-381 inhibited the sensitizing effects of NEFL to TMZ. [score:3]
For example, miR-381 increases the sensitivity of renal cancer cells to 5-fluorouracil (5-FU) by inhibiting WEE1 [14], and miR-381 modulates the MDR phenotype in leukemia cells and increases their drug uptake [19]. [score:3]
The correlation between miR-381 expression and NEFL levels in tumor tissues were analyzed using Spearman's rank test. [score:3]
B: U251 cells were transfected with either empty vector or NEFL and were forced to overexpress miR-381. [score:3]
In situ hybridization analysis of miR-381 expression (lower) in normal brain tissue and astrocytoma tissue. [score:3]
D: RT-qPCR analysis showing that the mRNA level of stemness factors (CD44, CKIT, KLF4, Nanog, and Nestin) were repressed in U251 cells after NEFL overexpression and were restored by miR-381. [score:3]
Compared with control cells, 39 proteins were differentially expressed in the LNA-anti-miR-381 -treated U251 cells. [score:2]
Furthermore, miR-381 is involved in the development and progression of multiple types of cancers, such as prostate cancer [13], renal cancer [14], lung cancer [15], ovarian cancer [16] and glioma [17, 18]. [score:2]
Figure 5A: U251 cells transfected with LNA-anti-miR-NC or LNA-anti-miR-381 were forced to repress the expression of NEFL, were treated with various concentrations of TMZ for 48 h and were then submitted to CCK8 assays. [score:2]
A: U251 cells transfected with LNA-anti-miR-NC or LNA-anti-miR-381 were forced to repress the expression of NEFL, were treated with various concentrations of TMZ for 48 h and were then submitted to CCK8 assays. [score:2]
A: The 2D-DIGE analysis of the different proteins regulated by LNA-anti-miR-381 in GBM cells. [score:2]
We observed that miR-381 affected the metabolism, proliferation, and signal transduction of glioma cells through regulating these proteins. [score:2]
B: U251 cells transfected with LNA-anti-miR-NC or LNA-anti-miR-381 were forced to repress the expression of NEFL, were treated with 100 μM TMZ for the indicated times, and were then subjected to CCK8 assays. [score:2]
miR-381 mimics disrupt the sensitization of NEFL to TMZ in glioblastoma cells. [score:1]
miR-381 has been reported to be an onco-miRNA and to be involved in the tumorigenesis and progression of many cancers [13- 18]. [score:1]
The U251-anti-miR-NC and U251-anti-miR-381 cells were harvested, and the proteins in cell lysates were extracted. [score:1]
Briefly, U251 cells were transfected with LNA-anti-miR-381 or LNA-anti-miR-NC as control. [score:1]
Therefore, HEK293 and U251 cells were co -transfected with the wild type (WT) or mutated (Mut) NEFL luciferase reporter vector, together with miR-381 or miR-NC, for 24 h. Luciferase activity was significantly reduced in cells transfected with WT NEFL and miR-381, but not in the cells transfected with Mut NEFL and miR-381 (Fig. 2B). [score:1]
The LNA-anti-miR-381 induced differential expression of proteins in glioma cells was characterized by 2-D DIGE analysis, as described previously [68]. [score:1]
C: RT-qPCR analysis showing that the mRNA level of multidrug resistance factors (ABCG2, ABCC3, ABCC5) were repressed in U251 cells after LNA-anti-miR-381 treatment and restored by transfection of the NEFL siRNA. [score:1]
Additionally, miR-381 has been shown to modulate sensitivity to chemotherapeutic agents. [score:1]
NEFL-siRNA prevented the sensitizing effects of LNA-anti-miR-381 to TMZ. [score:1]
A: Schematic of the interaction sites of miR-381 in the 3′-UTRs of NEFL. [score:1]
Our previous study indicated that miR-381 plays an oncogenic role and is involved in the pathogenesis of GBM [17]. [score:1]
miR-381 disrupts the sensitization of U251 cells to TMZ via NEFL. [score:1]
Anti-miR-NC: U251 cells transfected with LNA-anti-miR-NC; and anti-miR-381: U251 cells transfected with LNA-anti-miR-381. [score:1]
These results suggested that NEFL siRNA reverses the proliferation rate of LNA-anti-miR-381 -transfected, TMZ-sensitive U251 cells. [score:1]
These results suggest that NEFL induces chemosensitivity of U251 cells to TMZ treatment in an miR-381 -dependent manner. [score:1]
U251-LNA-anti-miR-NC and U251-LNA-anti-miR-381 cell lysates as well as internal standard proteins were treated with ReadyPrep 2D reagents, labeled with Cy3, Cy5, or Cy2, respectively, and subjected to 2-D electrophoresis. [score:1]
After the cells were transfected with LNA-anti-miR-NC or LNA-anti-miR-381, they were transfected with NEFL siRNAs for 8 h and then treated with different concentrations of TMZ. [score:1]
For its mutagenesis, the sequences complementary to the binding site of miR-381 in the 3′-UTR (NEFL:CTTGTAT) was replaced by TACTTGAC. [score:1]
D: RT-qPCR analysis showing that the mRNA level of stemness factors (ALDH1, CKIT, Nanog, Nestin, SOX2) was repressed in U251 cells after LNA-anti-miR-381 treatment and was restored by transfection of the NEFL siRNA. [score:1]
The results showed that LNA-anti-miR-381 significantly increased the chemosensitivity of U251 cells to TMZ. [score:1]
In this study, we analyzed the effects of miR-381 on the proteomic profiles of glioblastoma cells using the 2D-DIGE method. [score:1]
Figure 2A: Schematic of the interaction sites of miR-381 in the 3′-UTRs of NEFL. [score:1]
Because, we also determined the correlation between NEFL and miR-381 in astrocytoma samples. [score:1]
After cultured overnight, cells were cotransfected with the wild-type or mutated plasmid, pRL-TK plasmid, and equal amounts of miR-381 or miR-NC. [score:1]
NEFL-siRNA reverses the sensitivity of LNA-anti-miR-381 -treated cells to TMZ. [score:1]
Next, we investigated whether NEFL expression is critical for the LNA-anti-miR-381 -mediated cellular sensitivity of U251 cells to TMZ. [score:1]
The results showed that transfected LNA-anti-miR-381 decreased the proliferation of U251 cells and enhanced their sensitivity to TMZ. [score:1]
[1 to 20 of 100 sentences]
3
[+] score: 99
miR-381, as the post-transcriptional repressor of UBE2C, is downregulated and co-exists with UBE2C activation in NSCLC, which is further validated followed by our results that showed that overexpressing miR-381 with its mimics significantly reduced the UBE2C expression in lung cancer cells (Fig. 8a). [score:8]
Our data showed overexpressing miR-381 and depleting endogenous ALKBH5 significantly enhanced UBE2C expression at both RNA and protein levels in A549 and H1299 cells (Fig. 8a), in which ALKBH5 deficiency-enriched m [6]A levels of pre-mRNA and UBE2C overexpression impeded ALKBH5 insufficiency -induced enrichment of m [6]A in A549 and H1299 cells as showed in methylated RNA immunoprecipitation analysis (Fig. 8b). [score:7]
The following in vitro phenotypical examination of interaction between those two post-transcriptional regulators and UBE2C illustrated that forced expression of miR-381 and siRNA-specific downregulation of ALKBH5 hindered cell proliferation, migration invasive growth, clonogenicity, and EMT enhancement of A549 and/or H1299 cells. [score:7]
k Matrigel invasion assay indicating that miR-381 overexpression or ALKBH5 downregulation in A549 cells significantly decreased the cell invasive growth and partially blocked UBE2C overexpression -induced enhancement in the cell invasive growth. [score:7]
c In vitro proliferation assay demonstrating that miR-381 overexpression of siRNA-specific downregulation ALKBH5 decreased cell growth and arrested UBE2C overexpression -induced cellular proliferation of both A549 and H1299. [score:7]
l Scratch assay showing forced miR-381 overexpression and siRNA-specific downregulation of ALKBH5 dramatically arrested cell migration of A549 cells with or without over expressing UBE2C. [score:7]
UBE2C is repressed post-transcriptionally via tumor suppressor miR-381 and epitranscriptionally stabilized with enrichment and maintenance of high m [6]A level in its RNA due to downregulation of m [6]A demethylase ALKBH5 in NSCLC (Fig. 8a−m). [score:6]
i, j RT-PCR, immunoblotting, and immunofluorescence analysis of EMT biomarkers demonstrating that miR-381 overexpression or specific knockdown of ALKBH5 activated E-cadherin and repressed vimentin and resisted overexpressing UBE2C -mediated E-cadherin repression/vimentin activation pattern in A549 cells. [score:6]
d− f Flow cytometric, immunofluorescence (Annexin V), and immunoblotting (Caspase-cleaved) assay demonstrating that miR-381 overexpression and ALKBH5 knockdown significantly induced apoptosis and reduced ectopic UBE2C expression -mediated anti-apoptosis phenotypes in A549 cells for 72 h. g Cell cycle assay indicating treatment with miR-381 mimics or siRNA-ALKBH5 -induced significant G2 arrests/S reduction and reversed ectopic UBE2C expression -induced G2 reduction in A549 cells. [score:6]
Since both miR-381 -mediated posttranscriptional regulation of UBE2C and ALKBH5 -induced epitranscriptional activation of UBE2C were identified as essential mechanisms governing upstream regulation of UBE2C in this study, the interaction of NCTD with those epigenetic and epitranscriptional modulators is one of pathways for NCTD -mediated specific repression of UBE2C and its downstream target genes in lung cancer. [score:5]
As indicated in this diagram, UBE2C transcripts negatively regulated by miR-381and destabilized by the m [6]A demethylase ALKBH5 directly and selectively represses ATG3 and LC3 which further phenotypically arrest NSCLC progression Collectively, all the data above suggest that both miR-381 and ALKBH5, as the epigenetic and epitranscriptional regulators of UBE2C, are aberrantly involved in deregulation of UBE2C-autophagy repression axis which aggravates NSCLC progression. [score:5]
As indicated in this diagram, UBE2C transcripts negatively regulated by miR-381and destabilized by the m [6]A demethylase ALKBH5 directly and selectively represses ATG3 and LC3 which further phenotypically arrest NSCLC progressionCollectively, all the data above suggest that both miR-381 and ALKBH5, as the epigenetic and epitranscriptional regulators of UBE2C, are aberrantly involved in deregulation of UBE2C-autophagy repression axis which aggravates NSCLC progression. [score:5]
h Colony formation assay indicating that knockdown of miR-381 or ALKBH5 in A549 cells dramatically inhibited its clonal formation and arrested UBE2C overexpression -induced enhancements in its clonogenicity. [score:5]
To identify the post-transcriptional or epitranscriptional regulators modulating UBE2C in NSCLC, we first examined the specific post-transcriptional regulators miR-381 and ALKBH5 for UBE2C in NSCLC, in which miR-381 represses UBE2C via targeting its 3′UTR and ALKBH5, one of de novo m [6]A demethylase, stabilizes the UBE2C transcripts by reducing the m [6]A methylation level inside its mRNAs. [score:5]
miR-381, as the post-transcriptional repressor of UBE2C, is downregulated in lung adenocarcinoma. [score:4]
Apoptosis analysis demonstrated that elevated miR-381 and depleted ALKBH5 significantly speeded apoptosis and balked ectopic UBE2C expression -mediated anti-apoptosis phenotypes in A549 cells (Fig. 8d−f; Supplementary Figure S4). [score:3]
Moreover, miR-381 mimic activation and ALKBH5 knockdown retarded UBE2C -mediated those phenotypic alterations in those same cells (Fig. 8c, h−l; Supplementary Figure S4). [score:2]
Finally, cell cycle assay further validated that treatment with miR-381 mimics or siRNA-ALKBH5 led to significant G2 arrests/S reduction and prevented ectopic UBE2C expression -induced G2 reduction in A549 cells (Fig. 8g). [score:2]
miR-381, 5′-AGAGAGCUUGCCCUUGUAUAUU-3′; siUBE2C1, 5′-ACCU-GCAAGAAACCUACUCAdTdT-3′; siUBE2C2, 5′-AAUGAUGUCAGGACCAUU-CUGdTdT-3′. [score:1]
miR-381, control, and siUBE2C were synthesized by GenePharma (Shanghai, China). [score:1]
[1 to 20 of 20 sentences]
4
[+] score: 90
Other miRNAs from this paper: hsa-mir-128-1, hsa-mir-206, hsa-mir-128-2
Furthermore, AG-1296 and PP2 reversed bFGF -inhibited miR-381 expression (Figure 5F), indicating that bFGF promotes VEGF-C expression and lymphangiogenesis by suppressing miR-381 expression via the PDGFR and c-Src pathways. [score:11]
miR-381 has been reported to inhibit migration and invasion by targeting inhibitor of differentiation 1 in human lung adenocarcinoma [44]; miR-381 is also indicated to be a negative regulator of cell growth in glioma [45], but its effect on VEGF-C expression is largely unknown. [score:10]
Our data show that bFGF promotes VEGF-C expression and increases lymphangiogenesis by downregulating miR-381 through the PDGFR and Akt signaling pathways, rendering bFGF as a novel target for chondrosarcoma lymphangiogenesis. [score:8]
In addition, bFGF promotes VEGF-C expression and lymphangiogenesis by downregulating miR-381 expression via the PDGFR and c-Src signaling pathways. [score:8]
Furthermore, PDGFR and c-Src inhibitors reversed bFGF -mediated miR-381 expression as well as VEGF-C 3′UTR activity, implying that PDGFR and c-Src pathways are upstream molecules of bFGF-impaired miR-381 expression. [score:7]
In this study, bFGF knockdown significantly reduced the expression of VEGF-C (Figure 6A and 6B) and increased miR-381 expression (Figure 6C). [score:6]
In addition, we found that miR-381 directly represses VEGF-C protein expression through binding with the 3′UTR region of the human VEGF-C gene, thereby negatively regulating VEGF-C -mediated lymphangiogenesis. [score:5]
bFGF promotes VEGF-C production via inhibition of miR-381 expression. [score:5]
These data suggest that miR-381 directly represses VEGF-C protein expression via binding to the 3′UTR region of the human VEGF-C gene through PDGFR and c-Src signaling. [score:4]
bFGF promotes VEGF-C via downregulation of miR-381. [score:4]
Exogenous bFGF reduced miR-381 expression in a concentration -dependent manner (Figure 5A). [score:3]
To explore miR-381 involvement in bFGF -induced VEGF-C and lymphangiogenesis, miR-381 mimic was used; transfection with miR-381 mimic diminished bFGF -induced VEGF-C expression (Figure 5B and 5C). [score:3]
Figure 5(A) JJ012 cells were incubated with bFGF (0–30 ng/mL) for 24 h; miR-381 expression was examined by qPCR (n = 6). [score:3]
Co-transfection with miR-381 mimic reduced bFGF -induced VEGF-C expression as well as LEC migration and tube formation. [score:3]
We found that exogenous bFGF reduced miR-381 expression. [score:3]
In addition, miR-381 is negatively regulated by bFGF through transactivating the platelet-derived growth factor receptor (PDGFR)/c-Src signaling pathway. [score:2]
To learn whether miR-381 regulates the 3′UTR region of VEGF-C, we constructed luciferase reporter vectors harboring the wild-type 3′UTR region of VEGF-C mRNA (wt-VEGFC-3′UTR) and vector containing mismatches in the predicted miR-381 binding site (mt-VEGFC-3′UTR) (Figure 5G). [score:2]
miR-381 mimic, miRNA control, Lipofectamine 2000, and Trizol were purchased from Life Technologies (Carlsbad, CA, USA). [score:1]
Conversely, miR-381 mimic also diminished bFGF-promoted LEC migration and tube formation (Figure 5D and 5E). [score:1]
org) revealed that the 3′UTR region of VEGF-C mRNA harbors potential binding sites for miR-381. [score:1]
[1 to 20 of 20 sentences]
5
[+] score: 86
We found that WISP-1 enhances VEGF-A expression and tumor angiogenesis through the FAK, JNK, and hypoxia-inducible factor (HIF)-1 α signaling pathways, as well as via down-regulation of miR-381 expression. [score:8]
In conclusion, WISP-1 enhances VEGF-A expression in osteosarcoma and promotes EPC angiogenesis through integrin αv β3 and the FAK/JNK/HIF-1 α pathways, as well as via down-regulation of miR-381 expression. [score:8]
Specifically, WISP-1 increases VEGF-A expression and angiogenesis through the FAK/JNK/HIF-1 α pathways and down-regulates miR-381 expression. [score:8]
by down -regulating miR-381 expressionIncreasing evidence has reported the involvement of miRNAs in the angiogenic process and their potential therapeutic applications for vascular diseases. [score:6]
WISP-1 promotes VEGF-A expression and angiogenesis by down -regulating miR-381 expression. [score:6]
Whether miR-381 also regulates WISP-1 -mediated VEGF-A expression through down-regulation of the FAK pathway requires investigation in future studies. [score:5]
Previous research has shown that WISP-1 is an angiogenesis-related gene, [51] which implies that more angiogenesis-related proteins are yet to be discovered that will be stimulated by WISP-1. In primary osteosarcoma tissue, the expression of miR-381 is negatively correlated with VEGF-A or WISP-1. Co-transfection with miR-381 mimic reduced WISP-1 -induced VEGF-A expression as well as EPC tube formation and migration. [score:5]
To determine whether miR-381 regulates VEGF-A expression by binding to the VEGF-A 3′UTR, we constructed luciferase reporter vectors using the pmiRGLO vector, which harbors the wild-type (pmirGLO-WT; WT) or mutant (pmirGLO-MUT; Mut) 3′UTR of miR-381 (Supplementary Figure S3), and transfected these vectors into MG-63 cells. [score:4]
org) in an attempt to determine which miRs regulate the expression of VEGF-A, and to rank the top 14 miRNAs harboring VEGF-A binding sites, including miR-381. [score:4]
After stimulation with WISP-1, we found that miR-381 was the most down-regulated miRNA (Supplementary Table S1). [score:4]
In MG-63 cells, direct application of WISP-1 reduced miR-381 expression in a dose -dependent manner (Figure 5a). [score:4]
Here, we found that miR-381 mimic decreased VEGF-A expression in MG-63 cells and elevated levels induced by WISP-1, but had minimal effect upon WISP-1 -induced EPC tube formation and migration. [score:3]
Application of miR-381 mimic reduced WISP-1 -induced increases in VEGF-A expression and EPC tube formation, as well as migration (Figures 5c–e). [score:3]
After reaching confluence, cells were changed to serum-free medium, then pretreated with pharmacological inhibitors for 30 min, or pre -transfected with specific siRNA, or miR-381 mimic for 24 h. After treatment, cells were incubated with WISP-1 for another 24 h. The culture medium was removed and stored at −80 °C. [score:3]
It appears that miR-381 has an important role in WISP-1 -induced VEGF-A expression and angiogenesis. [score:3]
MiR-381 mimic was used to determine the effects of WISP-1-increased VEGF-A expression and angiogenesis. [score:2]
were expressed as Ct values and normalized to calculate the average Ct of each sample (ΔCt), and the relative expression of miR-381 was calculated using the comparative Ct method. [score:1]
Our results highlight the significance of miR-381 in WISP-1 -induced angiogenesis, and suggest that restoration of miR-381 may be a potential therapeutic strategy for osteosarcoma angiogenesis. [score:1]
org database identified that FAK protein is associated with the miR-381 binding site, but there are no published reports illustrating this. [score:1]
Next, we used clinical osteosarcoma samples to evaluate miR-381 expression. [score:1]
19, 20, 21, 22 However, the role of miR-381 in osteosarcoma is poorly understood. [score:1]
[17] MiR-381 has been reported to be dysregulated in several human cancers. [score:1]
We found that the miR-381 mimic diminished WISP-1-enhanced angiogenesis in CAM (Figure 5f). [score:1]
The results indicate that a negative correlation exists between miR-381 and VEGF-A or WISP-1 (Figures 5g–h). [score:1]
[22] However, the function and mechanism of miR-381 in human osteosarcoma remains unclear. [score:1]
Mimics of control and miR-381 were purchased from Invitrogen (Carlsbad, CA, USA). [score:1]
[1 to 20 of 26 sentences]
6
[+] score: 31
Set 2 is the list of predicted targets of miRs tested to not inhibit NALM6 growth (i. e. miR-550a, miR-873, miR-381 and miR-432) from TargetScan6.2 or miRDB, while Set 3 is the list of mRNA that is expressed in NALM6, as determined by genome-wide microarray profiling downloaded from the Cancer Cell Line Encyclopedia and its expression levels are denoted in the microarray dataset as “marginal” or “present”. [score:11]
First, we downloaded the sets of predicted mRNA targets of miR-509-5p and miR-509-3p (Set 1), as well as those of the 4 miRs that we had shown not to inhibit NALM6 growth (i. e. miR-381, miR-432, miR-550a and miR-873; Set 2) from the TargetScan6.2 [37] and/or miRDB [38], [39] miR target prediction databases. [score:9]
4 miRs (miR-381, miR-509, miR-550a, and miR-873) and 1 miR cluster (miR-432∼136) inhibited NALM6 growth in at least 2 of 3 replicate screens performed. [score:3]
These results indicate that miR-381, miR-432, miR-550a, and miR-873 do not inhibit growth of NALM6. [score:3]
Similarly, overexpression of miR-381, miR-550a, miR-873, and miR-432 was achieved by lentiviral transduction (Figure S1E). [score:3]
Similarly, no change in %GFP [+] cells was observed over 35 days in thes for miR-381, miR-550a, miR-873 and miR-432∼136 (Figure S1A-S1D). [score:1]
NALM6 cells were individually transduced with lentivirus of (A) miR-381; (B) miR-550a; (C) miR-873 and (D) miR-432∼136 and empty vector (EV#1) to MOI  = 2. At 7 days after transduction, cells were mixed with mock-transduced cells to 50% GFP [+] cells and this was set as Day 0. The %GFP [+] cells (pre-gated on viable cells) of each culture were assessed weekly by flow cytometry for 35 days. [score:1]
[1 to 20 of 7 sentences]
7
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-21, hsa-mir-23a, hsa-mir-27a, hsa-mir-29a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-146a, hsa-mir-150, hsa-mir-155, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-101-2, hsa-mir-301a, hsa-mir-378a, hsa-mir-340, hsa-mir-146b, hsa-mir-181d, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-590, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-378c, hsa-mir-23c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Namely, HHV-6A specifically induced an early up-regulation of miR-590 (1 d. p. i. ), miR-15a and miR-21 (3 d. p. i. ), a sustained up-regulation of miR-29b, miR-101 (3 and 6 d. p. i. ), miR-301a and miR-548e (1 and 6 d. p. i. ) and a late up-regulation of miR-340 and miR-381 (6 d. p. i. ) By contrast, HHV-6B infection specifically up-modulated the expression of miR-301b (2 and 3 d. p. i. ) and miR-548e (1 and 3 d. p. i. ), whereas it down-regulated miR-590 (2 and 3 d. p. i. ) and miR-15a (6 d. p. i. ). [score:15]
The up-regulated miR-101 and miR-381 are involved in the polarization and activation of the cells of the innate immune compartment, regulating the inflammatory response (Zhu et al., 2010; Essandoh et al., 2016; Wen et al., 2016); the increased miR-548 may represent a mechanism facilitating viral pathogenesis as it negatively correlates with IFNγR1 levels (Xing et al., 2014). [score:5]
MiR-381-3p regulates the antigen-presenting capability of dendritic cells and represses antituberculosis cellular immune responses by targeting CD1c. [score:3]
[1 to 20 of 3 sentences]
8
[+] score: 17
mir-200a, mir-34, mir-195, and mir-381-3p are usually downregulated in presence of SIRT1 expression, and vice versa low expression of SIRT1 relates to miRNAs upregulation [9, 11, 17, 18, 26– 28]. [score:11]
Also, upregulation of mir-34c-5p and mir-381-3p that target Nampt, an enzyme involved in the production of NAD, the cofactor for SIRT1 [29], diminishes SIRT1 actions. [score:6]
[1 to 20 of 2 sentences]
9
[+] score: 15
Two other down-regulated miRNAs, miR-299-3p and miR-381-3p, are predicted to suppress expression of integrin V (ITGAV) (Table 2 and Fig 6), which was in turn up-regulated in SLKK cells. [score:11]
Interestingly, miR-409-5p, miR-299-3p, and miR-381-3p are all located in the 14q32 cluster that is broadly down-regulated in SLKK cells as well as PEL cells [33]. [score:4]
[1 to 20 of 2 sentences]
10
[+] score: 13
However, from the up-regulated miRNAs, miR-19b-1* and miR-29c, and from down-regulated miRNAs, miR-381 and miR-30e*, had the highest fold change in the non-exosomal fraction of follicular fluid. [score:7]
MicroRNAs like miR-640, miR-526b* and miR-381 were abundant at higher level in theca cells, while miR-373, miR-30e* and miR-19b-1* expressed more in COCs. [score:3]
Four miRNAs namely: miR-19b-1*& miR-29c (enriched in non exosomal fraction of follicular fluid from BCB-) and miR-381 & miR-30e* (enriched in non exosomal fraction of follicular fluid from BCB+ group) were also investigated for their expression in surrounding follicular cells. [score:1]
Similarly, miR-526b* and miR-373 (in exosomal) and miR-381 and miR-30e* (in non-exosomal) were more abundant in follicular fluid from follicles with a fully grown oocyte (BCB+) (Table 2 ). [score:1]
Similar analysis for non-exosomal miRNAs shows that miR-19b-1* and miR-30e* were highly abundant in cumulus oocyte complex (COCs) whereas miR-381 was highly abundant in theca cells. [score:1]
[1 to 20 of 5 sentences]
11
[+] score: 13
PTTG protein 1 is a target of both miR-126 and miR-381, which were downregulated in GH-secreting pituitary adenomas [28]. [score:6]
Therefore, miR-126 and miR-381 might regulate pituitary adenoma invasion by targeting PTTG. [score:4]
Expression of miR-126 and miR-381 was decreased in GH-secreting pituitary adenomas [28]. [score:3]
[1 to 20 of 3 sentences]
12
[+] score: 13
We identified that the expression change of MIR381 (p-value < 0.83) contributes to the expression changes of RNA -binding protein 5 (RBM5) (p-value < 0.008) and ubiquitin specific peptidase 15 (USP15) (p-value < 6☓10 [-4]) via significant miRNA regulations (p-value < 10 [-16]) in cancer cells. [score:6]
For example, we identified the regulatory parameter a [RBM5,ETS1] =-0.22 from the TF ETS1 to the target gene RBM5, interaction parameter b [PGR,NCOA2] =0.06 between the 2 proteins PGR and NCOA2, and coupling rate c [USP15,MIR381] =0.001 between the miRNA MIR381 and the mRNA USP15 in gastric cancer cells. [score:4]
It has also been suggested that dysregulation of two proteins, IL4 and CD40, leads to dysfunction of cell proliferation in mantle cell lymphoma [72], and dysregulation of MIR381 leads to dysfunction of proliferation in esophageal cancer [73]. [score:3]
[1 to 20 of 3 sentences]
13
[+] score: 13
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-519e
For example, hsa-miR-381 was down-regulated while its potential target gene NFKBIA (encoding nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha), was up-regulated in the patients (t-test p = 0.00067). [score:11]
Notably, the gene NFKBIA was found to be negatively associated with its potential regulating miRNA has-miR-381 (Table 3). [score:2]
[1 to 20 of 2 sentences]
14
[+] score: 13
For instance, TUBG1 is inhibited by mir-152, STMN1 is inhibited by mir-210, LRRFIP2 and UNG are inhibited by mir-214, GCN1L1 is inhibited by mir-221, RPL37 is inhibited by mir-381, and PIGN is inhibited by mir-320a and mir-653. [score:13]
[1 to 20 of 1 sentences]
15
[+] score: 12
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCCmiRNAs regulate gene expression at the post-transcriptional level. [score:6]
Table 3. Highly expressed miRNAs in r-NSCP1 and r-NSCP6 in rhesus monkey miRNAs ESC R-NSCP1 R-NSCP6 NPC Mature_sequences R-NSCP1 prevalent miR-99b 212,869 2,252,754 566,306 102,551 CACCCGTAGAACCGACCTTGCG miR-146b-5p 22,717 247,013 61,668 10,987 TGAGAACTGAATTCCATAGGCT miR-135a 2,711 137,160.5 33,916 8,194 TATGGCTTTTTATTCCTATGTGA miR-20b 24,368 107,856 21,182 658 CAAAGTGCTCATAGTGCAGGTAG miR-106a 17,754 58,830 13,913 438 AAAAGTGCTTACAGTGCAGGTAGC miR-18b 8,136 29,118 6,400 108 TAAGGTGCATCTAGTGCAGTTAG miR-874 4,928 15,527 4,540 717 CTGCCCTGGCCCGAGGGACCGA miR-374a 2,796 12,882 3,576 1,500 TTATAATACAACCTGATAAGTG R-NSCP6 prevalent miR-149 5,779 44,126 154,996 17,501 TCTGGCTCCGTGTCTTCACTCCC miR-410 9,507 15,214 55,897 74 AATATAACACAGATGGCCTGT miR-654-3p 2,936 15,011 49,798 48 TATGTCTGCTGACCATCACCTT let-7e 1,908 16,231 48,955 7,494 TGAGGTAGGAGGTTGTATAGTT miR-409-3p 4,325 7,020 38,577 55 GAATGTTGCTCGGTGAACCCCT miR-381 5,215 5,655 28,323 21 TATACAAGGGCAAGCTCTCTGT miR-889 741 4,268 15,327 18 TTAATATCGGACAACCATTGT miR-758 988 2,422 10,903 10 TTTGTGACCTGGTCCACTACCC miRNAs regulate gene expression at the post-transcriptional level. [score:6]
[1 to 20 of 2 sentences]
16
[+] score: 11
The downregulated PTTG1 -targeting miRNAs (miR-329, miR-300, miR-381, and miR-655) induced PTTG1 expression resulting in the downregulation of p53. [score:11]
[1 to 20 of 1 sentences]
17
[+] score: 11
For example, we found a significant downregulation of miR-27a, miR-411 and miR-497 in bladder cancer patient B09 and a significant upregulation of miR-379, miR-381 and miR-411 in kidney cancer patient K44 (Figure  5B). [score:7]
Importantly, however, we also observed high editing frequencies elsewhere, for example, in human kidney where miR-411 was edited at 59% (559 edited and 387 unedited reads) and miR-381 at 32% (199 edited and 428 unedited reads). [score:1]
Consistent with this, miR-376b, miR-381 and miR-411 are thought to be edited primarily by ADAR [12, 13]. [score:1]
Not all miRNA editing events are ancient: we found six cases of miRNA editing (miR-376a-1, miR-376b, miR-376c, miR-379, miR-381 and miR-411) that were limited to placental mammals and that therefore represent evolutionary novelties (Figure  1). [score:1]
Editing of miR-376b, miR-376c, miR-379, miR-381, miR-411 and miR-497 was significantly correlated with age in both species, demonstrating that the age-related increase of editing frequencies at specific sites is conserved between species (Figure  4B). [score:1]
[1 to 20 of 5 sentences]
18
[+] score: 11
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
These miRNAs were chosen as representative of the different patterns that were observed: up-regulation (miR-9a-5p) or down-regulation (miR-598-5p) during latency, down-regulation in the late latency - first spontaneous seizure period (miR-381-3p) and down regulation in the chronic stage (miR-142-5p). [score:11]
[1 to 20 of 1 sentences]
19
[+] score: 10
Chen, B., Duan, L., Yin, G., Tan, J. & Jiang, X. Simultaneously expressed miR-424 and miR-381 synergistically suppress the proliferation and survival of renal cancer cells–Cdc2 activity is up-regulated by targeting WEE1. [score:10]
[1 to 20 of 1 sentences]
20
[+] score: 10
According to bioinformatics tools such as Targetscan [15] and microSniper [16], the rs1050955 polymorphism is predicted to map in the close vicinity of target binding sites for several miRNAs including hsa-miR-300, hsa-miR-381, hsa-miR-548l, hsa-let7f-1*, has-let7-a* and hsa-miR-421. [score:5]
While hsa-miR-548l, hsa-miR-300, has-miR-381, has-let7f-1* and hsa-let7a* miRNAs were not or very poorly expressed in any of the aforementioned cell lines, both PAI-1 (see Table 1 ) and miR-421 (see Table 2 ) were homogeneously found expressed in these cell lines with the highest levels observed in HUVEC. [score:5]
[1 to 20 of 2 sentences]
21
[+] score: 10
For instance, increased expression of miR-381 was associated with cell proliferation and tumor growth; stable expression of miR-381 has been shown to be a critical prognostic biomarker and ideal target in glioma [45]. [score:7]
Significant (>10 fold) increase in serum levels of miR-381, miR-548h, and miR-580 identify them as potential prognostic markers for neuroblastoma progression. [score:1]
Though hsa-miR-381 is homologous to mouse miRNA, it has been well studied as a potential marker in other cancer mo dels [44]. [score:1]
More importantly, the results identified three miRNAs, miR-381, miR-548h and miR-580 that exhibited >10-fold increase in mice with HR-NB, which could serve as potential candidates for immediate assessment in HR-NB patients. [score:1]
[1 to 20 of 4 sentences]
22
[+] score: 9
MiRNA target site/Species Human Mouse Cow Dog Chicken FrogTargeting Twist2 miR-15b-3p + − + + − − − miR-33-5p + + + + − + − miR-137-3p + + + + − + − miR-145a-5p + + + + − − + miR-151-5p + + + + − + − miR-214-5p + + + + − − − miR-326-3p + + + + − − − miR-337-3p + + + + − + − miR-361-5p + + + + − − − miR-378a-5p + + + + − − − miR-381-3p + + + + − + − miR-409-3p + + + + − − − miR-450b-5p + + + + − + − miR-508-3p + + + + − − − miR-543-3p + + + + − − − miR-576-5p + + + + − − − miR-580 + + + + − − − miR-591 + + + + − − − MicroRNAs underlined were tested in this study. [score:5]
The following miRNAs were tested for their potential to repress Twist1 translation in the human lung carcinoma cell line H1299: miR-33, miR-145a, miR-151, miR-326, miR-337, miR-361, miR-378a, miR-381, miR-409 and miR-543 (Fig. 1). [score:3]
The miRBase accession numbers for miRNAs are: mmu-miR-33 (MI0000707), mmu-miR-145a (MI0000169), mmu-miR-151 (MI0000173), mmu-miR-326 (MI0000598), mmu-miR-337 (MI0000615), mmu-miR-361 (MI0000761), mmu-miR-378a (MI0000795), mmu-miR-381 (MI0000798), mmu-miR-409 (MI0001160) and mmu-miR-543 (MI0003519). [score:1]
[1 to 20 of 3 sentences]
23
[+] score: 9
The miRNAs that exhibited at least a 2-fold change in expression in the hADSCs before and after the induction of chondrogenic differentiation are listed in Table I, and these include 12 upregulated miRNAs (miR-196a, miR-143, miR-383, miR-193b, let-7i, miR-26a, miR-539, miR-199a-3p, miR-337-5p, miR-146a-5p, miR-646, and miR-381) and 8 downregulated miRNAs (miR-490-5p, miR-1307, miR-125b, miR-96-3p, miR-302-3p, miR-23a-3p, miR-590, and miR-510). [score:9]
[1 to 20 of 1 sentences]
24
[+] score: 8
Similarly, when pri-mir-21, pri-mir-199a, and pri-mir-381 primary transcripts were up-regulated, their mature miRNA forms were up-regulated as well (Figure 6). [score:7]
pri-mir381 forward: 5'-tggtacttaaagcgaggttgc-3', pri-mir381 reverse: 5'-ggtcatgcacacacataccac-3'. [score:1]
[1 to 20 of 2 sentences]
25
[+] score: 8
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-101-1, hsa-mir-139, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-142, hsa-mir-144, hsa-mir-127, hsa-mir-154, hsa-mir-185, hsa-mir-195, hsa-mir-29c, hsa-mir-101-2, hsa-mir-380, hsa-mir-323a, hsa-mir-520e, hsa-mir-520a, hsa-mir-518c, hsa-mir-520d, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-509-1, hsa-mir-576, hsa-mir-548a-1, hsa-mir-586, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-599, hsa-mir-548a-3, hsa-mir-607, hsa-mir-613, hsa-mir-548c, hsa-mir-625, hsa-mir-634, hsa-mir-642a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-656, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-1208, hsa-mir-548e, hsa-mir-548j, hsa-mir-1290, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1247, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1324, hsa-mir-1825, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-323b, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-642b, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Note that the expression of ten of the 65 miRNAs we identified in the current study (miR-101, miR-127-3p, miR-139-5p, miR-142-5p, miR-185, miR-195, miR-218, miR-29a, miR-29c, miR-381) has been detected in samples of adult human hippocampus containing different subregions [34]. [score:3]
Interestingly, miR-381 is also expressed in the adult human hippocampus [34]. [score:3]
miR-381, another one of the seven miRNAs belonging to the miR-379-410 cluster identified in this study, has been shown to be involved in the regulation of dendritic outgrowth of hippocampal neurons controlled by neuronal activity [30]. [score:2]
[1 to 20 of 3 sentences]
26
[+] score: 7
logFC p-value B-statistic microRNA 0.98 3.53E-08 9.07 hsa-miR-1244 0.74 2.34E-07 7.34 hsa-miR-494 0.45 6.83E-07 6.34 hsa-miR-1979 0.31 3.97E-06 4.66 hsa-miR-1826 0.77 9.14E-06 3.85 hsa-miR-1281 −0.31 1.13E-05 3.65 hsa-miR-202 −0.37 1.14E-05 3.64 hsa-miR-4284 −0.49 1.70E-05 3.25 hsa-miR-221-star −0.89 6.51E-05 1.94 hsa-miR-3172 −0.63 9.48E-05 1.57 hsa-miR-548a-3p −0.43 1. 02E-04 1.49 hsa-miR-1272 −0.34 1.29E-04 1.27 hsa-miR-15a −0.40 1.59E-04 1.06 hsa-miR-3152 −0.22 2.56E-04 0.59 hsa-miR-142–5p 0.24 3.03E-04 0.43 hsa-miR-4270 −0.29 3.27E-04 0.35 hsa-miR-1910 −0.42 3.29E-04 0.35 hsa-miR-34a-star −0.18 3.78E-04 0.21 hsa-miR-381 −0.30 4.10E-04 0.13 hsa-miR-450b-5p 0.30 4.34E-04 0.08 hsa-miR-1469 We also looked for differentially expressed miRNAs (BH adjusted p < 0.05) that may target differentially expressed mRNAs (BH adjusted p < 0.05). [score:7]
[1 to 20 of 1 sentences]
27
[+] score: 7
Remarkably, MeCP2 silences miR-30a/d, miR-381 and miR-495, which in turn repress Brain-derived neurotrophic factor (BDNF), the down-regulated target gene in Mecp2 -null mice (Wang et al., 2006); this suggests a multilayered MeCP2 -mediated transcriptional regulation of BDNF (Wu et al., 2010). [score:7]
[1 to 20 of 1 sentences]
28
[+] score: 6
In vitro, rFGF2 treated chondrosarcoma cells increased VEGF-C expression via downregulation of miR-381 [82]. [score:6]
[1 to 20 of 1 sentences]
29
[+] score: 6
The regulator hub-UPmiR is miR-381-3p which has 45 target genes (Table S3.1). [score:4]
The regulator hub-DEmiRs in the two networks are miR-381-3p and miR-17-5p, respectively. [score:2]
[1 to 20 of 2 sentences]
30
[+] score: 6
A signature of 5 miRNAs (miR-376a, miR-381, miR-411, miR-432, and miR-487) along with miR-203 that can be mapped to both chromosome 14q32.1 and 14q32.33 is shown in ependymoma and other tumours to be regulated by DNA methylation, proving the global dysregulation of this chromosome in carcinomas [143, 149, 150]. [score:3]
Pituitary tumour transforming gene (PTTG) protein 1 is associated with increased tumour invasiveness [178] and is targeted by miR-126 and miR-381. [score:3]
[1 to 20 of 2 sentences]
31
[+] score: 6
In an attempt to discover whether the guinea pig Abcb1 isoform 1’s 3′UTR contains MREs, the reverse complement of several human ABCB1-specific miRs validated to reduce ABCB1 mRNA expression and ABCB1 activity (miR223 [24], miR508-5p [25], bta-miR145 [26], miR381 and miR-495 [27]) were searched via BLAST alignment for extrapolation to guinea pig; however, none were found. [score:3]
The human miR cluster at 14q32.31, an imprinted region, containing miR-381 and miR-495, contains over 20 miR sequences, several known to inhibit ABCB1 in human, and there is 90% homology (BLAT) between this region and a 31 kb region in the guinea pig genome, on the plus strand of scaffold 111, therefore representing a candidate region for miR discovery. [score:3]
[1 to 20 of 2 sentences]
32
[+] score: 6
VSNL1, a hub node within the network, is predicted to be targeted by 7 miRNAs, 5 of which are oncomiRNAs highly expressed in GBM (miR-23a, miR-23b, miR-196a, miR-196b, miR-381) (Figure 7) [24– 28]. [score:5]
Within this more restricted network, we pinpointed contactin 6 (CNTN6) as the only node that links CDR1 and VSNL1 by a genetic interaction, in addition to 7 miRNAs (miR-23a, miR-23b, miR-124a, miR-196a, miR-196b, miR-369–3p, miR-381) controlling different nodes. [score:1]
[1 to 20 of 2 sentences]
33
[+] score: 6
We also detected some differentially expressed miRNAs during human skeletal muscle development, such as miR-224, and miR-381, which have not yet been associated with muscle formation. [score:4]
In contrast, miR-1, miR-299–5p, miR-381, miR-193b* and let-7a seem to be more associated with the third phase of muscle development, the volumetric growth and maturation of the muscle fibers (Stg3, Fig. 3B). [score:2]
[1 to 20 of 2 sentences]
34
[+] score: 5
Other miRNAs from this paper: mmu-mir-381
Chen, W. et al. MicroRNA-381 Regulates Chondrocyte Hypertrophy by Inhibiting Histone Deacetylase 4 Expression. [score:5]
[1 to 20 of 1 sentences]
35
[+] score: 5
Treatment of microRNA-381 inhibits metastasis of gastric carcinomas by suppressing ANO1 [38]. [score:5]
[1 to 20 of 1 sentences]
36
[+] score: 5
miR-632, miR-338, miR-381 and miR-340 expression resulted very low, suggesting an alternative explanation to the absence of silencing effect on their predicted targets, as for example we can hypothesize that they do not work at physiological concentration of the HCC cell context. [score:5]
[1 to 20 of 1 sentences]
37
[+] score: 5
Other miRNAs from this paper: mmu-mir-381, hsa-mir-489, mmu-mir-489
Recent study reported that miR-381 inhibited migration, invasion and EMT of CRC cells by targeting TWIST1 [9]. [score:5]
[1 to 20 of 1 sentences]
38
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-191, hsa-mir-196a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-196a-2, hsa-mir-181a-1, mmu-mir-296, mmu-mir-298, mmu-mir-34c, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-143, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-148a, mmu-mir-196a-1, mmu-mir-196a-2, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-92a-2, mmu-mir-93, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-330, mmu-mir-346, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-107, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-181a-1, mmu-mir-29b-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34c, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-381, hsa-mir-330, mmu-mir-133a-2, hsa-mir-346, hsa-mir-196b, mmu-mir-196b, hsa-mir-18b, hsa-mir-20b, hsa-mir-146b, hsa-mir-519d, hsa-mir-501, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-92b, mmu-mir-146b, mmu-mir-669c, mmu-mir-501, mmu-mir-718, mmu-mir-18b, mmu-mir-92b, hsa-mir-298, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-718, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Six miRNAs showed a trend for a stronger upregulation during the brown adipocyte differentiation - miRPlus_17856, mmu-miR-381, mmu-miR-501-3p, mmu-miR-21*, mmu-miR-296-5p and miRPlus_17832. [score:4]
[1 to 20 of 1 sentences]
39
[+] score: 4
Conversely, miR-192-5p, miR-30a-5p, miR-381-3p, miR-769-5p and let7i-5p were significantly up-regulated, both at 16 and 36 hrs of H [2]O [2] treatment (Fig. 4A and supplementary Fig. S7 in linear scale). [score:4]
[1 to 20 of 1 sentences]
40
[+] score: 4
In contrast, in vivo studies showed that increasing the expression levels of edited miR-381 is correlated with increased lung cell proliferation [71] (Figure 3A). [score:3]
miR-381 was found in several studies to be involved in pathways towards cancer, such as stemness [110] and chemoresistance [111]. [score:1]
[1 to 20 of 2 sentences]
41
[+] score: 4
For miR-432, miR-411, miR 376-a, miR-381 and miR-487b, higher expression was associated with a lower relapse free probability. [score:3]
Five of these (miR- 376a, miR-381, miR-411, miR-432 and miR-487) map to human chromosome 14q32.31. [score:1]
[1 to 20 of 2 sentences]
42
[+] score: 4
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c, hsa-mir-200a, hsa-mir-429
Xia B Li H Yang S Liu T Lou G MiR-381 inhibits epithelial ovarian cancer malignancy via YY1 suppressionTumour Biol. [score:4]
[1 to 20 of 1 sentences]
43
[+] score: 3
Especially for the placenta, except miR-136, miR-184 and miR-381, 40 out of 43 (93.02%) placenta-specific miRNAs were clustered miRNAs, suggesting that these clustered miRNAs have similar expression patterns and play related or particular functions in this tissue. [score:3]
[1 to 20 of 1 sentences]
44
[+] score: 3
MiR-9-1, miR-125a-3p, miR-125a-5p, miR-320c, miR-320d, miR-4792, miR-376, miR-139, miR-543, and miR-381(MS00010752, MS00008554, MS00003423, MS00041867, MS00031710, MS00045087, MS00007392, MS00003493, MS00010080, MS00004116, QIAGEN, Valencia, CA) were selected for downstream validation. [score:1]
In this study, we selected miR-9-1, miR-125a-3p, miR-125a-5p, miR-320c, miR-4792, miR-376, miR-543, and miR-381 as diagnostic candidates for validation. [score:1]
In this follow up study, we selected nine miRNA candidates (miR-125-3p, miR-320c, miR-320d, miR-9-1, miR-139, miR-125a-5p, miR-4792, miR-376, miR-543, miRNA-381) for validation in the independently recruited patients with early-stage (I, II) colon cancer. [score:1]
[1 to 20 of 3 sentences]
45
[+] score: 3
83 *** hsa-mir-346 7.13 *** 69.13 *** hsa-mir-361-3p 4.51 *** 9.6 *** hsa-mir-483-3p 3.56 *** 68.61 *** hsa-mir-486-5p 2.85 *** 34.48 *** hsa-mir-574-3p 2.61 *** 43.22 *** hsa-mir-629* 16.62 *** 67.23 *** hsa-mir-885-5p 4.75 *** 43.73 *** Inhibited differentiation & high cell count hsa-mir-193b 38.04 *** 102.74 * Hits of functional screen Relative percentage of myotubes 1, % of control p value, Mann Whitney test Relative cell count 2, % of control p value, Mann Whitney test hsa-mir-369-3p 61.75 *** 103.6 * hsa-mir-381 61.75 *** 105.31 * hsa-mir-886-5p 38.04 *** 112.86 *** hsa-mir-940 21.37 *** 112.35 *** Enhanced differentiation hsa-mir-98 104.51 * 87.82 *** High cell count hsa-mir-631 92.63 ** 103.43 *** 1see Material and Methods; 2 *: p<0.05; **: p<0.01; *** p<0.005; − = not significant. [score:3]
[1 to 20 of 1 sentences]
46
[+] score: 3
In contrast, the miR-381 mimic showed little, if any, inhibitory effect. [score:3]
[1 to 20 of 1 sentences]
47
[+] score: 3
Inhibiting Hes1 with miR-381 will also affect the differentiation and proliferation mechanism of NSCs [80]. [score:3]
[1 to 20 of 1 sentences]
48
[+] score: 3
A previous study from our institution had predicted eleven of these fourteen (79%) miRNAs (hsa-miR-454, has-miR-582-5p, has-miR-181d, has-miR-500, has-miR-181c, has-miR-411, has-miR-363, has-miR-381, has-miR-302c*, has-miR-652 and has-miR-452), to target CYP3A4/5/7 3’-UTR using in silico approach [29]. [score:3]
[1 to 20 of 1 sentences]
49
[+] score: 3
Additionally, miR-424 and miR-381 synergistically target WEEN-1 in renal carcinoma [25]. [score:3]
[1 to 20 of 1 sentences]
50
[+] score: 3
Firstly, not all the pre-miRNA sequences are expressed in the order of the genome sequence due to the RNA editing [39, 40], such as mir-381,mir-1271. [score:3]
[1 to 20 of 1 sentences]
51
[+] score: 3
Differential miRNA expression levels included higher levels of MIR767, MIR135B, MIR1269, MIR182, MIR183, and MIR203 and lower levels of MIR494, MIR424, MIR381, MIR452, and MIR155 in PANC-1 cells. [score:3]
[1 to 20 of 1 sentences]
52
[+] score: 3
miRNAs [a]Presence in samples [b]Median editing (in %) Seed editing event Position in precursor Target Prediction [c]Overlap (%) Before/After editing hsa-mir-598-3p 6/5/0 0.49/0.34/0 Yes 62 11/9 0 (0) hsa-mir-376a-1-5p 6/6/0 11.24/8.43/0 Yes 9 131/166 4 (3.05) hsa-mir-337-3p* 4/1/0 4.21/−/0 Yes 66 146/197 11 (7.53) hsa-mir-376c-3p 6/5/2 3.72/1.9/− Yes 48 156/192 11 (7.05)hsa-mir-1301-3p [#,*] 6/6/2 7.59/3.94/− Yes 52 230/7 2 (0.87) hsa-mir-421 6/6/3 1.40/0.61/0.57 Yes 54 271/4 1 (0.37) hsa-mir-99b-3p* 6/6/2 3.61/1.65/− Yes 47 33/21 0 (0) hsa-mir-641-5p 6/6/3 5.62/7.08/3.35 Yes 18 355/128 11 (3.1) hsa-let-7e-3p* 4/0/0 2.09/0/0 Yes 57 5/3 0 (0)hsa-mir-1251-5p [#,*] 4/4/0 11.98/11.87/0 Yes 10 58/305 4 (6.9)hsa-mir-381-3p [#] 6/6/5 6.87/7.15/3.07 Yes 52 638/302 48 (7.52) hsa-mir-411-5p 6/6/5 27. [score:3]
[1 to 20 of 1 sentences]
53
[+] score: 3
In regards to age, we discovered that the expression levels of 14 miRNAs (miR-654-5p, miR-493*, miR-410, miR-376a*, miR-758, miR-381, miR-543, miR-539, miR-487b, miR-337-5p, miR-136*, miR-154*, miR-330-3p, and miR-421) were significantly higher in HCC up to 66 years old than in HCC over 67 years old. [score:3]
[1 to 20 of 1 sentences]
54
[+] score: 3
These analyses identified four miRNAs unique to pNK cells (has-miR-337, has-miR-422a, has-miR-549, and has-miR-618) and eight miRNAs uniquely expressed by PB NK cells (has-let-7b, has-miR-146b, has-miR-19b, has-miR-24, has-miR-347, has-miR-381, has-miR-517c, and has-miR-631). [score:3]
[1 to 20 of 1 sentences]
55
[+] score: 2
More recent studies have demonstrated roles for miR-539 and miR-381 in mediating a novel regulatory pathway between KIT and microphthalmia -associated transcription factor in normal and malignant mast cells [17]. [score:2]
[1 to 20 of 1 sentences]
56
[+] score: 2
Formosa A, Markert EK, Lena AM, Italiano D, Finazzi-Agro E, Levine AJ, et al. s, miR-154, miR-299-5p, miR-376a, miR-376c, miR-377, miR-381, miR-487b, miR-485-3p, miR-495 and miR-654-3p, mapped to the 14q32.31 locus, regulate proliferation, apoptosis, migration and invasion in metastatic prostate cancer cells. [score:2]
[1 to 20 of 1 sentences]
57
[+] score: 2
Ssc-miR-new-371 and ssc-miR-new-108 were homologous to hsa-miR-381-3p and hsa-miR-128-3p, both of which have been shown to be related to skeletal muscle development [32, 33]. [score:2]
[1 to 20 of 1 sentences]
58
[+] score: 2
Overall, the 40 combinations consisted of 15 different miRNAs (miR-20b, miR-24, miR-28-3p, miR-132-3p, miR-140-3p, miR-146b-5p, miR-155, miR-191, miR-193a-5p, miR-328, miR-331, miR-381, miR-532, miR-628-5p, and miR-660) that were used for further analysis. [score:1]
Notably, miR-381 seemed to be not affected by hemolysis, whereas the corresponding reference miR-20b was highly affected even at low hemolysis grades. [score:1]
[1 to 20 of 2 sentences]
59
[+] score: 2
Rothschild and colleagues showed that both miR-381 and miR-29b repressed ID1 and were dysregulated in LAD. [score:2]
[1 to 20 of 1 sentences]
60
[+] score: 1
It has also been observed that several miRNAs such as- miR-208, miR-381 and miR-339 exhibit significant differences by age. [score:1]
[1 to 20 of 1 sentences]
61
[+] score: 1
Nine of those 11 miRNAs including miR-433, miR-127, miR-381, miR-377, miR-299-3p, miR-409-3p, miR-154, miR-382, and miR-376c are associated with OS. [score:1]
[1 to 20 of 1 sentences]
62
[+] score: 1
Other miRNAs from this paper: mmu-mir-381
In lung cancer, ADAR1 was reported to exert growth-enhancing activity through mediating the A-to-I editing levels of coding region in NEIL1 (a DNA repair enzyme) and non-coding region in pre-miR381 RNA transcripts [21]. [score:1]
[1 to 20 of 1 sentences]
63
[+] score: 1
Some miRNAs have been demonstrated perhaps to play key roles in tumorigenesis, progression, invasion or metastasis in human GBM, such as miR-181, miR-200b, miR-182, miR-381, miR-142-3p and others [4], [7]– [9]. [score:1]
[1 to 20 of 1 sentences]
64
[+] score: 1
Signals from the miR-412 probe were not detected in FLS W samples, and miR-381 signals were not detected in FLS W or FLS ob/ob samples. [score:1]
[1 to 20 of 1 sentences]
65
[+] score: 1
Surprisingly, out of these, only two miRNAs (miR-23a-5p, miR-137) were more abundant in sEVs at both time points (Fig. 5C), while five miRNAs (miR-17-3p, miR-625-3p, miR-766-3p, miR-199b-5p, miR-381-3p) were less abundant in sEVs of senescent cells (Fig. 5D). [score:1]
[1 to 20 of 1 sentences]
66
[+] score: 1
The best example is the three miRNAs (miR-381/154/377) in the group VIIa that are located within a cluster of at least 32 miRNAs at chromosome 14q32.31. [score:1]
[1 to 20 of 1 sentences]
67
[+] score: 1
We also noted A to G substitutions at nucleotide position four for miR-381 and position five for miR-411, miR-200b, and miR-379 (Table 1, Fig. S3A). [score:1]
[1 to 20 of 1 sentences]
68
[+] score: 1
47 (33) CDK6, DAPK1, PDGFRA, WEE1, MAP3K2, STK39, TRIB20.0214HSA-MIR-381.47 (33) EPHA4, GRK5, MET, RPS6KA3, TEK, WEE1, ZAK0.0214HSA-MIR-449B. [score:1]
[1 to 20 of 1 sentences]
69
[+] score: 1
3/3p21.32 −3.91 hsa-miR-487b 14q32.2 −3.82(29) hsa-miR-487a 14q32.2 −3.78 hsa-miR-758 14q32.2 −3.65 hsa-miR-485-5p 14q32.2 −3.60 hsa-miR-138-1* 16q13.3/3p21.32 −3.55 hsa-miR-382 14q32.2 −3.53(12, 29) hsa-miR-504 Xq26.3 −3.45(52) hsa-miR-128 2q21.3/3p22.3 −3.43(12, 14, 51, 59) hsa-miR-490-5p 7q33 −3.42 hsa-miR-770-5p 14q32.2 −3.35 hsa-miR-410 14q32.2 −3.30(29) hsa-miR-432 14q32.2 −3.29 hsa-miR-485-3p 14q32.2 −3.02 hsa-miR-490-3p 7q33 −2.88 hsa-miR-381 14q32.2 −2. [score:1]
[1 to 20 of 1 sentences]
70
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-18a, hsa-mir-21, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-30a, mmu-mir-99a, mmu-mir-126a, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-138-2, hsa-mir-192, mmu-mir-204, mmu-mir-122, hsa-mir-204, hsa-mir-1-2, hsa-mir-23b, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-138-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-138-1, mmu-mir-192, mmu-let-7a-1, mmu-let-7a-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-103-1, mmu-mir-103-2, hsa-mir-1-1, mmu-mir-1a-2, mmu-mir-26a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, hsa-mir-26a-2, hsa-mir-376c, mmu-mir-381, mmu-mir-133a-2, rno-let-7a-1, rno-let-7a-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-18a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-26a, rno-mir-30a, rno-mir-99a, rno-mir-103-2, rno-mir-103-1, rno-mir-122, rno-mir-126a, rno-mir-133a, rno-mir-138-2, rno-mir-138-1, rno-mir-192, rno-mir-204, mmu-mir-411, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-193b, rno-mir-1, mmu-mir-376c, rno-mir-376c, rno-mir-381, hsa-mir-574, hsa-mir-652, hsa-mir-411, bta-mir-26a-2, bta-mir-103-1, bta-mir-16b, bta-mir-18a, bta-mir-21, bta-mir-99a, bta-mir-126, mmu-mir-652, bta-mir-138-2, bta-mir-192, bta-mir-23a, bta-mir-30a, bta-let-7a-1, bta-mir-122, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-204, mmu-mir-193b, mmu-mir-574, rno-mir-411, rno-mir-652, mmu-mir-1b, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-1-2, bta-mir-1-1, bta-mir-133a-2, bta-mir-133a-1, bta-mir-138-1, bta-mir-193b, bta-mir-26a-1, bta-mir-381, bta-mir-411a, bta-mir-451, bta-mir-9-1, bta-mir-9-2, bta-mir-376c, bta-mir-1388, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-451b, bta-mir-574, bta-mir-652, mmu-mir-21b, mmu-mir-21c, mmu-mir-451b, bta-mir-411b, bta-mir-411c, mmu-mir-126b, rno-mir-193b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Three miRNA candidates (bta-un10, bta-un13 and bta-un20) were identified in the 5' arm of bta-mir-381, -495 and -487a, respectively, while only the 3' arms of these miRNAs were reported in several species (Table 2, Additional file 4). [score:1]
[1 to 20 of 1 sentences]
71
[+] score: 1
Notably, three TFs (STAT1, E2F1, and ESR10) participated in all motifs and seven miRNAs participated in all motifs, namely hsa-miR-106a, hsa-miR-20a, hsa-miR-17, hsa-miR-19b, hsa-miR-381, hsa-miR-21, and hsa-miR-221. [score:1]
[1 to 20 of 1 sentences]
72
[+] score: 1
The miR-381-3p, miR-548u, miR-411-5p, miR-148a-5p, and miR-96-5p which were filtered in HFD comparison but not in intact comparison and no-T2D comparison might involve the progress of T2D fed with HFD only. [score:1]
[1 to 20 of 1 sentences]