sort by

136 publications mentioning hsa-mir-372 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-372. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 420
In HNSCC cells, the exogenous miR-372 expression is associated with the down-regulation of both p62 and NQO1 (Fig. 3C, Lt), and the miR-372 inhibition is associated the up-regulation of p62 (Fig. 3C, Rt). [score:11]
We further validated the concomitant down-regulation of p62 and NQO1 that accompanies miR-372 up-regulation in HNSCC tissues and that miR-372 is able to modulate the migration of HNSCC cells by suppression in this study. [score:9]
Lower, qRT-PCR analysis revealed highly significant miR-372 up-regulation together with down-regulation of p62 and NQO1 mRNA expression at 48 h for SAS cells, and at 72 h for OECM1 cells. [score:9]
Up-regulation of miR-372 and down-regulation of p62 and NQO1 mRNA expression can be seen. [score:9]
Since areca, an oral carcinogen, up-regulates HIF1α in HNSCC cells [4] and nicotine is also known to markedly up-regulated HIF1α expression in nasopharyngeal carcinoma cells [42], it seems likely that miR-372 contributes to human HNSCC genesis via stimulation by habitual use of carcinogenic substances. [score:9]
DMOG treatment induced miR-372 up-regulation and down-regulation of the mRNA expression of p62 and NQO1. [score:9]
Exogenous miR-372 expression decreased p62 protein expression (Lt and Middle), while miR-372 inhibition increased p62 expression (Rt) in HNSCC cells. [score:9]
The mRNA expression of p62 and NQO1 was down-regulated during hypoxia culture and it was generally opposite to the status of miR-372 expression (Fig. 5A, Lower). [score:8]
The mRNA expression of p62 and NQO1 was generally down-regulated during DMOG treatment and this was opposite to the effect on miR-372 expression (Fig. 5B). [score:8]
After the blockage of autophagy by 3-methyladenine (3MA), the hypoxia -induced p62 down-regulation still existed, which substantiates the involvement of hypoxia induced miR-372 expression in the attenuation of p62 expression, which is independent from autophagy (Fig. 5E). [score:8]
Moreover, a study indicated that miR-372 is a hypoxia up-regulated miRNA and that it targets the tumor suppressor RECK during pathogenesis [22]. [score:8]
As OECM1 cells expressed miR-372 at a much higher level than SAS cells, the decrease in exogenous p62 expression via targeting of miR-372 was particularly obvious in these cells. [score:7]
This study further identified that miR-372 was up-regulated by hypoxia and by HIF1α up-regulation in head and neck keratinocytes. [score:7]
miR-372 expression is known to repress several target genes that alter cellular phenotypes [23, 30, 31]; this suggests that the uncovering of additional miR-372 targets and an exploration of the pluripotent actions of miR-372 across different subset of tumors is likely to have important implications. [score:7]
In contrast, miR-372 has been shown to be down-regulated in cervical carcinoma and is able to target CDK2 [31]. [score:6]
This study presents novel clues showing that miR-372 targets p62 by virtue of the binding its 3′UTR site and that this down-regulates p62, which then increases the mobility of HNSCC cells. [score:6]
Although miR-372 is known to act as either an oncogenic miRNA or as a suppressor miRNA in various human malignancies [23, 26, 31], miR-372 is known to be up-regulated in HNSCC in earlier studies [1, 29]. [score:6]
Following the DMOG treatment, miR-372 expression was gradually up-regulated to a maximal level at 24 h for SAS cells and at 48 h for OECM1 cells. [score:6]
qRT-PCR analysis indicated that p62 mRNA expression was significantly down-regulated following the treatment with miR-372 mimic in both SAS and OECM1 cells (Fig. 1F). [score:6]
The up-regulation of NQO1 associated with miR-372 inhibition was eminent in SAS cells, while it was not eminent in OECM1 cells. [score:6]
To determine whether miR-372 is able to suppress p62 expression through direct binding to its 3′UTR, we transfected cells with the wild type reporter (WtR) and mutant reporter (MutR) plasmids (see schema in Fig. 1E). [score:6]
SAS-miR-372, OECM1-miR-372 cell subclones, and both SAS and OECM1 cells treated with miR-372 mimic were subjected to to show the down-regulation of p62 following increased expression of miR-372 (Fig. 1G, Lt and Middle). [score:6]
In addition, β-catenin is also known to up-regulate the expression of the miR-372/miR-373 cluster through promoter transactivation [30]. [score:6]
On the contrary, cells treated with miR-372 inhibitor exhibited up-regulation of p62 (Fig. 1G, Rt). [score:6]
miR-372 promotes the migration of HNSCC cells and targets p62Our previous study demonstrated that miR-372 was up-regulated in HNSCC tissue samples [1]. [score:6]
miR-372 expression levels are inversely correlated with p62 mRNA expression. [score:5]
Rt, Box and Whiskers plot illustrating miR-372 expression and the protein expression of p62 and NQO1 in tissue pairs. [score:5]
OECM1 cell line had the highest level of miR-372 expression, while SAS cell line exhibited miR-372 expression similar to other HNSCC cell lines (Fig. 1A). [score:5]
miR-372 enhances cell migration by targeting p62The expression of p62 mRNA in HNSCC cells was lower than the HIOK analyzed (Fig. 2A). [score:5]
A recent study identified that miR-372 affects esophageal and gastric carcinogenesis via an inhibition of LATS2 expression [25, 28]. [score:5]
Overall, the findings of this study indicate that miR-372 is able to evoke migration and increase ROS via targeting of p62, which may decreases NQO1 expression then, and the circulatory miR-372 could be HNSCC tumor marker. [score:5]
Exogenous miR-372 expression decreased p62 mRNA expression. [score:5]
Quantification indicated a significant down-regulation of the protein levels of p62 and NQO1 compared to miR-372 expression across this tissue subset (Fig. 6E, Rt). [score:5]
It is well known that hypoxia induced the EMT, which facilitated the invasiveness of HNSCC [15] and this study provides another clue demonstrating that miR-372 expression, when elicited by hypoxia, also mediates cell mobility by targeting p62 and its downstream detoxification cascade. [score:5]
We established SAS-miR-372 and OECM1-miR-372 cell subclones expressing exogenous miR-372 and SAS-miRZip-372 and OECM1-miRZip-372 cell subclones harboring stable suppression of miR-372 by lentiviral infection, sorting or selection of cells. [score:5]
Rt, Correlation analysis between miR-372 expression (X-axis) and the mRNA expression of p62 or NQO1 (Y-axis) in HNSCC tissue pairs. [score:5]
Fig. 1 miR-372 enhances migration of HNSCC cells and targets p62(A) qRT-PCR analysis of miR-372 expression in HNSCC cell lines and HIOK cell. [score:5]
TargetScan and PicTar in silico modules predicted that p62 might be an unreported target of miR-372 (Fig. 1E). [score:5]
However, the exogenous miR-372 expression or miR-372 inhibition did not cause changes in cell proliferation (Fig. S1A). [score:5]
The inhibition of miR-372 with the treatment of mirVana [TM] miR-372 inhibitor decreased the migration of cells (Fig. 1D), but it did not affect cell proliferation (Fig. S1C). [score:5]
Hypoxia induced migration can be mediated through the miR-372-p62 cascadeHNSCC cells were cultured under hypoxia conditions for 24 h - 72 h. revealed that both p62 protein expression and NQO1 protein expression decreased gradually over the culture period (Fig. 5A, Upper). [score:5]
The stable miR-372 expression enhanced the migration of SAS cells and the stable miR-372 inhibition reduced the migration of OECM1 cells (Fig. 1B). [score:5]
The results indicated that the increased migration (Fig. 2F, Lt) and invasion (Fig. 2F, Middle), other than anchorage-independent growth (AIG) (Fig. 2F, Rt), which was induced by miR-372 expression, was significantly attenuated by p62 expression. [score:5]
revealed that there was increased p62 expression in p62 coding sequence (CDS) cell subclones, but this increase became weaker in p62 CDS+3′UTR stable cell subclones, which contains the miR-372 target site in the 3′UTR (Fig. 2D, Lt). [score:5]
miR-372 up-regulation occurred earlier on 48 h in SAS cells than in OECM1 cells. [score:4]
Furthermore, up-regulation of miR-372/miR-373 has been found in HNSCC tissues during previous screenings [1, 29]. [score:4]
Although miR-372 also targets LATS2 in HNSCC cells, the knockdown of LATS2 did not affect HNSCC cell migration (detailed analysis not shown). [score:4]
Recently, miR-372/miR-373 have been found to be up-regulated in response to hypoxia via HIF1α and TWIST1 in SW620 CRC cells [22]. [score:4]
Our previous study demonstrated that miR-372 was up-regulated in HNSCC tissue samples [1]. [score:4]
Expression of miR-372 has been correlated with a poor prognosis and aggressive tumor growth [27]. [score:3]
miR-372 enhances cell migration by targeting p62. [score:3]
Furthermore, β-catenin transactivates miR-372/miR-373, which then target DKK1 [30]. [score:3]
miR-372 promotes the migration of HNSCC cells and targets p62. [score:3]
However, the influence of miR-372 on NQO1 expression was somewhat redundant in OECM1 cell line as more complicated factors could be involved. [score:3]
Luciferase activity assays indicated that miR-372 was able to repress the activity of WtR by binding to the wild type target sequences in the 3′UTR, while mutation of these wild type sequences removed this repression in both SAS-miR-372 and OECM1-miR-372 cell subclones (Fig. 1H). [score:3]
miR-372 enhances migration of HNSCC cells and targets p62. [score:3]
Significant opposite effects on the expression of miR-372 and p62, and of miR-372 and NQO1 could be seen. [score:3]
Expression of miR-372, p62 and NQO1 in HNSCC tissues. [score:3]
A MutR plasmid was obtained from the WtR plasmid by replacing the sequence AGCACUU at the target site of miR-372 with GAGCTCG in order to create a new SacІ restriction enzyme digestion site. [score:3]
In this study, we provide novel clues as to how miR-372 targets p62, which, in turn, enhances the mobility of HNSCC cells. [score:3]
Human hTERT immortalized oral keratinocyte (HIOK) and HNSCC cells exhibited different levels of endogenous miR-372 expression. [score:3]
Exogenous miR-372 expression was associated with increased ROS in HNSCC cells (Fig. 4A). [score:3]
Cell subclones with stable miR-372 inhibition and controls were established by puromycin selection. [score:3]
To further confirm that miR-372 enhances cell mobility by targeting p62, p62 CDS+3′UTR cell subclones of OECM1 were treated with miR-372 mimic. [score:3]
The miR-372 mimic, mirVana [TM] miR-372 inhibitor and controls were purchased from Applied Biosystems (Foster City, CA). [score:3]
Thus, HNSCC tumors and their paired non-cancerous matched tissue samples (NCMTs) were analyzed to explore the simultaneous expression of miR-372, p62 and NQO1 (Table S2). [score:3]
A region consisting of the 3′UTR of the p62 gene, predicted by TargetScan and PicTar software, which encompassed the miR-372 binding site, was amplified by PCR. [score:3]
Involvement of miR-372 and p62 in the genesis of ROSExogenous miR-372 expression was associated with increased ROS in HNSCC cells (Fig. 4A). [score:3]
Cell subclones with stable miR-372 expression and controls were established by sorting of red fluorescence. [score:3]
The treatment resulted in the expression of miR-372, but not of miR-373 or miR-372* (detailed analysis not shown). [score:3]
Furthermore, expression of p62 is able to attenuate the migration induced by miR-372. [score:3]
All cell lines had miR-372 expression equal to or higher than HIOK. [score:3]
The miR-372 and miR-373 miRNA cluster were originally associated with stemness in embryonic cells and oncogenicity in human testicular germ cell tumors via a concomitant targeting of LATS2 and CD44 [23]. [score:3]
There was an inversion correlation between the expression of miR-372 and p62 mRNA in HNSCC tissues analyzed (Fig. 5D, Rt). [score:3]
Fig. 6Expression of miR-372, p62 and NQO1 in HNSCC tissues(A) Growth curves of subcutaneous SAS cell xenografts. [score:3]
Since the reduction in migration that is mediated by p62 can be rescued by the knockdown of NQO1, this further supports a role for the miR-372-p62-NQO1 cascade in the progression of HNSCC. [score:2]
These findings indicate that hypoxia induced migration of HNSCC cells are able to be mediated by the miR-372-p62 regulatory cascade. [score:2]
Contrasting expression of p62 compared to miR-372 in HNSCC tissue samplesSAS cell subclones were injected subcutaneously into the flank of nude mice to evaluate the association between p62 expression and the xenografic tumor induction. [score:2]
Contrasting expression of p62 compared to miR-372 in HNSCC tissue samples. [score:2]
Patients having a higher plasma miR-372 were found to have larger primary tumors, nodal metastasis, a more advanced stage and higher mortality during follow-up. [score:1]
It showed the decline of miR-372 in patient's plasma and saliva after tumor resection. [score:1]
Fig. 7Increased plasma miR-372 defines HNSCC progression and worse prognosis(A) ROC analysis of plasma miR-372. [score:1]
Paired analysis also indicated that 8 out of 11 (72.7%) patients exhibited the conspicuous decrease of salivary miR-372 after tumor resection (Fig 7D, Rt). [score:1]
To exclude any confounding effect driven by the passenger strand of the miR-372 duplex, SAS and OECM1 cells were treated with miR-372 mimic, the passenger strand of which had been silenced by modification. [score:1]
miR-372, miR-373, miR-302, miR-520 and some other miRNAs are members of miR-93 family. [score:1]
Plasma and salivary miR-372 decreased after tumor resection. [score:1]
Patients with larger primary tumors, nodal metastasis and an advanced clinical stage exhibited higher miR-372 level in their pre-operative plasma than the remaining group of patients. [score:1]
ROC analyses indicated that the plasma miR-372 level had a predictive power of 0.69 for distinguishing malignant from non-malignant states (Fig. 7A). [score:1]
This increase in miR-372 was also associated with a higher mortality among the HNSCC patients (Fig. 7B). [score:1]
This study has demonstrated the occurrence of a consequential change in the miR-372-p62-NQO1 axis following the induction of hypoxia. [score:1]
To develop plasma markers for HNSCC using a panel of miRNAs, including miR-372, could be a promising strategy [6]. [score:1]
High levels of plasma miR-372 is associated with the progression of HNSCC and higher mortality of patientsTo examine the feasibility of using the plasma level of miR-372 as a diagnostic marker, plasma samples were collected from HNSCC patients and controls. [score:1]
Our preliminary analysis also detected the tumor-derived miR-372 in the saliva samples of HNSCC patients. [score:1]
The pre-miR-372 sequence was cloned into a lentivirus vector carrying a red fluorescence (RFP) tag; this vector was purchased from Biosetta (San Diego, CA). [score:1]
To further investigate the functional roles of miR-372 in head and neck pathogenesis, the endogenous miR-372 expression in various head and neck keratinocytes was analyzed. [score:1]
The results indicated that p62 reverted the increase in migration and invasion, but not AIG, mediated by miR-372. [score:1]
To examine the feasibility of using the plasma level of miR-372 as a diagnostic marker, plasma samples were collected from HNSCC patients and controls. [score:1]
miR-372, as a member in a panel of miRNAs, has been suggested to be suitable for predicting lung carcinoma from sputum samples [11]. [score:1]
Box and Whiskers plots illustrating miR-372 in the plasma or saliva samples of HNSCC patients. [score:1]
High levels of plasma miR-372 is associated with the progression of HNSCC and higher mortality of patients. [score:1]
Thus, plasma miR-372 would seem to be validated as a marker for HNSCC. [score:1]
It is likely that the salivary miR-372 in patients derived from tumor tissues. [score:1]
The p62 CDS+3′UTR cell subclone was treated with miR-372 mimic and then migration (Lt), invasion (Rt) and AIG (Lower) were analyzed. [score:1]
A further understanding of the molecular implications associated with miR-372-p62 interplay may eventually contribute to the diagnosis and treatment of malignancies. [score:1]
The miR-372 and miR-373 miRNA cluster were originally found to be associated with stemness in embryonic cells. [score:1]
qRT-PCR analysis also detected the salivary miR-372 level with a mean –ΔCt of −12.8 in HNSCC patients. [score:1]
Involvement of miR-372 and p62 in the genesis of ROS. [score:1]
miR-372-p62 modulates ROS and migration in HNSCC cells. [score:1]
miRZip™ lentivector -based anti- miR-372 plasmid, designated miRZip-372 in this study, was purchased from System Biosciences (Mountain View, CA). [score:1]
Our clinical analysis indicated that the plasma level of miR-372, which is most likely derived from tumors, is also associated with the progression of HNSCC. [score:1]
Increased plasma miR-372 defines HNSCC progression and worse prognosis. [score:1]
qRT-PCR analysis of 66 sample pairs indicated an average change of –ΔΔCt of 2.37, −0.83 and −0.76 for miR-372, p62 and NQO1, respectively, in HNSCC samples relative to NCMT samples (Fig. 6D, Lt). [score:1]
Fig. 4 miR-372-p62 modulates ROS and migration in HNSCC cells(A-D) Detection of ROS. [score:1]
Hypoxia induced migration can be mediated through the miR-372-p62 cascade. [score:1]
[1 to 20 of 114 sentences]
2
[+] score: 210
The repression of miR-372 and miR-373 is associated with the upregulation of their target, the cell cycle regulator large tumor suppressor homolog 2 (LATS2), leading to the inhibition of cell cycle progression in H. pylori-infected cells. [score:11]
To ascertain that the inhibition of G1/S transition was due to the downregulation of miR-372 and miR-373, we treated AGS cells with synthetic miR-372 and miR-373 prior to infection, in order to dampen their downregulation upon infection. [score:9]
Altogether, these results indicate that LATS2 is a functional target of miR-372 and miR-373 in AGS cells and that the high expression of miR-372 and miR-373 confers to them a growth advantage through the inhibition of LATS2 expression. [score:9]
Using a deep sequencing approach in the AGS cell line, a wi dely used cell culture mo del to recapitulate early events of H. pylori infection of gastric mucosa, we reveal that hsa-miR-372 is the most abundant microRNA expressed in this cell line, where, together with hsa-miR-373, it promotes cell proliferation by silencing large tumor suppressor homolog 2 (LATS2) gene expression. [score:7]
miR-372 and miR-373 downregulation is involved in H. pylori -induced cell cycle arrest in G1 phaseTo assess whether LATS2 upregulation was functionally relevant, we analyzed cell cycle progression of AGS cells upon infection. [score:7]
As expected from cells expressing high miR-372 and miR-373 levels, we observed a 60% inhibition of luciferase expression, as compared to the control pGL3 reporter (Figure 2C). [score:6]
To confirm that LATS2 synthesis was derepressed at the post-transcriptional level after miR-372 and miR-373 downregulation in AGS cells infected with wild-type H. pylori, we generated a stable LATS2 reporter AGS cell line expressing a fluorescent sensor containing the 3'UTR of LATS2 downstream of the enhanced green fluorescent protein (EGFP). [score:6]
miR-372 and miR-373 were initially discovered as novel oncogenes participating in the development of human testicular germ cell tumors by targeting the cell cycle inhibitor LATS2 [36]. [score:6]
These data confirm that the CagA -dependent accumulation of LATS2 protein involves a post-transcriptional release of its expression mediated by the downregulation of miR-372 and miR-373. [score:6]
Repressing LATS2 synthesis, through miR-372 and miR-373 overexpression, could represent an alternative pathway to the downregulation of p21 [cip1/waf1 ]or p27 [kip1 ]in the sequence of events leading to the malignant transformation of cells. [score:6]
Figure 2 miR-372 and miR-373 -mediated regulation of large tumor suppressor homolog 2 (LATS2) translation and AGS cell proliferation. [score:6]
No such inhibition was observed when the pGL3-LATS2 vector was transfected in MKN-74 cells, which express very low miR-372 and miR-373 levels [see Additional File 2, Figure S1]. [score:5]
To evaluate the effects of the downregulation of miR-372 and miR-373, we analyzed the regulation of their common target, LATS2, in AGS cells upon H. pylori infection. [score:5]
H. pylori represses the miR-371-372-373 expression via its major virulence factor CagAWe report here that H. pylori specifically inhibits the synthesis of miR-372 and miR-373 at the primary transcript level and that this repression relies on CagA translocation in AGS cells through a functional T4SS. [score:5]
Shortly after H. pylori infection, miR-372 and miR-373 synthesis is highly inhibited, leading to the post-transcriptional release of LATS2 expression and thus, to a cell cycle arrest at the G1/S transition. [score:5]
Large tumor suppressor homolog 2 (LATS2) translation efficiency in AGS (high miR-372 and miR-373) and MKN-74 (low miR-372 and miR-373) cells. [score:5]
Altogether, these results indicate that LATS2 is indeed a direct target of miR-372 and miR-373 in AGS cells. [score:4]
Mature miR-371-3p, miR-372 and miR-373 were all significantly downregulated (up to 50%) upon infection, as shown by RT-qPCR and northern blot analysis (Figure 3B,C, respectively). [score:4]
miR-372 and miR-373 regulate LATS2 expression in AGS cells. [score:4]
Downregulation of miR-372 and miR-373 upon infection was also shown by northern blot analysis (Figure 3C), which in addition revealed that miRNA precursors (pre-miRNA) were even more strongly repressed than the mature forms (Figure 3C, upper part of the blot for miR-373). [score:4]
Figure 3 Helicobacter pylori -induced downregulation of mature miR-371, miR-372 and miR-373 levels in AGS cells. [score:4]
The effects of these experimental manipulations of miR-372 and miR-373 and their common target LATS2 on the efficiency by which wild-type H. pylori blocks AGS cell cycle demonstrate that the regulation of these miRNAs contribute to the arrest at the G1/S transition in infected AGS cells. [score:4]
Altogether, these results reveal an unexpected mechanism involved in the cell cycle arrest upon infection: the CagA -dependent derepression of LATS2 by the downregulation of miR-372 and miR-373. [score:4]
miR-372 and miR-373 downregulation is involved in H. pylori -induced cell cycle arrest in G1 phase. [score:4]
We report here that H. pylori specifically inhibits the synthesis of miR-372 and miR-373 at the primary transcript level and that this repression relies on CagA translocation in AGS cells through a functional T4SS. [score:3]
However, because the 3'UTR of p21 [cip1/waf1 ]has also been proposed to be targeted by miR-372 and miR-373 [54], we certainly cannot exclude that its induction also participates in this cell cycle arrest [24, 49]. [score:3]
It belongs to a cluster located on the chromosomic region 19q13.42, which comprises four miRNAs, all of them highly expressed in AGS cells: miR-371-5p, miR-371-3p, miR-372 and miR-373 (Figure 1A, black bars). [score:3]
However, we were surprised to discover that the most abundant of this repertoire, miR-372, belongs to a specific cluster encoding three other miRNAs, miR-371-5p, miR-371-3p and miR-373, expressed notably in human embryonic stem cells [34, 44]. [score:3]
This repression was dependent on the two miR-372 and miR-373 binding sites located in the LATS2 3'UTR, as no significant inhibition was observed in AGS cells transfected with the pGL3-LATS2mut vector mutated for these sites [see Additional File 2, Figure S1]. [score:3]
Interestingly, miR-372, which is the most abundant miRNA expressed in AGS cells, was also the most significantly repressed upon infection (Figure 3A, Fisher's exact test, P value = 5.1 × 10 [-13]). [score:3]
Surprisingly, the most abundant one, miR-372, belongs to a miRNA cluster, miR-371-372-373, specifically expressed in embryonic stem cells. [score:3]
These data constitute a novel example of host-pathogen interplay involving microRNAs, and unveil the couple LATS2/miR-372 and miR-373 as an unexpected mechanism in infection -induced cell cycle arrest in proliferating gastric cells, which may be relevant in inhibition of gastric epithelium renewal, a major host defense mechanism against bacterial infections. [score:3]
This reporter system senses changes in the miR-372 and miR-373 levels and allows a direct observation of LATS2 post-transcriptional regulation in living cells. [score:3]
Intriguingly, miR-372 is an embryonic stem-cell-specific miRNA [34], also found highly expressed in placenta [35]. [score:3]
To validate this hypothesis, we transfected into AGS cells the luciferase sensor pGL3-LATS2, containing the 3' untranslated region (UTR) of LATS2, which harbors two miR-372 and miR-373 pairing sites [36] downstream to the firefly luciferase coding sequence (Figure 2A). [score:3]
In as372-373 treated cells, the firefly luciferase expression was significantly derepressed and almost reached the levels of that of the control vector (Figure 2C), contrarily to the cells treated with sc372-373, which did not affect the basal miR-372 or miR-373 levels. [score:3]
Conversely, blocking miR-372 and miR-373 with as372-373 prior to infection facilitated the infection -induced inhibition of DNA synthesis, which then reached its maximum (Figure 5B). [score:3]
Inhibition of LATS2 by miR-372 and miR-373 confers a growth advantage to cells [36, 37]. [score:3]
It appears that the LATS2 level was inversely correlated to the expression of miR-372 and miR-373 in these cell lines (Figure 2B, lower panel). [score:3]
Sample Ct value was compared to a standard curve determined using serially diluted synthetic miR-372 [see Additional File 1, Table S4] and expressed as copies per cell on the basis of our determination of 1 μg RNA/10 [5 ]AGS cells. [score:2]
miR-372 or miR-373 expression is considered as a rare event in tumors, and has only been found in testicular germ cell tumors [36], esophageal tumors [37] and thyroid adenomas [38]. [score:2]
Our work uncovers the unexpected pair of miR-372 and miR-373 as a novel example of miRNAs dysregulated in gastric cancer. [score:2]
TaqMan microRNA assays (Applied Biosystems, Carlsbad, CA, USA) were used to quantify the expression of mature miR-371-3p (AB 002124), miR-372 (AB 000560) and miR-373 (AB 000561). [score:2]
In testicular and esophageal tumors, in which they are abundant, miR-372 and miR-373 have been reported to act as oncogenes repressing LATS2, a serine-threonine kinase involved in cell cycle regulation [36, 37]. [score:2]
Also shown is the predicted base pairing formed between miR-372 or miR-373 with each of the LATS2 3'UTR binding sites as predicted by http://pictar. [score:1]
Therefore, one could imagine that the observed repression of miR-372 and miR-373 in AGS cells could be a consequence of a block in cell division. [score:1]
Figure 5Role of miR-372 and miR-373 in Helicobacter pylori -induced cell cycle arrest in AGS cells. [score:1]
Indeed, miR-372 and miR-373 belong to the miR-106b family which includes miR-93, miR-17-5p and miR-20a [45]. [score:1]
miR-372 copy number was determined by absolute RT-qPCR. [score:1]
To confirm that LATS2 is a functional target of miR-372 and miR-373 in AGS cells, we analyzed cell cycle progression of either as372-373 -treated or LATS2 -transfected cells using the 5-bromo-2'-deoxyuridine (BrdU) incorporation method, which measures the rate of DNA synthesis occurring in the S phase of the cell cycle. [score:1]
Seed regions of miR-372 and miR-373 are underlined. [score:1]
miR-372, miR-373 and miR-371-5p are shown (empty plots). [score:1]
The levels of detectable miR-372 or miR-373 were each specifically decreased by 90% by as372/as373, as verified by RT-qPCR and northern blot analysis [see Additional File 3, Figure S2A,B]. [score:1]
To confirm the role of miR-372 and miR-373 in this repression, we designed antisense oligonucleotides (as372, as373) and their scrambled controls (sc372, sc373) in order to block these miRNAs. [score:1]
In testicular germ cell tumors, which retained functional, wild-type p53, miR-372 and miR-373 act as oncogenes, silencing LATS2 and thus allowing cell proliferation [36]. [score:1]
Indeed, as372-373 -treated cells, in which miR-372 and miR-373 levels were decreased, turn fluorescent, whereas sc372-373 did not [see Additional File 5, Figure S4]. [score:1]
However, the block at the G1/S transition in AGS cells requires the derepression of LATS2 synthesis via the repression of miR-372 and miR-373. [score:1]
Thereby, as in the testicular germ cell tumors, abundant miR-372 and miR-373 in AGS cells, that totally silence LATS2, may participate in their active cell cycle progression despite high levels of p21 [cip1/waf1]. [score:1]
The peculiarity of the AGS miRNA repertoire, which besides containing ubiquitous miRNAs such as miR-16, miR-21, miR-17 and miR-92, resides in the outstanding abundance of miR-372, which was present in the range of 10 [6 ]copies/ng total RNA or 10 [4 ]copies per cell (see). [score:1]
We observed that LATS2 mRNA (Figure 4B) and protein levels (Figure 4C) were inversely correlated to those of miR-372 and miR-373 upon H. pylori infection. [score:1]
These results suggest that LATS2 could be repressed at the post-transcriptional level by miR-372 and miR-373 in AGS cells. [score:1]
We unveil LATS2/miR-372 and miR-373 as a novel mechanism in CagA -induced cell cycle arrest in proliferating gastric cells. [score:1]
Indeed, H. pylori is much less efficient in blocking cell proliferation when the level of LATS2 is maintained at a low level either by miR-372 and miR-373 mimics or by specific anti-LATS2 siRNAs. [score:1]
[1 to 20 of 63 sentences]
3
[+] score: 140
Other miRNAs from this paper: hsa-mir-371a, hsa-mir-373, hsa-mir-371b
Glioma tissues expressing miR-372 at levels less than the median expression level (4.9) were assigned to the low expression group (mean expression value 4.3, n=50), and those samples with expression above the median value were assigned to the high expression group (mean expression value 5.8, n=78). [score:15]
For example, Cho et al. [17] revealed that miR-372 plays an oncogenic role through down-regulation of the tumor suppressor gene LATS2, which accelerated growth and survival of gastric cancer cells; Yamashita et al. [21] indicated that the increased expression of miR-372 in colon cancer was an independent prognostic factor and was associated with synchronous liver metastasis; Voorhoeve et al. [14] demonstrated that miR-372 could enhance cell proliferation, stimulate cell cycle progression, or decrease apoptosis in testicular germ cell tumors. [score:8]
In addition, the multivariate analysis clearly demonstrated that high miR-372 expression was a statistically significant risk factor affecting overall survival in glioma patients, suggesting that miR-372 upregulation in gliomas is not only in a grade -dependent fashion, it is also a predictor of overall survival. [score:6]
In multivariate analysis, Cox proportional hazards mo del involving the expression level of miR-372 protein and various clinical parameters identified miR-372 upregulation (P=0.008) as an independent prognostic factor for glioma patients. [score:6]
As determined by the log-rank test, the survival rate of patients with high miR-372 expression was significantly lower than those with low miR-372 expression (P<0.001; Figure 2). [score:5]
These findings suggest that the different expression patterns and involvement of miR-372 in various cancers may depend on the roles of its target genes. [score:5]
Statistical values of the expression of miR-372 and other clinical parameters derived from Cox stepwise proportional hazards mo del were indicated in Table 3. Figure 2 Kaplan-Meier survival curves for glioma patients with high or low expression of miR-372. [score:5]
Statistical values of the expression of miR-372 and other clinical parameters derived from Cox stepwise proportional hazards mo del were indicated in Table 3. Figure 2 Kaplan-Meier survival curves for glioma patients with high or low expression of miR-372. [score:5]
Finally, subgroup analyses showed the significant prognostic value of miR-372 upregulation for glioma patients especially for those with advanced pathological grade. [score:4]
According to the univariate and multivariate analyses, we identified miR-372 upregulation as an independent predictor for short overall survival of glioma patients, which was consistent with the findings of Yamashita et al. [21] in colon cancer. [score:4]
miR-372 upregulation occurred more frequently in tumors with low KPS than those with high KPS (P=0.01). [score:4]
In addition, the aberrant expression of miR-372 was associated with advanced pathological grades and low KPS of glioma patients, indicating that this miRNA may be involved in the development of human gliomas. [score:4]
miR-372 upregulation in human glioma tissues. [score:4]
Relationship of miR-372 expression with overall survival in patients with gliomas. [score:3]
MiR-372 upregulation associates with advanced clinicopathological features of gliomas. [score:3]
The high level of miR-372 expression was significantly more common in glioma tissues with advanced pathologic grade than those with low pathologic grade (P=0.008, Table 2). [score:3]
Figure 1 miR-372 expression in 128 pairs of glioma and adjacent non-neoplatic brain tissues detected by quantitative real-time polymerase chain reaction (qRT-PCR) analysis. [score:3]
In addition, miR-372 expression in high-grade (III-IV; 5.6±1.0) and low-grade (I-II; 3.9±0.4) gliomas were both significantly higher than that in non-neoplastic brain tissues (2.4±1.1; P<0.001 and 0.001, respectively, Figure 1B). [score:3]
Paired samples T test has been performed to compare the expression levels of miR-372 between glioma and paired non-neoplastic brain tissues. [score:3]
For example, Tian et al. [22] found the downregulation of miR-372 in cervical carcinoma tissues as compared with adjacent normal cervical tissues. [score:3]
A significant relationship was also observed between miR-372 expression and the KPS. [score:3]
No significant association was found between miR-372 expression and gender or age at diagnosis. [score:3]
Then, the increased expression of miR-372 in glioma tissues was significantly correlated with advanced tumor progression and aggressive clinicopathological features. [score:3]
In the present study, we initially found that miR-372 was upregulated in human glioma tissues compared with non-neoplastic brain tissues. [score:3]
By contrast, accumulating studies showed the tumor suppressive roles of miR-372 in many cancers. [score:3]
We then analyzed the association between miR-372 expression and clinicopathological parameters in gliomas. [score:3]
Consistent with these previous studies, our data also found the upregulation of miR-372 in glioma tissues compared with paired adjacent non-neoplastic brain tissues. [score:3]
Next, the Kaplan-Meier analysis revealed that glioma patients with high miR-372 expression tend to have poorer overall survival. [score:3]
In conclusion, our data offer the convincing evidence for the first time that miR-372 may act as an oncogenic miRNA in gliomas and represent a potential regulator of aggressive development and a candidate prognostic marker for this malignancy, especially for advanced tumors with high pathological grades. [score:3]
There was also a significant difference in miR-372 expression between high-grade (III-IV) and low -grade (I-II) glioma tissue specimens (P=0.001, Figure 1B). [score:3]
As shown in Figure 1A, we found that the expression of miR-372 was distinctly increased in glioma tissues compared to non-neoplastic brain tissues (mean±SD: 5.2±1.1 vs. [score:2]
Our findings that miR-372 upregulation was associated with aggressive tumor progression mentioned above prompt us to investigate its possible prognostic value in glioma patients. [score:2]
MiR-372 expression was detected in 128 pairs of glioma and adjacent non-neoplastic brain tissues normalized to RNU6B. [score:2]
Interestingly, our subgroup analyses further suggested that miR-372 may act as a significant prognostic factor for glioma patients with high pathological grades (III~IV), but not for those with low pathological grades (I~II). [score:1]
During the follow-up period, 100 of 128 glioma patients (78.1%) had died [72 (92.3%) from the miR-372 -high group and 28 (56.0%) from the miR-372-low group]. [score:1]
Further elucidation of the mechanism by which the oncogenic roles of miR-372 in gliomas are thwarted is worth to be done. [score:1]
The expression of miR-372 in glioma and adjacent non-neoplastic brain tissues was measured by real-time quantitative RT-PCR analysis according to the conventional protocols of Tangdu hospital [19]. [score:1]
In the present study, we focus on miR-372, which has been demonstrated to act as either an oncogenic miRNA or an anti-oncomiR in various human malignancies [7, 17, 18]. [score:1]
Among these members, miR-372 may act as either an oncogenic miRNA or an anti-oncomiR in various human malignancies. [score:1]
The association of miR-372 with clinicopathological factors or prognosis of glioma patients was also statistically analyzed. [score:1]
MiR-372, together with miR-371a, miR-371b and miR-373, belongs to miR-371~373 cluster which has been demonstrated to play important roles in tumorigenesis and tumor progression [20]. [score:1]
[1 to 20 of 41 sentences]
4
[+] score: 91
Together with its inhibitory effects on PC1/PC2 at KD 6, the substantial decline in miR-372-3p expression levels after KD 3 was sufficient to increase the expression levels of PC1/PC2, despite the differences at earlier time-points. [score:7]
TargetScan analysis showed that both PKD1 and PKD2 are targeted by miR-372-3p (Supplementary Fig.   S3E). [score:5]
There was a differential change of miR-372-3p expression between hiPSC- and hESC-derived KD 3 cells that might be due to known differences in microRNA expression between these two hPSC types [59]. [score:5]
To assess the regulatory roles of miR-372-3p in KD, we first performed qPCR analysis to confirm the downregulation of miR-372-3p (Fig.   6A and Supplementary Fig.   S6A). [score:5]
Similarly, the percentage of cells that eventually expressed both HOXD11 and the nephric marker SIX2 at KD 18 was decreased upon the transfection (Fig.   6F), indicating that miR-372-3p inhibits the formation of nephron progenitors. [score:5]
Our array results indicated that miR-372-3p was specifically downregulated from KD 6 to 10 (Fig.   3B). [score:4]
We newly identified the regulation of miR-372-3p on PKD1/ PKD2, indicating the possible association of miR-372-3p with polycystic kidney disease for the first time. [score:4]
First, we confirmed that miR-192 and miR-372-3p directly repressed their downstream targets. [score:4]
Inhibitors of negative control, miR-192-3p, miR-192-5p, and miR-372-3p were purchased from Thermo Fisher Scientific. [score:3]
Table showing the percentage of HOXD11 [+] cells at KD 12, SIX2 [+] cells and HOXD11 [+] cells at KD 18, with the transfection of miR-372-3p mimics and non -targeting controls (data are presented as the means ± SD. [score:3]
Conversely, overexpression of miR-372-3p at KD 8–14 resulted in decreased PC1 and PC2 protein levels (Fig.   6E and Supplementary Fig.   S6D). [score:3]
Effects of miR-372-3p on the expression of KD-specific genes. [score:3]
10 pmol synthetic miRNA mimics of specific miRNAs, including miR-192-3p, miR-192-5p, and miR-372-3p or non -targeting control (GenePharma, Shanghai, China), and 200 ng reporter plasmids were co -transfected with 1 μl Lipofectamine 2000 according to the manufacturer’s instructions. [score:3]
Based on this atlas, those miRNAs with lineage-specific expressions, such as miR-192 and miR-372-3p, were easily identified. [score:3]
According to intra-lineage analysis (Supplementary Table  S1), miR-372-3p expression was not changed significantly; the change from KD 0 to KD 3 was ranked 99 [th] among 177 small RNAs. [score:3]
IFC analysis showed that the percentage of cells expressed the early metanephric marker HOXD11 at KD 12 was decreased substantially when H1 cells were transfected with miR-372-3p mimics (Fig.   6F). [score:3]
However, after KD 3, miR-372-3p expression decreased in both hPSC-derived cells. [score:3]
Mimics of non -targeting control, miR-192-3p, miR-192-5p, and miR-372-3p miRNAs were purchased from GenePharma. [score:3]
To demonstrate the effects of miR-372-3p on KD, we also determined the efficiency of KD when modulating the expression of miR-372-3p. [score:3]
Targets of miR-192 and miR-372-3p in lineage specification were predicted computationally. [score:3]
In addition to previously reported miRNAs, we identified miR-372-3p, which has well-established enrichment in hESCs but has never been reported in kidney development [42] (Supplementary Fig.   S3D). [score:2]
In this study, we identified miR-192 and miR-372-3p as key miRNAs regulating HD and KD, respectively. [score:2]
Knockdown of miR-372-3p during early nephron differentiation (KD 0–6) resulted in increased PC1 and PC2 protein levels (Fig.   6D and Supplementary Fig.   S6C). [score:2]
Next, we performed luciferase reporter assays and found that the 3′UTRs of PKD1/ PKD2 were significantly inhibited by miR-372-3p (Fig.   6C). [score:2]
To further validate miR-192 and miR-372-3p as key miRNAs, we performed comprehensive experiments to validate their regulatory functions in HD and KD. [score:2]
A negative correlation between miR-372-3p and PKD1/PKD2 was identified (Fig.   6B and Supplementary Fig.   S6B). [score:1]
The newly identified key miRNAs (miR-192-3p/5p and miR-372-3p) are indicated in the dendrograms that they are included. [score:1]
In contrast, inter-lineage analysis combined with bioinformatics analysis allowed us to identify miR-372-3p as a key miRNA, supporting the use of inter-lineage analysis to discover novel key miRNAs. [score:1]
Taken together, these experiments validated that miR-372-3p is a key miRNA. [score:1]
As a result, it was difficult to identify miR-372-3p as a key miRNA by intra-lineage analysis. [score:1]
These validations prove that miR-192 and miR-372-3p are truly key miRNAs. [score:1]
[1 to 20 of 31 sentences]
5
[+] score: 83
Other miRNAs from this paper: hsa-mir-373
Since NEO1 and LATS2 are tumor-suppressor genes and at the same time target genes for p53 and hsa-mir-372 and 373, both hsa-mir-372 and 373 may suppress the p53 pathway by destabilizing NEO1s and LATS2s transcript and/or by inhibiting their translation. [score:11]
We found that 40 genes (24 up-regulated and 16 down-regulated in TGCT cells), among our SAM-identified gene list were predicted target genes for both hsa-mir-372 and 373 (Table 2). [score:9]
Microarray analysis of hsa-mir-372/373 -expressing cells has shown that LATS2, a known inhibitor of CDK2, was down-regulated, and the 3' UTR of LATS2 was shown to harbor predicted hsa-mir-372/373 binding sites. [score:8]
We used the target prediction programs, PicTar and TargetScan 3.1 [41, 42], to identify possible targets of hsa-mir-372 and 373. [score:7]
The target prediction programs, PicTar [41] and TargetScan 3.1 [42], were used to identify possible targets of hsa-mir-372 and 373. [score:7]
This may explain the observed up-regulation of some of the hsa-mir-372/373 predicted target genes in TGCT cells (Table 2). [score:6]
Recently, Voorhoeve and co-workers identified two microRNAs (miRNA), hsa-mir-372 and hsa-mir-373 that are highly expressed in TGCTs and TGCT derived cell lines, and it was reported that these miRNAs suppressed elements of the p53 pathway in TGCT cells. [score:5]
Inhibition of LATS2 expression by hsa-mir-372/373 relieves CDK2 from repression allowing continued cellular proliferation in the presence of activated Ras [36, 50]. [score:5]
Cisplatin -induced down-regulation of DICER1 may repress the oncogenic properties of hsa-mir-372/373. [score:4]
We also identified 40 target genes for two microRNAs, hsa-mir-372 and 373 that may interfere with p53 signaling in TGCTs. [score:3]
* NEO1, LATS2 and ESR1 are the only target genes common for both p53 and hsa- mir-372 and 373. [score:3]
The tumor suppressor genes NEO1 and LATS2, and the estrogen receptor gene ESR1, all have binding sites for p53 and hsa-mir-372/373. [score:3]
From the SAM-identified gene list we found that Neogenin homolog 1 (NEO1), large tumor suppressor homolog 2 (LATS2) and Estrogen receptor 1 (ESR1) were the only genes that have the predicted binding sites for both p53 and hsa-mir-372 and 373. [score:3]
We have identified 29 genes that were predicted target genes for both hsa-mir-372 and 373. [score:3]
The newly discovered microRNAs; hsa-mir-372 and 373, have been reported to be over-expressed in TGCT cells but not in normal testis tissues. [score:3]
As shown in Table 1 and 2, NEO1, LATS2 and ESR1 are the only predicted target gene for both hsa-mir-372 and 373 and p53; the 3' UTR of NEO1, LATS2 and ESR1 have potential hsa-mir-372 and 373 binding sites. [score:3]
[1 to 20 of 16 sentences]
6
[+] score: 53
lncRNA Targets and mechanism of action lncRNA-p21 Inhibition of transcription of target genes involved in apoptosis and cell cycle through hnRNPK; also represses the translation of β-catenin and Jun B mRNA translation through HuR[38, 39, 40] PANDA Interacts with the transcription factor NF-YA to limit expression of proapoptotic genes[41] MEG3 Interacts with p53 to transactive target gene promoters[42, 43, 44, 45, 46] LincRNA-RoR Inhibits translation of p53 mRNA[47, 48] LOC285194 Inhibits function of miR-211[49] MALAT1 Down-regulates p53 and target genes; also up-regulates pro-metastatic genes such as MIA2 and ROBO1[50, 51, 52, 53, 54] p53 -induced eRNAs Promotes p53 target gene transcription[55] H19 Down-regulates RB mRNA translation through miR-675[56] KCNQ1OT1 Inhibits p57 transcription[57, 58, 59, 60, 61, 62, 63] ANRIL Represses the INK4b-ARF-INK4a locus with PRC1/2[64, 65, 66, 67, 68] HULC Sequestration of miR-372, causing derepression of PRKACB; also suppress p18 expression[69, 70]ncRNA [CCNDI] Represses CCND1 transcription with activation of TLS[71] GADD7 Inhibits TDP43 by sequestration of TDP43[72, 73] The p53 pathway is well studied in the context of regulating cell cycle and apoptosis and maintaining genomic integrity. [score:45]
Wang J. Liu X. Wu H. Ni P. Gu Z. Qiao Y. Chen N. Sun F. Fan Q. CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer Nucleic Acids Res. [score:6]
HULC itself is controlled by cAMP signaling as part of an intricate auto-regulatory loop: CREB promotes HULC transcription, HULC in turn acts to “sponge” endogenous miRNAs such as miR-372, causing derepression of PRKACB and increased protein kinase A activity, eventually resulting in increased CREB phosphorylation and activity [70]. [score:2]
[1 to 20 of 3 sentences]
7
[+] score: 31
Co-transfection of miR-371–373 reporters harboring perfectly complementary miRNA binding sites and a miR-371–373 expression construct into miR-290–295 null ES cells resulted in efficient silencing of the miR-371-5p, miR-371-3p, miR-372-3p and miR-373-3p luciferase reporters but not of the reporter constructs carrying miR-372-5p and miR-373-5p target sites (Figure 3D, Figure S3B, Table S1). [score:5]
As with miR-290–295, dilution of the miR-371-373 reporter constructs had no effect on the relative silencing of the reporters confirming that the failure to silence the miR-372-5p and miR-373-5p reporters is not due to excess of the mRNA targets over the hypothetical miRNAs. [score:3]
In this case pre-miR-295 and pre-miR-372 would express the same single 2-7U 7mer seed, which is shared with pre-miR-291a, pre-miR-294 and pre-miR373 and, importantly, is represented in all homologous miR-290–295/miR-371–373 loci. [score:3]
Thus, similarly to its interaction with the mouse miR-291-3p0, miR-294-3p0 and/or miR-295-3p0, the 2-7C-S target appears to interact via G:U wobble base pairing with miR-372-3p0 and/or miR-373-3p0 which also have a 2-7U seed. [score:3]
Thus, we ruled out the possibility that the miR-371-3p reporter is silenced by miR-372-3p or miR-373-3p by documenting its silencing by a single pre-miR-371 expression construct but not by a rescue construct in which pre-miR-371 was deleted (Figure 3E). [score:3]
Such isoforms have identical 6mer 3-7U seeds, but their 7mer seeds are different (3–7A for miR-295-3p+1 and 3-7U for miR-372-3p+1, Figure 1A, Figure S2). [score:1]
Thus, the mouse cluster likely evolved from a three pre-miRNA ancestor via duplication of a module consisting of the promoter proximal and middle pre-miRNAs (pre-miR-371 and pre-miR-372 in human, Figure 6A). [score:1]
In addition, several hairpins yield two miRNA isoforms with alternative 5′-ends represented by similar numbers of reads in the sequencing libraries (Figure 2, pre-miR-292, pre-miR-295, pre-miR-372). [score:1]
- miR-372-3p+1 a These seeds are implied by the sequencing data, but their activity was not confirmed by reporter silencing in this study. [score:1]
The assignment of active miRNAs to the 3p- strands of the pre-miR-372 and pre-miR-373 hairpin stems is consistent with the corresponding strand bias in sequencing data from human ES cells (Compare Figures 2 and 3D). [score:1]
The reporter silencing experiments presented in this study neither confirm nor confidently rule out the existence of the miR-295-3p+1 and miR-372-3p+1 isoforms implied by sequencing as that requires studying the silencing of the corresponding bulge reporters, which we did not pursue. [score:1]
The activities of miR-295-3p+1 and miR-372-3p+1 are unknown (Active?). [score:1]
With the caveat that miR-295-3p+1 and miR-372-3p+1 might perform species specific functions, the remainder of the miR-290-295/miR-371-373 pre-miRNAs appear to be functionally equivalent since they only produce mature 3p0 miRNAs with identical 2-7U seeds. [score:1]
Furthermore, as discussed below, pre-miR-295 and pre-miR-372 do not appear to be bona fide orthologs. [score:1]
The 7mer seed regions that correspond to the putative miR-295-3p+1 and miR-372-3p+1 isoforms are not conserved in the miR-290–295/miR-371-373 cluster family (Figure 1A). [score:1]
Sequencing data suggest that pre-miR-295 and pre-miR-372 might produce additional 3p+1 isoforms (Figure 2). [score:1]
This proposition is supported by the fact that pre-miR-372 and pre-miR-373, but not pre-miR-371 have oncogenic properties in tissue culture mo dels [21]. [score:1]
Note that in this scenario, the putative species-specific miR-295-3p+1 and miR-372-3p+1 isoforms are processed from different paralogous pre-miRNA families. [score:1]
Therefore, pre-miR-291a, pre-miR-291b and pre-miR294 are likely co-orthologs of pre-miR-372 and pre-miR-295 is an ortholog of the promoter distal pre-miR-373. [score:1]
[1 to 20 of 19 sentences]
8
[+] score: 25
Their data elucidated that fine tuning of the expression of the lncRNA HULC is part of an auto-regulatory loop, in which the inhibitory effect of HULC on the expression and activity of miR-372 allows upregulated expression of HULC in liver cancer. [score:13]
Wang et al (51) also demonstrated that the lncRNA HULC may act as an endogenous ‘sponge’, which downregulates miR-372 activity, and inhibition of miR-372 leads to reducing translational repression of its target gene, PRKACB, which in turn induces phosphorylation of CREB and HULC expression. [score:12]
[1 to 20 of 2 sentences]
9
[+] score: 25
In the promoter analyses, miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes showed the effects to increase the expression of proE-cad178-Luc and proE-cad670-Luc (Figure 6B, and D). [score:3]
The mean expression levels of the transcripts that have common seed-complementary sequences, AGCACUU, to dsEcad640 and miR-302/372/373/520 miRNA family members in their 3′UTR were apparently reduced by the transfection with dsEcad640, miR-302a, miR-372, miR-373, and miR-520c duplexes (Figure S1). [score:3]
of a one-sided K-S test for seed -dependent off-target effects is as follows: transcripts with complementary seed sequences of the opposite strand of dsEcad640, P = 0.999; those of miR-302a, P = 0.266; those of miR-372, P = 0.449; those of miR-373, P = 0.953; those of miR-520c, P = 0.031; those of miR-520f, P = 0.998. [score:3]
of a one-sided K-S test for seed -dependent off-target effects are as follows: transcripts with seed-complementary sequences of dsEcad640, P≤10 [−59]; those of miR-302a, P≤10 [−45]; those of miR-372, P≤10 [−20]; those of miR-373, P≤10 [−39]; those of miR-520c, P≤10 [−40]; those of miR-520f using common seed sequence, P≤10 [−14]; miR-520f using own seed sequence, P≤10 [−57]. [score:3]
To assess the parallel genome-wide regulation by dsEcad640 and the members of miR-302/372/373/520 family, microarray analyses were performed using PC-3 cells transfected with each of the miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes, as well as with dsEcad640 at 24 hour. [score:2]
The transcripts of ZEB1, MED8, MTPN, LATS2, and RAB31 possess seed-complementarities to either of dsEcad640, miR-302a, miR-372, miR-373, miR-520c, and miR-520f. [score:1]
Microarray profiles of transcripts containing common seed-complementary sequences of dsEcad640 and members of miR-302/372/373/520 family by the transfection of (A) dsEcad640, (B) miR-302a duplex, (C) miR-372 duplex, (D) miR-373 duplex, (E) miR-520c duplex, and (F) miR-520f duplex. [score:1]
The effects of dsEcad215, dsEcad302, dsEcad640, miR-302a, miR-372, miR-373, miR-520c, miR-520f, and siZEB1_CDS were determined using stably transfected cells with each luciferase reporter, and shown as Renilla/firefly. [score:1]
The silencing activities by dsEcad640, miR-302a, miR-372, miR-373, miR-520c, and miR-520f on wild-type pLuc-CDS (WT), pLuc-CDS-m640-1, -2, and -1+2 are shown as Renilla/firefly. [score:1]
The opposite strand miRNAs of miR-372 and miR-520f are not annotated. [score:1]
The seed sequences of dsEcad640 sense strand, miR-302*, the opposite strand of miR-372, miR-373*, miR-520c-5p, and the opposite strand of miR-520f, are different (Figure 1B). [score:1]
MiR-302a, miR-372, miR-373, miR-520c, miR-520f miRNA duplexes were synthesized to form the same sequences and structures described in miRBase [51]. [score:1]
Microarray profiles of transcripts containing variable seed-complementary sequences of the opposite strands in their 3′UTRs by the transfection of (A) dsEcad640, (B) miR-302a duplex, (C) miR-372 duplex, (D) miR-373 duplex, (E) miR-520c duplex, and (F) miR-520f duplex. [score:1]
The seed sequence of dsEcad640 antisense strand (AAGUGCU) is same as those of the miR-302/372/373/520 miRNA family members, miR-302a, miR-372, miR-373, miR-520a-3p, and miR-520f, although the seed sequence of miR-520f is shifted by 1 nt to 1–7 nt from 2–8 nt (Figure 1B). [score:1]
Chemically synthesized dsEcad640, miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes were transfected into PC-3 cells. [score:1]
Then, the effects on ZEB1 CDS were determined by the transfection of miR-302a, miR-372, miR-373, miR-520c, and miR-520f duplexes along with pLuc-CDS and pGL3-Control into PC-3 cells (Figure 1). [score:1]
[1 to 20 of 16 sentences]
10
[+] score: 24
Nuclear run on assay showed that excessive CUDR enhanced and CUDR knockdown inhibited the expression of miR21, miR155, miR17, miR675, miR372, miR192 (Figure S5B). [score:5]
3) CUDR overexpression enhanced the expression of miR21, miR155, miR17, miR675, miR372, miR192; 4) CUDR enhanced the loading of pStat3 on the promoter region of CUDR, HOTAIR, MALAT1, HULC, H19. [score:5]
As shown in Figs 6a and S5A, excessive CUDR enhanced and CUDR knockdown inhibited the loading of pStat3 on the promoter region of miR21, miR155, miR17, miR675, miR372, miR192. [score:4]
2) CUDR overexpression increased the miR21, miR155, miR17, miR675, miR372, miR192 promoter luciferase activity. [score:3]
To elucidate whether CUDR alters the expression of microRNAs and lncRNAs through pStat3 under the inflammatory condition, we first performed with anti-pStat3 followed by PCR with miR21, miR155, miR17, miR675, miR372, miR192 promoter primers in IL6 treated hepatocyte-like cells transfected with pCMV6-A-GFP, pCMV6-A-GFP-CUDR, pGFP-V-RS, pGFP-V-RS-CUDR. [score:2]
Excessive CUDR increased and CUDR knockdown decreased the miR21, miR155, miR17, miR675, miR372, miR192 promoter luciferase activity (Fig. 6b). [score:2]
Importantly, the phosphorylated Stat3 loads onto the promoter region of miR21, miR155, miR17, miR675, miR372, miR192, CUDR, HOTAIR, MALAT1, HULC, H19, as well as excessive CUDR and IL6 increases DNA methylation of MEG3, TERRA promoter region. [score:1]
The conclusion is supported by results from nine parallel sets of experiments: 1) CUDR enhanced the loading of pStat3 on the promoter region of miR21, miR155, miR17, miR675, miR372, miR192. [score:1]
That phosphorylated Stat3 loads onto the promoter region of miR21, miR155, miR17, miR675, miR372, miR192, CUDR, HOTAIR, MALAT1, HULC, H19 enhances these noncoding RNAs outcome. [score:1]
[1 to 20 of 9 sentences]
11
[+] score: 23
Previously, it was observed that miR-372 and miR-373 act as oncogenes in the tumorigenesis of human testicular germ cell tumors (Tera-1 and 833KE cells), through the direct inhibition of LATS2 expression (11). [score:6]
The expression of miR-372 or miR-373 suppressed the firefly luciferase activities of the MRE-containing 3′UTR of TNFAIP1 (Fig. 2B). [score:5]
These findings are in agreement with a previous study demonstrating that miR-372 targets TNFAIP1. [score:3]
The predicted MRE, wild-type 3′UTR of TNFAIP1, was cloned downstream of the firefly luciferase of the pmirGLO vector and co -transfected with miR-372 or miR-373 mimics (double-stranded processed miRNA) into HEK293 cells, which do not express miR-372 or miR-373. [score:3]
sT, and identified that miR-372 expression was markedly elevated in the AGS cells. [score:3]
Moreover, we previously reported that miR-372 maintains oncogene characteristics by targeting tumor necrosis factor, α -induced protein 1 (TNFAIP1), and that it regulates AGS cell growth (13). [score:2]
The present study validated whether the predicted MRE could be recognized by the miR-372/miR-373 family using the dual-luciferase vector pmirGLO. [score:1]
[1 to 20 of 7 sentences]
12
[+] score: 21
The numerical in brackets shows the ranking of each pathway Table 3 Common validated target genes shared between the C19MC-AAGUGC-miRNAs and the miR-302/-372 families AAGUGC-miRNASeed position [a] Target transcript miR-302/-372 C19MC miR-302c miR-520e I NIK[10, 15] miR-373 miR-520c I MT1-MMP, mTOR, SIRT1[14, 21] miR-372, -373 miR-520c, -520e I RelA[12] miR-302b, -372, -373 miR-520c, -520e I TGFβR2[9, 12] miR-520b, -520e I CD46[16] miR-302c miR-520c I MICA, MICB, ULBP2[17] miR-519a I RBL2[13] miR-512 IIa miR-519d, -520g IIb SMAD7[19, 20] miR-520g, -520h IIb DAPK2[18, 22] miR-302d, -372 miR-520b, -519b-3p, -520a-3p I CDKN1A[5, 6] miR-519e IIa miR-519d, -520h IIb [a]Group I seed position is the canonical nts 2-7; IIa is nts 1-6 and IIb is other non-canonical position, as defined in Fig.   2a The 2058 putative target genes were further subjected to GO analysis and KEGG pathway annotation (Fig.   3b-d). [score:7]
The numerical in brackets shows the ranking of each pathway Table 3 Common validated target genes shared between the C19MC-AAGUGC-miRNAs and the miR-302/-372 families AAGUGC-miRNASeed position [a] Target transcript miR-302/-372 C19MC miR-302c miR-520e I NIK[10, 15] miR-373 miR-520c I MT1-MMP, mTOR, SIRT1[14, 21] miR-372, -373 miR-520c, -520e I RelA[12] miR-302b, -372, -373 miR-520c, -520e I TGFβR2[9, 12] miR-520b, -520e I CD46[16] miR-302c miR-520c I MICA, MICB, ULBP2[17] miR-519a I RBL2[13] miR-512 IIa miR-519d, -520g IIb SMAD7[19, 20] miR-520g, -520h IIb DAPK2[18, 22] miR-302d, -372 miR-520b, -519b-3p, -520a-3p I CDKN1A[5, 6] miR-519e IIa miR-519d, -520h IIb [a]Group I seed position is the canonical nts 2-7; IIa is nts 1-6 and IIb is other non-canonical position, as defined in Fig.   2a The 2058 putative target genes were further subjected to GO analysis and KEGG pathway annotation (Fig.   3b-d). [score:7]
The miR-372 family that lies adjacent to the C19MC cluster (Fig.   1a) was also included in the analysis since they have been reported to be expressed in pluripotent stem cells [9]. [score:3]
a A scheme displaying relative genomic locations of the C19MC and the miR-372 family miRNAs on human chromosome 19q13.41. [score:1]
a The sixteen C19MC miRNAs that share the AAGUGC hexameric seed sequence (in bold letters and boxed in red) with the miR-302 (in blue letters) and miR-372 (in green letters) families are shown. [score:1]
Moreover, the identification of sixteen miR-302-like C19MC miRNAs predicts functions in promoting “stemness” as the miR-302 and miR-372 families. [score:1]
On sequence alignment, sixteen C19MC miRNAs were found to share the same seed sequence, 5’-AAGUGC-3’, with the reported reprogramming-able miR-302 and miR-372 miRNA families [8, 9] (Fig.   2a). [score:1]
[1 to 20 of 7 sentences]
13
[+] score: 21
One is the mir-371,2,3 cluster, consisting of differentially down-regulated miR-372, miR-373 and up-regulated miR-371-5p in patients with NOA; the other cluster, of 13 differentially down-regulated miRNAs (See additional file 3: Table S3 for Several differentially expressed miRNA clusters in NOA patients. [score:12]
Therefore, mir-17-92 cluster and miR-372/miR-373 may down-regulate apoptosis genes and potentially have a role in inhibiting apoptosis. [score:6]
The expression of miR-372 and miR-373 permits proliferation and tumorigenesis of primary human cells by harboring both oncogenic RAS and active wild-type p53 [27]. [score:3]
[1 to 20 of 3 sentences]
14
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-221
Five days after infection, cells expressing let-7a were significantly less numerous than cells expressing empty vector, while cells expressing miR-372 were significantly more numerous (left panel, * indicates p < 10 [-4 ]in a two-tailed t-test). [score:7]
As the goal of the library is to identify biologically relevant functions of miRNAs, we performed a proof-of-principle experiment by testing the well-documented effects of let-7a [49- 51] as an inhibitor of cell proliferation and miR-372 [38] as a stimulator in five cell lines. [score:3]
Expression of let-7a and miR-372 was measured 5, 9 and 20 days after infection. [score:1]
A375 cells were infected with either let-7a or miR-372-encoding virus and expression was measured by miRNA qPCR. [score:1]
The green dots represent let-7a-1, -2, and -3, while the red dot represents miR-372. [score:1]
72 hours after infection with let-7a or miR-372, we passaged A375 cells and cultured them either with or without puromycin selection. [score:1]
While let-7a is abundant in these cells, miR-372 is barely detectable (Figure 3). [score:1]
Although we did not find any novel effects of the miRNAs on nuclear shape, we were able to confirm the expected effects of let-7a and miR-372 on proliferation in a high-content setup. [score:1]
We have tested this extensively for let-7a and miR-372 in A375 cells. [score:1]
We tested whether we could detect proliferation effects in A375 cells in a 96-well setup, again using let-7a and miR-372 as test miRNAs. [score:1]
Five different cell lines were infected with either empty vector miR-372, or let-7a. [score:1]
[1 to 20 of 11 sentences]
15
[+] score: 17
Inhibition of miR-372 leads to reducing translational repression of its target gene, PRKACB. [score:7]
Wang J. Liu X. Wu H. Ni P. Gu Z. Qiao Y. Chen N. Sun F. Fan Q. CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer Nucleic Acids Res. [score:6]
It is also reported that HULC may act as an endogenous sponge capable of downregulating several miRs, including miR-372 (Table 1 and Figure 1). [score:4]
[1 to 20 of 3 sentences]
16
[+] score: 17
Among 20 expressed miRNAs, the expression levels of hsa-mir-25, hsa-mir-221, hsa-mir-302b, hsa-mir-363, hsa-mir-372, hsa-mir-199a, hsa-mir-302d, hsa-mir-26a, hsa-mir-320, hsa-mir-744, hsa-mir-152 and hsa-let-7e in the study of Morin et al. exceed those obtained with miRExpress, but the levels of hsa-mir-423, hsa-let-7a, hsa-mir-1, hsa-mir-340, hsa-mir-302a, hsa-mir-130a, hsa-let-7f and hsa-mir-122 in the work by Morin et al. are lower than those obtained from miRExpress (Table 6) (full data are available in additional file 7). [score:9]
For example, in detecting hsa-mir-372 expression levels, Morin et al. trimmed reads at 30 nt and aligned them with the human genome. [score:3]
Accordingly, the detected expression level of hsa-mir-372 differs between the two methods. [score:3]
For instance, the read sequence "AAAGTGCTGCGACATTTGAGCGTGCGTGTG" has the same sequence from bases 1 to 23 as that of mir-372, but bases 24~30 of its sequence "GCGTGCG" do not constitute a part of the adaptor sequence "TCGTATGCCGTCTTCTGCTTG". [score:1]
The 1~23 bases of some reads were mapped to the hsa-mir-372 chromosome location. [score:1]
[1 to 20 of 5 sentences]
17
[+] score: 17
While oncogenic stress leads to activation of P53 and induction of P21, which results in cell cycle arrest and senescence, the introduction of miR-372 or miR-373 prevents the inhibition of CDK by targeting tumor suppressor LATS2 directly, thereby permitting proliferation and tumorigenesis of transformed cells [7]. [score:8]
In cell lines originating from TGCTs, four out of seven expressed the miR-371-3 cluster, while in primary TGCTs tissue, most seminomas (28/32) and two thirds (14/21) of nonseminomas expressed miR-372/373. [score:5]
To identify miRNAs which cooperate with oncogenic RAS to overcome oncogene induced senescence, Voorhoeve et al. [7] developed a library of vectors expressing the majority of cloned human miRNAs, and identified miR-372 as well as miR-373 as an oncogene for the first time. [score:3]
It belongs to miR-371-3 gene cluster that is transcribed into polycistronic primary transcript pri-miR-371-3. The pri-miR-371-3 is then processed into 3 pre-miRNAs (pre-miR371, pre-miR-372 and pre-miR-373), giving rise to four mature miRNAs (miR-371, miR-372, miR-373 and miR-373*) [6, 7]. [score:1]
[1 to 20 of 4 sentences]
18
[+] score: 16
More specifically, experimentally has been shown, the suppression of RAS oncogene by let-7 [40]; the suppression of BCL-2 by miR-15a and miR-1 [51]; the regulation of transcription factor E2F1 activity by miR-17-5p and miR-20 [52]; the downregulation of the KIT oncogene by miR-221 and miR-222 [53], the inhibition of the expression of tumour-supressor LATS2 and the influence on p53 pathway by miR-372 and miR-373 [54], and finally, the downregulation of the proto-oncogene BCL6 by miR-127 [55]. [score:16]
[1 to 20 of 1 sentences]
19
[+] score: 14
13, 28 An example of this type of regulation is exemplified by HULC, an lncRNA highly upregulated in liver cancer, whose upregulated expression is in part to its inhibitory effects on the expression and activity of miRNA-372 (Wang et al. [29]). [score:14]
[1 to 20 of 1 sentences]
20
[+] score: 14
miRNAs expressed at high levels in hES cells and downregulated during differentiation or in adult cells included the well-known miR-302 family, miR-200 family, and miR-372. [score:6]
Our results also confirmed other miRNAs that are upregulated in hES cells such as miR-299-3p, miR-369-3p, miR-96 and miR-372[16, 17, 24, 25]. [score:4]
However, miR-371, which is located in the same cluster with miR-372, was not discovered to be upregulated in hES cells by our results. [score:4]
[1 to 20 of 3 sentences]
21
[+] score: 14
mir372 is downregulated and targets CDK2 and Cyclin A1 in cervical cancer [152]. [score:6]
Tian R. Q. Wang X. H. Hou L. J. Jia W. H. Yang Q. Li Y. X. Liu M. Li X. Tang H. MicroRNA-372 is down-regulated and targets cyclin -dependent kinase 2 (CDK2) and cyclin a1 in human cervical cancer, which may contribute to tumorigenesisJ. [score:5]
Moreover, a number of microRNAs, including miR-9, miR-21, miR-143, miR-203, and miR-372, among others, have been implicated in different aspects of cervical carcinogenesis, with the expression of some microRNAs increased (miR-21, miR-143, miR-9) and others decreased (miR-34a, miR-203, miR-372) [55, 149, 150, 151, 152, 153, 154]. [score:3]
[1 to 20 of 3 sentences]
22
[+] score: 13
Epigenetic modification Cell lines or biological samples (location) Assessment/modification Identified gene targets Dose (range) DNA methylationBlood (San Francisco, USA, n = 58) Targeted/hypermethylation GSTM1 Blood Hg: 2.9 μg/LHanna et al., 2012 DNA methylationBuccal mucosa samples (Michigan, USA, n = 131) Targeted/hypomethylation SEPP1 Hair Hg: 0.31–0.44 (μg/g)Goodrich et al., 2013 Urine Hg: 0.60–0.83 (μg/L) mi -RNA NT2 (carcinoma pluripotent stem cells) Genome-wide/ – 400 nM MeHgCl for 2–36 dPallocca et al., 2013 ↑ miR-302b ↑ miR-367 ↑ miR-372 miR-196b miR-141↑, increased; ↓, decreased; [*], functionally validated at the expression level; –, not functionally validated at the expression level; Global refers to global methylation patterns; Genome-wide refers to high throughput gene-specific assays; DMGs, differentially methylated genes. [score:10]
In carcinoma pluripotent stem cells, exposure to methyl mercury chloride (MeHgCl) was associated with increased expression of miR-302b, miR-367, miR-372, miR-196b, and miR-141 (Pallocca et al., 2013). [score:3]
[1 to 20 of 2 sentences]
23
[+] score: 13
DND1 has also been shown to inhibit miR-372 from the 3′-UTRs of LATS2 (serine/threonine-protein kinase, large tumor suppressor, homolog 2) and inhibit miR-1 and miR-206 from the 3′-UTRs of CX43 (connexin-43) [4]. [score:7]
APOBEC3G had a similar effect of blocking DND1 function to restore miR-206 inhibition from CX43 (connexin-43; pGL3 Cx43 3′UTR) (P = 0.02) and to restore miR-372 inhibition from the 3′-UTR of LATS2 (pGL3 3′UTR LATS2) (P = 0.001) (Figure  1d and 1e). [score:5]
Similar transfections also tested the effect of DND1, APOBEC3G and miR-372 (mirVec-372) on pGL3 3′UTR LATS2, and miR-206 (miR vec-206) on pGL3 Cx43 3′UTR and pGL3-control vector. [score:1]
[1 to 20 of 3 sentences]
24
[+] score: 13
Some of the upregulated miRNAs included, miR-499, miR-372, miR-18a, miR-21 and miR-30d, while let-7c and miR-198 were downregulated. [score:7]
In line with previous reports of head and neck cancer [10, 11, 26– 34] miR-499, miR-372, miR-18a and miR-21 were upregulated in our series. [score:4]
html) for the first 789 bp 3’UTR of PDCD4 MicroRNA Fold change miR-372 4.82 miR-499 2.89 miR-18a 2.82 miR-200c 2.69 miR-130a 2.59 miR-21 2.29 miR-30d 2.21 miR-409-5p 2.14 miR-20a 2.12 let-7c 0.45 miR-198 0.40 The array data were then confirmed by QRT-PCR of 4 representative miRNAs using ten tumour and adjacent normal samples. [score:1]
b Validation of miR-372, miR-499, miR-21 and let7c in the Australian patient cohort (n = 10). [score:1]
[1 to 20 of 4 sentences]
25
[+] score: 13
Type of cells Processes involved Non-coding RNA Reference hESC Pluripotency, self-renewal, cell cycle and fate specification miR-302 Suh et al. (2004), Bar et al. (2008), Lipchina et al. (2011) hESC Inhibition of pluripotency miR-145 Xu et al. (2009) iPSC Pluripotency miR-17, miR-106b, and miR-106a Li et al. (2011) Fibroblasts to iPSC Reprogramming miR-302, miR-372 Anokye-Danso et al. (2011), 2012, Subramanyam et al. (2011) Fibroblasts to iPSC Reprogramming Combination of miR-302, miR-200c, and miR-369 Miyoshi et al. (2011) iPSC Reprogramming LincRNAs Loewer et al. (2010) hESC Neural differentiation LincRNAs Ng et al. (2012) iPS-derived neural progenitors Neural differentiation LincRNAs Lin et al. (2011) hESC Differentiation to neuroectoderm miR-200, miR-96 Du et al. (2013) hESC-derived neural stem cells Suppression of selfrenewal, neural differentiation miR-124, miR-125b and miR-9/9 Roese-Koerner et al. (2013) hESC Neural differentiation miR7 Liu et al. (2012) hESC Neural differentiation miR125 Boissart et al. (2012) hESC, human embryonic stem cells; iPSC, induced pluripotent stem cells. [score:5]
Several miRNA, especially miR-302 and miR-372 have been directly involved in enhancing of HFF reprogramming (Subramanyam et al., 2011) revealing the possibility to directly target these miRNAs to reprogram the HFF without Yamanaka factors. [score:5]
Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells. [score:3]
[1 to 20 of 3 sentences]
26
[+] score: 12
Agami and colleagues were able to show that miR-372 and miR-373 neutralize p53 -mediated CDK inhibition, possibly through direct inhibition of the expression of the tumor-suppressor LATS2. [score:10]
miR-372 and miR-373 can Substitute for Loss of Wild Type (WT) p53. [score:1]
Two miRNAs in this cluster, miR-372 and miR-373 induced cell transformation with oncogenic RAS and WT p53. [score:1]
[1 to 20 of 3 sentences]
27
[+] score: 12
Up-regulated HULC may act as miRNA sponge and down-regulate miR-372, an important miRNA in liver cancer. [score:7]
Wang J. Liu X. Wu H. Ni P. Gu Z. Qiao Y. Chen N. Sun F. Fan Q. Creb up-regulates long non-coding RNA, hulc expression through interaction with microrna-372 in liver cancer Nucleic Acids Res. [score:5]
[1 to 20 of 2 sentences]
28
[+] score: 11
92) 43 hsa-mir-302a dbDEMC 19 hsa-let-7g dbDEMC, miR2Disease 44 hsa-mir-212 literature 20 hsa-let-7b dbDEMC, HMDD, miR2Disease 45 hsa-mir-372 dbDEMC 21 hsa-mir-150 dbDEMC, literature 46 hsa-mir-197 dbDEMC 22 hsa-mir-338 dbDEMC 47 hsa-mir-124 literature 23 hsa-mir-103 dbDEMC, miR2Disease 48 hsa-mir-378 HMDD 24 hsa-mir-15b dbDEMC, HMDD 49 hsa-mir-26b dbDEMC, miR2Disease 25 hsa-mir-31 dbDEMC, HMDD, miR2Disease 50 hsa-mir-542 higher RWRMDA (No. [score:11]
[1 to 20 of 1 sentences]
29
[+] score: 11
Several studies proved that down-regulated expression of miR-221, miR-137, miR-372, miR-182*, let-7 and miR-34a is associated with shorter survival in patients with lung cancer [41- 43]. [score:6]
The HULC RNA appeared to function as a ‘molecular decoy’ or ‘miRNA sponge’ sequestering miR-372, of which one function is the translational repression of PRKACB, a kinase targeting cAMP response element binding protein (CREB). [score:5]
[1 to 20 of 2 sentences]
30
[+] score: 11
According to the online database for miRNA target prediction and functional annotations, miRDB [61, 62] the number of predicted targets for miRNAs in the miR-371–373 and miR-302 families range from 469 to 529; interestingly, LATS2 is one of the highest ranking targets on the list for all miR-302 family members as well as miR-372 and miR-373 (Target Score > 98) [62]. [score:9]
Functional studies have demonstrated that miRNA-372 and miRNA-373 act as oncogenes in TGCT through interactions with the p53 pathway, in particular through regulation of LATS2 [32]. [score:2]
[1 to 20 of 2 sentences]
31
[+] score: 10
The reduction of miR-372 expression leads to increased expression of its target PRKACB, which in turn induces CREB phosphorylation. [score:7]
HULC has been demonstrated to act as a microRNA (miRNA) sponge that binds to and reduces the expression of a number of miRNAs, including miR-372. [score:3]
[1 to 20 of 2 sentences]
32
[+] score: 10
miR-372 and miR-373 can also promote the proliferation and tumorigenesis of primary human cells by neutralizing p53 -mediated CDK inhibition, which possibly through the direct inhibition of tumor-suppressor LATS2’s expression [14]. [score:10]
[1 to 20 of 1 sentences]
33
[+] score: 10
For example, lncRNA HULC is upregulated in liver cancer, and HULC overexpression can promote tumor progression in part through its inhibitory effects on the expression and activity of miR-372. [score:10]
[1 to 20 of 1 sentences]
34
[+] score: 10
miR-372, miR-21, mIR-10b, and miR-17 were intermediately expressed and 10 other miRNAs (miR-215, -34a, -124, -125b, -128, -137, -218, -326, -184, and -152) were lowly expressed in our cohort. [score:5]
miR-372, miR-21, mIR10b, and miR-17 were intermediately expressed, and 10 other miRNAs were expressed at a lower level (Fig. 1). [score:5]
[1 to 20 of 2 sentences]
35
[+] score: 9
Expression of miR-520c, miR-371-3p, miR-372 and miR-373 in cell lines and primary tumors. [score:3]
We then quantified the expression of miR-371-3p, miR-372, and miR-373 in the cell lines where comparable results were obtained (Figure 3d). [score:3]
All tumors with 19q13 rearrangements were shown to express significantly higher levels of miR-371-3p, miR-372, and miR-373 than three samples of surrounding histologically normal thyroid tissue (p≤0.02236) and the five cytogenetically normal adenomas (p≤0.01428) (Figure 3c). [score:3]
[1 to 20 of 3 sentences]
36
[+] score: 9
The lncRNA hepatocellular carcinoma upregulated long non-coding RNA (HULC) acts as an endogenous miRNA sponge for miR-372 and downregulates its target gene protein kinase cAMP-activated catalytic subunit beta (PRKACB) [4, 65]. [score:9]
[1 to 20 of 1 sentences]
37
[+] score: 9
Such conservation has been observed between two miRNA -targeting sequences for miR-221/222 and miR-372 in the 3'-UTRs of mRNAs coding for the tumour suppressors cyclin -dependent kinase inhibitor 1B (CDKN1B, also known as p27) and large tumour suppressor kinase 2 (LATS2), respectively (Figure 1a (i)). [score:9]
[1 to 20 of 1 sentences]
38
[+] score: 9
lncRNA acting as ceRNA Competing protein coding gene Shared miRNA ceRNA score Reference HULC (Highly Upregulated in Liver Cancer) PRKACB miR-372 0.026 (p-value = 0.001) [20] lincRNA MD1 MAML1 miR-133 0.022 (p-value = 0.02) [21] H19 Targets of hsa-let-7 Let-7 - [22] Linc-RoR (Regulator of Reprogramming) SOX2 and NANOG miR-145 0.038 (p-value = 0.008) [36] PTCSC3 Targets of miR-574-5p in thyroid cancer cell line miR-574-5p - [37] Users can browse for ceRNA candidates for a protein coding gene (by gene symbol, gene id or refseq accession) and/or lncRNA gene (by gene name, ensemble gene id or ensemble transcript id) and/or miRNA name. [score:9]
[1 to 20 of 1 sentences]
39
[+] score: 9
Other miRNAs from this paper: hsa-mir-196a-1, hsa-mir-196a-2
CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer. [score:6]
Several ceRNAs such HULC in liver cancer cells sequester miR-372 (Wang et al., 2010) and PTENP1 sequesters PTEN -targeting miRNAs through similarities in miRNA binding sites in prostate cancer cells (Poliseno et al., 2010). [score:3]
[1 to 20 of 2 sentences]
40
[+] score: 8
A recent report showed that highly up-regulated liver cancer (HULC) might act as an endogenous ‘sponge’ of miR-372, which results in reducing translational repression of its target gene [39]. [score:8]
[1 to 20 of 1 sentences]
41
[+] score: 8
miR-372 and miR-373 are specifically expressed in placenta, while miR-206 is specifically expressed in skeletal muscle. [score:5]
However, there are a few outliers; miR-372, miR-373, and miR-206 that are associated with 5, 4, and 4 diseases, whereas they show high tissue specificity index values of 0.86, 0.82, and 0.78, respectively. [score:3]
[1 to 20 of 2 sentences]
42
[+] score: 8
Voorhoeve et al. carried out studies on the expression of miR-371-3 cluster in testicular GCTs and they found that miR-372 and miR-373 were overexpressed: in particular they showed that miR-372 and miR-373, together with RAS, induced neoplastic transformation in presence of wild-type p53 [65]. [score:5]
Syring et al. demonstrated that serum miRNAs can be used as novel and more sensitive and specific biomarkers in TC; in fact, they detected high levels of miR-371a-3p, miR-372-3p, miR-373-3p and miR 367-3p in patients with locally advanced disease [88]. [score:3]
[1 to 20 of 2 sentences]
43
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-28, hsa-mir-29a, hsa-mir-93, hsa-mir-100, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-34a, hsa-mir-181c, hsa-mir-182, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-217, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-134, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-106b, hsa-mir-29c, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-382, hsa-mir-148b, hsa-mir-196b, hsa-mir-424, hsa-mir-448, hsa-mir-449a, hsa-mir-483, hsa-mir-491, hsa-mir-501, hsa-mir-503, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320c-1, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320c-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
miR-501 which targets HBx interacting protein (HBxIP) and miR-372/373 which targets nuclear factor I B (NF-IB) of the host to promote viral replication are upregulated by HBV [70, 71]. [score:8]
[1 to 20 of 1 sentences]
44
[+] score: 8
A similar consideration can be made for miR-372 (up-regulated in oocytes) and miR-371 (O-miRNA). [score:4]
In contrast, 11 miRNAs (miR-9-5p, miR-184, miR-328-3p, miR-363-3p, miR-372-3p, miR-518d-3p, miR-518f-3p miR-523-3p, miR-618, miR-625-5p, and miR-628-5p) were significantly up-regulated in human oocytes (with respect to FF) (Figure 3B and Supplementary Table S1). [score:4]
[1 to 20 of 2 sentences]
45
[+] score: 8
Several recent studies suggest that miR-15b, miR-16, miR-21, miR-221, miR-222, miR-372, miR-373, miR-92a and miR-182 can regulate the expression level of RECK by targeting its conserved sequences of 3’-UTRs in different diseases [25– 27]. [score:8]
[1 to 20 of 1 sentences]
46
[+] score: 7
Another RNA binding protein Dnd1 was shown to protect miR-430 targeted mRNAs in zebrafish primordial cells and miR-372 targeted mRNAs in human cells derived from germ line through binding to U-rich regions (URR) located in the miRNA targeted mRNA regions [7]. [score:7]
[1 to 20 of 1 sentences]
47
[+] score: 7
The down-regulated miRNAs were highly enriched for LCL specific miRNAs (miR-155, let-7a-i, miR-21, miR-142, miR103, miR-320, miR-146a-b) and the up-regulated miRNAs were highly enriched for iPSC specific miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, miR-18a). [score:7]
[1 to 20 of 1 sentences]
48
[+] score: 7
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-105-1, hsa-mir-105-2, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-205, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-141, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-188, hsa-mir-320a, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-302a, hsa-mir-34c, hsa-mir-30e, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-383, hsa-mir-339, hsa-mir-133b, hsa-mir-345, hsa-mir-425, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-193b, hsa-mir-181d, hsa-mir-498, hsa-mir-518f, hsa-mir-518b, hsa-mir-520c, hsa-mir-518c, hsa-mir-518e, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-503, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-376a-2, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-645, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-744, hsa-mir-548e, hsa-mir-548j, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-302e, hsa-mir-302f, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-378b, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-320e, hsa-mir-548x, hsa-mir-378c, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-378f, hsa-mir-378g, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-378h, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-378i, hsa-mir-548am, hsa-mir-548an, hsa-mir-371b, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-378j, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
The most highly expressed miRNA in euploid embryos was miR-372, as revealed by an array -based quantitative real-time polymerase chain reaction (qPCR). [score:3]
Two miRNAs, miR-191 and miR-372, were expressed specifically in spent media after embryo culture. [score:3]
Interestingly, miRNAs were related to some bad condition: miR-191 was more highly concentrated in media from aneuploid embryos, and miR-191, miR-372, and miR-645 were more highly concentrated in media from failed in vitro fertilization cycles without pregnancy (Figure 4). [score:1]
[1 to 20 of 3 sentences]
49
[+] score: 7
They included known oncogenic miRNAs such as miR-372 (cell viability, 187%) and miR-373 (165%), and tumor suppressive miRNAs such as miR-124a (28.3%), miR-7 (37.1%), miR-192 (36.6%) and miR-193a (29.7%) in several different cancer types (18, 25– 27). [score:3]
For example, miR-93/miR-302/miR-372/mir-373 seed family miRNAs (miR-93, miR-302b, miR-302d, miR-372, miR-373) were pro-proliferative, while miR-193 seed family miRNAs (miR-193a, miR-193b) were anti-proliferative (Table I). [score:1]
We discovered pro-proliferative miRNAs (miR-9 [*], miR-93, miR-130a, miR-130b, miR-301, miR-302b, miR-302d, miR-363, miR-372, miR-373), and anti-proliferative miRNAs (miR-7, miR-124a, miR-192, miR-193a, miR-193b, miR-199a [*], miR-432 [*], miR-497, miR-506, miR-517c) in A2780 cells. [score:1]
By the same miRNA mimics library screening, we found that miR-93/miR-372/miR-373 and miR-124a were pro-proliferative and anti-proliferative, respectively, in DLD-1 colorectal cancer cells (23), suggesting consistent roles of these miRNAs on cell proliferation in ovary and colorectal cancer cells. [score:1]
pro-proliferative miR-93, miR-302b, miR-302d, miR-372, miR-373 and anti-proliferative miR-193a, miR-193b), supporting the importance of the seed region of miRNA on its function. [score:1]
[1 to 20 of 5 sentences]
50
[+] score: 7
Further study of malignant GCTs, including TGCTs, across a range of representative ages (paediatric and adult), anatomical sites (gonadal and extragonadal) and histological subtypes (YST, seminoma and EC) confirmed universal over -expression at diagnosis of serum levels of miR-372 and miR-367 (Fig. 3) (Murray & Coleman, 2012). [score:3]
Levels of miR-372 were over 700-fold higher at malignant GCT diagnosis and fell to normal levels during treatment and in uneventful clinical follow-up (Murray et al., 2011). [score:1]
There was a potential association between serum levels of both miR-372 and miR-367 and total tumour volume at diagnosis (Murray & Coleman, 2012). [score:1]
Levels of miR-372 from the miR-371–373 cluster (left) and miR-367 from the miR-302/367 cluster (right) in the serum at the time of diagnosis in eight malignant GCTs of different patient age, anatomical site and histological subtype. [score:1]
Across all the datasets studied, a consistent, highly significant increase in the levels of four microRNAs (miR-371a-3p, miR-372, miR-373 and miR-367) was observed in serum from all patients with malignant GCTs at the time of diagnosis. [score:1]
[1 to 20 of 5 sentences]
51
[+] score: 7
CULB upregulates the CDK2 expression by negatively transcription in miR-372/373, resulting in the positive regulation of CDC6. [score:7]
[1 to 20 of 1 sentences]
52
[+] score: 7
As noted above, the HuH6 EVs carried the most specific miRNA load, missing or carrying at lower concentration some miRNA particularly abundant in the EVs of other cells, but showing several uniquely enriched miRNAs as follows: miR-372-3p; miR-371a-3p; miR-371a-5p; miR-373-3p; miR-34a-3p and miR-122-5p The EV-cargos did show some specificity with the detection of miRNAs expressed at high levels in only one line: miR-16-5p in HuH7-EVs only; miR-18a-5p and miR-20a-5p in Hep3B-EVs only and miR-451a in HepG2-EVs only. [score:3]
As noted above, the HuH6 EVs carried the most specific miRNA load, missing or carrying at lower concentration some miRNA particularly abundant in the EVs of other cells, but showing several uniquely enriched miRNAs as follows: miR-372-3p; miR-371a-3p; miR-371a-5p; miR-373-3p; miR-34a-3p and miR-122-5p The EV-cargos did show some specificity with the detection of miRNAs expressed at high levels in only one line: miR-16-5p in HuH7-EVs only; miR-18a-5p and miR-20a-5p in Hep3B-EVs only and miR-451a in HepG2-EVs only. [score:3]
Only the HuH6-derived EV cargoes contained abundant levels of miR-372-3p, miR-371a-3p, miR-371a-5p and miR-373-3p. [score:1]
[1 to 20 of 3 sentences]
53
[+] score: 6
For example, findings demonstrated an oncogenic role for miR-372 in controlling cell growth, cell cycle and apoptosis through the down-regulation of a tumor suppressor gene, LATS2 [30]. [score:6]
[1 to 20 of 1 sentences]
54
[+] score: 6
CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer. [score:6]
[1 to 20 of 1 sentences]
55
[+] score: 6
An additional layer of complexity arises with the recent discoveries showing that the hESC-specific miRNA signaling network is capable of regulating the progression of hESCs through the cell cycle and maintenance of self-renewal: the levels of WEE1 kinase, which is a target of miR-195, controls the rate of hESC division, whereas the expression of CDKN1A is kept at low levels by miR-372 for hESC division to proceed [79]. [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
Oncogenic miRs are frequently over-expressed in cancer tissues, including miR-21, miR-17-92, miR-155 and miR-372, while miRs such as miR-34 and the let-7 family miR-15a and miR-16-1 are considered as tumor suppressors and their expression is often reduced in cancer tissues [27]. [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
Other miRNAs from this paper: hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-216b
Wang J. Liu X. Wu H. Ni P. Gu Z. Qiao Y. Chen N. Sun F. Fan Q. CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer Nucleic Acids Res. [score:6]
[1 to 20 of 1 sentences]
58
[+] score: 6
HULC binding to miR-372 reduces miRNA -mediated translational repression of protein kinase cAMP-activated catalytic subunit beta (PRKACB), one of the target genes of miR-372 [63]. [score:5]
HULC acts as endogenous sponge of miR-372 [63]. [score:1]
[1 to 20 of 2 sentences]
59
[+] score: 6
For example, miR-372 and -373 promote HBV gene expression through a pathway involving nuclear factor I/B 34, and miR-15b enhances HBV enhancer I activity by targeting hepatocyte nuclear factor 1α, a negative regulator of HBV enhancer I 35. [score:6]
[1 to 20 of 1 sentences]
60
[+] score: 6
CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer. [score:6]
[1 to 20 of 1 sentences]
61
[+] score: 6
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-100, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, mmu-mir-1a-1, mmu-mir-23b, mmu-mir-125b-2, mmu-mir-130a, mmu-mir-9-2, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-184, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-205, mmu-mir-206, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-223, mmu-mir-302a, hsa-mir-1-2, hsa-mir-23b, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-184, hsa-mir-206, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-103-1, mmu-mir-103-2, rno-mir-338, mmu-mir-338, rno-mir-20a, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-107, mmu-mir-17, mmu-mir-100, mmu-mir-181a-1, mmu-mir-214, mmu-mir-219a-1, mmu-mir-223, mmu-mir-199a-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-338, mmu-mir-181b-2, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-16, rno-mir-17-1, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-100, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-125b-1, rno-mir-125b-2, rno-mir-130a, rno-mir-145, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-184, rno-mir-199a, rno-mir-205, rno-mir-206, rno-mir-181a-1, rno-mir-214, rno-mir-219a-1, rno-mir-219a-2, rno-mir-223, hsa-mir-512-1, hsa-mir-512-2, rno-mir-1, mmu-mir-367, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, rno-mir-17-2, hsa-mir-1183, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-103b-1, hsa-mir-103b-2, rno-mir-9b-3, rno-mir-9b-1, rno-mir-9b-2, rno-mir-219b, hsa-mir-23c, hsa-mir-219b, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, mmu-mir-219b, mmu-mir-219c, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
From the top ten downregulated miRNAs at this transition, six miRNAs (miR-367, miR-302a, miR-302c, miR-372, miR-302b, and miR-302d) have been shown to encourage proliferation and are highly expressed in undifferentiated cells and cancer stem cells [43], [44], [45], [46], [47], [48]. [score:6]
[1 to 20 of 1 sentences]
62
[+] score: 6
In fact, as judged by microarray results at 48 h. p. i., miRNA expression was only modestly modulated (less than 3-fold changes), with most of miRNA resulting slightly downregulated (2.2 fold for miR-181d, miR-302c, miR-372, miR-520e and miR-875; 2.4 fold for miR-520d). [score:6]
[1 to 20 of 1 sentences]
63
[+] score: 6
Other miRNAs from this paper: hsa-mir-27b, hsa-mir-126
CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer. [score:6]
[1 to 20 of 1 sentences]
64
[+] score: 6
Other miRNAs from this paper: hsa-mir-196a-1, hsa-mir-196a-2
CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer. [score:6]
[1 to 20 of 1 sentences]
65
[+] score: 6
Wang J CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancerNucleic Acids Res. [score:6]
[1 to 20 of 1 sentences]
66
[+] score: 6
CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancer. [score:6]
[1 to 20 of 1 sentences]
67
[+] score: 6
It contains a polyA tail and a particularly conserved miR-372 target site [49]. [score:3]
binds to miR-372 and acts as a sponge to competitively inhibit miRNA from binding to a sense mRNA transcript. [score:3]
[1 to 20 of 2 sentences]
68
[+] score: 6
Other miRNAs from this paper: hsa-mir-22, hsa-mir-140, hsa-mir-188, hsa-mir-507
Wang J. Liu X. Wu H. Ni P. Gu Z. Qiao Y. Chen N. Sun F. Fan Q. CREB up-regulates long non-coding RNA, HULC expression through interaction with microRNA-372 in liver cancerNucl. [score:6]
[1 to 20 of 1 sentences]
69
[+] score: 6
As described in literature [42], T. Nijjar et al. identified that low expression level of hsa-mir-372 can be associated with recurrence case groups of stage I of non-small cell lung cancer. [score:3]
Among the top 50 prediction list, 47 miRNAs were verified by HMDD, dbDEMC, and miR2Disease; and only hsa-mir-151, hsa-mir-372, and hsa-mir-376b were not confirmed. [score:3]
[1 to 20 of 2 sentences]
70
[+] score: 6
Other miRNAs from this paper: hsa-mir-31, hsa-mir-455, hsa-mir-574
HULC may act as an endogenous “sponge” to downregulate miR-372, thus leading to translational derepression of PRKACB, sequentially inducing phosphorylation of CREB (Wang et al., 2010). [score:6]
[1 to 20 of 1 sentences]
71
[+] score: 6
The genes and miRNAs expected to be enriched in iPSCs/ESCs, from the literature [18, 21, 38– 42], include transcription factors involved in maintaining “stemness” (FOXD3, GATA6, NANOG, NR6A1, POU5F1, SOX2, UTF1, TFCP2L1, and ZFP42), signaling molecules involved in pluripotency and self-renewal (CRABP2, EDNRB, FGF4, FGF5, GABRB3, GAL, GRB7, IFITM1, IL6ST, KIT, LEFTY1, LEFTY2, LIFR, NODAL, NOG, NUMB, PTEN, SFRP2, and TDGF1), cytokines and growth factors (FGF4, FGF5, LEFTY1, LEFTY2, NODAL, and TDGF1), other ESC-specific genes (BRIX1, CD9, DIAPH2, DNMT3B, IFITM2, IGF2BP2, LIN28A, PODXL, REST, SEMA3A, TERT, ESRG, and GJA1), and miRNAs (miR-302a, miR-302c, miR-371a, miR-302b, miR-302d, miR-372, miR-373, miR-92a-1, miR-92a-2, miR-92b, miR-17, miR-20a, and miR-18a) that were highly enriched in genes and miRNAs that were expressed (NRC ≥ 20) in our reprogrammed iPSCs and the majority of them showed significant upregulation (FC ≥ 2.0, FDR ≤ 0.05) during iPSC reprogramming (Figure 4(c)). [score:6]
[1 to 20 of 1 sentences]
72
[+] score: 6
A recent study has reported that a combination of miR-302b and miR-372 downregulates TGFBR2 and RHOC gene expression [19]. [score:6]
[1 to 20 of 1 sentences]
73
[+] score: 6
Recently, we reported that the expression of hES cell-specific miRNAs miR-302 d, miR-372 and miR-367 and miR-200c, as well as miR-199a, were strongly up-regulated by activin A [6]. [score:6]
[1 to 20 of 1 sentences]
74
[+] score: 5
An example for this type of regulation is exemplified by HULC, an lncRNA expressed in hepatocellular carcinoma, which binds miR-372 and forms a regulatory interaction [37]. [score:5]
[1 to 20 of 1 sentences]
75
[+] score: 5
They showed that HULC functions as a miRNA sponge to inhibit the activity of many miRNAs, including hsa-miR-372-5p, resulting in de-repression of its target gene, PRKACB. [score:5]
[1 to 20 of 1 sentences]
76
[+] score: 5
CagA translocation caused a strong inhibition of miRNA-372 and miRNA-373, which both promote cell proliferation by silencing large tumor suppressor homolog 2 (LATS2) (158). [score:5]
[1 to 20 of 1 sentences]
77
[+] score: 5
Other miRNAs from this paper: hsa-mir-155, hsa-mir-770, hsa-mir-675
The HULC RNA appeared to function as a 'molecular decoy' or 'miRNA sponge' sequestering miR-372, of which one function is the translational repression of PRKACB, a kinase targeting cAMP response element binding protein (CREB). [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 5
The oncomiR group is wide, and comprises other microRNAs such as the miR-17-92 cluster, which is crucial for B-cell proliferation and its absence induces an increase of the proapoptotic protein Bim and inhibits the pro-B to pre-B cell development [85]; miR-372/373, which are involved in the development of human testicular germ cell tumors by neutralizing the TP53 pathway [86]; miR-10b, which promotes cell migration and invasion in breast cancer [87]; the polycistron miR-106-25, which acts as an oncogene by interfering with the synthesis of p21 and Bim [88]. [score:5]
[1 to 20 of 1 sentences]
79
[+] score: 5
Colorectal cancer cell lines with KRAS mutations showed an over -expression of miR-9, miR-9*, miR-95, miR-148a, miR-190 and miR-372, in relation to the human normal colon cell line. [score:4]
Moreover, miR-372 has been recently described as potential oncogene that collaborate with oncogenic RAS in cellular transformation [23]. [score:1]
[1 to 20 of 2 sentences]
80
[+] score: 5
In fact, miR-302 and miR-372 have been shown to promote reprogramming, and miR-302 and miR-372 inhibit the TGF-ß -induced epithelial–mesenchymal transition, as does mouse miR-294 [37]. [score:3]
The human miR-371 cluster was predicted to exist based on sequence similarity to members of the mouse miR-290 cluster [36], [37]; indeed, one of the members of the miR-371 cluster, miR-372, is 33 [rd] in the human miRNA list (Fig. 6A). [score:1]
The seed sequence of miR-302 is identical to those of miR-372, miR-373 [39], [40], and some C19MC members. [score:1]
[1 to 20 of 3 sentences]
81
[+] score: 5
Examination of the miRNA expression profiles of HES1 versus HES2 cells (Fig. 1A) revealed miRNAs that were highly expressed in both lines, such as miR-21, miR-372 and members of the cluster 302. [score:5]
[1 to 20 of 1 sentences]
82
[+] score: 5
Wang J. Liu X. Wu H. Ni P. Gu Z. Qiao Y. Chen N. Sun F. Fan Q. Creb up-regulates long non-coding rna, hulc expression through interaction with microrna-372 in liver cancerNucleic Acids Res. [score:5]
[1 to 20 of 1 sentences]
83
[+] score: 5
Consistent with other studies on TGCT [21], [22], miR-372 and miR-373 have been suggested to act as oncogenes, and were found to be up-regulated solely in TGCT as well as the star form miR-373* in our study, further confirming their special roles in TGCT development. [score:5]
[1 to 20 of 1 sentences]
84
[+] score: 4
Importantly, miR-372 negatively regulates the expression of p21 in unstressed hESC which is necessary for unperturbed hESC division to proceed [68]. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
These authors [45] also reported that miRNA-372 and miRNA-373 can neutralize p53 -mediated CDK inhibition and allow the growth of tumor cells. [score:3]
In testicular germ cell tumors the presence of miRNA-372 and miRNA-373 has been reported, whereas a miRNA302 cluster was undetected [45]. [score:1]
[1 to 20 of 2 sentences]
86
[+] score: 4
Other miRNAs from this paper: hsa-mir-21, mmu-mir-21a, mmu-mir-21b, mmu-mir-21c
Recently, Loayza-Puch F et al. reported that hypoxia and Ras-signaling pathways cooperatively down-regulate RECK through miR-372/373 and miR-21 [11]. [score:4]
[1 to 20 of 1 sentences]
87
[+] score: 4
Expression of mature miR-302a-d, miR-372 and miR-373 is suppressed in an endothelial differentiation-specific manner, as compared to time-matched SA461 pluripotent samples. [score:4]
[1 to 20 of 1 sentences]
88
[+] score: 4
Other miRNAs from this paper: hsa-mir-3923
Wang and his colleagues showed that the crosstalk between lncRNA HULC and PRKACB gene via competitive binding to miR-372 in a ceRNA -dependent feed-forward loop resulted in highly up- regulated expression of HULC in liver cancer [13]. [score:4]
[1 to 20 of 1 sentences]
89
[+] score: 4
Other miRNAs from this paper: hsa-mir-21, hsa-mir-145, hsa-mir-127, hsa-mir-155, hsa-mir-661
A few examples include: 1) stimulating apoptosis in cultured glioblastoma cells by deprogramming miR-21 (an oncogenic miRNA) [152, 153], 2) up -regulating miR-372 and 373 in testicular germ cell tumors [99, 154], and 3) over -expressing miR-155 in both breast cancers and B-cell lymphomas [99, 155– 157]. [score:4]
[1 to 20 of 1 sentences]
90
[+] score: 4
It is known that mouse miR-290-295 and its human homologues in the miR-372 clusters are ESC specific and regulate cell cycle progression 20, 21. [score:2]
We also found a homologue of human mir-372 located inside the rat miR-290-295 cluster. [score:1]
miR-372 in humans is known to be connected to fibroblasts reprogramming, particularly by promoting MET [60]. [score:1]
[1 to 20 of 3 sentences]
91
[+] score: 3
For example, small ncRNAs (less than 200 nucleotides), such as the microRNAs (miRNAs), miR-302/367, and miR-372 clusters, repress the expression of differentiation-related genes in hESCs [17]. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
They have identified a panel of nine miRNAs—miR-451, miR-16, miR-135b, miR-10b, miR-124a, miR-372, and miR-412, miR-658, miR-205 (being the last two specific of saliva)—that are differentially expressed to such a degree as to permit the identification of the body fluid origin of forensic biological stains using as little as 50 pg of total RNA. [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
DND1 can also relieve the repression of cyclin -dependent kinase inhibitor 1B (CDKN1B) mediated by miR-221 and the repression of LATS2 by miR-372 in HEK293T cells [10]. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
The luciferase assays demonstrated that miR-137 and miR-133a, rather than miR-126, miR-22, and miR-372 could significantly suppress the luciferase activity in pmirGLO-TINCR (3′-UTR) and miRNAs cotransfected cells (Figure 4). [score:2]
Based on these data and the previous reports about the candidate miRNAs’ function, six cancer-related or tumor-suppressing miRNAs were chosen for further investigation, including miR-198, miR-126, miR-133a, miR-137, miR-22, and miR-372 [18– 23]. [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 3
In contrast, chr9:123671954−123672027:−:ESC was primarily expressed in hESC instead of iPS, as were mir-371-5p, mir-372, and mir-520a. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
Additionally, miR-372 and miR-373 were highly up-regulated in the cerebellar tumors compared with normal cerebellum or whole brain [26]. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
2008.06.008 18774719 6. Subramanyam D Lamouille S Judson RL Liu JY Bucay N Derynck R Blelloch R Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cellsNat Biotechnol. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
Subramanyam D Lamouille S Judson RL Liu JY Bucay N Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cellsNat Biotechnol. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
Subramanyam D. Lamouille S. Judson R. L. Liu J. Y. Bucay N. Derynck R. Blelloch R. Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells Nat. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
At this site it is transactivated by CREB and sequesters miR-372 by acting as a sponge, and IGF2BP are able to govern the expression of HULC [11]. [score:3]
[1 to 20 of 1 sentences]