sort by

692 publications mentioning hsa-mir-200a (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-200a. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 284
TP73-AS1 was inversely correlated with miR-200a, while positively correlated with HMGB1 and RAGE, respectively, which further confirmed that TP73-AS1 targeted miR-200a to inhibit its expression, subsequently upregulated HMGB1/RAGE expression to promote HCC cell proliferation. [score:12]
showed that miR-200a expression was downregulated, while HMGB1 and RAGE expression was upregulated in HCC tissues (Fig.   6a, b and c). [score:11]
showed that TP73-AS1 was upregulated by miR-200a inhibition while downregulated by miR-200a overexpression (Fig.   4b). [score:11]
Moreover, in HCC tissues, miR-200a expression was downregulated, while HMGB1 and RAGE expression was upregulated. [score:11]
Consistently with the NF-кB protein expression change trend, the assays demonstrated that levels of TNF-α, IL-6 andIL-1β were upregulated by miR-200a inhibition, reduced by si-TP73-AS1; the promotive effect of miR-200a inhibitor on the levels of TNF-α, IL-6 andIL-1β could be partially abolished by si-TP73-AS1 (Fig.   5c). [score:9]
Fig. 5TP73-AS1 regulated HMGB1/RAGE expression and NF-κB targets cytokines levels through miR-200a a and b HepG2 and HCCLM3 cell lines were co -transfected with si-TP73-AS1 and miR-200a inhibitor. [score:8]
MiR-200a inhibition could up-regulate HMGB1, RAGE, NF-κB expression as well as NF-κB regulated cytokines levels, which could be partially restored by si-TP73-AS1. [score:8]
Here, we found that miR-200a significantly down-regulated HMGB1 expression in HCC cells, which inspired us to hypothesize miR-200a might play some functional roles in HCC through regulation of HMGB1. [score:7]
b TP73-AS1 expression in response to ectopic miR-200a expression and inhibition in HCCLM3 and HepG2 cells was determined by using real-time PCR. [score:7]
By using online tools, we screened out several candidate upstream miRNAs of HMGB1, among which miR-200a overexpression inhibited HMGB1 mRNA expression the most significantly. [score:7]
In HCC tissues, miR-200a was down-regulated while HMGB1 and RAGE were up-regulated; TP73-AS1 was inversely correlated with miR-200a, while positively correlated with HMGB1 and RAGE, respectively. [score:7]
After miR-200a inhibited, the protein levels of HMGB1, RAGE and NF-κB were significantly upregulated. [score:6]
TP73-AS1 expression in response to miR-200a overexpression and inhibition in HepG2 and HCCLM3 cell lines was determined by using real-time PCR assays. [score:6]
In summary, it was identified that TP73-AS1 could promote HCC cell proliferation through miR-200a -dependent HMGB1/RAGE regulation; TP73-AS1 might compete with HMGB1 for miR-200a binding to inhibit miR-200a expression. [score:6]
When TP73-AS1 was knocked out by si-TP73-AS1 in miR-200a inhibitor -transfected HCC cell lines, the promotive effect of miR-200a inhibitor on the protein levels of HMGB1, RAGE and NF-κB could be partially abolished. [score:6]
TP73-AS1 regulated HMGB1/RAGE expression and NF-кB targets cytokines levels through miR-200a. [score:6]
miR-200a inhibitor was transfected into HepG2 and HCCLM3 cell lines to achieve miR-200a inhibition (Fig.   4a). [score:5]
inhibitor-NC + si-TP73-AS1 group We determined the expression levels of miR-200a, HMGB1 and RAGE in HCC tissues. [score:5]
Luciferase reporter gene vectors (wt-HMGB1 3’UTR, mut-HMGB1 3’UTR containing a 7 bp mutation on miR-200a binding site in the 3’UTR of HMGB1, wt-TP73-AS1, and mut-TP73-AS1 containing a 7 bp mutation on miR-200a binding site1 or site2 in TP73-AS1) were constructed and co -transfected into HepG2 cells with miR-200a mimics or miR-200a inhibitor (Fig.   4d). [score:5]
Fig. 4TP73-AS1 competed with HMGB1 for miR-200a binding a miR-200a inhibitor was transfected into HCCLM3 and HepG2 cells to achieve miR-200a inhibition. [score:5]
A negative correlation between TP73-AS1 and miR-200a expression levels, a positive correlation between TP73-AS1 and HMGB1 levels, and a positive correlation between TP73-AS1 and RAGE expression levels was observed (Fig.   6d, e and f). [score:5]
showed that in both HepG2 and HCCLM3 cell lines, the protein levels of HMGB1, RAGE and NF-кB were increased by miR-200a inhibition, reduced by si-TP73-AS1; the promotive effect of miR-200a inhibitor on the protein levels of HMGB1, RAGE and NF-кB could be partially abolished by si-TP73-AS1 (Fig.   5a and b). [score:5]
To confirm that miR-200a regulated HMGB1 pathway in HCC cell lines, we monitored the protein levels of HMGB1, RAGE and NF-κB in response to the combined effect of miR-200a inhibition and TP73-AS1 knockdown. [score:5]
showed that HMGB1 protein levels were reduced by miR-200a overexpression while increased by miR-200a inhibition (Fig.   3c and d). [score:5]
In this study, we report an interaction between TP73-AS1 and miR-200a which regulates HCC cell growth through directly targeting HMGB1. [score:5]
In neuroblastoma cells, miR-200a inhibits tumor proliferation by targeting AP-2gamma [44]. [score:5]
Additionally, miR-200a has also been shown to directly target the pro-angiogenic ligands IL-8 and chemokine (C-X-C motif) ligand 1 (CXCL1) to regulate angiogenesis in ovarian cancer [25]. [score:5]
Given the consistency of the binding site(s), TP73-AS1 might compete with HMGB1 for miR-200a binding, so that to attenuate the inhibitory effect of miR-200a on HMGB1 expression. [score:5]
Then we validated whether TP73-AS1 regulated HMGB1/RAGE expression through miR-200a. [score:4]
These data indicated that miR-200a could negatively regulate HMGB1 expression in HCC cell lines. [score:4]
g Mechanism diagram of TP73-AS1 modulating HCC cell proliferation through miR-200a -dependent HMGB1/RAGE pathway regulation Initially the expression levels of TP73-AS1 in 84 paired samples (HCC specimens and corresponding adjacent non-tumor tissues) were examined using real-time PCR. [score:4]
MiR-200a suppresses cell growth and migration by targeting MACC1 in hepatocellular carcinoma [43]. [score:4]
After si-TP73-AS1 -induced TP73-AS1 knockdown, miR-200a expression in HepG2 and HCCLM3 cell lines was increased (Fig.   4c). [score:4]
The protein levels of HMGB1 in HepG2 and HCCLM3 cell lines in response to miR-200a overexpression and inhibition were then determined by using assays. [score:4]
c and d The protein levels of HMGB1 in HCCLM3 and HepG2 cells in response to miR-200a overexpression or inhibition were determined by using assays. [score:4]
Among nine promising candidate miRNAs, we focused on miR-200a because of its essential regulator roles in breast cancer, skin tumor and ovarian tumorigenesis through targeting different downstream genes. [score:4]
c miR-200a expression in response to TP73-AS1 knockdown in HCCLM3 and HepG2 cells was determined by using real-time PCR. [score:4]
Fig. 6The correlation of TP73-AS1 with miR-200a, HMGB1 and RAGE in HCC tissues a, b and c The expression levels of miR-200a, HMGB1 mRNA and RAGE mRNA in 84 paired tumor tissues and adjacent normal tissues were determined by using real-time PCR. [score:3]
Expression of miR-200a, HMGB1 and RAGE and the correlation of TP73-AS1 with miR-200a, HMGB1 and RAGE in HCC tissues. [score:3]
e The wt-HMGB1 3’UTR/mut-HMGB1 3’UTR vectors and miR-200a inhibitor/miR-200a mimics were co -transfected into HepG2 cells. [score:3]
MiR-200a could negatively regulate HMGB1 expression. [score:3]
It was found that forced expression of miR-200a in meningioma cells reduced xenograft tumor growth when injected into the flanks of SCID [24]. [score:3]
Cells (1 × 10 [4] cells per well) cultured in 96-well plates and transfected with miR-200a inhibitor or si-TP73-AS1 for 48 h. Then the culture media from each group was collected and stored at −80 °C until use. [score:3]
f The wt-TP73-AS1/mut-TP73-AS1 vectors and miR-200a inhibitor/miR-200a mimics were co -transfected into HepG2 cells. [score:3]
By using of the Lipofectamine™ 2000 transfection reagent, HepG2 cells cultured in 24 well plates were co -transfected with luciferase reporter plasmids (wt-HMGB1, mut-HMGB1 containing miR-200a binding site, wt-TP73-AS1, mut-TP73-AS1 containing miR-200a binding site1 or site2) and miRNA mimics or inhibitor as well as the internal control pRSV-β-Galactosidase vector. [score:3]
The proten levels of HMGB1 signaling-related factors in response to co-processing TP73-AS1 knockdown and miR-200a inhibition were determined using assays and. [score:3]
Among the nine miRNAs, miR-200a inhibited HMGB1 mRNA the most significantly (Fig.   3b). [score:3]
Taken together, we demonstrated that TP73-AS1 inhibited miR-200a to promote HCC cell proliferation through HMGB1/RAGE pathway. [score:3]
showed that the luciferase activity of wt-HMGB1 3’UTR and wt-TP73-AS1 vectors was significantly reduced by miR-200a mimics while amplified by miR-200a inhibitor; these changes of luciferase activity were abolished after the predicted binding sites were mutated (Fig.   4e and f). [score:3]
g Mechanism diagram of TP73-AS1 modulating HCC cell proliferation through miR-200a -dependent HMGB1/RAGE pathway regulation The non-coding portion of the genome accounts for greater than 90% of the total mammalian genome. [score:2]
These data indicated that in HCC cell lines, TP73-AS1 affected cell proliferation through miR-200a -dependent HMGB1/RAGE regulation. [score:2]
More interestingly, a negative dual-regulation between miR-200a and TP73-AS1 was observed. [score:2]
We co -transfected HepG2 and HCCLM3 cell lines with miR-200a inhibitor and si-TP73-AS1, and then monitored the protein levels of HMGB1, RAGE and NF-кB using assays and the gradation analysis. [score:2]
According to online tools, TP73-AS1 shared a same binding site in miR-200a with HMGB1. [score:1]
The miR-200 family consisting of 5 members (miR-200a, −200b, −200c, −141, −429) is an emerging miRNA family that has been shown to play crucial roles in cancer initiation and metastasis, and potentially be important for the diagnosis and treatment of cancer [23]. [score:1]
By using luciferase assays, we confirmed miR-200a could directly bind to TP73-AS1 and the 3’UTR of HMGB1 on the predicted binding site(s). [score:1]
Whether miR-200a is involved in HCC? [score:1]
LncRNA HULC enhances epithelial-mesenchymal transition to promote tumorigenesis and metastasis of HCC via the miR-200a-3p/ZEB1 signaling pathway [16]. [score:1]
lncRNA TP73-AS1 miR-200a HCC HMGB1 Proliferation Liver cancer is the sixth most common cancer in the world, with 782,000 new cases diagnosed in 2012 alone. [score:1]
d A wt-TP73-AS1 luciferase reporter vector (wt-TP73-AS1), as well as a mut-TP73-AS1 luciferase reporter vector (mut-TP73-AS1) by sequentially mutating the predicted two miR-200a binding sites in TP73-AS1 was constructed. [score:1]
As predicted by online tools, TP73-AS1 shared a similar binding site of miR-200a with HMGB1. [score:1]
A wt-HMGB1 3’UTR luciferase reporter vector (wt-HMGB1 3’UTR), as well as a mut-HMGB1 3’UTR luciferase reporter vector (mut-HMGB1 3’UTR) by sequentially mutating the predicted miR-200a binding sites in the 3’UTR of HMGB1 was constructed. [score:1]
Our findings provide a novel understanding of the role of TP73-AS1 and miR-200a in HCC cell proliferation and the mechanism involved. [score:1]
d, e and f The correlations between TP73-AS1 and miR-200a, HMGB1 and RAGE, respectively, were analyzed by using the Spearman’s rank correlation analysis. [score:1]
Further, miR-200a, HMGB1 mRNA and RAGE mRNA and their correlations in HCC tissues were determined. [score:1]
These data indicated that both TP73-AS1 and HMGB1 could bind to miR-200a;. [score:1]
TP73-AS1 competed with HMGB1 for miR-200a binding. [score:1]
Can TP73-AS1 interact with miR-200a to modulate HCC progression? [score:1]
By using luciferase assays, we confirmed that miR-200a could directly bind to TP73-AS1 and the 3’UTR of HMGB1;. [score:1]
[1 to 20 of 69 sentences]
2
[+] score: 281
Knockdown of ATB reduced the expression of TGF-β2 at mRNA and protein levels, and sh-ATB combined with miR-200a mimics significantly reduced the expression levels of TGF-β2, in contrast, miR-200a inhibitors restored the reduction of TGF-β2 expression in ATB knockdown glioma cells (Fig.   7a-c). [score:11]
Recent study has reported that miR-200a suppresses renal cell carcinoma development by directly targeting TGF-β2 [35] and miR-200a prevents renal fibrogenesis by suppressing of TGF-β2 [36]. [score:9]
ATB knockdown suppressed glioma biological characteristics by directly targeting miR-200a and negatively regulating its expression in glioma cells. [score:8]
These data indicated that miR-200a inhibited TGF-β2 expressions in glioma cells by directly targeting the 3′UTR of oncogene TGF-β2. [score:8]
ATB directly targeted miR-200a and inhibited its expression in glioma cells. [score:8]
Overexpression of miR-200a significantly reduced both mRNA and protein expression levels of TGF-β2 compared to miR-200a NC while inhibited miR-200a expression exhibited the opposite effects (Fig.   6b-c). [score:8]
The results showed that ATB knockdown combined with miR-200a overexpression resulted in significant reduction of clone numbers and clone size of glioma cells, whereas miR-200a inhibitors recused the clone ability in ATB knockdown glioma cells (Fig.   5c). [score:7]
In addition, ATB knockdown combined with miR-200a overexpression group was strongly reduced invaded cells, and miR-200a inhibitors reversed the invasion of ATB knockdown glioma cells (Fig.   5d). [score:7]
To further elucidate whether ATB was regulated by miR-200a, we compared ATB expression levels in U251 and A172 cells transfected with miR-200a NC or miR-200a mimics and the results showed that overexpression of miR-200a did not reduce the expression of ATB in glioma cells (Fig.   3e). [score:7]
The proliferation was reduced in ATB knockdown, while miR-200a inhibitors reversed the reduction of proliferation and miR-200a mimics inhibited the proliferation (Fig.   5a-b). [score:6]
Previous studies have demonstrated that miR-200a as a member of the miR-200 family, which exerts as a tumor-suppressor gene and is down-regulated in many tumors, including glioma [18]. [score:6]
TGF-β2, a target oncogene, is directly bound to tumor-suppressor gene miR-200a and is involved in ATB function as a ceRNA for miR-200a in glioma. [score:6]
Consistent with previous studies, we confirmed that miR-200a regulated the expression of TGF-β2 via targeting the 3′UTR of TGF-β2. [score:6]
d Pearson’s correlation analysis of the relationship between TGF-β2 expression and miR-200a expression. [score:5]
ATB fragment containing the predicted miR-200a binding site, the putative sequences of the binding site then cloned into a pmirGlO Dual-luciferase miRNA Target Expression Vector (Promega, Madison, WI, USA) to form the reporter vector pmiRGLO-ATB-wild-type (ATB-WT). [score:5]
Previous study showed that down-regulation of miR-200a promoted glioma malignancy by up -regulating SIM2-s [18]. [score:5]
d The efficiency of miR-200a expression levels after glioma cells transfected with miR-200a NC, miR-200a mimics and miR-200a inhibitors. [score:5]
Additionally, we further found that the expression levels of TGF-β2 was inversely correlated with the expression of miR-200a and positively associated with ATB in 79 human glioma patients (Fig.   7d-e). [score:5]
We further found that the expression level of ATB was inversely correlated with the expression of miR-200a in 79 human glioma patients (Fig.   3c). [score:5]
The expression levels of TGF-β2 in glioma cells transfected with miR-200a NC, mimics and inhibitors were tested. [score:5]
b- c Relative expression of TGF-β2 mRNA and protein levels in U251 and A172 cells after transfected with miR-200a mimics, miR-200a inhibitors, and miR-200a NC. [score:5]
Our findings suggest that ATB plays an oncogenic role of glioma cells by inhibiting miR-200a and facilitating TGF-β2 in glioma, thereby may represent a potential therapeutic target for the treatment of human glioma. [score:5]
Similarly the 3’-UTR of TGF-β2 containing the putative miR-200a binding site, the putative sequences of the binding site were cloned into a pmirGlo Dual-luciferase miRNA Target Expression Vector to form the reporter vector TGF-β2-wild-type (TGF-β2-WT) (GenePharma). [score:5]
To determine whether ATB was regulated by miR-200a in such a manner, we conducted anti-Ago2 RIP in U251 and A172 cells transiently overexpressing miR-200a. [score:4]
Fig. 4ATB directly targeted miR-200a in glioma. [score:4]
As shown Fig.   3a, using QRT-PCR analysis, we found that the expression of miR-200a was lowly expressed in glioma tissues compared with normal brain tissues (NBTs). [score:4]
RNA-IP assay showed that the expression of ATB immunoprecipitated with in the miR-200a overexpression group was significantly increased. [score:4]
Glioma cell lines U251 and A172 were transfected with sh-ATB, miR-200a mimics, miR-200a inhibitors, after we assayed the cell phenotype and expression of the relevant molecules. [score:4]
These findings suggest that ATB functions as a ceRNA to regulate the expression of TGF-β2 by releasing miR-200a in glioma cells. [score:4]
ATB regulated TGF-β2, a target of miR-200a, in glioma cells. [score:4]
Dual-luciferase reporter assay, RIP and a xenograft mouse mo del were used to examine the expression of sh-ATB and its target gene miR-200a. [score:4]
In addition, ATB was confirmed to target miR-200a, and miR-200a inhibition reversed the malignant characteristics of ATB knockdown on glioma cells. [score:4]
b miR-200a expressed levels was inversely correlated with pathological grades of glioma. [score:3]
In addition, we found that TGF-β2 expression was negatively correlated with miR-200a, but positively associated with ATB in glioma tissues. [score:3]
c Pearson’s correlation analysis of the relationship between ATB expression and miR-200a level in 79 human glioma patients. [score:3]
Data were presented as mean ± SD from three independent experimentsThen, U251 and A172 glioma cells were transfected with miR-200a NC, miR-200a mimics and miR-200a inhibitors (Fig.   3d). [score:3]
Fig. 5Repression of miR-200a abolished the sh-ATB induced inhibitory effects on glioma cells. [score:3]
However, knockdown of ATB significantly increased the expression levels of miR-200a compared to the control group (Fig.   3f). [score:3]
Data were presented as mean ± SD from three independent experiments Then, U251 and A172 glioma cells were transfected with miR-200a NC, miR-200a mimics and miR-200a inhibitors (Fig.   3d). [score:3]
e Relative expression of ATB in U251 and A172 cells transfected with miR-200a mimics and miR-200a NC. [score:3]
MiR-200a mimics, miR-200a inhibitors and miR-200a negative control (NC) were obtained from RiboBio (RiboBio, Guangzhou, China), and transfected into cell lines as the above described. [score:3]
Taken all together, these data strongly suggested that ATB directly targets miR-200a and affects the biological characteristic of glioma cells by negatively regulating miR-200a. [score:3]
The relationship between the expression of ATB, miR-200a and TGF-β2 in tissues was analyzed with Pearson’s correlation. [score:3]
However, the molecular mechanism of miR-200a deregulation and how such deregulation contributes to glioma tumorigenesis remains abstruse. [score:3]
Endogenous ATB pull-down was specifically enriched in miR-200a -transfected cells (Fig.   4d-e), supporting that miR-200 s are bona fide ATB -targeting microRNAs. [score:3]
Data are presented as mean ± SD from three independent experiments To investigate whether miR-200a targeted TGF-β2 in glioma cells, and TargetScan software predicted miR-200a binding sites in the 3’UTR of human TGF-β2 (Fig.   6a). [score:3]
f Relative expression of miR-200a in U251 and A172 cells transfected with sh-ATB and sh-control. [score:3]
Repression of miR-200a restored the sh-ATB induced inhibitory effects on glioma cells. [score:3]
ATB could promote the invasion-metastasis cascade in HCC by negative regulating of miR-200 family [13]. [score:2]
Data are presented as mean ± SD from three independent experiments To explore whether ATB could function as a ceRNA for TGF-β2 via modulating miR-200a in glioma, RT-QPCR and Western blot assays were performed to detect the mRNA and protein levels of TGF-β2 after cells transfected with sh-ATB combined with miR-200a mimics, miR-200a inhibitors. [score:2]
d Invasion assay (use matrigel transwell chambers) in U251 and A172 cells was performed to determined cell invasiveness after co -transfected with sh-ATB and miR-200a mimics or miR-200a inhibitors. [score:2]
a- b RT-QPCR and c Western blot assays were performed to detect the mRNA and protein levels of TGF-β2 after cells transfected with sh-ATB and miR-200a mimics or miR-200a inhibitors. [score:2]
To validate the direct binding between miR-200a and ATB at endogenous levels, we constructed luciferase reporters, which contain wild-type (WT) or mutated (Mut) miR-200a binding sites (Fig.   4a). [score:2]
Data are presented as mean ± SD from three independent experimentsTo explore whether ATB could function as a ceRNA for TGF-β2 via modulating miR-200a in glioma, RT-QPCR and Western blot assays were performed to detect the mRNA and protein levels of TGF-β2 after cells transfected with sh-ATB combined with miR-200a mimics, miR-200a inhibitors. [score:2]
a- b CCK-8 assay was performed to determine the proliferation after co -transfected with sh-ATB and miR-200a mimics or miR-200a inhibitors. [score:2]
a MiR-200a was lowly expressed in glioma tissues and cell lines. [score:2]
We verified that ATB is directly bound to miR-200a on ATB transcript. [score:2]
c Colony formation assay was performed to detect the proliferation effect of U251 and A172 cells after co -transfected with sh-ATB and miR-200a mimics or miR-200a inhibitors. [score:2]
We demonstrated that miR-200a reversed the reduction of TGF-β2 mediated by ATB knockdown. [score:2]
These results suggested that ATB functions as a ceRNA via decreasing miR-200a, up -regulating TGF-β2 in human glioma. [score:2]
We found that overexpression of miR-200a could reduce ATB-WT luciferase activity but not affect ATB-Mut luciferase activity compared with miR-200a NC (Fig.   4b-c). [score:2]
Therefore, these results suggest that ATB acts its tumor-oncogene roles though miR-200a in glioma cells. [score:1]
b- c Luciferase activity in U251 and A172 glioma cells co -transfected with miR-200a mimics and luciferase reporters containing ATB-WT or ATB-MUT transcript. [score:1]
To mutate the putative binding site of miR-200a in ATB gene, the sequence of putative binding site was replaced as indicated and was named as pmiRGLO-ATB-mutated-type (ATB-MUT). [score:1]
All-in-One™ miRNA First-Strand cDNA Synthesis Kit (Genecopoeia, Guangzhou, China) was used for miRNA reverse transcription and RT-QPCR was conducted using All-in-One™ miRNA qPCR Kit (Genecopoeia, Guangzhou, China) of miR-200a and U6 (miR-200a (Cat#HmiRQP0298) and U6 (Cat#HmiRQP9001), Genecopoeia, Guangzhou, China), respectively, by using the ABI 7100 (Applied Biosystems, Darmstadt, Germany). [score:1]
GAPDH and U6 were used as internal controls for ATB, TGF-β2 and miR-200a. [score:1]
RIP was implemented to pull down endogenous miR-200a associated with ATB in glioma cell lines, and was performed following the manufacturer's protocol. [score:1]
In particular, ATB may act as a ceRNA, effectively becoming a sink for miR-200a, thereby modulating the derepression of TGF-β2. [score:1]
Data are presented as mean ± SD from three independent experiments Previous studies have demonstrated that lncRNAs could function as a competing endogenous RNAs (ceRNA) by competitively binding miRNAs, such as miR-200a, in hepatocellular carcinoma [8, 13, 19]. [score:1]
Fig. 7ATB as a ceRNA for TGF-β2 by releasing miR-200a in glioma cells. [score:1]
d- e Luciferase activity in U251 and A172 cells co -transfected with miR-200a mimics and luciferase reporters containing TGF-β2 wild type (WT) or mutant type (MUT) 3′-UTR. [score:1]
d-e RNA-IP with anti- antibody was performed in U251 and A172 cells transfected with miR-200a NC and miR-200a mimics. [score:1]
pmirGLO-ATB-WT or pmirGLO-ATB-MUT was cotransfected with miR-200a mimics or miR-200a NC into glioma cells by using Lipofectamie 2000 (Invitrogen, USA). [score:1]
We further found that miR-200a level in glioma tissues was inversely correlated with pathological grades of glioma (Fig.   3b). [score:1]
Meanwhile, we found that ATB exerted the function of anti-tumor by miR-200a in glioma cells. [score:1]
miR-200a NC group. [score:1]
Our present study confirmed that miR-200a was significantly decreased in glioma tissues and inversely correlated with ATB. [score:1]
In addition, the interaction among ATB, miR-200a and TGF-β2 was also studied in order to reveal the underlying mechanisms. [score:1]
We identified that ATB may act as a ceRNA of miR-200a, which resulted in the derepression of TGF-β2. [score:1]
These data demonstrated that miR-200a bound to ATB but did not induce the degradation of ATB. [score:1]
a The predicted of miR-200a binding sites in the 3′-UTR region of TGF-β2 (TGF-β2-3′-UTR-WT) and the corresponding mutant sequence (TGF-β2-3′UTR-MUT) was shown. [score:1]
a The predicted miR-200a binding sites on ATB. [score:1]
To mutate the putative binding site of miR-200a in the 3′-UTR-containing vector, the sequence of putative binding site was replaced as indicated and was named as TGF-β2-mutated-type (TGF-β2-MUT). [score:1]
All these data implied that ATB physically correlated with the miR-200a in glioma cells. [score:1]
Glioma lncRNA ATB miRNA miR-200a ceRNA TGF-β2 Glioma poses a tremendous threat to public health with an incidence of ~5 cases per 100,000 persons and its mortality is high around the world. [score:1]
[1 to 20 of 85 sentences]
3
[+] score: 260
These results indicate that miR-200a downregulates TP53INP1 expression by directly targeting its 3’ UTR. [score:9]
In the current study, mRNA expression of p73 is not significantly changed with variation of miR-200a expression, indicating that regulation of p73 is not at RNA level but posttranslational level. [score:8]
PR: partial response, SD: stable disease, PD: progressive disease To further identify the association between TP53INP1 and miR-200a in breast cancer, the expression of miR-200a and TP53INP1 were examined in various breast cancer cell lines (Fig.   6a and b). [score:7]
Furthermore, knockdown of YAP1 and TP53INP1 phenocopied the effects of miR-200a overexpression, and confirmed that TP53INP1 is a novel target of miR-200a. [score:6]
The results showed that overexpression of miR-200a correlated significantly with shorter disease free survival duration of patients with breast cancer. [score:5]
A reverse correlation was observed between miR-200a expression and TP53INP1 expression. [score:5]
The cells overexpressing miR-200a had a lower level of TP53INP1 expression (R = −0.780, p = 0.0279, n = 12) (Fig. 6c). [score:5]
Furthermore, we found miR-200a was overexpressed in gemcitabine resistant breast cancer cells, and inhibition of miR-200a can restore sensitivity to these cells. [score:5]
Remarkably, TP53INP1 expression is inversely correlated with miR-200a expression in Breast cancer cell lines. [score:5]
b Kaplan-Meier curves of disease free survival rates of 110 patients with breast cancer who had definitive surgical treatment of their primary tumors according to miR-200a expression. [score:5]
Unexpectedly, in miR-200a transfected MDA-MB-231, the p73 pathway expression levels of YAP1 and TP53INP1 were low, which resulted in the transcriptional repression of the pro-apoptosis target genes puma, Bax, bim and noxa (Fig. 3d). [score:5]
In this study, our results showed ectopic expression of miR-200a promotes chemoresistance in breast cancer cell lines to several chemotherapeutic agents, whereas inhibition of miR-200a enhances gemcitabine chemosensitivity in resistance cancer cells. [score:5]
To confirm whether miR-200a also directly regulates the expression of TP53INP1, the 3’ UTR region of the TP53INP1 was cloned downstream of the luciferase open reading frame to construct the reporter plasmid psiCHECK2–3’UTR-TP53INP1-luc (Fig. 3b). [score:5]
These results implied that, enforced expression of miR-200a in breast cancer cell lines conferred chemoresistance via targeting YAP1 and TP53INP1. [score:5]
In the cells viability assay, miR-200a overexpression significantly decreases the inhibitory effect of these chemotherapeutic agents. [score:4]
The predicted targets of miR-200a, including the p53 family members as well as binding proteins that may regulate the p53 pathway were exported into Cytoscape and analyzed for evidence of intersection [13]. [score:4]
We show that TP53INP1 and YAP1 are direct targets of miR-200a that contribute to the ability of miR-200a to promote chemoresistance. [score:4]
Upregulated miR-200a enhances treatment resistance via antagonizing TP53INP1 and YAP1 in breast cancer. [score:4]
Knockdown of TP53INP1 and YAP1 phenocopied effects of overexpression of miR-200a. [score:4]
Cytoscape was used to find intersection between predicted miR-200a targets and p53 family binding proteins responsible for the regulation of p53, p63 and p73 (Fig.   3a, Additional file 1: Table S2) [13]. [score:4]
In present study, the results showed that miR-200a can negatively regulate TP53INP1 expression through binding to its 3’ UTR of mRNA. [score:4]
Fig. 5Overexpression of miR-200a was associated with poor response to preoperative chemotherapy and poor prognosis in patients with breast cancers. [score:3]
a The Cytoscape map shows the intersection between the miR-200a predicted targets and the p53/p73 interacting proteins. [score:3]
In present study, we found TP53INP1 as a novel target of miR-200a. [score:3]
Table S2: Intersection between predict target of miR-200a and p53 family binding partner. [score:3]
miR-200a is known to suppress Epithelial mesenchymal transition (EMT) [5– 7]. [score:3]
Fig. 3Overexpression of miR-200a induced chemoresistance was mediated through TP53INP1 and YAP1. [score:3]
org/) to search for potential targets of miR-200a [12]. [score:3]
We showed that miR-200a promotes DNA damage resistance by inhibiting DNA damage -induced apoptosis via YAP1 and TP53INP1 in breast cancer. [score:3]
These results suggest the involvement of miR-200a overexpression in chemoresistance and poor prognosis. [score:3]
The results indicated that high expression of miR-200a was closely associated with poor response to preoperative chemotherapy. [score:3]
Fig. 2Ectopic expression of miR-200a promoted chemoresistance in breast cancer cell lines to multiple agents. [score:3]
S-J Y, Yang L, Hong Q, Shao Z-M. Overexpression of miR-200a confers chemoresistance by antagonizing TP53INP1 and YAP1 in human. [score:3]
miR-200a expression was assessed by quantitative real-time PCR (qRT-PCR) in breast cancer patients treated with preoperative chemotherapy. [score:3]
Overexpression of miR-200a was associated with poor response to preoperative chemotherapy and poor prognosis in patients with breast cancer. [score:3]
c Pearson correlation of the TP53INP1 and miR-200a expression levels in breast cancer cell lines (R = −0.780, P = 0.0279, n = 12). [score:3]
In this study we showed that miR-200a expression is significantly associated with the response to chemotherapy in patients with breast cancer. [score:3]
Our previous study has shown overexpression of miR-200a promotes anoikis resistance and metastasis in human breast cancer. [score:3]
Inhibition ratio of scramble RNA, siYAP1, siTP53INP1 and miR-200a mimic transfected MDA-MB-231 (d) and ZR-75-30 (e) after treating with cis-platin 72 h. The cis-platin concentrations were 1 μM, 2 μM, 3 μM, 4 μM, and 5 μM, respectively. [score:3]
Unfortunately, we cannot determine the dynamic expression of miR-200a after treating with chemotherapy due to small chemotherapy samples and a relatively limited number of patients. [score:3]
Inhibition ratio of miR-200a and miR-Ctrl transfected MDA-MB-231 (a) and ZR-75-30 (b) after treating with chemo drugs 72 h. The drug concentrations were gemcitabine 5 μM, cis-platin 5 μM, and paclitaxel 60 nM, respectively. [score:3]
a Relationship between miR-200a expression and response to preoperative chemotherapy in patients with breast cancer. [score:3]
These findings demonstrate that overexpression of miR-200a in breast cancer is associated with chemoresistance. [score:3]
Moreover, silencing TP53INP1 and YAP1 can partly reproduce treatment resistance of miR-200a overexpression (Fig. 6d and e). [score:3]
c, d miR-200a inhibitor enhanced the sensitivity of gemcitabine-resistant cells to gemcitabine. [score:3]
qRT-PCR and western blot confirmed a significantly higher miR-200a expression in gemcitabine-resistant cell lines than in its parent cells (5.5-fold change of mRNA level in MDA-MB-231) (Fig. 4b). [score:3]
We found overexpression of miR-200a was closely associated with poor response to preoperative chemotherapy and poor prognosis in breast cancer patients. [score:3]
These data suggest that miR-200a confer insensitivity to drug -induced apoptosis by antagonizing YAP1 and TP53INP1 expression. [score:3]
miR-200a may also prevent apoptosis by targeting TP53INP1 [25]. [score:3]
b relative expression levels of miR-200a in human breast cancer cell lines. [score:3]
Thus, by targeting two nodes of the chemo -induced apoptosis pathway, miR-200a confers resistance to chemotherapy (Fig.   7). [score:3]
We further detected the expression proapoptotic proteins puma, Bax, bim and noxa in miR-200a transfected cell lines. [score:3]
The expression of miR-200a in preoperative chemotherapy treated breast cancer tissues were quantified by qRT-PCR. [score:3]
Fig. 4Inhibition of miR-200a restored the sensitivity to chemotherapy. [score:3]
miR-200a expression promotes chemoresistance in breast cancer cell lines. [score:3]
Overexpression of miR-200a induced chemoresistance was mediated through TP53INP1 and YAP1. [score:3]
The protein levels of cleaved caspase-3 were normalized to GAPDH To examine the effects of miR-200a on chemosensitivity, we stably expressed miR-200a in the human breast cancer cell lines MDA-MB-231 and ZR-75-30. [score:3]
Third, cleavage of Caspase-3 was suppressed in both miR-200a mimic transfected cells compared with the miR-Ctrl transfected cells (Fig. 1e). [score:2]
Furthermore, caspase3/7 activity assays showed that expression of miR-200a renders MDA-MB-231 and ZR-75-30 cells resistant to paclitaxel, cis-platin and gemcitabine induced apoptosis (Fig.   2a and b). [score:2]
In Table  1, we compared the relationship between miR-200a expression and clinicopathologic characters of patients received preoperative chemotherapy followed by surgery. [score:2]
Breast cancer cells transfected with mimic or inhibitor for miR-200a was assayed for chemoresistance in vitro. [score:2]
Despite its preliminary character, this study clearly indicates that miR-200a acts as a negative regulator of chemotherapy induced apoptosis therefore confer chemoresistance. [score:2]
This data further indicated the functional link between miR-200a and TP53INP1 in breast cancer. [score:1]
In our previous studies, it has been shown that MDA-MB-231 and ZR-75-30 had low levels of miR-200a. [score:1]
We believe p53 does not matter in miR-200a mediated chemoresistance. [score:1]
Synthetic miR-200a- and miR-control -transfected cells were plated onto poly-lysine -treated cover clips in six-well plates. [score:1]
Second, Annexin V/PI staining showed that ZR-75-30-miR-200a mimic cells were resistant to cis-platin -induced apoptosis. [score:1]
b The confocal TUNEL analysis showed that the miR-200a -transfected MDA-MB-231 cells had lower levels of apoptosis than the miR-Ctrl -transfected MDA-MB-231 cells. [score:1]
Together, these data suggest that miR-200a plays a role in chemoresistance. [score:1]
In addition, the effects of miR-200a on chemoresistance were mediated through antagonizing TP53INP1 and YAP1. [score:1]
b Sequence alignment of human miR-200a within the 3’-UTRs of TP53INP1. [score:1]
a MDA-MB-231 cells that had been transfected with the miR-200a mimic or the miR-Ctrl were treated with 5 μM cis-platin and stained with TUNEL-TMR red, phalloidin-FITC for actin and DAPI for the cell nucleus. [score:1]
Taken together, these clinical and experimental results demonstrate that miR-200a is a determinant of chemoresistance of breast cancer. [score:1]
To further examine the role of miR-200a in chemosensitivity, MDA-MB-231 and ZR-75-30 cells were transfected with miR-200a mimics, respectively. [score:1]
We found that TP53INP1 and YAP1 are involved in p73 -mediated apoptosis pathway and have a high degree of complementarity with the seed region of miR-200a (Fig. 3b). [score:1]
In this study, we demonstrate that miR-200a plays an important role in chemoresistance. [score:1]
Deciphering the association of miR-200a and chemoresistance might provide important insights into tumor progression and treatment. [score:1]
d The expression of TP53INP1, YAP1 and p73 were evaluated using western blotting on samples from pMR-miR-200a and pMR-miR-Ctrl transfected MDA-MB-231 cells. [score:1]
MicroRNA-200a represents miR-200a-5p in the current study. [score:1]
miR-200a plays a role in chemoresistance of breast cancer cells. [score:1]
Fig. 7 Schematic representation of the effects of miR-200a on chemoresistacne In summary, we established a role of miR-200a in chemotherapy resistance. [score:1]
Our previous study has also shown that miR-200a functions as a repressor of YAP1, which stabilized p73 under conditions like DNA damage and stress [20– 24]. [score:1]
Specific siRNAs and scrambled siRNA were purchased from Genepharma, and miR-200a mimics, antagomiRNA, and negative controls were obtained from Ribobio. [score:1]
The molecular events of miR-200a linking EMT are becoming well defined, while the role of miR-200a in therapy resistance remains unclear. [score:1]
First, the confocal TUNEL analysis showed that the miR-200a -transfected MDA-MB-231 cells had lower levels of apoptosis than the miR-Ctrl -transfected MDA-MB-231 cells (Fig.   1a, b, and p < 0.05). [score:1]
These results demonstrate a critical role for miR-200a in the chemoresistance of breast cancer cells. [score:1]
In summary, we combined the results to establish a role for miR-200a in chemoresistance. [score:1]
The optimal cut-off value for miR-200a expression was calculated by a X-tile program [14]. [score:1]
Taken together, these data indicate that miR-200a is a determinant of chemosensitivity in breast cancer cells. [score:1]
The seed sequence of miR-200a matches the 3’-UTRs of TP53INP1. [score:1]
Importantly, the miR-200 mimic did not decrease the luciferase activity of a mutant construct that contained substitutions at three nucleotides within the miR-200a binding site (Fig. 3c). [score:1]
We used MDA-MB-231 (TP53 mutant) and ZR-75-30 (TP53 wild-type) in the current study and miR-200a plays a role in mediating chemoresistance in both cell lines. [score:1]
b The miR-200a level is increased in gemcitabine-resistant cells. [score:1]
After treating with paclitaxel, cis-platin and gemcitabine, cells viability and Caspase 3/7 activity of stably miR-200a and scramble transfected cells were tested. [score:1]
Therefore, in response to chemotherapy, miR-200a may lead to p73 degradation, causing attenuated transcription of downstream proapoptotic genes, such as Bax, Bim and Puma. [score:1]
Luciferase assays, cell proliferation assay were performed to identify the targets of miR-200a and the mechanism by which it promotes treatment resistance. [score:1]
[1 to 20 of 96 sentences]
4
[+] score: 251
Other miRNAs from this paper: hsa-mir-139, hsa-mir-200b, hsa-mir-141, hsa-mir-200c, hsa-mir-429
In line with this observation, we found that the expression levels of the miR-200 family in a panel of HCC cell lines showed an opposite trend with the E-cadherin expression, and transient overexpression of miR-200a, miR-200b, and miR-200c precursors were all able to suppress the ZEB1/2 expression. [score:11]
These suppressive effects were significantly reduced in the miR-200a overexpressing cells or upon mutation of the miR-200b subfamily binding sequence, thus confirming the specificity of the miR-200b subfamily in regulating RhoA and ROCK2 expression (Figure 3a and 3b). [score:9]
Consistent with our findings, down-regulation of miR-200 family has been previously observed in HCC miRNA profiling and miR-200 expression studies reported by others [18- 20], suggesting that loss of miR-200 expression is a frequent event in liver carcinogenesis. [score:8]
In line with this observation, the endogenous expression of RhoA and ROCK2 mRNA was significantly inhibited in miR-200b- and miR-200c-stably overexpressing BEL7402 cells when compared to the empty vector and miR-200a-stably overexpressing controls (Figure 3c and 3d). [score:8]
Overexpression of miR-200b and miR-200c moderately suppressed HCC cell proliferation and colony formation, and drastically attenuated cell migration; all these effects were not seen in miR-200a overexpressing cells. [score:7]
Furthermore, we employed locked nucleic acid (LNA) miRNA inhibitors to specifically inhibit the expression of the miR-200 family members. [score:7]
Surprisingly, we found that although miR-200a, miR-200b and miR-200c all attenuated ZEB1/2 expression in HCC cells, only stable overexpression of miR-200b and miR-200c remarkably suppressed HCC cell migration. [score:7]
We performed quantitative RT-PCR (qRT-PCR) to validate the expression of miR-200 family members in an expanded HCC cohort (n = 64) and found that, consistent to our miRNA profiling data, miR-200a, miR-200b, and miR-200c were all significantly down-regulated in primary HCC samples (Figure 1b, P < 0.001). [score:6]
Indeed, down-regulation (> 2-fold) of all the miR-200 family members was detected in approximately 80% of primary HCC cases, suggesting that loss of miR-200 expression was a common event in human HCCs (Figure 1c). [score:6]
By comparing the expression of miR-200 in a pair of HCC cell lines derived from the primary tumor and its portal vein metastasis of the same patient, we noted that the miR-200 family members were significantly down-regulated in the metastatic cell line (H2M) when compared to its non-metastatic counterpart (H2P), suggesting that loss of miR-200 family might play a role in HCC metastasis (Supplementary Figure 2). [score:5]
We found that the empty vector and miR-200a overexpressing cells were readily seeded onto the uncoated glass surface, exhibited an extended cell morphology and started to migrate within 12 hours, whereas miR-200b and miR-200c overexpressing cells failed to seed on the uncoated glass surface till the end of the experiment (Figure 5b and Supplementary Videos). [score:5]
The successful overexpression and post-translational gene regulatory activity of miR-200 family members in the stably infected cells were confirmed by qRT-PCR and luciferase reporter assays. [score:5]
In addition, miRNA specific sensors containing the complementary sequences to individual mature miR-200 family members were also cloned into the same vector and served as positive control for accessing the post-translational gene repression activity of ectopically expressed miR-200 family members. [score:5]
The distinct function of miR-200a and miR-200b subfamilies on HCC cell growth and migration implied that miR-200b subfamily exerted its tumor suppressive functions via a mechanism beyond the inhibition of ZEB1/2 mediated EMT. [score:5]
To interrogate the expression of miR-200 family members in human HCCs, we retrieved the data from our previous miRNA expression profiling of 20 pairs of primary HCCs and their corresponding non-tumorous livers [4]. [score:5]
The miR-200b and miR-200c overexpressing cells exhibited a rounded morphology, in contrast to a flat and extended morphology of the empty vector and miR-200a overexpressing cells (Figure 5a lower panel). [score:5]
Loss of miR-200 family results in up-regulation of ZEB1 and ZEB2 and consequently leads to transcriptional repression of E-cadherin to facilitate EMT [5- 7]. [score:4]
When seeded onto uncoated glass surfaces, miR-200b- and miR-200c -overexpressing cells exhibited a rounded morphology as compared to the flat and extended morphology of miR-200a -overexpressing cells and empty vector controls. [score:4]
Second, both miR-200a and miR-200b subfamilies share the negative regulatory function on ZEB1/2 but only miR-200b subfamily suppressed HCC growth and migration, which implies that mechanisms in addition to the well-characterized miR-200s/ZEB1/2/E-cadherin axis may be involved to empower tumor suppressive functions specific to the miR-200b subfamily in HCC. [score:4]
Both down- and up-regulations of miR-200 family have previously been reported [10- 14]. [score:4]
We found that the formations of stress fibers (stained by Phallodin) and focal adhesions (stained by anti-paxillin antibody) were profoundly impeded in miR-200b- and miR-200c -overexpressing cells as compared to the empty vector and miR-200a -overexpressing controls (Figure 4a and 4b). [score:4]
As illustrated by the heat map diagram, all five members of miR-200 family were profoundly down-regulated in human HCCs, suggesting that loss of miR-200 family might play a role in liver carcinogenesis (Figure 1a). [score:4]
Computer-aided cell migration tracking revealed that the cell migratory ability was modestly impaired in miR-200a overexpressing cells when compared to the empty control, but was drastically abolished in miR-200b and miR-200c overexpressing cells (Figure 5c). [score:4]
These miR-200 family members negatively regulate the expression of transcription repressors ZEB1 and ZEB2. [score:4]
In summary, the work present here revealed that all the miR-200 family members were frequently down-regulated in human HCC. [score:4]
Frequent down-regulation of miR-200 family in human HCCs. [score:4]
To further investigate the functions of miR-200 family in human HCC, miR-200a, miR-200b, and miR-200c were subcloned into a lenti-viral based expression vector (Supplementary Figure 4a) and stably overexpressed in HCC cell lines, BEL7402 and SMMC-7721. [score:3]
The migration rate of HCC cells overexpressing miR-200a, was similar to the vector control (Figure 2c). [score:3]
In this study, we demonstrated that all five members of miR-200 family (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) were frequently down-regulated in human HCCs as compared to their corresponding non-tumorous livers. [score:3]
Figure 2(a) Proliferation rate of miR-200 stably overexpressing cells. [score:3]
Aberrant expression of either miR-200 family or ZEB1/2 will therefore feed-forward to disrupt the equilibrium and result in epithelial-mesenchymal transition (EMT) or mesenchymal-epithelial transition (MET) [8, 9]. [score:3]
MiR-200 family miRNA precursors and LNA inhibitors. [score:3]
For miR-200 overexpression, the cells were transfected with 30 ηM of designated miRNA precursors or pre-miR negative control 1 (Applied Biosystems) using X-tremeGENE siRNA transfection reagent (Roche). [score:3]
Overexpression of miR-200b and miR-200c, but not miR-200a, resulted in a moderate but significant reduction on cell proliferation and also impeded anchorage independent growth on soft agar (Figure 2a and 2b). [score:3]
Therefore, as proof-of-concept, miR-200a, miR-200b, and miR-200c were selected to represent each subgroup for expression and functional studies (Supplementary Figure 1b). [score:3]
This observation was reproducible by transiently overexpressing the miR-200 precursors in the same cell lines, thus ruling out the possibility of experimental artifacts that might be introduced by the lenti-viral vector or stable infection (Supplementary Figure 5). [score:3]
MiR-200a, miR-200b and miR-200c genes were amplified from the genomic DNA of MIHA cells and sub-cloned into a lenti-viral based miRNA expression vector, pCDH-CMV-MSC-EF1-copGFP/Puro (System Biosciences) utilizing the EcoRI and NotI restriction sites. [score:3]
Unsupervised clustering analysis revealed a profound differential expression of the miR-200 family members in primary HCCs. [score:3]
12p13 cluster), whereas, at the functional level, the miR-200 family members are categorized into two other groups based on the sequence homology hence two distinct groups of targets involved (miR-200b subfamily and miR-200a subfamily) (Supplementary Figure 1a) [5, 6]. [score:3]
Our findings have demonstrated the functional discrepancy of miR-200 family members and provided a mechanistic explanation toward the miR-200b specific tumor suppressive function in HCC. [score:3]
Figure 1(a) Expression of the miR-200 family members in 20 pairs of primary HCCs and their corresponding non-tumorous livers. [score:3]
Figure 5(a) Cell morphology of miR-200 stably overexpressing BEL7402 cells was observed under phase-contrast microscope (20×) and scanning electron microscope (2500×). [score:3]
In fact, we observed that the expression levels of mature miR-200a and miR-200b, both from the 1p36 cluster, significant correlated with each other in both non-tumorous livers and primary HCCs (R [2] = 0.691 and 0.603, respectively, P < 0.001, linear regression). [score:3]
Only the miR-200b subfamily but not its closely related miR-200a subfamily possessed tumor suppressor functions in HCC. [score:3]
However, knowledge regarding the expression and functional implications of miR-200 family in human HCC is awaited for detailed elucidation. [score:3]
Figure 4(a) Stress-fibers (filaments across the cytosol) in miR-200 stably overexpressing BEL7402 cells were visualized by TRITC-Phalloidin staining. [score:3]
GFP maker was used to indicate the stable infection of miR-200 expression vectors. [score:3]
We reasoned that, at the expression level, the miR-200 family can be categorized into two groups based on the chromosomal locations in which two different up-stream promoters are involved (Ch. [score:3]
Figure 3 expression(a) and (b)s. Wild-type and mutated RhoA or ROCK2 3′UTR were co -transfected with miR-200 precursors into BEL7402 cells. [score:3]
Altogether, these findings suggested that the miR-200a and miR-200b subfamilies acted differentially, with the miR-200b subfamily members specifically functioning as tumor suppressors in HCC. [score:3]
Gene ontology (GO) analysis further revealed that the down-stream targets of miR-200a and miR-200b subfamilies were enriched in different GO terms (Supplementary Table 1). [score:3]
For miR-200 inactivation, cells were transfected with 50 ηM designed miRCURY LNA™ miRNA Inhibitor or LNA control (Exiqon). [score:3]
The homeostatic expression between miR-200 family and ZEB1/2 is critical for maintaining the stability of epithelial or mesenchymal phenotype of cells. [score:3]
In silico analyses have revealed that the down-stream targets of miR-200a and miR-200b subfamilies are largely non-overlapping with each other. [score:3]
Nevertheless, the expression of the miR-200 family in human cancer remains contentious. [score:3]
Interestingly, ZEB1 and ZEB2 are also involved in the transcriptional repression of the miR-200 family, thus the miR-200 family and ZEB1/2 form a double -negative feedback loop to regulate each other. [score:2]
These findings recapitulated the previous reports and supported the negative regulatory functions of miR-200 family in ZEB1/2 mediated EMT (Supplementary Figure 3). [score:2]
Since EMT is a crucial step in cancer metastasis, the miR-200 family members have been considered as metastasis-suppressive miRNAs. [score:2]
First, although the miR-200 family members are generally considered as functionally redundant paralogs, the miR-200a and miR-200b subfamilies in fact have distinct functions in regulating HCC cell growth and migration. [score:1]
MiR-200 family consists of five evolutionarily conserved members located in two separate clusters in the human genome, with miR-200b, miR-200a, and miR-429 mapped to chromosome 1p36 (thereafter, referred as 1p36 cluster), and miR-200c and miR-141 mapped to chromosome 12p13 (henceforth, indicated as 12p13 cluster). [score:1]
MiR-200 family has recently been identified as a major regulator of epithelial-mesenchymal transition (EMT). [score:1]
MiR-200 family can also be sub-divided into two subfamilies according to their seed sequence homology, with miR-200a and miR-141 as a group (hereafter, denoted as miR-200a subfamily) and miR-200b, miR-200c, and miR-429 as another group (henceforward, named as miR-200b subfamily) (Supplementary Figure 1a) [5, 6]. [score:1]
In this sense, the miR-200 family can be sub-divided into the functionally miR-200a subfamily (miR-200a and miR-141) and miR-200b subfamily (miR-200b, miR-200c and miR-429). [score:1]
MiR-200 family members are conventionally divided into two groups based on their genome locations clustered at 1p36 (miR-200a, miR-200b and miR-429) and 13p12 (miR-200c and miR-141), respectively. [score:1]
With these miR-200s stably overexpressing cells, we then investigated the effects of miR-200 family in HCC cell growth. [score:1]
To experimentally validate these in-silico prediction results, 3′UTRs of RhoA and ROCK2 were cloned into a luciferase reporter construct and co -transfected with miR-200 precursors in BEL7402. [score:1]
15 ηM of each miR-200 precursors was first individually transfected into HCC cells using X-tremeGene. [score:1]
Also, the miR-200 family may play different roles in different cancers depending on their specific cellular contexts [15]. [score:1]
Among the 33,410 mRNA transcripts included in this analysis, 871 and 1488 mRNAs were predicted to harbor evolutionarily conserved binding site(s) of miR-200a and miR-200b subfamilies, respectively. [score:1]
Whether functional cross-talks exist between miR-200 subfamilies in both normal cells and during pathological conditions is an interesting question worthy to be further explored. [score:1]
Effects of the miR-200 family on HCC cell growth and migration. [score:1]
In this regard, immunofluorescence staining was performed to visualize the effects of miR-200 family on Rho/ROCK mediated stress fiber and focal adhesion formations. [score:1]
[1 to 20 of 72 sentences]
5
[+] score: 242
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200c
The up-regulation of miR-200a in NRK52E cells was shown to down-regulate the expression of TGF-β2, via direct interaction with the 3′ UTR of TGF-β2 (19), which can induce EMT and reduce the invasiveness in meningiomas (18). [score:10]
We demonstrated that up-regulation of miR-200a down-regulated the expression of β-catenin and affected the activity of the Wnt/β-catenin signaling pathway. [score:9]
We also used the miR-200a inhibitor to down-regulate the expression of miR-200a in SGC7901 and U251 cells. [score:8]
Therefore, via regulating the expression of E-cadherin by targeting ZEB1 and ZEB2, miR-200a can inhibit the invasive potential of tumor cells. [score:8]
The wild-type 3′ untranslated region (UTR) of the CTNNB1 gene, containing predicted miR-200a target sites, and a mutated CTNNB1 3′ UTR in which the miR-200a target sites were mutated were inserted into the XbaI and FseI sites of the pGL3 control vector (GenScript, Nanjing, China) and were named pGL3-CTNNB1 and pGL3-CTNNB1-mt, respectively. [score:7]
The mimic and inhibitor sequences were: miR-200a mimic sense: 5′-UAA CAC UGU CUG GUA ACG AUG U-3′; anti-sense: 5′-AUC GUU ACC AGA CAG UGU UAU U-3′; negative control sense: 5′-UUC UCC GAA CGU GUC ACG UTT-3′; anti-sense: 5′-ACG UGA CAC GUU CGG AGA ATT-3′; miR-200a inhibitor: 5′-ACA UCG UUA CCA GAC AGU GUU A-3′; inhibitor negative control: 5′-CAG UAC UUU UGU GUA GUA CAA-3′. [score:7]
To monitor the expression of miR-200a in target cells, the miR-200a mimic, inhibitor and scrambled control were delivered into SGC7901 and U251 cells. [score:7]
To determine whether the expression of E-cadherin is also under the control of miR-200a in SGC7901 cells, we used the miR-200a mimic to over-express miR-200a, and was performed to detect the expression of ZEB and cadherin/catenin complexes (Fig. 8). [score:7]
Yue et al (24) showed that knockdown of β-catenin by siRNA in human U251 glioma cells inhibited cell proliferation and invasive ability and induced apoptotic cell death; however, in our studies, apoptosis in U251 cells was undetectable after miR-200a -induced β-catenin down-regulation. [score:7]
Expression of miR-200a was up-regulated by approximately 40-fold in cells transfected with the miR-200a mimic. [score:6]
revealed that over -expression of miR-200a could significantly reduce luciferase activity, while down-regulation of miR-200a caused an enhancement of luciferase activity. [score:6]
Wnt/β-catenin signaling was inhibited when the level of miR-200a was up-regulated. [score:6]
It has also been reported that the Wnt/β-catenin signaling pathway regulates the early and late stages of apoptosis in other cancer cells (25, 26), so our studies did not conclusively demonstrate the mechanisms of miR-200a action in U251 cells, and additional mechanisms are possible, such as regulation through direct target genes other than β-catenin, or even through other signaling pathways. [score:6]
MiR-200a regulates the activity of β-catenin through two kinds of mechanism (Fig. 9), and up-regulation of miR-200a is a potential therapeutic strategy for glioma and gastric adenocarcinoma. [score:5]
In an effort to further investigate the effect of miR-200a on the phenotype of tumor cells, we used epithelial tumor cell lines, SGC7901 and U251, and found that over -expression of miR-200a significantly inhibited SGC7901 and U251 cell growth, invasion and induced G0/G1 phase arrest, while reduced expression of miR-200a promoted tumor cell growth and invasion. [score:5]
Modulation of miR-200a expression by a mimic and an inhibitor. [score:5]
Then we found that miR-200a can regulate the expression of β-catenin through not only direct interaction with the 3′ UTR of CTNNB1, but also via interaction with the cadherin/catenin complex. [score:5]
Recently, ZEB1 and ZEB2 have both been suggested to be targets of miR-200a, and miR-200a was demonstrated to cause changes in E-cadherin expression (16, 21, 22). [score:5]
MiR-200a could also regulate tumor cell invasive ability by directly targeting β-catenin. [score:4]
Up-regulation of miR-200a also decreased cellular invasion and metastasis in nasopharyngeal carcinoma cells (15). [score:4]
In addition, using luciferase reporter assays, we demonstrated that the expression of β-catenin was regulated directly by miR-200a in SGC7901 cells. [score:4]
Here, we investigated whether up- or down-regulation of miR-200a expression was accompanied by changes in the activity of the Wnt/β-catenin signal pathway in gastric adenocarcinoma SGC7901 cells and glioblastoma U251 cells. [score:4]
The invasion activity was inhibited by approximately 40% in the miR-200a mimic group (117.7±8.5) and increased (232.3±13.3) in the miR-200a inhibitor group compared with the control (178.3±11.3) and scrambled control (163.0±14.0) groups (Fig. 4B). [score:4]
Furthermore, at the protein level, our results indicate that miR-200a also regulates some downstream targets of Wnt/β-catenin signaling, such as Fra-1, Cyclin D1, and MMPs. [score:4]
Direct evidence for the EMT -inhibitory actions of miR-200a has been revealed in several cancer cell lines, including nasopharyngeal carcinoma, endometrial serous adenocarcinomas, bladder cancer and meningiomas (15– 18). [score:4]
Furthermore, we confirmed that CTNNB1 is a direct target of miR-200a. [score:4]
β-catenin mRNA was also down-regulated by transfection of the miR-200a mimic (Fig. 7C). [score:4]
Meanwhile, in cells transfected with the miR-200a inhibitor, miR-200a expression was reduced by about 80% compared with control (Fig. 1). [score:4]
Over -expression of miR-200a reduced ZEB1, ZEB2 and N-cadherin protein levels, while E-cadherin protein levels were increased, consistent with earlier reports (15, 16, 21, 22). [score:3]
of β-catenin and TCF-4 showed that the location of β-catenin in cells shifts from nuclear to cytoplasmic when the expression of miR-200a increased. [score:3]
Target validation of miR-200a. [score:3]
These results suggest that high levels of miR-200a inhibit the migration and invasion capacity of SGC7901 and U251 cells, while low levels of miR-200a has the opposite effects. [score:3]
was performed to determine the abundance of miR-200a in SGC7901 and U251 cells 48 h after transfection with miR-200a mimic or inhibitor or scrambled negative control. [score:3]
We identified for the first time in gastric adenocarcinoma SGC7901 cells that over -expression of miR-200a reduced levels of ZEB1, ZEB2 and N-cadherin and increase E-cadherin levels. [score:3]
According to TargetScanHuman 5.1, the 3′ UTR of CTNNB1 contains predicted seed regions for miR-200a and miR-141 (Fig. 7A). [score:3]
We have identified β-catenin, encoded by CTNNB1, as a target protein for miR-200a. [score:3]
MiR-200a was reported to down-regulate β-catenin -mediated transcription; however, little is known about the mechanism involved in this activity. [score:3]
MicroRNA-200a, a member of the miR-200 family, stands out as an inhibitor of EMT. [score:3]
The level of miR-200a expression was then examined 48 h after transfection by qRT-PCR. [score:3]
We determined that miR-200a is an inhibitor of EMT in SGC7901 cells. [score:3]
In summary, β-catenin is an important functional target for miR-200a in gastric adenocarcinoma SGC7901 cells and glioblastoma U251 cells. [score:3]
Relationship between miR-200a expression and activity of the β-catenin/Wnt signaling pathway. [score:3]
The miR-200a mimic led to G0/G1 entry, while the miR-200a inhibitor blocked G0/G1 entry (Fig. 6). [score:3]
To determine whether endogenous miR-200 could target the 3′ UTR of CTNNB1 in SGC7901 and U251 cells, the 3′ UTR of CTNNB1 and a mutated CTNNB1 3′ UTR were cloned into a modified pGL-3 control vector, placing it downstream of the luciferase coding sequence. [score:3]
The expression level of miR-200a clearly influenced the biological activity of SGC7901 and U251 cells. [score:3]
CTNNB1 (the gene which encodes β-catenin) has been suggested to be a target of miR-200a (18, 20). [score:3]
These results showed an important correlation between miR-200a expression and activity of β-catenin/Wnt signaling. [score:3]
First we showed that miR-200a can inhibit the activity of the Wnt/β-catenin signaling pathway. [score:3]
Recent studies have reported that miR-200a targets the mRNA of the E-cadherin repressor proteins, ZEB1 and ZEB2. [score:3]
We delivered pGL3-CTNNB1 and pGL3-CTNNB1-mt into cells transfected with the miR-200a mimic or inhibitor. [score:3]
Regulation of tumor cell activity by miR-200a. [score:2]
So it is reasonable for us to consider that the effect of miR-200a on tumor cell growth might be attributed to β-catenin regulation. [score:2]
This study highlights two different mechanisms by which miR-200a regulates the activity of β-catenin. [score:2]
We show that miR-200a can influence the biological characteristics of SGC7901 and U251 cells by regulating the down-stream targets of Wnt/β-catenin signaling. [score:2]
In conclusion, we found that in SGC7901 cells miR-200a regulated both the EMT of the cells and the activity of the Wnt/β-catenin signaling pathway. [score:2]
The induction of apoptosis by inhibiting the activity of the Wnt/β-catenin signaling pathway in tumor cells was not detected in our studies and further investigations are required to explain the role of miR-200a in tumor cells. [score:1]
We considered that miR-200a may play an important role in regulating the activity of the Wnt/β-catenin pathway. [score:1]
We therefore postulate that miR-200a affects the biological activity of tumor cells. [score:1]
We next investigated a functional outcome for the miR-200a -mediated suppression of β-catenin/Wnt signaling. [score:1]
The miR-200a mimic group proliferated at a significantly lower rate than the other groups. [score:1]
Increasing miR-200a levels induces mesenchymal to epithelial transition (MET) in SGC7901 cells. [score:1]
Representative micrographs of wound healing assay and of transwell filters are shown in Fig. 5. The number of cells invading through the matrigel in the miR-200a mimic group was significantly decreased (29.3±4.1), while in the miR-200a inhibitor group it was increased (141.0±7.5) compared to control (59.7±3.0) and scrambled control (58.7±3.8) groups. [score:1]
[1 to 20 of 62 sentences]
6
[+] score: 233
As shown in Fig.   3b, the upregulation of miR-200a by knockdown of XIAP was impaired by overexpression of BIR domain, while alteration of miR-200b and miR-429 was not observed by either knockdown of XIAP or overexpression of BIR domain, revealing the important role of the BIR domain in XIAP inhibition of miR-200a expression. [score:14]
Ectopic expression of miR-200a in T24T cells led to a dramatical reduction of EGFR expression (Fig.   3d), and inhibited expression of miR-200a in T24T(shXIAP) cells could also significantly upregulate the EGFR expression (Fig.   3e, f). [score:14]
As expected, ectopic expression of dominant -negative c-Jun (protein product named as c-Jun(D)), successfully blocked miR-200a expression (Fig.   4f) and increased EGFR protein levels (Fig.   4g), demonstrating an important role of c-Jun activation in XIAP suppression of miR-200a and upregulation of EGFR expression. [score:12]
Among these transcription factors tested, the levels of RelB, p100 protein, and c-Jun phosphorylation (Ser63/73) were upregulated in XIAP knockdown cells, and this upregulation was reversed by ectopic expression of ∆RING, suggesting they are consistent with alteration of miR-200a in those transfectants (Fig.   4c). [score:10]
These data demonstrate that XIAP and its BIR domain inhibit Rac1 expression and subsequently decreasing the PP2A-C phosphorylation at Tyr307 and MAPKK/MAPK/c-Jun activation, and further resulting in miR-200a induction and EGFR translation inhibition, as diagramed in Fig.   6d. [score:9]
In the current study, we found that XIAP BIR domain could regulate EGFR expression through downregulating miR-200a by targeting protein phosphatase 2 (PP2A)/c-Jun axis and further promoted the bladder cancer cell anchorage-independent growth. [score:9]
Taken together, our results demonstrate that BIR domain mediates XIAP inhibition of c-Jun activation (Ser63/73 phosphorylation) and subsequently suppresses miR-200a expression and promotes EGFR protein translation. [score:9]
Since miR-200a binds to the 3′-UTR of EGFR mRNA and inhibits EGFR protein translation, the attenuation of miR-200a expression by BIR domain of XIAP results in the enhancement of EGFR protein translation and increases the anchorage-independent growth of the bladder cancer cells. [score:9]
In conclusion, we demonstrate a novel function of XIAP BIR domain in regulating cancer cell anchorage-independent growth ability through the upregulation of EGFR translation via the inhibition of miR-200a transcription through the Rac1/PP2A/MAPKK/MAPK/c-Jun axis. [score:9]
Further study demonstrated that BIR domain of XIAP was crucial for regulating the EGFR translation by suppressing the transcription and expression of miR-200a. [score:8]
These results indicate that the inactivation of PP2A-C by elevation of phosphorylation at Tyr307 mediates activation of MAPK/MAPKKs/c-Jun, induction of miR-200a, as well as inhibition of EGFR expression in UMUC3(shXIAP/Vector) cells, further supporting that XIAP/BIR-regulated PP2A plays an important role in their mediating EGFR expression. [score:8]
Fig. 3BIR domain -mediated inhibition of miR-200a was responsible for XIAP promotion of EGFR protein translational regulation by targeting EGFR mRNA 3′ UTR. [score:8]
XIAP BIR domain -mediated inhibition of miR-200a was responsible for EGFR protein translational regulation by targeting EGFR mRNA 3′ UTR. [score:8]
The results indicated that overexpressed miR-200a failed to inhibit the mutant EGFR 3′ UTR activity, whereas it significantly inhibited the activity in wild-type EGFR 3′ UTR reporter (Fig.   3h). [score:7]
These results demonstrate that the BIR domain of XIAP promotes EGFR protein expression through suppression of miR-200a expression. [score:7]
c miR-200a expression plasmid was stably transfected to T24T cells and the expression efficiency was determined by real-time PCR. [score:5]
By using online prediction tools Targetscan 6.2 and starBase v2.0 [44, 45], we obtained a number of miRNAs that potentially target EGFR 3′ UTR, including miR-7, miR-27a, miR-27b, miR-133a, miR-133b, miR-141, miR-200a, and miR-302b. [score:5]
Our results showed that miR-200a could bind to EGFR 3′-UTR and inhibit EGFR translation. [score:5]
Further, c-Jun dominant -negative mutant expression plasmid TAM67 was transfected into UMUC3 cells for determining the potential contribution of c-Jun activation to the expression of miR-200a and EGFR. [score:5]
The overexpression of miR-200a/200b/429 expression plasmid was bought from Addgene (Cambridge, MA, USA). [score:5]
As shown in Fig.   4a, knockdown of XIAP significantly increased the promoter activity of miR-200a, overexpressing ∆RING in XIAP knockdown cells reversed the miR-200a promoter activity in the T24T(shXIAP/∆RING) cells. [score:5]
To define the specific transcription factors involved in the regulation of miR-200a, we determined the expression of these transcription factors in various stable transfectants of T24T and UMUC3 cell lines as indicated in Fig.   4c. [score:4]
e miR-200a inhibitor lentivirus was used to infect T24T(shXIAP) cells and the knockdown efficiency was determined by real-time PCR. [score:4]
Mechanistic studies indicated that BIR domain activated the protein phosphatase 2 (PP2A) activity by decreasing the phosphorylation of PP2A at Tyr307 in its catalytic subunit, PP2A-C. Such activated PP2A prevented the deviant phosphorylation and activation of MAPK kinases/MAPKs, their downstream effector c-Jun, and in turn inhibiting transcription of c-Jun-regulated the miR-200a. [score:4]
The results obtained from quantitative real-time PCR indicated that only miR200a was significantly increased upon knockdown of XIAP, indicating that miR-200a is the potential miRNA that might be negatively regulated by XIAP. [score:3]
To evaluate the effect of miR-200a on EGFR, we generated stable T24T transfectant expressing miR-200a, which showed over 22-fold expression of miR-200a in comparison to the corresponding empty vector transfectant (Fig.   3c). [score:3]
XIAP BIR domain promoted miR-200a transcription by inhibiting c-Jun protein phosphorylation at Ser63/73. [score:3]
The inhibition of c-Jun further leads to a reduction of miR-200a transcription. [score:3]
These results suggested that EGFR mRNA was likely to be targeted by miR-200a. [score:3]
f TAM67 was stably transfected into UMUC3 cells, and real-time PCR was used to determine the miR-200a expression. [score:3]
Fig. 4XIAP BIR domain promoted miR-200a transcription by inhibiting c-Jun protein phosphorylation at Ser63/73. [score:3]
The miR200a inhibitor lentivirus was packaged in 293T cells with pCMV delta R8.2 and pMD2. [score:3]
d T24T(Vector) and T24T(miR-200a) cells were subjected to Western blotting to determine the EGFR expression. [score:3]
To clarify if miR-200a could directly bind to 3′ UTR of the EGFR mRNA, we introduced point mutations of miR-200a binding site in EGFR 3′ UTR as indicated in Fig.   3g. [score:3]
miR-200a, the anti-tumor microRNA, is able to inhibit the epithelial-mesenchymal transition and reverse the resistance to anti-EGFR therapy [61, 62]. [score:3]
Further analysis revealed that the knockdown of XIAP could lead to a high phosphorylation level of PP2A, and subsequently activate the MAPK kinase/MAPK pathway, leading to a high phosphorylation level of c-Jun at ser63 and ser73, which could bind to the miR-200a promoter region and promote the transcription of miR-200a. [score:2]
The miR-200a binding site point mutation of EGFR 3′-UTR luciferase reporter was constructed in our lab based on the wild-type EGFR 3′-UTR luciferase reporter. [score:2]
In this study, we also show a new mechanism for XIAP BIR domain in regulating miR-200a through Rac1/PP2A/MAPKK/MAPK/c-Jun axis. [score:2]
Taken together, we therefore demonstrate that BIR domains regulated the miR-200a transcription through the PP2A-related MAPK/c-Jun activation for the first time. [score:2]
g EGFR 3′-UTR Luciferase reporter and its miR-200a binding site point mutation were diagramed as indicated. [score:2]
The miR-200a knockdown plasmid was purchased from GeneCopoeia (Rockville, MD, USA). [score:2]
b Expression levels of the miR-200a/200b/429 cluster in the indicated three stable cells were evaluated by real-time PCR. [score:1]
b The diagram of predicted transcription factor binding sites in miR-200a promoter region. [score:1]
EGFR mRNA 3′ UTR luciferase reporter, miR-200a/200b/429 promoter luciferase reporter, was stably transfected into cultured cells. [score:1]
We next performed a bioinformatics scan on the promoter region of miR-200a, and several potential binding sites for transcription factors were shown in the miR-200a promoter region, including the binding sites for c-Jun, E2F1, STAT3, NF-κB, and Sp-1 (Fig.   4b). [score:1]
To further test this notion, the levels of the miR200a-200b-429 cluster were analyzed in T24T(Nonsense), T24T(shXIAP), and T24T(shXIAP/∆RING) cells. [score:1]
[1 to 20 of 46 sentences]
7
[+] score: 221
The up-regulation of ZEB2 expression inhibited the increase in E-cadherin expression, ZO1 expression as well as the loss of N-cadherin expression induced by miR-200a. [score:14]
In this study, we found that the down-regulation of miR-200a may promote the metastasis of SP cells, whereas the up-regulation of miR-200a inhibited the metastasis of SP cells. [score:9]
We also over-expressed or downregulated the miR-200a expression in MHCC-97H, and by western-blot we determined that miR-200a had the opposite function of ZEB2 (Fig. 7B). [score:8]
In addition, immunohistochemistry revealed that miR-200a expression was inversely correlated with ZEB2 expression but was positively correlated with E-cadherin expression (Fig. 6G). [score:7]
Immunohistochemistry revealed that miR-200a expression was inversely correlated with ZEB2 expression but was positively correlated with E-cadherin expression (Fig. 2A,B). [score:7]
In this study, we found that miR-200a inhibited ZEB2 expression by binding to the ZEB2 promoter, which inhibits epithelial to mesenchymal transition. [score:7]
In contrast, the knockdown of miR-200a increased ZEB2 and N-cadherin expression and decreased E-cadherin and ZO1 expression in the Huh7-SP-KD-miR-200a group. [score:6]
The upregulation of miR-200a expression decreased the ability of the MHCC-97H-SP cells to invade and migrate. [score:6]
In this study we found that miR-200a expression was significantly downregulated in SP cells of human HCC cell lines and HCC tissues. [score:6]
MiRNA expression profiling has shown that miR-200a is frequently downregulated [23, 24, 25, 26]. [score:6]
MiR-200a inhibits the metastasis of SP cells in vitroThe index of miR-200a expression in SP cells of MHCC-97H and Huh7 was significantly lower than that in NSP cells from both the MHCC-97H and Huh7 cell lines (Fig. 5A). [score:5]
MiR-200a decreased ZEB2 and N-cadherin expression and increased E-cadherin and ZO1 expression in the MHCC-97H-SP-miR-200a group. [score:5]
E-cadherin and ZO-1 were over-expressed in the MHCC-97H-SP-miR-200a group but were weakly-expressed in the Huh7-SP-KD-miR-200a group. [score:5]
Conversely, the inhibition of miR-200a expression in Huh7-SP cells enhanced the ability of the SP cells to invade and migrate (Fig. 5D). [score:5]
In this study, we show that low expression of miR-200a promotes human HCC SP cells to metastasize through the transactivation of ZEB2 expression, which results in the induction of EMT. [score:5]
The down-regulation of ZEB2 significantly reduced the migration and invasion abilities of the cells, which was induced by miR-200a knockdown. [score:5]
The up-regulation of ZEB2 rescued the miR-200a -induced decrease in cell migration and invasion (Fig. 7G). [score:4]
Downregulation of miR-200a is associated with metastasis of HCC and poor prognosis. [score:4]
MiR-200a decreased N-cadherin expression and increased E-cadherin expression. [score:4]
MiR-200a is inversely correlated with ZEB2 expression but is positively correlated with E-cadherin expression. [score:4]
In breast and ovarian cancer, the down-regulation of miR-200a plays an important role in cancer metastasis [14, 15, 16]. [score:4]
We compared the low (51 cases) and high (50 cases) miR-200a expression groups (Table 1) and found that low expression of miR-200a strongly correlated with metastasis (P=0.011). [score:4]
In contrast, the down-regulation of miR-200a increased the incidence of lung metastasis and the number of metastatic lung nodules on the surface but decreased the overall survival time in the Huh7-SP-KD-miR-200a group (Fig. 6B,C,D,F). [score:4]
The multivariate Cox regression analysis revealed that low expression of miR-200a (P < 0.001) as well as differentiation and metastasis were independent prognostic factors of patient survival (Table 2, lower panel). [score:3]
In addition, these clinical data strongly indicate that low expression of miR-200a contributes to the metastasis of HCC. [score:3]
The gene expression level of miR-200a was 0.59±0.08 in the tumor specimens and 1.40±0.41 in the corresponding non-tumor tissues (Fig. 1A). [score:3]
MiR-200a is down-regulated in HCC. [score:3]
Figure 5Functional analysis of miR-200a in vitro(A) MiR-200a expression in a subpopulation in human HCC cell lines. [score:3]
Expression of miR-200a after transfection was confirmed by qRT-PCR (Fig. 5B). [score:3]
MiR-200a mimics and a miR-200a inhibitor had no effect on the activity of 3′UTR mutant (MT) ZEB2 (Fig. 7C) (Y-axis signifies the luciferase activity of ZEB2). [score:3]
Association of miR-200a expression with the clinicopathologic factors of 101 patients with HCC. [score:3]
The index of miR-200a expression in the HCC cell lines MHCC-97H, HepG2, Huh-7 and SMMC-7721 was significantly lower than in the normal human hepatocyte cell line HL-7702 (Fig. 1B). [score:3]
We found that miR-200a was significantly downregulated in the SP cells of HCC compared with the fetal liver cells [21]. [score:3]
The in vivo metastatic assay showed that the upregulation of miR-200a decreased the incidence of lung metastasis and the number of metastatic lung nodules on the surface, but increased the overall survival time in the MHCC-97H-SP-miR-200a group. [score:3]
The index of miR-200a expression in SP cells of MHCC-97H and Huh7 was significantly lower than that in NSP cells from both the MHCC-97H and Huh7 cell lines (Fig. 5A). [score:3]
Figure 7(A) The miR-200a target site in the 3′UTR of ZEB2. [score:3]
The correlation between miR-200a expression and EMT. [score:3]
Patients in the low miR-200a expression group had a significantly shorter overall survival (P < 0.01); * P < 0.05, t test. [score:3]
As in the case with HCC cell lines, miR-200a expression was much lower in HCC tissues from patients who developed metastasis than in patients who did not develop metastasis. [score:3]
The Kaplan-Meier analysis revealed that low miR-200a expression was associated with a shorter overall survival (P < 0.01) (Fig. 1D). [score:3]
In our previous studies, we found that miR-200a inhibits the EMT process via the activation of transcriptional factors such as ZEB2, which is required during EMT; this has been thoroughly demonstrated in rat hepatic oval cells [22]. [score:3]
Figure 2 (A) An immunohistochemical analysis of miR-200a, ZEB2, and E-cadherin expression in HCC tissues and in adjacent non-tumor tissues. [score:3]
A luciferase reporter gene assay showed that, compared with the NC group, miR-200a mimics significantly inhibited the 3′UTR wild-type (WT) ZEB2 activity (P < 0.01) and a miR-200a inhibitor significantly increased its activity (P < 0.01). [score:3]
Recently, it was reported that miR-200a plays a crucial role in the development of cancer through its regulation of epithelial to mesenchymal transition (EMT), cell migration, proliferation and metastasis [11, 12, 13]. [score:3]
The target site of miR-200a in the 3′UTR of ZEB2 was predicted (Fig. 7A). [score:3]
MiR-200a inhibits the metastasis of SP cells in vivoSP cells were injected into the caudal vein of nude mice. [score:2]
MiR-200a induces the metastasis of SP cells through the transactivation of ZEB2 expression. [score:2]
The human miR-200a gene was constructed in GV254 (Genechem, China) and designated as either LV-miR-200a or LV-knockdown-miR-200a (LV-KD-miR-200a). [score:2]
MiR-200a inhibits the metastasis of SP cells in vivo. [score:2]
MiR-200a inhibits the metastasis of SP cells in vitro. [score:2]
The level of miR-200a expression was significantly lower in 74 cases of primary tumors with clinically confirmed metastasis compared with the 27 cases without metastasis (Fig. 1C). [score:2]
MiR-200a expression was analyzed in primary tumor specimens from 101 patients with HCC. [score:2]
We further investigated the possible relationship between miR-200a, ZEB2 and E-cadherin expression in human HCC tissues. [score:1]
There were no obvious metastatic nodules in the lungs of mice in the MHCC-97H-SP-miR-200a group. [score:1]
Figure 1(A) The expression of miR-200a in HCC tissue specimens and in corresponding non-tumor tissues was measured by qRT-PCR. [score:1]
Thus, the miR-200a -mediated ZEB2/EMT signaling pathway is essential for SP cells in HCC cell lines to metastasize. [score:1]
In conclusion, this study delineates the function of miR-200a in SP cells of HCC. [score:1]
Functional analysis of miR-200a in vitro. [score:1]
In contrast, metastatic nodules were observed in the lungs of mice in the Huh7-SP-KD-miR-200a group, whereas no metastatic nodules were found in mice in the Huh7-SP-KD-Control group (Fig. 6E). [score:1]
[1 to 20 of 59 sentences]
8
[+] score: 216
Studies showed that miR-200 inhibits EMT by targeting ZEB1 and ZEB2[52] and our studies showed that overexpression of miR-200a, miR-200b, miR-15a, miR-429, and miR-203 decreased the protein expression of Mesenchymalmarkers i. e. N-cadherin, Vimentin, Snail, β-Catenin (Fig 3A, 3B and 3C) showing these miRNAs can promote mesenchymal to epithelial transition (MET). [score:9]
Ourstudies show that altering the expression of a group of miRNAs that include miR-15a, miR-200a, miR-200b, miR-429, and miR-203 produced a significant down-regulation of the expression of BMI1 in the breast cancer cell lines, MDAMB-231 and BT549. [score:8]
Overexpression of miR-200a, miR-200b, miR-15a, miR-429 and miR-203 not only down-regulated the expression of BMI1protein, but also that of RING1A and RING1B, which also belong to PRC1 complex(Figs 1B, 2A and 2B). [score:8]
Our previous experiments demonstrated that the ectopic expression of miR-200a, miR-200b, miR-15a, miR-429, miR-203 inhibited the expression of PRC1 group of protein BMI1. [score:7]
Overexpression of miR-200a, miR-200b, miR-15a, miR-429 and miR-203 leads to inhibition ofPRC-1 group of protein expression. [score:7]
A significant down-regulation in the expression of BMI1 was seen in cells having the ectopic expression of miR-15a, miR-200a, miR-200b, miR-429 and miR-203 when compared to control cells transfected with scrambled miRNAs (Fig 1B). [score:7]
Interestingly, overexpression of miR-200a, miR-200b and miR-203 in MDAMB-231 cells followed by treatment with SAHA lead to a down-regulation of HDAC1, HDAC2, HDAC6 and HDAC8 protein expression levels when compared to SAHA treated control cells transfected with scramble miRNAas well as cells that were treated with SAHA alone (Fig 6E). [score:7]
Interestingly, overexpressionof miR-200a, miR-200b, miR-15a, resulted in the down-regulation of BMI1 and UbH2A in the CD44+ Cancer Stem Cell population of MDAMB-231 cells(Fig 6A, 6B and 6C) demonstrating a definite role in maintaining gene silencing and maintainingcancer stemness. [score:6]
Our results uniquely showed that miR-200a, miR-200b, miR-15a, miR-429, miR-203 significantly down-regulatedprotein expression levels of Ub-H2A in MDAMB-231 and BT-549 cells (Fig 2A and 2B). [score:6]
miR-200a, miR-200b, miR-15a inhibits CD44 expression in CSCs. [score:5]
0190245.g002 Fig 2 Expression of BMI1, RING1A, RING1B and Ub-H2A in MDAMB-231(A) and BT549 (B) cells having overexpression of miR-200a, miR-200b, miR-15a, miR-429, miR-203. [score:5]
Expression of BMI1, Ub-H2A protein in MDAMB-231cells transfected with Anti-miR- 200a, Anti-miR-200b, Anti-miR-15a, Anti-miR-449, Anti-miR-203 (C) BMI1, RING1A localization in MDAMB-231 cells having overexpressed miR-200a, miR-200b, miR-15a, miR-449, miR-203under confocal microscopy (D, E). [score:5]
Our studies with qRT-PCR show that a limited set of miRNAs(miR-200a, miR-200b, miR-15a, miR-429, and miR-203)are up-regulated upon knock-downof PRC1 complex of protein BMI1(Fig 1A). [score:5]
0190245.g003 Fig 3 Level of expression of N-cadherin, Vimentin, β-Catenin, ZEB-1, Snailin MDAMB-231cells having overexpressed miR-200a, miR-200b, miR-15a, miR-429, and miR-203(A). [score:5]
Protein expression of various HDACs in cells having overexpression of miR-200a, miR-200b and miR-203. [score:5]
Protein expression of BMI1wasanalyzed by performing western blotting in BT-549 cells having overexpressed miR-200a, miR-200b, miR-15a, miR-429, and miR-203. [score:5]
miR-200a, miR-200b and miR-15a down-regulated BMI1 and Ub-H2A116, CD44 expression when compared to other miRNAs and scramble transfected control cells (Fig 6C and S5 Fig). [score:5]
Expression of BMI1, RING1A, RING1B and Ub-H2A in MDAMB-231(A) and BT549 (B) cells having overexpression of miR-200a, miR-200b, miR-15a, miR-429, miR-203. [score:5]
S5 Fig Expression of CD44 in CSCs cells having overexpression miR-200a, miR-200b, miR-15a, miR-429, miR-203. [score:5]
We also show for the first time that the sensitivity of MDAMB-231 cells to cisplatinand histone deacetylase inhibitor (HDACi) SAHAis elevated upon overexpressing miR-15a and miR-200a, miR-200b, miR-203. [score:5]
miR-200a, miR-200b, miR-15a, miR-429, and miR-203 were overexpressed in MDAMB-231 cells and the expression of mesenchymal markers, N-cadherin, Vimentin, ZEB-1, snail andβ-catenin were checked at protein level. [score:5]
Level of expression of N-cadherin, Vimentin, β-Catenin, ZEB-1, Snailin MDAMB-231cells having overexpressed miR-200a, miR-200b, miR-15a, miR-429, and miR-203(A). [score:5]
We have shown that the miR-200a, miR-200b, miR-15a, miR-429 and miR-203 coordinately regulate expression of PRC1 group of proteins and also affect the rate of Mesenchymal to Epithelial transition (MET) in MDAMB-231 cells. [score:4]
To confirm that miR-15a, miR-200a, miR-200b, miR-203 and miR-429, have the binding sites in 3′UTRs of BMI1 and regulates the expression of BMI1 in MDAMB-231, cells were seeded in 12-well plates and co -transfected with the individual miRNA along with wild (wt) BMI1in psiCHECK2 vector as well as with mutant (Mut) BMI1psiCHECK2 reporter plasmids separately. [score:4]
Only miR-200a, miR-200b and miR-203 were up-regulated when MDAMB-231 and BT-549 cells were treated with SAHA, aHDACi. [score:4]
The miR-200 family suppresses Epithelial to Mesenchymal Transition (EMT) by regulating ZEB1 and ZEB2transcription factors. [score:4]
Antagonizing miR-15a, miR-200a, miR-200b, miR-429, and miR-203 reversed the effects generated by overexpression of these miRNAsconfirming the roles of these miRNAs on BMI1 protein and Ub-H2A116 (Fig 2C). [score:3]
Tocorroborate specifically that these miRNAstarget BMI1, MDAMB-231 cells were transfected with anti-miR-15a, anti-miR-200a, anti-miR-200b, anti-miR-429 and anti-miR-203. [score:3]
Both MDAMB-231 and BT-549 cells were treated with 2μM of SAHA and the expression levels of miR-200a, miR-200b, miR-15a, miR-429, and miR-203 was checked. [score:3]
studies showed a reduced N-cadherin, Vimentin signal upon miR-200a, miR-200b, miR-15a, miR-15a, miR-429, and miR-203 overexpression compared to control cells transfected with scramble miRNA vector(Fig 3B and 3C) confirming that miR-200a, miR-200b, miR-15a, miR-429, and miR-203 plays a very crucial role in METby regulating BMI1. [score:3]
miR-200a, miR-200b, miR-15a, miR-429, miR-203 inhibits migration and cell proliferation. [score:3]
miR-200a, miR-200b, miR-15atargets BMI1 in CD44 enriched cancer stem cells (CSCs). [score:3]
After 24 hrs, miR-15a, miR-200a, miR-200b, miR-429 and miR-203 were ectopically expressed and the cells were incubated for 24 hrs. [score:3]
S2 Fig data showing expression of RING1B in MDAMB-231cells upon transfection with miR-15, miR-200a, miR-200b, miR-429 and miR-203. [score:3]
After 24 hrs, miR-15a, miR-200a, miR-200b, miR-429 and miR-203 were ectopically expressed and the cells were incubated for 48 hrs. [score:3]
Expression of miR-15a, miR-200a, miR-200b, miR-429, miR-203 were elevated in BMI1 knock-down samples in both MDAMB-231 and BT-549 cells compared to un -transfected MDAMB-231 and BT-549 cells that served as control(Fig 1A). [score:3]
Protein expression of BMI1 and Ub-H2A in CD44+ population transfected with miR-200a, miR-200b, miR-15a, miR-429 and miR-203 (C). [score:3]
indicated a significant increase in miR-200a, miR-200b and miR-203 expression whereas miR-15a, miR-429, did not show any significant change(Fig 6D). [score:3]
S7 Fig Trypan Blue assay shows cell viability upon overexpression of miR-200a, miR-200b, miR-15a, miR-429 and miR-302 in MDAMB-231 cells. [score:2]
Cell viability assay upon overexpression of miR-200a, miR-200b, miR-15a, miR-429 miR-302 in MDAMB-231 cells. [score:2]
Also to check the cell viability upon overexpression of miR-200a, miR-200b, miR-15a, miR-429, miR-203 we perfomed the trypan blue assay. [score:2]
miR-200a, miR-200b, miR-15a, miR-429, miR-203 regulate PRC1 proteins in MDAMB-231 cells. [score:2]
S6 Fig cell proliferation assay upon overexpression of miR-200a, miR-200b, miR-15a, miR-429 and miR-302 in MDAMB-231 cells. [score:2]
The vector with the wild-type BMI1 3’UTR was co -transfected along with miR-15a, miR-200a, miR-200b, miR-429, and miR-203 respectively into MDAMB-231 cells. [score:1]
miR-15a, miR-200a, miR-200b, miR-429 and miR-203 showed a clear binding to the 3’UTR of BMI1 (S1 Fig). [score:1]
miR-200a, miR-200b, miR-15a, miR-429 and miR-203 were transfected to BT-549 and MDAMB-231cells in 60 mm dishes and the cells were incubated for 48 hrs. [score:1]
Here we illustrate the unique role of miRNAsin their dramatic participation in breast cancer cells and our data demonstrates that the levels of PRC group of proteins in breast cancer cell lines MDAMB-231 and BT-549 can be altered by using the miRNAs i. e. miR-200a, miR-200b, miR-15a, miR-429and miR-203 which have possible binding sites at the 3’UTR sequences of BMI1. [score:1]
miR-200a, miR-200b, miR-15a, miR-429and miR-203 promote Mesenchymal to Epithelial transition. [score:1]
miR-200a, miR-200b, miR-15a, miR-429 and miR-203 weretransfected into both MDAMB-231(Fig 2A) and BT-549 (Fig 2B) cells. [score:1]
Antagonizing miR-200a, miR-200b, miR-15a, miR-429, and miR-203 enhances BMI1. [score:1]
miR-200a, miR-200b, miR-15a, miR-429 and miR-302 reduced cell proliferation in MDAMB-231 cells. [score:1]
miR-200a, miR-200b, miR-429, and miR-203 induce Mesenchymal to Epithelial transition. [score:1]
To see whether the same set of miRNAs produce any effect on anchorage independent growth, MDAMB-231 cells transfected with miR-15a, miR-200a, miR-200b, miR-429, miR-203were trypsinized after 48hrsof incubation and further allowed to incubate in soft agar for 3 weeks. [score:1]
Anti-proliferative activity of miR-200a, miR-200b, miR-15a, miR-429, miR-203 in various cancers has been previously reported [25, 27]. [score:1]
PMIRH15PA-1, miR-200a Cat#. [score:1]
No significant change was observed upon co-transfection of Mut-3’BMI1 UTR with miR-15a, miR-200a, miR-200b, miR-429, and miR-203(Fig 1D). [score:1]
miR-200a, miR-200b, miR-15a, miR-429, miR-203reduces cell proliferation of MDAMB-231 cells. [score:1]
miR-200a, miR-200b, miR-15a, miR-429, and miR-203 were transfected into the cells. [score:1]
miR-200a, miR-200b, miR-15a, miR-429, and miR-203 reduces rate of migration invasion and anchorage-independent growth ofMDAMB-231 cells. [score:1]
The binding sites of the miR-200a, miR-200b, miR-15a, miR-203 and miR-429 on BMI1 3’ UTR and EZH2 3’ UTR were identified with the help of the software tool, miRTarBase (http://mirtarbase. [score:1]
After 24 hrs, cells were transfected with miR-200a, miR-200b, miR-15a, miR-429 and miR-203. [score:1]
wt-BMI1 3’ UTR and Mut-BMI1 3’UTR were overexpressed along with miR-200a, miR-200b, miR-15a, miR-429, miR-203 and luciferase activity was measured (C,D). [score:1]
4100999–001), anti-miR-200a (Exiqon, cat #. [score:1]
To further our observation we next performed immunocytochemistry in MDAMB-231 cells transfected with miR-200a, miR-200b, miR-15a, miR-429, and miR-203. [score:1]
miR-200a, miR-200b, miR-15a, miR-429, and miR-203 could bring an exciting new dimension in the field of clinical management of human cancer in coming future. [score:1]
These results conclude that miR-200a, miR-200b, miR-15acould reduce cancer stemness thorough repressing BMI1 protein. [score:1]
Levels of miR-200a, miR-200b, miR-15a, miR-429 and miR-203 in MDAMB-231 and BT-549 cells treated with SAHA. [score:1]
[1 to 20 of 67 sentences]
9
[+] score: 215
Since miR-200 family members repress ZEB1 expression [27], [30] and ZEB1 is expressed in LY2 cells (Fig. 2), we used siRNA to knockdown ZEB1 expression in LY2 cells and examined cell proliferation by BrdU incorporation. [score:8]
B, In endocrine-resistant cells that have undergone EMT, miR-200 family expression is low, resulting in increased ZEB1 protein which inhibits E-cadherin expression. [score:7]
miR-200 family members regulate EMT by suppressing expression of transcriptional repressors ZEB1/2. [score:6]
Inhibitors of Deacetylation and Methylation Increase miR-200 Family Expression in LY2 Cells. [score:5]
Many studies have identified an inverse relationship between the expression of the miR-200 family and its targets ZEB1/2 in cells [27], [28], [29], [30], [31]. [score:5]
To determine if decreased expression of miR-200 family members in LY2 cells is due to methylation and histone deacetylation, LY2 cells were treated with 2.5 µM 5-aza-dC alone or in combination with 100 ng/µl TSA, a histone deacetylase (HDAC) inhibitor, for 72 h. TSA was added in the last 16 h of the treatment period [52]. [score:5]
Overexpression of miR-200b or miR-200c partially restores antiestrogen sensitivity to LY2 cells, but other molecules and/or pathways known to be involved in antiestrogen-resistance such as coregulators [40], [41], [42], altered growth factor signaling [43], [44], [45], NFκB activation [46], [47], or other dysregulated microRNAs in addition to the miR-200 family [32] may also be involved in the phenotype of these cells. [score:5]
Further, miR-200 had pro-metastatic activity in a mouse mo del of breast cancer metastasis by targeting Sec23a, a suppressor of metastasis [68]. [score:5]
Our data indicate that reduced miRNA-200b and miR-200c expression contributes to endocrine resistance in breast cancer cells and that the reduced expression of these miR-200 family members in endocrine-resistant cells can be reversed by 5-aza-dC+TSA. [score:5]
10 nM E [2] and 100 nM 4-OHT significantly decreased miR-200a and miR-200b expression in MCF-7 cells, but had no effect on miR-200c expression. [score:5]
In endocrine-sensitive luminal breast cancer cells, expression of miR-200 family members represses ZEB1, thus E-cadherin is expressed and vimentin is repressed and cells have an epithelial phenotype. [score:5]
Although studies have identified a role for miR-200 as a suppressor of EMT, there is little evidence for a role of miR-200 as a suppressor of endocrine resistance in breast cancer cells, hence the novelty of these data. [score:5]
Our results show that there is an inverse relationship between the expression of miR-200 family expression and ZEB1 mRNA in LY2 cells. [score:5]
Here we examined the expression of miR-200a, miR-200b, and miR-200c and their regulation by estradiol (E [2]) and 4-hydroxytamoxifen (4-OHT), an active TAM metabolite, in a panel of ERα -positive breast cancer cell lines derived from MCF-7 endocrine-sensitive cells representing a cellular mo del of progression towards endocrine/TAM-resistance. [score:4]
The miR-200bc/429 cluster differs from the miR-200a/141 cluster by the fourth nucleotide (U to C) in the seed region; thus, they regulate different target genes in breast cancer [25]. [score:4]
Microarray analysis of miRNA expression revealed low expression of miR-200a, miR-200b, and miR-200c in LY2 endocrine-resistant breast cancer cells compared to MCF-7 endocrine-sensitive breast cancer cells [32]. [score:4]
Values are the mean ± SEM of 3 experiments and are expressed as fold relative to EtOH -treated MCF-7. *p<0.05 versus EtOH -treated MCF-7. To examine if expression of miR-200 family members affects sensitivity of endocrine-resistant LY2 cells to antiestrogens, cells were transiently transfected with precursors for miR-200a, miR-200b, and miR-200c and MTT cell viability assays were performed in cells treated with vehicle control, 4-OHT, or fulvestrant for 6 days (Fig. 3A). [score:4]
This is the first report of 4-OHT regulation of miR-200 family expression in LCC1, LCC2, LCC9 and LY2 cells. [score:4]
Figure S1 Effect of E [2] and 4-OHT on the expression of miR-200 family members in MCF-7, LCC1, LCC2, LCC9, and LY2 cells. [score:3]
LY2 cells were transfected with pre-miR-200a, pre-miR-200b, or pre-miR-200c for 3 d. RNA was harvested at 3 days and qPCR was used to confirm overexpression of miR-200. [score:3]
Expression of miR-200 Family in MCF-7, LCC1, LCC2, LCC9 and LY2 Human Breast Cancer Cells. [score:3]
However, there was no effect of E [2] and 4-OHT on the expression of miR-200 family in LCC2, LCC9 and LY2, reflecting their endocrine resistance. [score:3]
We suggest that in addition to being a biomarker for EMT, reduced miR-200 expression may serve as a prognostic marker in acquired endocrine resistance. [score:3]
Resistance of pancreatic cancer cells to gemcitabine was reduced by treatment with natural compounds such curcumin, which increased miR-200 expression [56], [57], [58], [59]. [score:3]
Figure S5 Overexpression of miR-200 in transfected cells. [score:3]
Expression of miR-200 family members in MCF-7, LCC1, LCC2, LCC9 and LY2 cells. [score:3]
There was no difference in basal miR-200a, miR-200b, or miR-200c expression between MCF-7 and LCC1 cells. [score:3]
Cells were serum-starved for 48 h and then treated with vehicle control EtOH, 10 nM E [2], or 100 nM 4-OHT for 6 h. miR-200 expression was quantified by qPCR. [score:3]
LY2 cells had undetectable levels of miR-200 family expression. [score:3]
miR-200 family members repress ZEB1 expression at the mRNA and protein levels [14], [26], [27], [28]. [score:3]
We and others previously reported that E [2] reduces miR-200 family expression in MCF-7 cells [32], [39]. [score:3]
For example, miR-200 family expression is a marker of poor prognosis and chemoresistance in ovarian cancer [64], [65], [66]. [score:3]
LY2 cell viability was unaffected by overexpression of miR-200a regardless of treatment (Fig. 3A). [score:3]
miR-200 family expression was progressively reduced in a breast cancer cell line mo del of advancing endocrine/tamoxifen (TAM) resistance. [score:3]
Decreased miR-200 family expression in LY2 cells could be due to epigenetic changes in the promoter, e. g., DNA methylation and histone deacetylation. [score:3]
Notably, there is an inverse relationship between the expression of miR-200 family and ZEB1 in LY2 cells (compare Fig. 1 and 2). [score:3]
Basal miR-200 and the effect of E [2] and 4-OHT on miR-200 expression was examined by qPCR in the cell lines described above (Fig. 1 and Fig. S1). [score:3]
Similarly, gemcitabine-resistant pancreatic cancer is associated with decreased miR-200 expression [55]. [score:3]
We report a progressive decrease in the expression of miR-200a, miR-200b, and miR-200c in an MCF-7-derived cell line mo del of TAM/endocrine resistance, i. e., decreasing from MCF-7, LCC1, LCC2, LCC9, to LY2, respectively. [score:3]
Cells expressing miR-200a did not show a change in morphology or change in sensitivity to antiestrogens. [score:3]
Concomitant with miR-200 decrease, there was an increase in ZEB1 mRNA expression. [score:3]
Figure S6 Overexpression of miR-200 family after 3d of transfection. [score:3]
Epigenetic changes in chromatin structure may be responsible for reduced expression of miR-200 family members in LY2 cells. [score:3]
Contrary to the expected decrease in miR-200 expression in metastatic cells, high levels of miR-200b and miR-200c were detected in 4T1 metastatic mouse mammary tumor cells [67]. [score:3]
Our study agrees with these reports of epigenetic silencing of the miR-200 family, because we demonstrated that treatment of LY2 cells with 5-aza-dC+TSA increased miR-200b and miR-200c expression. [score:3]
Overexpression of miR-200 family changes LY2 cell morphology from a mesenchymal to an epithelial appearance. [score:3]
qPCR performed to confirm overexpression of miR-200a, miR-200b or miR-200c. [score:3]
0062334.g001 Figure 1Cells were serum-starved for 48 h and then treated with vehicle control EtOH, 10 nM E [2], or 100 nM 4-OHT for 6 h. miR-200 expression was quantified by qPCR. [score:3]
Similarly, E [2] significantly decreased the expression of miR-200a, miR-200b, and miR-200c in estrogen-independent, but TAM-sensitive LCC1 cells. [score:3]
Reduced expression of the miR-200 family has been observed in breast, ovarian, endometrial, lung and gastric cancer [26]. [score:3]
Overexpression of miR-200a had no effect on LY2 cell appearance (Fig. 5B), in agreement with the lack of effect of miR-200a on cell viability (Fig. 3A). [score:3]
These data are in agreement with other reports showing an inverse correlation between miR-200 family and ZEB1 expression in basal-like, triple negative breast cancer (TNBC) cells such as MDA-MB-231 and BT549 [14], [28], [30], [31]. [score:3]
Increased miR-200a, miR-200b and miR-200c expression was confirmed by qPCR even 11 days after transfection, as well as earlier time points (Fig. S2 and data not shown). [score:3]
Previously we reported that the expression of miR-200a, miR-200b, and miR-200c was lower in LY2 endocrine-resistant, mesenchymal breast cancer cells compared to parental, endocrine sensitive, epithelial MCF-7 breast cancer cells. [score:2]
Although miR-200 is considered a tumor suppressor miRNA, there are some reports of its role as an oncogene or oncomiR. [score:2]
However, LCC2 and LCC9 cells had lower miR-200 family member expression compared to MCF-7 cells. [score:2]
A, LY2 cells were either untransfected (No TF) or transfected with negative control (Neg control) or pre-miR-200a, miR-200b or miR-200c. [score:1]
Members of the miR-200 family and miR-221/222 are implicated in EMT and metastasis [9]. [score:1]
0062334.g003 Figure 3 A, LY2 cells were either untransfected (No TF) or transfected with negative control (Neg control) or pre-miR-200a, miR-200b or miR-200c. [score:1]
These studies demonstrate that loss of miR-200 has roles in multiple types of drug resistance. [score:1]
The miR-200 family of miRNAs are transcribed from two chromosomal locations: miR-200b, miR-200a, and miR-429 are located on chromosome 1p36; while miR-200c and miR-141 are located on chromosome 12p13 [14]. [score:1]
LY2 cells were transfected with negative control, pre-miR-200a, pre-miR-200b, or pre-miR-200c. [score:1]
LY2 cells were transfected either with pre-miR-200a, pre-miR-200b or pre-miR-200c. [score:1]
Mo del of function of miR-200 family members in endocrine resistance in breast cancer cells. [score:1]
Figure S7 LY2 cells were transfected with control Pre-miR miRNA negative control #1 (Ambion), pre-miR-200a, pre-miR-200b, or pre-miR-200c for 3 d. A–D. [score:1]
These studies reflect cell context-specific roles for miR-200 family members that require further study. [score:1]
To follow up on this initial observation, the expression of miR-200a, miR-200b and miR-200c was measured by qPCR in a panel of human breast cancer cell lines, i. e., LCC1, LCC2 and LCC9 cells that were derived from the parental MCF-7 cell line by propagation first as a xenograft in ovariectomized, athymic nude mice (LCC1), and then in long-term culture with tamoxifen (LCC2) or fulvestrant (LCC9) [33]. [score:1]
A role for miR-200 family in drug resistance, i. e., paclitaxel, was reported in ovarian cancer [54]. [score:1]
Our results indicate a role for loss of miR-200 family members and increased ZEB1 in conferring resistance to antiestrogens in breast cancer. [score:1]
[1 to 20 of 69 sentences]
10
[+] score: 210
Other miRNAs from this paper: hsa-mir-31
Selective targeting of DLL3 or ACOT7 recapitulates miR-31 and/or miR-200a -mediated suppression of Y79 cell proliferationTo determine if selective reduction of endogenous DLL3, PPP6C, STK40, or ACOT7 could recapitulate the inhibitory effect on proliferation mediated by miRNAs-31 and/or -200a, we transiently introduced small interfering RNAs (siRNAs) that are designed to target specific mRNAs for degradation (Fig 7). [score:9]
mirVana [TM] miRNA inhibitor transfectionsHuman retinoblastoma cell lines (Y79 and Weri1) were reverse transfected using RNAiMAX (Invitrogen) in triplicate with 30 picomoles of negative mirVana [TM] mimic inhibitor (Ambion, Catalog #:4464076), miRNA-31-5p inhibitor (Ambion, Catalog #:4464084, ID: MH11465), miRNA-200a-3p inhibitor (Ambion, Catalog #:4464084, ID:MH10991), or “Mix”. [score:9]
As STK40 is not a predicted target of miR-200a using GOmir [23] (S2 Table), nor was its expression found to be different in our profiling arrays, we did not observe knockdown of STK40 in cells overexpressing miRNA-200a, as we expected (Fig 3B). [score:8]
In order to elucidate the genetic mechanisms underlying our observations, we used a gene expression array (>47,000 probes) to identify those genes most differentially expressed after increasing miRNA-31 or miRNA-200a expression individually, or when co -overexpressed together (Mix) in Y79 cells, as compared to controls. [score:8]
Our findings collectively suggest that contextually dependent loss of miRNA-31 and miRNA-200a expression promotes retinoblastoma progression through selective downregulation of targets associated with rapid proliferation. [score:8]
Human retinoblastoma cell lines (Y79 and Weri1) were reverse transfected using RNAiMAX (Invitrogen) in triplicate with 30 picomoles of negative mirVana [TM] mimic inhibitor (Ambion, Catalog #:4464076), miRNA-31-5p inhibitor (Ambion, Catalog #:4464084, ID: MH11465), miRNA-200a-3p inhibitor (Ambion, Catalog #:4464084, ID:MH10991), or “Mix”. [score:7]
Continuing our screen for targets that may have triggered Y79 sensitivity to miRNA overexpression (Fig 2), we also identified repression of acyl-CoA thioesterase 7 (ACOT7) following miR-200a overexpression. [score:7]
MicroRNA-target gene-prediction analyses indicate that miRNA-31 and miRNA-200a could significantly target genes that are expressed in primary retinoblastomas, such as TIAM1 [29] (S2 Table). [score:7]
We further observed that putative targets of miR-200a are most significantly enriched in developmental signaling, apoptosis, survival, cell cycle, and gene translation (S1 Table). [score:6]
We also observed downregulation of DLL3 following overexpression of miRNA-31 or miRNA-200a. [score:6]
We did not observe a statistically significant knockdown of DLL3 in Weri1 cells, in contrast to Y79-miR-31 or Y79-miR-200a -expressing cells (Fig 3A and 3B), suggesting a miRNA-target interaction unique to Y79 cells. [score:6]
Using GOmir, we obtained 305 putative miRNA-31 mRNA targets and 656 putative miRNA-200a mRNA targets (S2 Table). [score:5]
Furthermore, our work is the first to demonstrate that overexpression of miRNA-31 and/or miR-200a results in differential gene expression patterns of ACOT7, DLL3, PPP6C, and STK40 between two phenotypically different retinoblastoma cell lines (Fig 3). [score:5]
Although GOmir only reports T-cell lymphoma invasion and metastasis 1 (TIAM1) as a miRNA-200a target, it was previously validated as a miRNA-31 target in colon cancer cells [30]. [score:5]
Selective targeting of DLL3 or ACOT7 recapitulates miR-31 and/or miR-200a -mediated suppression of Y79 cell proliferation. [score:5]
Conversely, we expressed miRNA inhibitors to evaluate if exerting a greater loss of miR-31 and miR-200a expression had any consequence in their ability to proliferate (S3 Fig). [score:5]
In silico analysis to identify pathways involving miRNA-31 and miRNA-200a regulationGOmir [23] was used to identify miRNA-31 and miRNA-200a predicted target genes. [score:4]
ACOT7 is a direct target of miRNA-200a. [score:4]
Based upon previous miRNA profiling reports [12, 16], we hypothesized that downregulation of miRNA-31 and miRNA-200a may be an important contributing factor for retinoblastoma proliferation. [score:4]
0138366.g004 Fig 4 ACOT7 is a direct target of miRNA-200a. [score:4]
S2 Fig Expression of miRNAs-31 (A,C) and -200a (B,D) as measured by TaqMan qRT-PCR in human retinoblastoma cells (Y79 and Weri1) after transient overexpression of miR-31, miR-200a, or co -transfected miRNAs-31 and -200a (Mix), as compared to negative control miRNA overexpressing cells. [score:4]
0138366.g003 Fig 3(A- C) Expression of ACOT7, DLL3, PPP6C, and STK40 mRNAs as measured by TaqMan qRT-PCR in human retinoblastoma cells (Y79 and Weri1) after transient overexpression of miR-31 (A), miR-200a (B), and co -transfected miRs-31 and -200a, “Mix” (C) as compared to negative control miRNA overexpressing cells. [score:4]
Therefore, we further validated knockdown of ACOT7 after miRNA-200a overexpression in Y79, which we observed to also occur Weri1 cells (Fig 3B). [score:4]
In comparison to three normal pediatric retinas, both miRNA-31 and miRNA-200a were significantly downregulated in both cell lines. [score:4]
As a suppressor of the Wnt/β-Catenin pathway in meningiomas [19], miR-200a is of great interest because Wnt activation is associated with expansion of a highly malignant cancer stem cell-like population within retinoblastoma cell cultures [20]. [score:3]
We next evaluated the extent to which overexpression of miRNA-31, miRNA-200a, or concurrent overexpression of both miRNAs affects retinoblastoma cell proliferation in vitro. [score:3]
In order to overcome obstacles to their long-term survival, we hypothesized that some retinoblastomas may rely upon significantly reducing miRNA-31 and miRNA-200a expression. [score:3]
A second miRNA with the potential to inhibit retinoblastoma proliferation is miRNA-200a, which we identified in a miRNA profiling study of 12 retinoblastomas [16]. [score:3]
“Mix” is a 1:1 combination of miRNA-31 and miRNA-200a inhibitor per 5.0E4 cells/well in a 24-well plate. [score:3]
Although we did not detect a significant difference of ACOT7 in Y79 cells using immunofluorescence (Fig 5B and 5E), we did observe a substantial decrease of ACOT7 following miRNA-200a overexpression using western blotting (Fig 5F), which was sustained under the Y79-Mix condition. [score:3]
Using annexin V and 7-AAD as markers, we detected a significant increase in levels of total cell apoptosis in Y79 cells after miR-31 or miR-200a overexpression (Fig 2B). [score:3]
By overexpressing miRNA-31 and -200a in vitro, we demonstrated that miRNA-31 and/or miRNA-200a significantly reduce Y79 cell proliferation, but not Weri1 cell proliferation (Fig 2). [score:3]
For validation of miRNA-31 and miRNA-200a expression in human retinoblastomas, we analyzed a cohort of 21 primary human retinoblastomas. [score:3]
We observed that miRNA-200a overexpression leads to reduction of DLL3 in Y79 cells (Fig 5A). [score:3]
Predicted targets of miRNA-31 and miRNA-200a identified by GOmir. [score:3]
GOmir [23] was used to identify miRNA-31 and miRNA-200a predicted target genes. [score:3]
Target mRNA expression, as measured in log10, in Y79 and Weri1 retinoblastoma cells after expressing miR-31, miR-200a, or “Mix” (miR-31/-200a), as compared to control treated cells were measured for 4 genes (ACOT7, DLL3, PPP6C, STK40). [score:2]
MiRNA-200a belongs to a family of miRNAs that are significant regulators of cancer metastasis [17], neuronal differentiation and cell cycle exit [18]. [score:2]
In silico analysis to identify pathways involving miRNA-31 and miRNA-200a regulation. [score:2]
We demonstrate that overexpression of miRNA-31, miRNA-200a, or both miRNAs together (Mix) significantly reduce Y79 retinoblastoma proliferation as compared to control -treated cells by 23.94%, 31.13%, and 24.84%, respectively, at 96 hours post-transfection (Fig 2A). [score:2]
As compared to controls, Y79 cells overexpressing miR-200a exhibited no significant difference of pMir-mut luciferase activity. [score:2]
Validation of STK40, PPP6C, and DLL3 knockdown by miRNA-31, miRNA-200a, or miRNA-31/-200a (Mix) was confirmed using real-time PCR in Y79 cells (Fig 3). [score:2]
As compared to controls, we observed a significant decrease in luciferase activity in miR-200a overexpressing cells. [score:2]
This data confirms that a specific binding site sequence interaction is required for miR-200a mediated regulation of ACOT7. [score:2]
For quantification of immunofluorescence intensity, four independent images from two independent experiments were obtained for each condition (Negative miR, miR-31, miR-200a, Mix). [score:1]
S5 Fig Immunofluorescence staining of PPP6C (A) and STK40 (B) in Weri1 cells transfected with a negative miRNA (control), miRNA-31, miRNA-200a, and miR-31/-200a (Mix). [score:1]
Western blots of DLL3 (D) and ACOT7 (F) of Weri1 cells transfected with a negative miRNA (control), miRNA-31, miRNA-200a, and miR-31/-200a (Mix). [score:1]
Immunofluorescence staining of DLL3 (A) and ACOT7 (B) in Y79 cells transfected with a negative miRNA (control), miRNA-31, miRNA-200a, and miR-31/-200a (Mix). [score:1]
The capacity for miR-200a to repress ACOT7 in retinoblastoma cells suggests a novel contributory role of ACOTs in retinoblastoma progression. [score:1]
Next, we evaluated the expression of miRNA-31 and miRNA-200a in two human retinoblastoma cell lines, Y79 and Weri1 (Fig 1C). [score:1]
Reverse transfection was conducted using Lipofectamine 2000 (Invitrogen), in accordance with manufacturer’s instructions, and in the presence of 30 pmol of a negative or miR-200a mimic, in addition to a renilla encoding plasmid (285ng, Life Technologies) for normalization purposes. [score:1]
Altogether, our real-time PCR studies coupled with our analyses in silico supports our hypothesis that miRNA-31 and miRNA-200a have an important role in retinoblastoma proliferation. [score:1]
This vector was co -transfected into Y79 cells receiving a negative miR mimic (control) or a miR-200a mimic (Fig 4B). [score:1]
0138366.g005 Fig 5 Immunofluorescence staining of DLL3 (A) and ACOT7 (B) in Y79 cells transfected with a negative miRNA (control), miRNA-31, miRNA-200a, and miR-31/-200a (Mix). [score:1]
Western blot analysis from one experiment of PPP6C (D) and STK40 (F) in Y79 cells transfected with a negative miRNA (control), miRNA-31, miRNA-200a, and miR-31/-200a (Mix). [score:1]
from one experiment of PPP6C (D) and STK40 (F) in Y79 cells transfected with a negative miRNA (control), miRNA-31, miRNA-200a, and miR-31/-200a (Mix). [score:1]
S4 Fig Immunofluorescence staining of PPP6C (A) and STK40 (B) in Y79 cells transfected with a negative miRNA (control), miRNA-31, miRNA-200a, and miR-31/-200a (Mix). [score:1]
A second luciferase-encoding vector (pMir-mut) contains three changed nucleotides within the putative miR-200a binding site of the 3’UTR of ACOT7 (Origene, custom order). [score:1]
We sought to elucidate the roles of miRNA-31 and miRNA-200a in retinoblastoma proliferation and apoptosis. [score:1]
of DLL3 (D) and ACOT7 (F) in Y79 cells transfected with a negative miRNA (control), miRNA-31, miRNA-200a, and miR-31/-200a (Mix). [score:1]
Human retinoblastoma cell lines (Y79 and Weri1) were reverse transfected using RNAiMAX (Invitrogen) in triplicate with 30 picomoles of a negative mirVana [TM] mimic (Ambion, Catalog #: 4464058), or, miRNA-31 mimic (Ambion, Catalog #: 4464066, ID: MC11465), or miRNA-200a (Ambion, Catalog #: 4464066, ID: MC10991), or, “Mix” where the “Mix” is a 1:1 combination of miRNA-31 mimic and miRNA-200a mimic per 5.0E4 cells/well in a 24-well plate. [score:1]
Immunofluorescence staining of DLL3 (A) and ACOT7 (B) in Weri1 cells transfected with a negative miRNA (control), miRNA-31, miRNA-200a, and miR-31/-200a (Mix). [score:1]
0138366.g006 Fig 6 Immunofluorescence staining of DLL3 (A) and ACOT7 (B) in Weri1 cells transfected with a negative miRNA (control), miRNA-31, miRNA-200a, and miR-31/-200a (Mix). [score:1]
mirVana [TM] mimic transfectionsHuman retinoblastoma cell lines (Y79 and Weri1) were reverse transfected using RNAiMAX (Invitrogen) in triplicate with 30 picomoles of a negative mirVana [TM] mimic (Ambion, Catalog #: 4464058), or, miRNA-31 mimic (Ambion, Catalog #: 4464066, ID: MC11465), or miRNA-200a (Ambion, Catalog #: 4464066, ID: MC10991), or, “Mix” where the “Mix” is a 1:1 combination of miRNA-31 mimic and miRNA-200a mimic per 5.0E4 cells/well in a 24-well plate. [score:1]
[1 to 20 of 64 sentences]
11
[+] score: 203
Other miRNAs from this paper: hsa-mir-141
miR-200a downregulation and Keap1 mRNA upregulation in human necrotic femoral head tissues. [score:7]
Stable OB-6 cells expressing (sh-Keap1, “Sequ1”) were also transfected with/out miR-200a expression vector (“miR-200a-Vec”); Cells were then treated with/out Dex (1 μM) for applied time; MiR-200a-3p expression (F), cell viability (G), cell death (H) were tested. [score:7]
Together, these results suggest that miR-200a expression activates Nrf2 cascade to inhibit oxidative stress, and protects OB-6 cells from Dex. [score:5]
Significantly, expression of miR-200a, by inducing Nrf2 activation, largely inhibited Dex -induced oxidative stress and subsequent osteoblasts/osteoblastic cell death and apoptosis. [score:5]
Remarkably, miR-200a expression was unable to further protect OB-6 cells from Dex, when Keap1 was already silenced by targeted-shRNA (“Sequ1”, Figure 4G and 4H). [score:5]
Nrf2 mRNA expression was unchanged after miR-200a expression in OB-6 cells (Figure 1D), yet Nrf2 protein was stabilized and accumulated (Figure 1E). [score:5]
Reversely, miR-200a depletion by the antamiR-200a led to Keap1 upregulation and Nrf2 degradation. [score:4]
Second, stabilized Nrf2 induced transcription of several Nrf2-regulated genes (HO1, NOQ1 and GCLC) in miR-200a -expressing cells. [score:4]
Significantly, we found that miR-200a level was decreased in necrotic femoral head tissues, which was correlated with Keap1 mRNA upregulation. [score:4]
The miR-200a downregulation in human necrotic femoral head tissues indicates a potential function of this miRNA in the pathogenesis of femoral head necrosis in the Dex-taking patients. [score:4]
Quantitative real-time PCR (“qRT-PCR”) assay results in Figure 2A showed that mRNA expressions of the Nrf2 genes (HO1, NOQ1 and GCLC) were significantly increased in OB-6 cells expressing miR-200a, indicating Nrf2 signaling activation. [score:4]
If Keap1 is the primary target of miR-200a in OB-6 cells, then direct silence of Keap1 should also protect cells from Dex. [score:4]
Therefore, miR-200a depletion by anti-sense induces Keap1 upregulation and Nrf2 degradation. [score:4]
Primary human osteoblasts were transfected with (“Sequ1”) or miR-200a Vector (“miR-200a-Vec”) as described; Relative expression of miR-200a-3p (A), Keap1 mRNA (B) and Keap1/Nrf2 protein (C), and quantified in (D) were shown; Cells were also treated with/out Dex (1 μM) for 48 hours, cell viability (CCK-8 OD, (E) and cell death (LDH release, (F) were tested. [score:3]
Figure 1MicroRNA-200a-3p (“miR-200a-3p”) putatively targets the 3′-UTR of Keap1 mRNA (A). [score:3]
Stable OB-6 cells expressing (sh-Keap1, “Sequ1/2”), non-sense control shRNA (“sh-C”), or the parental control cells (“Ctrl”) were subjected of qRT-PCR assay (A and C) and Western blotting assay (Data were quantified in (B), relative Keap1/Nrf2 expression and miR-200a-3p level were shown. [score:3]
Human osteoblasts/osteoblastic cells were transfected with miR-200a expression vector, antamiR-200a, scramble miRNA control (“miR-C”) or scramble antagomiR control (antagomiR-C) via the Lipofectamine 2000 reagent (Invitrogen, Suzhou, China). [score:3]
Figure 5Primary human osteoblasts were transfected with (“Sequ1”) or miR-200a Vector (“miR-200a-Vec”) as described; Relative expression of miR-200a-3p (A), Keap1 mRNA (B) and Keap1/Nrf2 protein (C), and quantified in (D) were shown; Cells were also treated with/out Dex (1 μM) for 48 hours, cell viability (CCK-8 OD, (E) and cell death (LDH release, (F) were tested. [score:3]
The non-sense microRNA-control (“miR-C”) failed to change expressions of miR-200a (Figure 1B) and Keap1/Nrf2 (Figure 1D–1E). [score:3]
The pSuper-GPF-puro-miR-200a expression vector, encoding miR-200a, was designed by Genepharm (Shanghai, China). [score:3]
Above results have shown that miR-200a expression silenced Keap1 to cause Nrf2 stabilization and accumulation in OB-6 cells. [score:3]
AntamiR-200a indeed decreased miR-200a-3p expression (Figure 1F). [score:3]
Keap1 mRNA level was sharply decreased after expressing miR-200a or Keap1-shRNA (Figure 5B). [score:3]
To test this hypothesis, miR-200a vector was introduced to (“Sequ1”) -expressing OB-6 cells (Figure 4F). [score:3]
Remarkably, 3′-UTR luciferase activity of Keap1 mRNA was dramatically decreased in the miR-200a -expressing cells (Figure 1C). [score:3]
Our results here demonstrate that microRNA-200a (“miR-200a”) targets Keap1 mRNA. [score:3]
We therefore conclude that Keap1 is the primary target of miR-200a in osteoblasts in mediating its anti-Dex functions. [score:3]
Relative expression of miR-200a-3p (F), Keap1 mRNA (G), Keap1/Nrf2 protein (H) and Nrf2 mRNA (I) in stable OB-6 cells with miR-200a anti-sense (“antamiR-200a”), antagomiR-control (“antamiR-C”), as well as in parental control cells (“Ctrl”) were shown. [score:3]
Figure 6Relativeexpressions of miR-200a-3p (A) and Keap1 mRNA (B) in necrotic femoral head tissues (“Necrosis”) and surrounding normal femoral head tissues (“Normal”) from ten Dex-taking patients were shown. [score:3]
Next, the miR-200a expression vector (pSuper-GFP-puro) was established, which was transfected to OB-6 human osteoblastic cells [28, 29]. [score:3]
Here, we showed that Dex -induced ROS production was largely attenuated after expression of miR-200a in OB-6 cells (Figure 2B). [score:3]
Relativeexpressions of miR-200a-3p (A) and Keap1 mRNA (B) in necrotic femoral head tissues (“Necrosis”) and surrounding normal femoral head tissues (“Normal”) from ten Dex-taking patients were shown. [score:3]
MicroRNA-200a-3p (“miR-200a-3p”) putatively targets the 3′-UTR of Keap1 mRNA (A). [score:3]
Expression of miR-200a/antamiR-200a. [score:3]
Figure 3Stable OB-6 cells expressing (sh-Keap1, “Sequ1/2”), non-sense control shRNA (“sh-C”), or the parental control cells (“Ctrl”) were subjected of qRT-PCR assay (A and C) and Western blotting assay (Data were quantified in (B), relative Keap1/Nrf2 expression and miR-200a-3p level were shown. [score:3]
First, we demonstrate that miR-200a (“-3p”) putatively targets the 3′-UTR of Keap1 mRNA (at position 131-138) (Figure 1A), as reported by other studies [26, 27]. [score:3]
These results suggest that Keap1 should be the primary target of miR-200a in mediating its pro-survival function in OB-6 cells. [score:3]
If Keap1 is the primary target of miR-200a, then miR-200a should be ineffective in Keap1-silenced cells. [score:3]
More importantly, forced -expression of miR-200a silences Keap1 to activate Nrf2 signaling, which protects human osteoblasts/osteoblastic cells from Dex. [score:3]
Thus, miR-200a expression depletes Keap1 to cause Nrf2 stabilization. [score:3]
At last, we tested expression of miR-200a in human necrotic femoral head tissues. [score:3]
Figure 2Stable OB-6 cells, expressing miR-200a expression vector (two lines, “Line1/2”), non-sense microRNA-control (“miR-C”), or the parental control cells (“Ctrl”) were treated with/out Dex (1 μM) for applied time; Relative expressions of listed genes were tested by quantitative real-time PCR (“qRT-PCR”) assay (A); ROS level was presented in (B); Cell viability (CCK-8 assay, (C), cell death (LDH release assay, (D and F) and apoptosis (Histone DNA ELISA assay, (E) were also tested. [score:3]
Remarkably, Dex -induced OB-6 cell viability reduction (CCK-8 OD/optic density, Figure 2C), cell death (LDH release, Figure 2D) and apoptosis (Histone DNA apoptosis ELISA OD, Figure 2E) were significantly alleviated in miR-200a -expressing cells. [score:3]
miR-200a expression activates Nrf2 signaling and protects human osteoblastic cells from Dex. [score:3]
Keap1 is the primary target of miR-200a in mediating its actions. [score:3]
Stable OB-6 cells, expressing miR-200a expression vector (two lines, “Line1/2”), non-sense microRNA-control (“miR-C”), or the parental control cells (“Ctrl”) were treated with/out Dex (1 μM) for applied time; Relative expressions of listed genes were tested by quantitative real-time PCR (“qRT-PCR”) assay (A); ROS level was presented in (B); Cell viability (CCK-8 assay, (C), cell death (LDH release assay, (D and F) and apoptosis (Histone DNA ELISA assay, (E) were also tested. [score:3]
The primary cells were also transfected with miR-200a expression vector or Keap1-shRNA (“Sequ1”). [score:3]
miR-200a expression depletes Keap1 to cause Nrf2 accumulation in human osteoblastic cells. [score:3]
The antagomiR-control (“antamiR-C”) failed to change expressions of miR-200a, Keap1 nor Nrf2 (Figure 1F–1H). [score:3]
Thus, miR-200a expression was very much invalid against Dex when Keap1 was already silenced (Figure 4G and 4H). [score:3]
Also, non-sense shRNA control (“sh-C”) had on significant effect on expressions of Keap1/Nrf2 (Figure 3A and 3B) nor miR-200a-3p (Figure 3C). [score:3]
For example, Yang et al., showed that miR-200a activates Nrf2 by targeting Keap1 in hepatic stellate cells [38]. [score:3]
First, forced -expression of miR-200a induced Keap1 degradation, causing Nrf2 stabilization in human osteoblasts/osteoblastic cells. [score:3]
Stable OB-6 osteoblastic cells, expressing miR-200a expression vector (“miR-200a-Vec”, two lines, “Line1/2”), non-sense microRNA-control (“miR-C”), or the parental control OB-6 cells (“Ctrl”) were subjected to quantitative real-time PCR (“qRT-PCR”) assay (B and D), Keap1 mRNA 3′-UTR luciferase activity assay (C) and Western blotting assay (E, results were quantified). [score:2]
MiR-200a expression activates Nrf2 signaling and protects human osteoblasts/osteoblastic cells from Dex. [score:2]
MiR-200a (−3p) level was again increased after expressing the construct in Keap1-silenced cells (Figure 4F). [score:2]
As compared to the surrounding normal femoral head tissues (“Normal”), expression of miR-200a (−3p) was significantly decreased in the “Necrosis” tissues (Figure 6A). [score:2]
Next, we focused the potential effect of miR-200a in the primary human osteoblasts. [score:1]
Dex -induced viability reduction (Figure 5E) and cell death (Figure 5F) were largely attenuated in osteoblasts with or miR-200a. [score:1]
It will be interesting to further test the potential function of miR-200a on Dex-damaged human osteoblasts in vivo. [score:1]
As shown in Figure 1B, miR-200a-3p level was significantly increased in stable cells. [score:1]
More importantly, miR-200a was unable to further protect OB-6 cells from Dex when Keap1 was silenced by shRNA. [score:1]
miR-200a level was also normalized to GAPDH. [score:1]
Keap1 silence by shRNA or miR-200a protects primary human osteoblasts from Dex. [score:1]
Next, the miR-200a anti-sense (“antamiR-200a”) was introduced to OB-6 cells. [score:1]
In the current study, we demonstrate that miR-200a activated Nrf2 signaling in OB-6 cells and primary human osteoblasts. [score:1]
The miR-200a anti-sense (“antamiR-200a”) was provide by Ambion (Shanghai, China). [score:1]
As expected, didn't change the level of miR-200a-3p in OB-6 cells (Figure 3C). [score:1]
Third,, mimicking miR-200a, activated Nrf2 and protected OB-6 cells from Dex. [score:1]
The reporter plasmid was then utilized as template to generate a miR-200a response element. [score:1]
[1 to 20 of 70 sentences]
12
[+] score: 199
Concurrent down-regulation of TGF-β pathway genes and high levels of E-cadherin and miR-200 expression were revealed in the cancerous cysts by gene expression profiling. [score:8]
The expression of miR-200 targets, ZEB2 and TGF-β2, were increased several folds, without any change in the expression of epithelial protein E-cadherin [87]. [score:7]
Second, kidney tubule-specific knockout of Dicer, the miRNA biogenesis enzyme, led to significant down-regulation in the expression of all five members of the miR-200 family and formation of kidney tubule-derived cysts [16]. [score:7]
Most of the studies on the miR-200 family in cancer research have been focused on the function of this miRNA family in suppressing EMT, leading to E-cadherin overexpression, epithelial cell identity, and cancer metastasis inhibition [3, 18, 19]. [score:7]
Our analysis of the miR-200 expression levels in ovarian cell lines growing in three-dimensional (3D) cultures suggests that the expression of miR-200s shows cluster -dependent co-regulation [6]. [score:6]
This interesting study suggests a mo del for the combined regulatory activity of miR-200c and HuR on TUBB3 expression in ovarian cancer that may not happen in other cell types and provides additional insight into studying potential player(s) that may affect the outcome of miR-200 interaction with target genes. [score:6]
miR-141 and miR-200a inhibit protein expression of p38α. [score:5]
Conversely, Cao et al. reported that elevated expression of miR-200a and miR-200b was associated with advanced stage and high-grade tumors, while high miR-200c expression was only associated with advanced tumors [72]. [score:5]
A study to analyze miR-200 expression in tissue from patients with or without relapse showed that miR-200b and miR-200c were down-regulated in relapsers compared with non-relapsers. [score:5]
However, studies of clinical samples are not conclusive to relate the expression level of miR-200 family with disease stage. [score:5]
Hales et al. reported expression of miR-200a, miR-200b and miR-429 were significantly up-regulated in ovarian tumors compared to normal ovaries [28]. [score:5]
miR-200 family is one of the several miRNAs that have been studied for the diagnosis and prognosis of ovarian cancers [2] and also well known as the master suppressor of epithelial-mesenchymal transition (EMT) for the expression of E-cadherin, the classical calcium -dependent cell–cell adhesion protein to maintain epithelial cell phenotype [3]. [score:5]
Although tumorigenesis is promoted by overexpression of miR-200a or miR-141, overexpression of miR-200a and miR-141 also increases tumor-cell death and slows tumor growth under treatment with paclitaxel, a chemotherapeutic drug known to increase ROS. [score:5]
The expression levels of miR-200a and miR-200c were significantly associated with disease progression. [score:5]
We have also shown by quantitative reverse transcription-polymerase chain reaction (RT-PCR) that miR-200 pathway genes are up-regulated in microdissected cells derived from ovarian tumor tissues and serous tubal intraepithelial carcinoma (STIC), a precursor lesion for high-grade serous ovarian carcinoma (HGSOC) [32, 33, 45, 46, 47], relative to normal ovarian surface epithelial (OSE) and fallopian tube epithelial (FTE) cells. [score:4]
Tryndyak V. P. Beland F. A. Pogribny I. P. E-cadherin transcriptional down-regulation by epigenetic and microRNA-200 family alterations is related to mesenchymal and drug-resistant phenotypes in human breast cancer cellsInt. [score:4]
Gregory P. A. Bert A. G. Paterson E. L. Barry S. C. Tsykin A. Farshid G. Vadas M. A. Khew-Goodall Y. Goodall G. J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat. [score:4]
Interestingly, increased expression of miR-200 and E-cadherin was also identified in the laying hen mo del of spontaneous ovarian carcinoma [27, 28], implicating the importance of this conserved pathway in ovarian cancer development. [score:4]
Third, miR-200 knockdown in cultured renal epithelial cells inhibited tubulogenesis and produced cyst-like structures. [score:4]
Hajarnis S. S. Patel V. Aboudehen K. Attanasio M. Cobo-Stark P. Pontoglio M. Igarashi P. Transcription factor hepatocyte nuclear factor-1β (HNF-1β) regulates microRNA-200 expression through a long noncoding RNAJ. [score:4]
Regulation of miR-200 family on EMT and E-cadherin expression is well documented [2, 3, 18, 19]. [score:4]
Intriguingly, another study by Zhang et al. showed an opposite function of miR-200 target ZEB1 in EGFR-mutated lung cancer cells. [score:3]
There is no direct evidence on linking miR-200s to ovarian inclusion cyst formation; several lines of emerging evidence suggest that the miR-200 family plays an important role in renal tubule development, renal cyst pathogenesis and spermatogenic cyst formation in yellow catfish. [score:3]
Application of miR-200 antagomirs can reverse EMT caused by the depletion of ERRα molecules, with an increase of Snail expression [68]. [score:3]
The recent Cancer Genome Atlas (TCGA) genomic study of uterine carcinomasarcomas has also shown that sarcomas and uterine carcinosarcomas with extensive sarcoma components showed enhanced promoter methylation and down -expression of miR-200 family [41]. [score:3]
Consistent with the finding from the mouse mo del, human ovarian cancer with high miR-200a expression showed low amounts of p38α protein and an associated oxidative stress signature. [score:3]
Depletion of IRS-1 partially inhibited the miR-200 -dependent AKT activation [57]. [score:3]
miR-200a overexpression was found to be associated with mucinous histology and advanced stage tumors, and patients with lymph node metastasis showed significant elevation of miR-200c [123]. [score:3]
Zuberi M. miR R. Das J. Ahmad I. Javid J. Yadav P. Masroor M. Ahmad S. Ray P. C. Saxena A. Expression of serum miR-200a, miR-200b, and miR-200c as candidate biomarkers in epithelial ovarian cancer and their association with clinicopathological featuresClin. [score:3]
First, the expression of miR-200 family members is reduced in injured kidney tubules, but highly enriched in the normal kidney tubules. [score:3]
2009.11.020 20005803 8. Beclin C. Follert P. Stappers E. Barral S. Nathalie C. de Chevigny A. Magnone V. Lebrigand K. Bissels U. Huylebroeck D. miR-200 family controls late steps of postnatal forebrain neurogenesis via zeb2 inhibitionSci. [score:3]
For ovarian cancer prognosis, several studies have studied the association between circulating miR-200 levels and disease prognosis. [score:3]
ZEB2 has two predicted miR-200a/141 and five miR-200b/200c/429 seed matches in its 3′ untranslated region (3′-UTR). [score:3]
Pandey A. Singh P. Jauhari A. Singh T. Khan F. Pant A. B. Parmar D. Yadav S. Critical role of the miR-200 family in regulating differentiation and proliferation of neuronsJ. [score:2]
Pecot C. V. Rupaimoole R. Yang D. Akbani R. Ivan C. Lu C. Wu S. Han H. D. Shah M. Y. Rodriguez-Aguayo C. Tumour angiogenesis regulation by the miR-200 familyNat. [score:2]
Further studies with more cell lines and co-culture experiments are required to provide insight into whether exosomal miR-200 transcript levels are associated with ovarian cancer development. [score:2]
HNF-1β binds to a promoter region upstream of the miR-200 genes and directly controls the transcription of the miR-200a/b/429 cluster. [score:2]
miR-200s are highly conserved among vertebrate species and even in bilaterian animals, with miR-8 being the sole homolog of miR-200 in Drosophila melanogaster [7], implying that they possess important functions in a diversity of developmental processes. [score:2]
The miR-200 family is a master regulator of EMT in epithelial ovarian cancer. [score:2]
Gregory P. A. Bracken C. P. Smith E. Bert A. G. Wright J. A. Roslan S. Morris M. Wyatt L. Farshid G. Lim Y. Y. An autocrine TGF-β/ZEB/miR-200 signaling network regulates establishment and maintenance of epithelial-mesenchymal transitionMol. [score:2]
Furthermore, a study to characterize the function of an epithelial cell transcription factor implicated in cancer progression, grainhead-like 2 (GRHL2) in ovarian cancer showed that GRHL2 bound to miR-200 promoters, intronic enhancer of CDH1, and promoters of ErbB3 and other epithelial cell-related genes and positively regulated their expression [78]. [score:2]
Brozovic A. Duran G. E. Wang Y. C. Francisco E. B. Sikic B. I. The miR-200 family differentially regulates sensitivity to paclitaxel and carboplatin in human ovarian carcinoma OVCAR-3 and MES-OV cellsMol. [score:2]
Chung V. Y. Tan T. Z. Tan M. Wong M. K. Kuay K. T. Yang Z. Ye J. Muller J. Koh C. M. Guccione E. GRHL2-miR-200-ZEB1 maintains the epithelial status of ovarian cancer through transcriptional regulation and histone modificationSci. [score:2]
As ErbB3 is essential for growth of EGFR-mutated lung cancer cells, the ZEB1/miR-200 negative feedback loop might potentially provide a cell context -dependent regulation of ErbB3. [score:2]
In our sequential in vitro 3D mo del in collagen I matrix, we noted that migrating HGSOC spheroids tended to release some single cells in the later phase of migration [6], and quantitative real-time PCR also demonstrated that HGSOC samples had a lower level of expression of miR-200 pathway genes compared to other histologic subtypes of ovarian tumors. [score:2]
ZEB1 carries five putative miR-200b/200c/429 and three miR-200a/141 sites in its 3′-UTR [3]. [score:1]
The miR-200a dependent stress signature is correlated with longer progression-free survival and improved survival of patients in response to chemotherapeutic treatment [122]. [score:1]
These five miRNAs form two clusters: cluster 1 of miR-200b, miR-200a and miR-429 maps to chromosome 1 (1p33.36), while the miR-200c and miR-141 cluster maps to chromosome 12 (12p13.31) [4]. [score:1]
Herein we review the function of miR-200 on both pathogenesis and other aspects of ovarian cancer, and the potential utility in clinical diagnosis and therapies. [score:1]
Mateescu B. Batista L. Cardon M. Gruosso T. de Feraudy Y. Mariani O. Nicolas A. Meyniel J. P. Cottu P. Sastre-Garau X. miR-141 and miR-200a act on ovarian tumorigenesis by controlling oxidative stress responseNat. [score:1]
This miRNA family consists of five members: miR-200a, miR-200b, miR-200c, miR-141 and miR429. [score:1]
Moreover, Kan et al. [124] revealed that individual levels of miR-200a, miR-200b and miR-200c normalized to serum volume and miR-103 were significantly higher in the sera of the serous ovarian cancer cohort. [score:1]
miR-200 was reported to associate with chemoresponse in various types of cancer [109]. [score:1]
In human ovary, miR-200 may also have a role in ovarian cyst formation. [score:1]
Burk U. Schubert J. Wellner U. Schmalhofer O. Vincan E. SpadeRNA S. Brabletz T. A reciprocal repression between ZEB1 and members of the miR-200 family promotes emt and invasion in cancer cellsEMBO Rep. [score:1]
Two evolutionary-conserved binding sites for the miR-200 members were identified in the 3′-UTR of the polycystin 1 (PKD1) gene. [score:1]
In ovarian cancer, Taylor et al. reported that exosomal miR-200 levels were more elevated in sera from ovarian cancer patients than samples from benign controls [106]. [score:1]
Accumulation of miR-141 and miR-200a mimicked p38α deficiency and promoted malignancy in mouse mo dels. [score:1]
In a study of serum miR-200 levels in 74 ovarian cancer patients, both miR-200c and miR-141 were significantly elevated in cancer sera than in healthy control [126]. [score:1]
Koutsaki M. Spandidos D. A. Zaravinos A. Epithelial-mesenchymal transition -associated miRNAs in ovarian carcinoma, with highlight on the miR-200 family: Prognostic value and prospective role in ovarian cancer therapeuticsCancer Lett. [score:1]
Despite increase in tumor growth, the miR-200 -dependent stress response could also enhance sensitivity to chemotherapy, indicating its dual function in tumors. [score:1]
Korpal M. Kang Y. The emerging role of miR-200 family of microRNAs in epithelial-mesenchymal transition and cancer metastasisRNA Biol. [score:1]
However, the two miR-200 members showed discordant prognostic values. [score:1]
Alternatively, the miR-200 family members can also be categorized in two functional groups based upon the similarities of their seed sequences. [score:1]
Li Z. Yin H. Hao S. Wang L. Gao J. Tan X. Yang Z. miR-200 family promotes podocyte differentiation through repression of RSAD2Sci. [score:1]
2. miR-200 and Ovarian Cancer. [score:1]
However, in our view, miR-200 function in epithelial cell identity and maintenance has a positive effect on ovarian cancer cell growth and collective movement in metastasis. [score:1]
The levels of miR-200a in cancer sera samples were found to be six-fold, while the levels of miR-200b and miR-200c were three-fold higher than the levels in normal controls. [score:1]
Cao Q. Lu K. Dai S. Hu Y. Fan W. Clinicopathological and prognostic implications of the miR-200 family in patients with epithelial ovarian cancerInt. [score:1]
2.1. miR-200, EMT, and Epithelial Nature of Ovarian Cancer Cells. [score:1]
As mentioned in the Exosome section, Taylor et al. identified elevated exosomal miR-200 levels in the sera of ovarian cancer patients than in benign controls, and the circulating miRNA profiles accurately reflected the miRNA profiles in the tumors [106]. [score:1]
Taken together, the current studies have shown promising results for serum or plasma miR-200 levels as diagnostic and prognostic biomarkers. [score:1]
2.2. miR-200, Collective Movement, and Ovarian Cancer Metastasis. [score:1]
With the involvement of only two cell lines, Kobayashi’s study is not conclusive to associate the relationship between ovarian cancer cell invasiveness with miR-200 contents in the secreted exosomes. [score:1]
miR-200b, miR-200c and miR-429 (Functional Group I) all share the same seed sequence (5′-AAUACUG-3′), while miR-200a and miR-141 (Functional Group II) both share the same seed sequence (5′-AACACUG-3′), with the two functional groups differing in the seed sequence only by one nucleotide [5]. [score:1]
[1 to 20 of 75 sentences]
13
[+] score: 187
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-96, mmu-let-7g, mmu-let-7i, mmu-mir-124-3, mmu-mir-9-2, mmu-mir-141, mmu-mir-152, mmu-mir-182, mmu-mir-183, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-214, hsa-mir-200b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-141, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-96, hsa-mir-200c, mmu-mir-200c, mmu-mir-214, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-130b, hsa-mir-376a-1, mmu-mir-376a, dre-mir-7b, dre-mir-7a-1, dre-mir-7a-2, dre-mir-182, dre-mir-183, dre-mir-199-1, dre-mir-199-2, dre-mir-199-3, dre-mir-205, dre-mir-214, hsa-mir-429, mmu-mir-429, hsa-mir-450a-1, mmu-mir-450a-1, dre-mir-429a, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-7a-3, dre-mir-9-1, dre-mir-9-2, dre-mir-9-4, dre-mir-9-3, dre-mir-9-5, dre-mir-9-6, dre-mir-9-7, dre-mir-96, dre-mir-124-1, dre-mir-124-2, dre-mir-124-3, dre-mir-124-4, dre-mir-124-5, dre-mir-124-6, dre-mir-130b, dre-mir-141, dre-mir-152, dre-mir-200a, dre-mir-200b, dre-mir-200c, hsa-mir-450a-2, dre-let-7j, hsa-mir-376a-2, mmu-mir-450a-2, dre-mir-429b, mmu-let-7j, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Some of the miR-9 and miR-200-class targets upregulated in the mutant OE (Qk, Foxf2) are mesenchymally-expressed rather than OE-expressed, while other targets were actually downregulated in the absence of Dlx5 (Akap6, Elmod1, Snap25) (Table 1C). [score:15]
We found eight miRs differentially expressed, six down-regulated (miR-9, miR-141, miR-200a, miR-200b, miR-429 and miR-376a) and two up-regulated (miR-450a-5p and miR130b*) in the Dlx5 [−/−] OE (Fig.  1a). [score:9]
To determine whether the forced expression of DLX5 may result in an upregulation of miR-9 and miR-200-class RNAs, SH-SY5Y cells were transfected with myc-tagged wild-type DLX5 or Q178P mutant DLX5 expression vectors, and the relative abundance of miR-9 and miR-200 was quantified by Real-Time qPCR. [score:8]
Thus, Dlx5 is likely to regulate the expression of miR-9.3 directly, and the expression of miR-200a/ b/ miR-429 indirectly. [score:8]
In summary, since miR-9 and miR-200-class are down-modulated in the absence of Dlx5, while Foxg1 protein level is up-regulated, and since the 3′ UTR of the Foxg1 mRNA is a predicted target of these miRs, we can infer that the Dlx5-miR-Foxg1 regulation is most likely a direct one. [score:8]
Two possible explanations: either changes in the abundance of miR-9 and miR-200-class cause changes in the abundance of target RNAs that are too modest to pass the imposed cut-off value, or these miRs preferentially affect translation and not stability of the target mRNAs. [score:7]
For chromatin immunoprecipitation (ChIP) we used the human SHSY-5Y neuroblastoma cells, which express low endogenous levels of Dlx5, miR-9 and miR-200, transfected with 5 μg of DLX5-myc-tag expression vector (from Open-Biosystem) or with the same vector in which the Q178P mutation (Shamseldin et al., 2012) was introduced (BioFab, Rome, sequence verified). [score:6]
A significant enrichment of miR-9 and miR-200-class target sequences was detected in the 3′ UTR of genes up-regulated in the Dlx5 [−/−] OE (Table 1A, B). [score:6]
myc-tagged version of either the WT or the Q178P mutant DLX5 were expressed in the SH-SY5Y human neuroblastoma cells, which express DLX5, miR-9 and miR-200 endogenously. [score:5]
We also show that Dlx5 promotes expression of miR-9 and miR-200 class, thereby tends to repress Foxg1 protein translation. [score:5]
•Dlx5 controls the expressions of miR9 and miR-200, which target the Foxg1 mRNA • miR-9 and -200 are needed for olfactory neurons differentiation and axon extension • miR-9 and -200 are required for the genesis and position of GnRH neurons. [score:5]
2.9To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
To downmodulate endogenously expressed miR-9 and miR-200 we used the commercially available Ambion anti-miR inhibitors (Life Technologies). [score:5]
On the contrary, DLX5 overexpression did not induce changes in miR-200 expression, either in SH-SY5Y (Fig.  2d) or in GN11 (neuroendocrine) or in U2OS (osteosarcoma) cells (data not shown). [score:5]
Next we intersected the predicted miR-9 and miR-200-class targets with the coding mRNAs found to be differentially expressed in the Dlx5 [−/−] OE compared to the WT (Garaffo et al., 2013). [score:4]
Alternatively the expression of miR-200a/ b/ miR-429 could require additional transcription (co)factors not present in these cells. [score:3]
To overexpress miR-9 and miR-200 exogenously we used commercially available Ambion pre-miR precursors (Life Technologies). [score:3]
miR-200a, miR-200b, miR-141 and miR-429 share the same seed sequence and likely target the same mRNAs; for this reason they are grouped in a single miR class (named miR-200-class). [score:3]
The 3′ UTR of tetrapod and zebrafish Foxg1 mRNAs hosts miR-9 and miR-200 target sequences. [score:3]
To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
3.7To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
Searching for functionally relevant targets of miR-9 and miR-200 clsss in the OE. [score:3]
Here we show that mouse and fish foxg1 mRNA is a target of miR-9 and miR-200 class, both of which are down-modulated in the Dlx5 null embryonic OE. [score:3]
We also show that miR-9 and miR-200-class target (amongst others) the foxg1 mRNA, through which they likely exert their functions. [score:3]
Instead, we could easily monitor the number and position of early GFP -expressing neurons, and noted that upon depletion of miR-200 class they appear reduced in number but normally clustered. [score:3]
To determine whether miR-9 and miR-200-class play a role in GnRH neuronal differentiation and migration, we used the GnRH3:GFP transgenic zebrafish strain, in which the GFP reporter is expressed under the transcriptional control of a fragment of the z- GnRH3 promoter. [score:3]
The results presented here indicate that loss of Dlx5 causes a down-modulation of miR-9 and of miR-200-class, which results in the over -expression of the Foxg1 protein. [score:3]
3.6To functionally demonstrate a role of miR-9 and miR-200-class for olfactory development, and the involvement of Foxg1 in this regulation in vivo, the zebrafish mo del was again used. [score:3]
In the same cells, the expression of pre -miR-200 led to a 3.9-fold decrease in Foxg1 proteins level (Fig.  3c). [score:3]
The most abundant miRs expressed in the developing mouse OE are: the miR-200-class (- 200a, - 200b, - 200c, - 141 and - 429), miR-199, miR-152, miR-214, miR-205, miR-183, miR-182 and miR-96 (Choi et al., 2008). [score:3]
Examining olfactory development more thoroughly we now can implicate the miR-9 and miR-200-class networks in a more complex phenotype reminiscent of the Kallmann syndrome (see below). [score:2]
Another indication comes from a study in zebrafish, showing a role of miR-200-class for olfactory development (Choi et al., 2008). [score:2]
To determine whether miR-9 and miR-200-class may modulate Foxg1 protein level, the effect of introduction of pre-miR-9 or depletion of endogenous miR-9 on Foxg1 protein level was assayed by Western blot analysis in SH-SY5Y cells, which express DLX5, miR-9, miR-200-class and Foxg1 endogenously. [score:2]
Thus, both miR-9 and miR-200 negatively regulate Foxg1 protein level. [score:2]
Genomic regulation of miR-9 and miR-200 by Dlx5. [score:2]
miR-9 and miR-200-class regulate Foxg1. [score:2]
In this work we define the role of miR-9 and miR-200-class in the development of the olfactory system, with functions ranging from ORN differentiation to axon guidance, glomerulus formation and GnRH neuron migration. [score:2]
We predicted one Dlx5 binding site near the miR-9.2 locus, located about 1.5 kb downstream, three sites near the miR-9.3 locus, located about 4, 5 and 6 kb downstream, and two sites near the miR-200a–200b-429 locus, located about 5 kb upstream (Fig.  2a). [score:1]
Starting from profile data obtained from a mouse mo del of Kallmann syndrome, we functionally examined this pathway in zebrafish showing that miR-9 and miR-200-class are required for normal differentiation of the ORNs, for the extension and connectivity of the olfactory axons, and for the migration of the GnRH neurons from the nasal primordium to the forebrain. [score:1]
It has also been shown that miR-200 represses neural induction of human embryonic stem cells, via modulation of Pax6 and Zeb transcription factors (Du et al., 2013). [score:1]
Since miR-200a, miR-200b, miR-141 and miR-429 share very similar seed sequences (Suppl. [score:1]
miR200a and miR200b could not be tested by in situ hybridization due to high sequence conservation between all members of the miR-200-class. [score:1]
To complement the previous (static) data with live images of the migrating GnRH3 neurons, we carried out few time-lapse video recordings on untreated (4) and z- miR-200-class MO injected (4) embryos at earlier ages (36–52 hpf), in order to observe the first appearance of these neurons. [score:1]
We depleted the miR-200 class in fish zygotes, by injecting a mix of anti -miR-200 MO previously described and found to efficiently down-modulate several miR of the class-200 and to affect ORN differentiation (Choi et al., 2008). [score:1]
We previously verified that the depletion of miR-9 and miR-200-class in zebrafish embryos leads to higher level of z-foxg1 mRNA (no Ab efficiently recognizes the z-foxg1 protein). [score:1]
The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
The abundance of z-hoxa-7a and z-hoxa-10b mRNAs did not greatly change, indicating that the differentiation delay observed upon depletion of miR-200-class is specific. [score:1]
Thus, our results provide the first evidence of the participation of miR-9 and miR-200-class in these early events. [score:1]
z-foxg1 mRNA level increased by three-folds when either miR-9 or miR-200-class were depleted (Figs.  5e and 6f). [score:1]
In control embryos, we counted an average of 13 (+/− 2) GnRH3::GFP + neurons/embryo at 72 hpf, while in miR-9 and miR-200 MO injected embryos the average number was, respectively, 5 (+/− 1) and 6 (+/− 1) (Suppl. [score:1]
3.4The 3′ UTR of the mammalian and fish Foxg1 mRNA contains seed sequences for miR-9 and miR-200 (Suppl. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in altered GnRH neuron genesis and position. [score:1]
Previous results in which zebrafish embryos were injected with anti- miR-200 class MOs found a delayed ORN differentiation, but axonal organization and GnRH neuron migration was not assessed (Choi et al., 2008). [score:1]
com/request/, while the anti- z-miR-200 MO mix was as previously published (Choi et al., 2008). [score:1]
Similarly, the depletion of miR-200-class (N = 23) resulted in a reduced number of GFP + neurons in 22% of GFP + embryos with the phenotype “reduced number” and 50% of the cases showing the phenotype “scattered position” (Fig.  7). [score:1]
We used the same MOs indicated above to deplete miR-9 and miR-200 class in GnRH3::GFP zygotes, and examined the effect on the number and position of the GFP + neurons associated to the terminal nerves, between 36 and 72 hpf. [score:1]
In Danio rerio (zebrafish) the miR-200-class is required for the proliferation, differentiation and survival of ORNs (Choi et al., 2008). [score:1]
Upon injection of the anti-miR-200 MO mix, only about 24% of examined embryos turned out CFP + (vs. [score:1]
To test whether the DLX5 protein physically occupies the Dlx5 sites near the miR-9.3 and miR-200a/ b/ miR-429 loci, Chromatin Immuno-Precipitation (ChIP) analysis on these sites was performed. [score:1]
The miR-200a, - 200b and - 429 loci are closely located on chromosome 4, while miR-141 and -200c are closely located on chromosome 6. miR-376a is clustered with 16 other miRs on chromosome 12. [score:1]
Using reporter zebrafish strains to visualize the embryonic olfactory axons (Miyasaka et al., 2005; Sato et al., 2005; Yoshida et al., 2002) or the GnRH + neurons (Abraham et al., 2008, 2009, 2010), we show that miR-9 and miR-200-class play a role in ORN differentiation and axonal organization. [score:1]
miR-9 and miR-200 mediate the Dlx5-Foxg1 cascade. [score:1]
Depletion of miR-9 and miR-200-class in zebrafish results in delayed ORN differentiation. [score:1]
We injected anti- miR-9 and anti- miR200 (or control) MOs in WT zygotes, then at 48 hpf we extracted total -RNA from these and carried out Real-Time qPCR analyses. [score:1]
[1 to 20 of 64 sentences]
14
[+] score: 186
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200c, hsa-mir-429
a. low miRNA-200a in stromal fibroblasts; b. high miRNA-200a in stromal fibroblasts; c. low miRNA-200a in cancer cells; d. high miRNA-200a in cancer cells; e. high HGF expression in stromal fibroblasts; f. low HGF expression in stromal fibroblasts; g. high HGF expression in cancer cells; h. low HGF expression in cancer cells. [score:9]
In previous studies, miRNA-200a expression has been shown to downregulate several prognostic markers for cancer patients, such as ZEB1, ZEB2, ATRX, DLC1, HFE and HNRNPA3 [17– 18]. [score:6]
The upregulation of miRNA-200a reduced the expression level of HGF protein in human CAFs. [score:6]
Upregulation of miRNA-200a reduced expression of HGF. [score:6]
TargetScan analysis suggests that HGF may be one of the target gene regulated by miRNA-200a. [score:6]
Barron et al [20] also found that miRNA-200a overexpression can reduce prostate cancer cell growth and its lower expression may predict biochemical relapse following radical prostatectomy in prostate cancer patients. [score:5]
Twenty-four hours after transfection, real-time PCR results showed that relative expression of miRNA-200a in the mimic -transfected group to be upregulated ~8-fold compared to control groups (p< 0.05; Figure 2a). [score:5]
a. different clinical stage groups; b. miRNA-200a expression groups; c. HGF expression groups. [score:5]
There had strong evidence in basic research to demonstrate that miRNA-200a inhibits EMT and suppresses lung cancer cell migration and invasion [16, 23]. [score:5]
Our results showed that a significant inverse correlation existed between miRNA-200a and HGF expression levels of stromal fibroblasts (p = 0.000; Table 1) in NSCLC specimen, whereas no significant association was found between miRNA-200a and HGF expression level in cancer cells (p = 0.135). [score:5]
Moreover, progressive loss of miRNA-200a expression was associated with disease progression. [score:5]
Expression of target gene HGF of miRNA-200a. [score:5]
MiRNA-200 is a family of tumor suppressor miRNAs consisting of five members (miRNA-200a, miRNA-200b, miRNA-200c, miRNA-429, and miRNA-141), which is significantly involved in inhibition of epithelial-to-mesenchymal transition (EMT), repression of cancer stem cells self-renewal and differentiation, modulation of cell division and apoptosis, and reversal of chemoresistance [16]. [score:5]
Our results showed that miRNA-200a expression of stromal fibroblasts in squamous carcinoma was higher than in non-squamous carcinoma (p=0.004; Table 2), as well as its expression in cancer cells. [score:5]
In conclusion, the results suggested that miRNA-200a expression was inverse correlation with HGF expression in stromal fibroblasts. [score:5]
To determine the regulatory role of miRNA-200a on HGF, we tested the effect of miRNA-200a elevation on HGF protein expression in human CAFs in vitro. [score:4]
org) to predict that HGF may be one of the target gene regulated by miRNA-200a. [score:4]
Furthermore, the 3-year OS rate was higher in patients with high miRNA-200a expression in stromal fibroblasts compared to those with low miRNA-200a expression (p=0.039; Figure 2b). [score:4]
For 56 patients with squamous carcinoma, the 3-year OS rates with low and high miRNA-200a expression in stromal fibroblasts were 39.8% and 59.7%, respectively (χ [2]=1.86, p=0.172). [score:3]
The expression of miRNA-200a and HGF was observed mainly in the cytoplasm. [score:3]
Association between miRNA-200a and HGF expression levels in stromal fibroblasts. [score:3]
Furthermore, in vitro, we confirmed overexpression of miRNA-200a decreased HGF protein level in human CAFs. [score:3]
With regard to age, gender, clinical stage, pathologic type, pathologic differentiation and vascular invasion, the significant difference that correlated with miRNA-200a expression in stromal fibroblasts was observed for gender (p=0.001) and pathologic type (p=0.004), respectively. [score:3]
However, no significant association was found to be miRNA-200a expression level in cancer cells with respect to OS in patients with NSCLC. [score:3]
However, no significant difference of OS was found between low and high miRNA-200a expression of stromal fibroblasts in patients with squamous carcinoma or non-squamous carcinoma, respectively (p=0.172; p=0.102). [score:3]
For 78 patients with non-squamous carcinoma, the 3-year OS rates with low and high miRNA-200a expression in stromal fibroblasts were 34.3% and 48.7%, respectively (χ [2]=2.68, p=0.102). [score:3]
The significant associations were found between miRNA-200a expression in cancer cells and age (p=0.027) and pathologic type (p=0.000) (Table 2). [score:3]
The amount of miRNA-200a expression (2 [−ΔΔ]Ct) was normalized using the endogenous U6 reference. [score:3]
Association between miRNA-200a expression and clinicopathologic features. [score:3]
High miRNA-200a and low HGF expression in stromal fibroblasts may predict a good prognosis in patients with NSCLC. [score:3]
a. Real-time PCR analysis of miRNA-200a expression in human CAFs. [score:3]
However, no significant association was found between low and high miRNA-200a/HGF expression levels in cancer cells with respect to OS in these patients, respectively (40.8% vs. [score:3]
van Kempen et al [19] showed that decreased expression level of miRNA-200a was correlation with increasing thickness in primary melanomas and metastases. [score:3]
Our results showed that miRNA-200a expression in cancer cells was correlated with pathologic type (p=0.000; Table 2). [score:3]
Expression of miRNA-200a and HGF in stromal fibroblasts and cancer cells. [score:3]
Conversely, one function overexpression study has yielded conflicting results on the role of miRNA-200a in lung cancer cell migration [24]. [score:3]
No significant association was found between miRNA-200a and HGF expression levels in cancer cells (χ [2] = 2.239, p = 0.135). [score:3]
The 3-year OS rates with low and high miRNA-200a expression in stromal fibroblasts were 37.6% and 52.3%, respectively (χ [2]=4.25, p=0.039; Figure 3b). [score:3]
Expression of miRNA-200a and HGF in NSCLC (magnification ×200). [score:3]
The analysis revealed a significant inverse correlation between miRNA-200a and HGF expression levels in stromal fibroblasts (χ [2] = 21.778, p = 0.000; Table 1). [score:3]
The results indicated that miRNA-200a expression in higher in cells treated with miRNA-200a mimics; b. of CAFs treated with miRNA-200a mimics. [score:3]
However, not much is known regarding miRNA-200a expression in tumor stromal fibroblasts and the relationship between miRNA-200a and HGF in cancer. [score:3]
The percentages of high miRNA-200a expression in stromal fibroblasts and cancer cells were 59.7% (80/134) and 52.2% (70/134), respectively (Figure 1a–1d). [score:3]
The previous studies have revealed the dysregulation of miRNA-200a in various cancers, including bladder cancer, breast cancer, colorectal cancer, endometrial cancer, gastric cancer, prostate cancer, and lung cancer [17, 19– 22]. [score:2]
On the contrary, miRNA-200a was found to be high expression in ovarian cancer cells compared to normal human ovarian surface epithelial cells. [score:2]
The multivariate analysis using by Cox proportional hazard mo del was fitted to investigate significant covariates including variables relation to OS: clinical stage, miRNA-200a and HGF expression in stromal fibroblasts. [score:1]
The sequence of miRNA-200a mimics and negative control are listed as below: 5′-UAACACUGUCUGGUAACGAUGUAUCGUUACCAGACAGUGUUAUU-3′ and 5′-UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT-3′ To transfect human CAFs, 100-pmol mimics of miRNA-200a (Ribobio, Guangzhou, China) and negative control in 200ul of serum-free medium were mixed with 5ul of Lipofectamine 2000 transfection reagent (Ribobio), dissolved in 200ul of the same medium, respectively. [score:1]
The third slide was used to evaluate miRNA-200a expression by ISH. [score:1]
In present study, therefore, we separately investigate the expression levels of miRNA-200a and its potential target gene HGF in stromal fibroblasts and cancer cells from specimens of NSCLC, and evaluate the prognostic significance of these markers in patients with clinical stage I -IIIA NSCLC after curative resection. [score:1]
The present study tried to explore miRNA-200a expression level in stromal fibroblasts and evaluate its prognostic value in NSCLC. [score:1]
Association of miRNA-200a and HGF expression and clinicopathologic characteristics. [score:1]
The relationships between miRNA-200a and HGF expression in cancer cells or stromal fibroblasts and clincopathologic characteristics were examined by Spearmann correlation coefficient test. [score:1]
Slides were hybridized at 55 [°]C for 2 hours with 50 nmol/L locked nucleic acid -modified digoxigenin-labeled probes for miRNA-200a (Boster, Wuhan, China). [score:1]
These results indicate that the role of miRNA-200a in NSCLC is rather complex. [score:1]
Human CAFs transfected with miRNA-200a mimics and negative controls. [score:1]
The sequence of miRNA-200a mimics and negative control are listed as below: 5′-UAACACUGUCUGGUAACGAUGUAUCGUUACCAGACAGUGUUAUU-3′ and 5′-UUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT-3′ To transfect human CAFs, 100-pmol mimics of miRNA-200a (Ribobio, Guangzhou, China) and negative control in 200ul of serum-free medium were mixed with 5ul of Lipofectamine 2000 transfection reagent (Ribobio), dissolved in 200ul of the same medium, respectively. [score:1]
However, the function of miRNA-200a may differ depending on cancer types. [score:1]
[1 to 20 of 57 sentences]
15
[+] score: 176
While up -regulating miR-200a expression decreased the invasion and migration capabilities of HCC cells (Figure 6B), inhibiting the expression of miR-200a-3p increased the levels of ZEB1 but decreased the levels of E-Cadherin in HCC cells treated with miR-200a-3p inhibitor (Figure 6C). [score:10]
When the expression of HULC in HCC cells transfected by HULC siRNA was inhibited, a significant increase in miR-200a-3p expression was observed as compared with siRNA-NC (P<0.05), and miR-200a-3p mimics could further promote miR-200a-3p expression. [score:8]
C. Expression levels of ZEB1 and E-Cadherin as determined using western blot in Huh-6, BEL-7402 and SMMC-7721 cells transfected with the miR-200a-3p inhibitor, miR-NC or HULC siRNA, and normalized to β-actin expression. [score:7]
However, HULC siRNA inhibited these changes in ZEB1 and E-Cadherin expression in HCC cells treated with the miR-200a-3p inhibitor (Figure 6C). [score:7]
Figure 3 A. Analysis of miR-200a-3p expression levels in HULC(L) and HULC(H) groups of HCC tissues as determined using qRT-PCR and normalized to GAPDH expression. [score:5]
In the present study, we found that the expression of miR-200a-3p was increased in HULC(L) HCC tissues (Figure 3A), while ZEB1 mRNA expression was decreased (Figure 3B). [score:5]
A. Analysis of miR-200a-3p expression levels in HULC(L) and HULC(H) groups of HCC tissues as determined using qRT-PCR and normalized to GAPDH expression. [score:5]
Accordingly, we present clear evidence indicating that miR-200a-3p was negatively regulated by HULC in HCC cells, and HULC functioned as a ceRNA to up-regulate ZEB1 by sequestering miR-200a-3p (Figure 3G). [score:5]
Taken together, these data indicate that miR-200a-3p was negatively regulated by HULC in HCC cells, and HULC functioned as a ceRNA to up-regulate ZEB1 by sequestering miR-200a-3p. [score:5]
Compared with siRNA-NC group, there was a high -expression of miR-200a-3p, but a low -expression of ZEB1 mRNA in HULC siRNA tumor samples (P<0.01) from the nude mice (Figure 7B). [score:4]
To determine whether HULC regulates EMT by affecting miR-200a targets, we first evaluated the effect of miR-200a-3p on the ZEB1 target. [score:4]
ZEB1 and miR-200-3p form a double -negative feedback loop that plays a key role in determining the metastatic fate of epithelial cancers through the regulation of downstream target genes and miRNAs [22]. [score:4]
This prediction was similar to that presented in a previous report indicating that ZEB1 was a target of miR-200a-3p as determined via a luciferase reporter [19]. [score:3]
miR-200 suppression in poor prognosis of some colorectal cancer (CRC) cells may promote ZEB1 -mediated cancer metastasis [45]. [score:3]
Loss of expression of the miR-200 family members may play a critical role in the repression of E-cadherin by ZEB1 and ZEB2 during EMT, thereby enhancing migration and invasion during cancer progression [44]. [score:3]
Cells were then transfected with 100 nmol/L of LncRNA HULC siRNA, miR-200a-3p mimics/inhibitor or a miR-NC that consisted of Lipofectamine 2000 transfection reagent. [score:3]
Meanwhile, the expression levels of miR-200a-3p were negatively correlated with those of ZEB1 mRNA (r=−0.558, P<0.001, Figure 3D). [score:3]
Based upon the bio-informatics database, we performed alignment prediction and found that HULC was aligned with sequences of miR-200a-3p (Figure 3E) and subsequently verified the presence of a targeting relationship between HULC and miR-200a-3p. [score:3]
Within our 38 clinical HCC tissues samples, we found that expression levels of HULC were negatively correlated with those of miR-200a-3p (r=−0.608, P<0.001, Figure 3C). [score:3]
B. QRT-PCR was performed to detect the average expression of miR-200a-3p and ZEB1 mRNA in xenograft tumors (n=5). [score:3]
D. Expression levels and location of ZEB1 and E-Cadherin as determined using immunocytochemistry in Huh-6, BEL-7402 and SMMC-7721 cells transfected with miR-200a-3p mimics, miR-NC or HULC siRNA (magnification, 400×, scale bars=20 μm). [score:3]
These results suggest that HULC can interfere with miR-200a -mediated inhibition of ZEB1, leading to a differentiation from EMT in HCC. [score:3]
As determined with immunocytochemistry, both intranuclear and intracytoplasmic levels of ZEB1 decreased, but E-Cadherin expression increased in HCC cells treated with miR-200a-3p mimics. [score:3]
G. Relative expressions of miR-200a-3p and ZEB1 mRNA as determined using qRT-PCR in Huh-6, BEL-7402 and SMMC-7721 cells transfected with HULC siRNA or miR-200a-3p mimics. [score:3]
A. Western blot was used to measure expression levels of ZEB1 and E-Cadherin in Huh-6, BEL-7402 and SMMC-7721 cells transfected with miR-200a-3p mimics or miR-NC, and normalized to β-actin expression. [score:3]
In addition, HULC siRNA promoted changes in ZEB1 and E-Cadherin expression in HCC cells treated with miR-200a-3p mimics (Figure 6D). [score:3]
D. Correlations between miR-200a-3p and ZEB1 mRNA expression in HCC tissues. [score:3]
Given that the ceRNA hypothesis, which proposes that a large number of non-coding RNA might function as molecular sponges for miRNAs and hence functionally liberate other RNA transcripts targeted by active miRNAs [46], we hypothesized that lncRNA HULC might serve as a ceRNA by sequestering miR-200a during EMT progress. [score:3]
When comparing expression levels of miR-200a-3p between HULC(L) and HULC(H) tissues, we found these levels to be significantly lower (P<0.01, Figure 3A). [score:3]
H19, as a competing endogenous RNA (ceRNA) for miR-138 and miR-200a, antagonized the functions of these miRNAs which results in the de-repression of their endogenous targets, Vimentin, ZEB1 and ZEB2. [score:3]
As expected, restored expression of miR-200a-3p decreased the protein levels of ZEB1 in Huh-6, BEL-7402 and SMMC-7721 cells treated with miR-200a-3p mimics. [score:3]
Expression levels of HULC were negatively correlated with those of miR-200a-3p in HCC samples (Figure 3C). [score:3]
It has been reported that ZEB1 is a target of miR-200a-3p via a luciferase reporter [42]. [score:3]
These results suggest that HULC can interfere with miR-200a -mediated inhibition of ZEB1, leading to differentiation from an epithelial to mesenchymal transition. [score:3]
To verify whether HULC enhanced EMT by sequestering miR-200a-3p in HCC cells, we assessed the protein levels of ZEB1 in miR-200a-3p over- or under -expressing HCC cells. [score:3]
H. Relative expressions of ZEB1 and HULC mRNA were measured by qRT-PCR in Huh-6 and BEL-7402 cells transfected with miR-200a-3p mimics or inhibitor. [score:3]
LncRNA HULC Smart Silencer, miR-200a-3p mimics/inhibitor, miRNA negative control (miR-NC), and RiboFECTTM CP Reagent were purchased from RiboBio Co. [score:3]
C. Correlations between HULC and miR-200a-3p expression in HCC tissues. [score:3]
Figure 6 A. Western blot was used to measure expression levels of ZEB1 and E-Cadherin in Huh-6, BEL-7402 and SMMC-7721 cells transfected with miR-200a-3p mimics or miR-NC, and normalized to β-actin expression. [score:3]
And, in turn, miR-200a-3p expression was negatively correlated with that of ZEB1 mRNA in HCC samples. [score:3]
miR-200a-3p appears to act as a multifunctional tumor suppressor miRNA in meningioma, which might be related to ZEB1 and E-Cadherin [47, 48]. [score:3]
B. The effect of increasing miR-200a-3p expression in cell invasion and migration of Huh-6, BEL-7402 and SMMC-7721, transfected with miR-200a-3p mimics or miR-NC, as determined using a transwell assay (magnification, 100×, scale bars=50 μm). [score:2]
However, these HULC and ZEB1 mRNA levels increased after transfection with the miR-200a-3p inhibitor as compared with that of miR-NC (P<0.05, Figure 3H). [score:2]
The E-Cadherin signal was decreased and ZEB1 increased following miR-200a knockdown. [score:2]
Findings from a previous study exhibited various levels of metastatic potential that are mainly regulated by ZEB1 and miR-200-3p [21]. [score:2]
E. A mo del showing the predicted interaction between HULC and miR-200a-3p through complementary base-pairs. [score:1]
As expected, miR-200a-3p decreased protein levels of ZEB1 in HCC cells (Figure 6A). [score:1]
HULC increased ZEB1 by sequestering miR-200a-3p. [score:1]
Such an effect would result in the sequestering of the miR-200a-3p signaling pathway thereby contributing to tumor growth and metastasis. [score:1]
Therefore, we hypothesized that HULC might promote angiogenesis as related to changes in ZEB1 and miR-200a-3p. [score:1]
F. A photograph showing the predicted interaction between miR-200a-3p and ZEB1 mRNA through complementary base-pairs. [score:1]
We also treated HCC cells with miR-200a-3p mimics/inhibitor and HULC siRNA to investigate the potential for interactions between miR-200a and HULC during EMT in HCC (Figure 6C). [score:1]
Protein levels of E-Cadherin increased significantly in HCC cells treated with miR-200a-3p mimics (Figure 6A). [score:1]
de/apps/zmf/mirwalk2/), we predicted that the miR-200a-3p binding site was at the 3′-UTR of ZEB1 (Figure 3F). [score:1]
HULC enhanced epithelial to mesenchymal transition by sequestering miR-200a-3p in HCC cells. [score:1]
Here, we demonstrate that HULC enhanced epithelial-mesenchymal transition by sequestering miR-200a-3p in HCC cells. [score:1]
HULC enhanced epithelial to mesenchymal transition by sequestering miR-200a in HCC cells. [score:1]
[1 to 20 of 57 sentences]
16
[+] score: 174
Unexpectedly, we found that miR-33a was down-regulated whereas miR-200a was strongly up-regulated in primary keratinocytes from elderly donors (Figure 5(a)), suggesting that the latter miRNA may be responsible of OGG1-2a down-regulation during skin aging. [score:10]
Interestingly, we found that miR-200a overexpression down-modulates also its putative target Bmi-1 and up-regulates p16 (Supplemental Figure 2). [score:8]
Moreover, miR-200a overexpression down-regulates OGG1-2a and induces IL-1 β secretion through NLRP3 pathway. [score:6]
Altogether, these findings point miR-200a as key player in primary human keratinocyte aging since its overexpression reduces oxidative DNA repair activity and may induce cell cycle arrest via p16 up-regulation and fuels chronic inflammation via NLRP3 activation (Supplemental Figure 2). [score:6]
Relative luciferase activity was significantly down-regulated (~29%) upon miR-200a overexpression (Figure 5(b)). [score:6]
In conclusion, miR-200a plays a pivotal role in primary human keratinocyte aging, since its overexpression reduces oxidative DNA repair activity and may induce growth arrest via p16 up-regulation and fuels chronic inflammation via NLRP3 activation. [score:6]
Furthermore, we show that miR-200a overexpression down-regulates Bmi-1 and induces p16. [score:6]
Thus, the observed IL-1 β secretion may be due to OGG1-2a down-regulation following miR-200a overexpression. [score:6]
HEK 293 cells were seeded in 12-well plates and cotransfected with 0.1  μg of OGG1 3′-UTR target sequence expression plasmid with 0.25  μg of pre-miR-200a or miR-scramble. [score:5]
Western blot analysis displayed a significant increased expression of cleaved form of caspase 1 (Figure 5(f)) and secretion of IL-1 β (Figure 5(g)) following miR-200a overexpression in human fibroblasts, demonstrating the activation of NLRP3 inflammasome. [score:5]
Of note, miR-200a overexpression induced also a significant increase of NRLP3, caspase 1, and IL-1 β expression (Figure 5(e)) mainly in fibroblasts, suggesting a role in the initiation of the inflammasome activation. [score:5]
Computational prediction of OGG1 as target gene of miR-33a and miR-200a was done using published algorithms: TargetScan (http://www. [score:5]
Following miR-200a expression, Bmi-1 expression significantly decreased at both mRNA and protein levels (Figures 5(h) and 5(i)) in HEK 293 cells and primary human fibroblasts. [score:5]
As expected, following miR-200a expression (Figure 5(c)), a significant decrease of OGG1-2a expression was observed in both cell types (Figure 5(d)). [score:5]
Thus, OGG1-2a is a direct target of miR-200a that increases with primary keratinocyte aging. [score:4]
However, miR-141 and miR-200c, which belong to miR-200 family, have been demonstrated to directly target Bmi-1 [71, 102, 103]. [score:4]
In this study, we show that primary human keratinocytes from elderly donors are characterized by a significant accumulation of the oxidative base lesion 8-OH-dG, an impairment of oxidative DNA repair and a decrease of OGG1-2a expression; OGG1-2a is a direct target of the ROS -induced miR-200a; the levels of miR-200a significantly increase in aged keratinocytes. [score:4]
Altogether, these data demonstrate that miR-200a is able to down-regulate OGG1-2a and modulates the NLRP3/IL-1 β and the Bmi-1/p16 axes. [score:4]
Altogether, these findings suggest that the age -dependent modulation of Bmi-1 and p16 in keratinocytes may be due, at least in part, to age-related miR-200a up-regulation. [score:4]
These findings suggest that the age -dependent miR-200a increase in human keratinocytes may induce NLRP3 inflammasome activation through OGG1-2a down-regulation. [score:4]
In keeping with our data, miR-200a has been found up-regulated during differentiation of human keratinocytes [87]. [score:4]
Here, we show that OGG1-2a, a BER enzyme critical for 8-OH-dG repair, is a direct target of miR-200a. [score:4]
To demonstrate that OGG1-2a is a direct target of miR-200a, HEK 293 cells have been cotransfected with a construct containing the OGG1-2a 3′-UTR downstream of a luciferase open reading frame and either with miR-200a or a miR-scramble. [score:4]
Thus, the age -dependent modulation of Bmi-1 and p16 in keratinocytes may be due, at least in part, to age-related miR-200a up-regulation. [score:4]
Down-modulation of miR-200a expression might be a useful tool to improve DNA repair system and reduce the chronic inflammation in aged skin. [score:3]
miR-200a overexpression was controlled by quantitative real-time PCR (qRT-PCR) (see methods below). [score:3]
Altogether, our data indicate that ROS overproduction may induce both oxidative DNA lesions and miR-200a expression in aged skin. [score:3]
2.6. miR-200a Overexpression. [score:3]
The demonstration that OGG1-2a is a direct target of miR-200a was successively verified by luciferase assays. [score:3]
In silico analyses indicated that OGG1-2a isoform is a potential target of both miR-33a and miR-200a. [score:3]
Specifically, computational miRNA target analysis revealed that OGG1-2a has two predicted seed sequences for miR-33a and one seed sequence for miR-200a in its 3′-UTR (Supplemental Figure 1A). [score:3]
ROS overproduction induces both oxidative DNA lesions, such as 8-OH-dG, and miR-200a expression. [score:3]
Indeed, it displays a seed sequence for miR-200a and is a demonstrated target of miR-141, a miR-200 family member that posses the same seed sequence of miR-200a. [score:3]
Our results obtained in HEK 293 cells and primary human fibroblasts show NLRP3 activation and IL-1 β secretion following miR-200a overexpression (Supplemental Figure 2). [score:3]
3.7. miR-200a Modulates OGG1-2a, NRLP3, IL-1 β, Bmi-1, and p16 Expression. [score:3]
Transient expression of miR-200a or miR-scramble in HEK 293 cells and primary human fibroblasts was carried out. [score:3]
Among these miRNAs, miR-200 family members have been established as key regulators of epithelial phenotype and cellular senescence [69– 71]. [score:2]
Of note, Bmi-1 may be considered a putative target of miR-200a. [score:2]
miR-141, which possesses the same seed sequence of miR-200a, induces senescence in human fibroblasts via posttranscriptional regulation of Bmi-1 [71]. [score:2]
3.7. miR-200a Modulates OGG1-2a, NRLP3, IL-1 β, Bmi-1, and p16 ExpressionTo investigate whether miR-200a up-regulation was able to modulate the senescence and inflammation players characterizing aged keratinocytes, we took advantage of the easily transfectable HEK 293 cell line. [score:2]
Supplemental Figure 2: a diagram of the functional effects of miR-200a on the oxidative DNA repair activity, growth arrest, and chronic inflammation. [score:1]
Supplemental Figure 1: miR-33a and miR-200a seed sequences on OGG1-2a gene. [score:1]
Interestingly, Bmi-1 possesses a seed sequence for miR-200a, although the relation between miR-200a and Bmi-1 has not yet been analyzed. [score:1]
These findings indicate an active multiple role of miR-200a in aging establishment. [score:1]
The miR-200 family consists of five members that can be divided into two functional groups according to their seed sequences: miR-200b, miR-200c, and miR-429 belong to functional group I whereas miR-141 and miR-200a to functional group II [69]. [score:1]
Both HEK 293 cells and primary human fibroblasts have been transfected with miR-200a or a miR-scramble. [score:1]
[1 to 20 of 46 sentences]
17
[+] score: 174
These findings suggest that dysregulation of the three miRNA clusters, namely the downregulation of the miR-200 clusters and the upregulation of the miR-221-222 cluster, is involved in the suppression of apoptosis in both breast CSCs and normal mammary stem/progenitor cells. [score:10]
miR-22 targets the methylcytosine dioxygenase TET (ten-eleven translocation) family members, inhibits the demethylation of the miR-200 promoter, and suppresses the expression of miR-200 [65]. [score:9]
The miR-200 family miRNAs downregulate ZEB1 and ZEB2 expression, and effectively upregulate the cellular E-cadherin level to maintain a cell in a more epithelial-like state (Figure 3). [score:9]
The multiple miRNAs dysregulated in the breast CSCs, such as miR-142, miR-146, miR-200, and miR-141, cooperatively activate the Wnt signaling pathway by targeting or upregulating the expression of its components. [score:9]
ZEB1 suppresses the expression of all miR-200 family members (miR-141, miR-200a,b,c and miR-429), which in turn inhibits the translation of ZEB1 mRNA, resulting in the double -negative ZEB/miR-200 feedback loop [160]. [score:9]
Expression of the miR-200 family miRNAs is downregulated in the breast CSCs and normal mammary stem/progenitor cells, and is upregulated in the more differentiated counterparts. [score:9]
These findings suggest that the downregulation of miR-200 members and upregulation of miR-146 are involved in the activation of the Notch signaling pathway in the breast CSCs and normal mammary stem/progenitor cells. [score:7]
These findings suggest that the three miRNA clusters, namely two miR-200 clusters and one miR-183 cluster, coordinately upregulate the expression of Bmi1 to enhance the stem cell self-renewal abilities in both breast CSCs and normal mammary stem/progenitor cells. [score:6]
miR-200 family miRNAs that are downregulated in human breast CSCs and normal mammary stem/progenitor cells function as the suppressors of the Wnt signaling pathways (Figure 3 and Figure 4). [score:6]
miR-200a and miR-141 suppress the Wnt signaling pathway by targeting β-catenin [150, 151]. [score:5]
miR-8, a Drosophila homologue of miR-200, targets TCF transcription factor and suppresses the Wnt signaling activities [152]. [score:5]
miR-200 family miRNAs suppress the Notch signaling by targeting Notch pathway components, such as JAG1 and the mastermind-like Notch coactivators, Maml2 and Maml3 (Figure 3) [170]. [score:5]
Downregulation of miR-200 family miRNAs and let-7 family miRNAs is observed in the CSCs of other cancers, such as colon cancer and Wilms tumor, and is associated with cancer progression [48, 49]. [score:4]
The miR-200 family miRNAs are involved in the regulation stem cell functions by targeting the genes and pathways important for stem cell maintenance, such as self-renewal factor Bmi-1, the apoptosis signaling pathway, the canonical Wnt signaling pathway, EMT and the Notch signaling pathway. [score:4]
Saydam O. Shen Y. Wurdinger T. Senol O. Boke E. James M. F. Tannous B. A. Stemmer-Rachamimov A. O. Yi M. Stephens R. M. Downregulated microRNA-200a in meningiomas promotes tumor growth by reducing E-cadherin and activating the Wnt/β-catenin signaling pathway Mol. [score:4]
The expression of the miR-200 family members can be regulated through interactions with transcriptional factors, modifications of their promoter regions, and Polycomb-group-gene -mediated repression. [score:4]
Because the expression of miR-200 family is downregulated in breast CSCs, analyses of the metastatic CSCs will be required to further characterize the roles of miR-200 family miRNAs in colonization and metastases to distant organs. [score:4]
The mammalian miR-200 clusters are expressed as two separate polycistronic pri-miRNA transcripts. [score:3]
The miR-200b, -200c and -429 subgroup miRNAs, but not the miR-200a and -141 subgroup miRNAs, target PLCγ1, reduce cell viability and induce apoptosis [71]. [score:3]
A large number of studies demonstrate the strong suppressive effects of miR-200 on cell transformation, cancer cell proliferation, migration, invasion, tumor growth and metastasis [61]. [score:3]
ZEB1 and ZEB2 can inhibit the transcription of the entire miR-200 family [58]. [score:3]
The mammalian miR-200 family gained particular prominence because it is involved in the regulation of EMT, EGF signaling, regulation of stem cell characters, and somatic cell reprogramming into induced pluripotent stem cells [24, 56, 66, 67, 68, 69, 70, 71, 72]. [score:3]
The miR-200 family is highly expressed within epithelial cells and miR-200c and miR-141 have both been strongly linked to epithelial integrity [158, 159]. [score:3]
These eight miRNAs are located on the three miRNA clusters and two of the three clusters are the miR-200 clusters, suggesting that the suppression of miR-200 family miRNAs is critically important in the maintenance of stem cell functions. [score:3]
The mammalian miR-200 family clusters are expressed as two separate polycistronic pri-miRNA transcripts: miR-200b-200a-429 and miR-200c-141 clusters (Figure 1). [score:3]
The miR-200 cluster is an extensively studied tumor-suppressive miRNA cluster in the genome (Figure 1). [score:3]
miR-22 targets the ten-eleven-translocation (TET) family of methylcytosine dioxygenases and demethylates the promoter region of the miR-200 precursor [161]. [score:3]
Figure 3 Targeting of the genes and pathways for stem cell maintenance by miR-200 family miRNAs. [score:3]
Kolesnikoff N. Attema J. L. Roslan S. Bert A. G. Schwarz Q. P. Gregory P. A. Goodall G. J. Specificity protein 1 (Sp1) maintains basal epithelial expression of the miR-200 family: Implications for epithelial-mesenchymal transition J. Biol. [score:3]
The promoter regions of the miR-200 family are bound by multiple transcription factors, including zinc finger E-box binding homeobox 1 (ZEB1) and 2 (ZEB2, also known as SIP1), specificity protein 1 (Sp1), Smad3, Wnt inhibitory factor 1 (WIF1) and p53. [score:3]
The modifications to the promoter regions of each of the miR-200 clusters cause the loss of the expression of the miR-200 family miRNAs in cancer. [score:3]
Therefore, the interplay between the miR-200 family, miR-22, and ZEB1/ZEB2 plays an important role in the stemness regulation and EMT. [score:2]
Brabletz S. Brabletz T. The ZEB/miR-200 feedback loop—A motor of cellular plasticity in development and cancer? [score:2]
Wang G. Guo X. Hong W. Liu Q. Wei T. Lu C. Gao L. Ye D. Zhou Y. Chen J. Critical regulation of miR-200/ZEB2 pathway in Oct4/Sox2 -induced mesenchymal-to-epithelial transition and induced pluripotent stem cell generation Proc. [score:2]
The miR-200 family miRNAs have been highly conserved in deuterostome from Echinodermata and Chordata to all Vertebrata classes, including fish, amphibians, reptiles, birds and mammals [55]. [score:1]
Interestingly, the cooperation between miR-22 and the miR-200 family results in EMT, an elevated pool of stem cells and increased tumorigenesis. [score:1]
Le M. T. Hamar P. Guo C. Basar E. Perdigao-Henriques R. Balaj L. Lieberman J. miR-200-containing extracellular vesicles promote breast cancer cell metastasis J. Clin. [score:1]
The miR-200 family in mammals is composed of five miRNAs: miR-200a, miR-200b, miR-200c, miR-141, and miR-429. [score:1]
3.1. miR-200 Clusters. [score:1]
The miR-200 family members can also be divided into two subgroups based upon their seed sequences that differ by only 1 nt between the subgroups: miR-200b, -200c, and -429 (AA UACUG) and miR-200a and -141 (AA CACUG). [score:1]
Thus, ZEB1 and ZEB2 keep a cell in a mesenchymal phenotype by repressing the transcription of both E-cadherin and the miR-200 family miRNAs. [score:1]
Burk U. Schubert J. Wellner U. Schmalhofer O. Vincan E. Spaderna S. Brabletz T. A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells EMBO Rep. [score:1]
Furthermore, the metastatic mouse mammary tumor 4T1 cells, but not the poorly metastatic mammary tumor 4TO7 cells, can secrete miR-200 family miRNAs into exosomes [190]. [score:1]
In addition, miR-200 family miRNAs are involved in colonization and metastases to distant organs [195]. [score:1]
Among them, miR-200a, miR-200b and miR-429 are found in all deuterostomes including Echinodermata, Chordata and Vertebrata, but miR-200c and miR-141 are only detected in cephalochordates, teleosts and mammals or in tunicates, teleosts and mammals, respectively. [score:1]
Mongroo P. S. Rustgi A. K. The role of the miR-200 family in epithelial-mesenchymal transition Cancer Biol. [score:1]
Lim Y. Y. Wright J. A. Attema J. L. Gregory P. A. Bert A. G. Smith E. Thomas D. Lopez A. F. Drew P. A. Khew-Goodall Y. Epigenetic modulation of the miR-200 family is associated with transition to a breast cancer stem-cell-like state J. Cell Sci. [score:1]
Trumbach D. Prakash N. The conserved miR-8/miR-200 microRNA family and their role in invertebrate and vertebrate neurogenesis Cell Tissue Res. [score:1]
Furthermore, miR-200 family members belonging to either seed sequence subgroup do not show a clear phylogenetic relationship, suggesting that the 1 nt difference between the two subgroups arose independently in different lineages [56]. [score:1]
The roles of miR-200 family miRNAs in breast CSCs are described in more detail later in Section 4. The miR-183 cluster, which is comprised of miRNA-183, -96 and -182, is a miRNA family with sequence homology (Figure 1). [score:1]
The poorly metastatic 4TO7 cells can take up miR-200 from the exosomes of 4T1 cells and become metastatic in a miR-200 -dependent manner. [score:1]
[1 to 20 of 51 sentences]
18
[+] score: 166
For example, in one study, overexpression of Stat3 [44], PDGF-D [45], Notch-1 [46], and DCLK1 [47] in cancer cells led to significant downregulation of miR-200 family members; this resulted in up-regulation of ZEB1, ZEB2, and SNAI2 expression and acquisition of the EMT phenotype. [score:11]
Similarly, NPV-LDE-225 suppressed EMT by upregulating E-cadherin and inhibited N-cadherin, Snail, Slug, and ZEB1 by increasing miR-200a, miR-200b, and miR-200c [43]. [score:8]
A plethora of miRNAs, including miR-200 family members and miR-506, have been found to directly regulate the expression of the target genes that are known to play critical roles in EMT regulation (Figure  4). [score:8]
MiR-200 can directly target β-catenin mRNA, inhibiting its translation and blocking Wnt/β-catenin signaling in meningioma [24]. [score:7]
IDH1 and IDH2 mutants also caused an EMT-like phenotype; this phenotype was dependent on upregulation of the transcription factor ZEB1 and downregulation of miR-200 family members [48]. [score:7]
Inhibition of the Smad signaling pathway completely blocked the TGF-β1 -mediated decrease in miR-200, suggesting that TGF-β1 -induced suppression of the miR-200 family is regulated via Smad [27]. [score:6]
Pathways that promote EMT by suppressing miR-200 and upregulating ZEB1 and ZEB2. [score:6]
Furthermore, a recent study illustrated that miR-200 members can target Jagged1, thereby mediating the downregulation of ZEB1 [23]. [score:6]
Pathways that suppress EMT by upregulating miR-200 and repressing ZEB1 and ZEB2. [score:6]
Several molecules have been found to upregulate the miR-200 family and consequently suppress EMT. [score:6]
p53 has been reported to transactivate miR-200 family members by directly binding to the promoters that repress ZEB1 and ZEB2 expression, leading to inhibition of EMT [41, 42]. [score:6]
Exposing epithelial cells to TGF-β promotes the loss of epithelial morphological features, the increased expression of EMT marker genes such as ZEB1 and ZEB2, and the decreased expression of miR-200 [25]. [score:5]
MiRNAs other than miR-200 inhibit EMT by targeting ZEB1 and ZEB2. [score:5]
The Wnt/β-catenin signal pathway promotes EMT in cancer, and miR-200a was found to inhibit Wnt/β-catenin by targeting ZEB1 and ZEB2. [score:5]
The results of recent studies suggest that members of the miR-200 family play a critical role in suppressing EMT and cancer invasion and metastasis [34] by targeting transcriptional repressors of ZEB1 and ZEB2 [35]. [score:5]
In addition to miR-200 family members, other miRNAs have been identified that regulate EMT by directly targeting ZEB1 and ZEB2. [score:5]
While SNAI2 is targeted by miR-200, SNAI2 directly binds E-boxes in the miR-200a/b promoter regions and represses miR-200a/b transcription. [score:4]
Moreover, some signaling pathways, including p53, regulate EMT by regulating the miR-200-ZEB1 and ZEB2 regulatory loop. [score:4]
Meanwhile, ZEB1 can directly suppress miRNA-200 family members in cancer cells, including miR-141 and miR-200c [36, 37]. [score:4]
Members of the miR-200 family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429) have emerged as important regulators of EMT, in part by targeting ZEB1 and ZEB2. [score:4]
The miR-200 family is usually downregulated in human cancer cells and tumors as a result of aberrant epigenetic gene silencing. [score:4]
Other miRNAs can induce EMT by downregulating miR-200 through DICER, such as miR-103 or miR-107 [49]. [score:4]
Smad3 was also reported to upregulate miR-200 family members at the transcriptional level in a TGF-β-independent manner [40]. [score:4]
Similarly, it was reported that EGF and EGFR can promote EMT by downregulating the miR-200 family in anaplastic thyroid cancer cells [32]. [score:4]
It was also reported that ZEB1 and ZEB2 repressed the expression of miR-200a, miR-200b, and miR-429 by binding to a conserved pair of ZEB-type E-box elements located proximal to the transcription start site in the promoter region [38]. [score:3]
All of these findings indicate that these molecules promote EMT by suppressing miR-200. [score:3]
In addition to their role in regulating EMT, miR-200 family members are negatively regulated by multiple signaling pathways. [score:3]
ZEB1 and Twist1 bound the E-box consensus in the promoters proximal to the putative miR-200 TSS and repressed miR-200 expression. [score:3]
Therefore, ZEB1 and ZEB2 and miR-200 family members repress expression of each other in a reciprocal feedback loop, which may lead to amplification of EMT. [score:3]
Epigenetic regulation of miR-200. [score:2]
Twist1 was also reported to directly associate with miR-200 promoters as a transcriptional repressor of miR-200 [56] (Figure  3A). [score:2]
In another double-feedback loop, miR-200 and SNAI2 regulate EMT. [score:2]
Therefore, SNAI2 and miR-200 act in a self-reinforcing regulatory loop that leads to amplification of EMT [71]. [score:2]
Moreover, SNAI1 can repress transcription of miR-34 genes, resulting in a SNAI1/miR-34 feedback loop that is analogous to the reciprocal ZEB/miR-200 feedback loop [66]. [score:1]
Similarly, miR-130b silencing can restore DICER1 to a threshold level that allows miR-200 family members to repress EMT in endometrial cancer [50]. [score:1]
The miR-200 family consists of five members in two clusters: miR-200b ~ 200a ~ 429 and miR-200c ~ 141. [score:1]
Figure 3 MiR-200 and miR-506 DNA methylation genomic loci and promoters of E- and N-cadherin. [score:1]
Aberrant DNA methylation of the CpG island or the CpG-enriched regions is closely linked to miR-200 inappropriate silencing in cancer cells [57]. [score:1]
Other factors may also be involved in miR-200 repression, such as ZEB1 and Twist1. [score:1]
Furthermore, delivery of miR-200 members into the tumor endothelium resulted in marked reductions in metastasis and angiogenesis [98]. [score:1]
A recent study showed that induction of ZEB1 and ZEB2 increased the methylation of miR-200 promoters [58]. [score:1]
MiR-200 family members can also be epigenetically regulated. [score:1]
[1 to 20 of 42 sentences]
19
[+] score: 153
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c
Members of the miR-200 family are downregulated in human cancer cells and tumors due to aberrant epigenetic gene silencing and play a critical role in the suppression of EMT, tumor cell adhesion, migration, invasion and metastasis, by targeting and repressing the expression of key mRNAs that are involved in EMT (ZEB1 and ZEB2), and participates in a signalling network with the E-cadherin transcriptional repressors ZEB1/ deltaEF1 and ZEB2/SIP1, and TGF-β2 that is postulated to facilitate maintenance of stable epithelial or mesenchymal states but also allow reversible switching between these states in response to EMT effectors (such as TGF-β) [15, 16]. [score:10]
By westernblot analysis, we found that the overexpression of miR-200a in the CSCs resulted in the up-regulation of epithelial marker E-cadherin and down-regulation of mesenchymal markers ZEB1 and N-cadherin, but not Vimentin at protein level (Figure  4A and 4B). [score:9]
Moreover, overexpression of miR-200a was resulted in down-regulation of N-cadherin, ZEB1 and vimentin, but up-regulation of E-cadherin. [score:9]
We found that the overexpression of miR-200a in the CSCs resulted in the up-regulation of epithelial marker E-cadherin and down-regulation of mesenchymal markers ZEB1, N-cadherin and Vimentin at mRNA level (Figure  3B). [score:9]
Among many miRNAs, miR-200 family is known as tumor suppressor and they are usually down-regulated in some tumors including prostate cancer and the loss of expression of miR-200 family contributes to the acquisition of EMT phenotype and drug resistance. [score:8]
In the present study, miR-200a inhibits epithelial-mesenchymal transition by inhibiting the expression of vimentin, N-cadherin and ZEB1, and also retards CSCs migration and invasion. [score:7]
Members of miR-200 family are known to be tumor suppressors, which are usually downregulated in some tumors. [score:6]
Down-regulation of miR-200 by siRNA technique has been shown to be associated with EMT phenotype while overexpression of miR-200a can result in the reversal of EMT phenotype [22]. [score:6]
Down-regulation of miR-200 by siRNA technique has been shown to be associated with EMT phenotype while reexpression of miR-200 can result in the reversal of EMT phenotype. [score:6]
Real time-PCR result showed that miR-200a were significantly downregulated in CSCs (Figure  2A), while miR-200b and miR-200c expressions were similar with PANC-1 cell line (data was not shown). [score:6]
These results clearly suggested that overexpression of miR-200a inhibits migration and invasion of CSC cells through the reversal of EMT to MET phenotype. [score:5]
MiR-200 family is known as tumor suppressor and they are usually down-regulated in EMT in some cancer stem cells, such as in prostate cancer and breast cancer [22, 23]. [score:5]
In addition, miR-200a overexpression inhibited cell migration and invasion in CSCs. [score:5]
Figure 2 miR-200a and EMT markers expression in CSCs of PANC-1. (A) Real-time PCR analyzed the expression of miR-200a in PANC-1 and CSCs. [score:5]
MIR-200a and EMT markers expression in CSC of PANC-1. MIR-200a regulated EMT of CSCs in pancreatic cancer. [score:4]
Interestingly, recent studies have also shown that miR-200 family could regulate the processes of EMT by targeting E-box binding protein ZEB1 and ZEB2 [36]. [score:4]
In summary, we identified a highly tumorigenic subpopulation of pancreatic cancer cells expressing the cell surface markers CD24, CD44 and ESA in pancreatic adenocarcinoma cell line PANC-1. MiR-200a played important roles in the MET process of CSCs by changing EMT markers expressions and cell migration and invasion. [score:4]
Among the family of miR-200, only miR-200a expression was dramatically decreased. [score:3]
We determined the expression levels of miR-200a, miR-200b and miR-200c in CSCs of PANC-1 by real time RT-PCR. [score:3]
Then, we analysed the miR-200 family and transcription factors Oct4 and Nanog expression in CSCs of pancreatic cancer cell line PANC-1, and determined their relationships with EMT markers and repressors of E-cadherin transcription. [score:3]
In ovarian and breast cancer, low expression of miRNA-200 plays important roles in cancer metastasis [14, 17, 18]. [score:3]
Pancreatic cancer cells with EMT phenotype displayed stem-like cell features characterized by the expression of cell surface markers CD24, CD44 and epithelial-specific antigen (ESA), which was associated with decreased expression of miR-200a. [score:3]
These findings hypothesizes that the expression of miR-200 in pancreatic cancer cell is correlated with stemness, EMT and metastasis. [score:3]
We determined the expression levels of miR-200a, miR-200b and miR-200c in PANC-1 cell line and CSCs by real time-PCR. [score:3]
And miR-200 has been identified as a powerful regulator of EMT. [score:2]
MiR-200a overexpression decreased the ability of invasion and migration of CSCs. [score:2]
Figure 3 miR-200a regulated EMT of CSCs in pancreatic cancer. [score:2]
MiR-200 changed the tumor environment, inhibiting the process of EMT and metastasis [19, 20]. [score:2]
RT-qPCR was performed using the miScript PCR Kit to assay the expression of miR-200 family. [score:2]
In order to find the role of miR-200a in the process of EMT, miR-200a mimic was transfected to CSCs. [score:1]
Cells were transfected with either control (5′-UUGUACUACACAAAAGUACUG-3′) or miR-200a (forward 5′-UAACACUGUCUGGUAACGAUGU-3′, reverse 5′-AUCGUUACCAGACAGUGUUAUU-3′) mimic at a final concentration of 25 nM using EntransterTM-R transfection reagent (Engreen). [score:1]
Control and miR-200a mimic were purchased from Invitrogen. [score:1]
The number of cells invasion and migration in the miR-200a mimic treated groups were decresed (A-F). [score:1]
These results suggest that the loss of miR-200a is critical for the acquisition of EMT characteristics and that the overexpression of miR-200a could reverse the EMT phenotype of CSCs. [score:1]
After transfection, the morphology of miR-200a transfected CSCs was partially changed from elongated fibroblastoid to epithelial cobblestone-like appearance, and the cells appeared to grow in close contact with each other (× 200 magnification) (Figure  3C-E). [score:1]
Total protein was extracted from untreated and the cells treated by transfecting miR-200a and subjected to western blot analysis as described to evaluate the expression of E-cadherin, N-cadherin, ZEB1 and vimentin. [score:1]
Thus, the discovery of molecular knowledge of drug resistance and metastasis in relation to miR-200 family, CSCs and EMT in pancreatic cancer are becoming an important area of research, and such knowledge is likely to be helpful in the discovery of newer drugs as well as designing novel therapeutic strategies for the treatment and/or prevention of pancreatic cancer with better outcome. [score:1]
Figure 5 miR-200 reduces invasion and migration in human pancreatic cancer. [score:1]
Thus, further studies are needed to elucidate how miR-200a eliminates the stem-like cells by reversing EMT phenotypic cells and to assess whether miR-200a could be useful for the prevention of pancreatic cancer tumorigenesis and metastasis. [score:1]
The results showed that the number of CSCs transfected with miR-200a mimic which invaded and migrated to the lower side of the membrane was significantly decreased than CSCs or NC mimic by about 0.33 fold in invasion and 0.22 fold in migration, respectively (Figure  5). [score:1]
MiR-200a, miR-200b, miR-200c and U6 kits were purchased from Biomics biotech (NanTong). [score:1]
In order to study the role of miR-200a for EMT in CSCs, miR-200a mimic was transformed into CSCs. [score:1]
Figure 4 miR-200a induced MET in human pancreatic CSCs. [score:1]
[1 to 20 of 43 sentences]
20
[+] score: 142
Other miRNAs from this paper: hsa-mir-142, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2
Transfection of human MDMs with MIM-200a downregulated SOCS6 (FC = 0.57) while inhibition of miR-200a-3p (INH-200a) upregulated SOCS6 (FC = 1.55), confirming that miR-200a-3p effectively regulates the expression of SOCS6 (Fig. 3e). [score:12]
Our study suggests co-infection leads to overexpression of miR-200a-3p, which in turn targets and downregulates the JAK-STAT regulator SOCS-6 and consequently increases CXCL10 (IP-10) expression. [score:11]
Overexpressing miR-200a-3p (MIM-200a) in single and mixed IAV/SP-infected cells enhanced the levels of CXCL10 at 24 h post-infection, whereas partial inhibition (INH-200a) downregulated the expression of CXCL10 (Fig. 3d). [score:10]
Moreover, SOCS6 was synergistically downregulated in IAV- or IAV/SP-infected MDMs overexpressing miRNA-200a (Fig. 3e), suggesting that both infection and miR-200a-3p negatively regulate the expression of SOCS6. [score:9]
In vitro, miR-200a-3p was synergistically induced following mixed IAV/SP infection of human MDMs and found to indirectly regulate CXCL10 (IP-10) expression by targeting the suppressor of cytokine signaling-6 gene (SOCS6), a well-known repressor of the JAK-STAT signaling pathway. [score:9]
These results indicate miR-200a-3p is strongly induced in response to mixed viral and bacterial co-infection, which in turn leads to downregulation of the JAK-STAT regulator SOCS-6 at both the mRNA and protein levels and subsequent upregulation of IP-10. [score:8]
As TGFB2 is known to be targeted by miR-200a-3p (Fig. 3b, in silico alignment), we monitored its expression to assess the efficiency of mimicking/inhibiting miR-200a-3p in THP-1 MDMs. [score:7]
Predictive target analysis indicated that the 3‘ UTR of suppressor of cytokine signaling-6 (SOCS6) may be targeted by miR-200a-3p (Fig. 3b). [score:7]
For miR-200a-3p inhibition/mimic assays, 1 × 10 [6] THP-1 MDMs were transfected with either 30 nmol miRVana® hsa-miR-200a-3p inhibitor (#4464084), hsa-miR-200a-3p mimic (#4464066), miRNA Inhibitor Negative Control #1 (#4464077) or miRNA Mimic Negative Control #1 (#4464058; all Life Technologies) in OptiMEM (Life Technologies) using 3 μl Invitrogen RNAiMAX Lipofectamine/well in 12-well plates. [score:6]
MiRNA-200a-3p indirectly regulates IP-10 expression by targeting SOCS6. [score:6]
Using a specific Taqman probe assay targeting miR-200a-3p, we confirmed a significant upregulation of miR-200a-3p following mixed IAV and SP infection of human MDMs (Fig. 3a). [score:5]
As the general trend was suggestive of a synergistic induction of miR-200a-3p in response to mixed infection (Fig. 3a), we hypothesized microRNA-200a-3p may play a role in the regulation of CXCL10 (IP-10), which was also synergistically upregulated in mixed-infected MDMs (Fig. 2c and d) and primary HAEC (Fig. 2e). [score:5]
As shown in Fig. 2a, several JAK-STAT signaling pathway genes were deregulated in mixed IAV- and SP-infected human MDMs; therefore, we hypothesized that miR-200a-3p directly regulates a regulator of the JAK-STAT signaling pathway. [score:5]
A specific PCR-probe assay targeting miR-200a-3p was used to assess the fold changes in miR-200a-3p expression in mock -transfected and infected cells. [score:4]
Interestingly, a complementary in-silico approach reveals that several microRNAs that were found dysregulated in our experiments of IAV and SP co-infection of MDMs or HAEC, might target several genes of SOCS family and play similar role than miR-200a-3p. [score:4]
Endogenous miRNA-200a-3p expression correlates with CXCL10 (IP-10) induction following mixed IAV and SP infection of human MDMs. [score:3]
By focusing on the intracellular mechanisms that regulate inflammatory pathways, we demonstrated a novel role for miRNA-200a-3p in the regulation of CXCL10 (IP-10). [score:3]
To test this hypothesis, we investigated the effects of overexpressing (MIM-200a) or inhibiting (INH-200a) microRNA-200a in MDMs. [score:3]
MiRNA-200a-3p was overexpressed after both single IAV (FC = 6.9), single SP (FC = 3.7) and mixed IAV/SP infection (FC = 7.3), indicating this miRNA may play a role in the innate immune response to viral and bacterial co-infection. [score:3]
In this experiment, a more marked up-regulation of miR-200a-3p was observed following IAV+SP compared to results obtained previously (Fig. 2b). [score:3]
These results suggested miR-200a-3p indirectly regulates CXCL10 and led us to hypothesize that miR-200a-3p controls a potential repressor of the JAK-STAT signaling pathway. [score:3]
Among all microRNAs screened, miR-200a-3p was the most overexpressed in IAV/SP co-infection of human MDMs. [score:3]
This discrepancy has been attributed to the use of two different approaches to quantify miR-200a-3p expression. [score:3]
Similar miRNA-200a-3p dysregulation profiles were obtained following IAV and/or SP infections of human macrophages-like (THP-1 monocytes-derived macrophages) or primary MDMs (data not shown). [score:2]
IAV and SP co-infection of MDMs exacerbates induction of IP-10: putative role for miR-200a-3p in regulating the JAK-STAT signaling pathway. [score:2]
MiRNA-200a-3p was not predicted to target any of the other six members of the SOCS gene family. [score:2]
In the remainder of this study, we decided to investigate the interconnection between miR-200a-3p expression and the innate immune response. [score:1]
Functional analysis of miR-200a-3p. [score:1]
Functional analysis of the synergistic induction of miR-200a-3p in MDMs after mixed infection with IAV and SP. [score:1]
The use of a target-specific stem-loop reverse transcription primer in Fig. 3a allows a better sensitivity of miR-200a-3p detection compared to the non-specific fluorescent dye used in Fig. 2b. [score:1]
[1 to 20 of 30 sentences]
21
[+] score: 137
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-200c
Given the remarkable pleiotropy of the miR-200 family in regulating genome-wide targets to suppress EMT, the regulation of specific cellular functions is still being elucidated. [score:7]
Similar results were obtained with the mesenchymal human H157 lung cancer cell line with a stable doxycycline-inducible system to express miR-200a and/or b at levels ~20-fold baseline 32, which produced an MET with morphologic reorganization into tight epithelial clusters (Fig. 1f), suppression of ZEB1 and other mesenchymal markers, and re -expression of epithelial protein markers (Fig. 1g). [score:7]
Based upon our previously published findings that the KP tumors have significantly elevated levels of TGFβ as a driver of EMT and metastasis 30 and that metastatic cell lines from the mo del can be alternately shifted in their phenotype by miR-200 expression (Supp Fig. S3h) or treatment with TGFβ, we probed the effect of TGFβ -induced EMT on the 344SQ murine cells and demonstrated robust up-regulation of signaling through the FAK/CRKL pathway (Fig. 5g). [score:6]
Either intrinsic dysregulation of Zeb1 or TGFβ -mediated suppression of miR-200 can de-repress CRKL expression to drive subsequent collagen I -mediated ITGβ1-FAK signaling. [score:6]
As a functional consequence, in vitro migration and invasion were enhanced in the previously non-invasive 393P cells, and suppressed upon miR-200 re -expression (Fig. 1e). [score:5]
Additionally, across the TCGA datasets (n = 9105 tumor specimens), CRKL levels negatively correlated with the miR-200 family levels, positively correlated with the expression of ZEB1, an EMT gene expression signature, and the p-Src Y416 levels (Fig. 4b). [score:5]
Because neither Itgβ1 nor FAK are predicted miR-200 family targets and neither correlated with the EMT status of the cells, we analyzed the pan-cancer TCGA datasets 34 and a separate compendium of publically-available lung cancer datasets 25 for genes with negative correlation to miR-200 family expression, high correlation to ZEB1, and predicted miR200b sites in the 3′ UTR by three different prediction algorithms (Fig. 4a and Supplemental Table 2). [score:5]
Upon re -expression of miR-200 the cells displayed a more organized epithelial acinar structure in Matrigel culture, with pronounced cortical actin staining, and suppression of the collagen -induced protrusions (Fig. 2a, bottom row). [score:5]
The generation of the genetically modified 393P and 344SQ cell lines stably expressing ZEB1 or the miR-200b, −200a, −429 cluster, respectively, are described in previous publications 30 42, while the H157 cells with doxycycline-inducible expression of miR-200a, −200b or the combination were previously described in 32 and 43. [score:5]
In this manner, direct regulation by miR-200 of the CRKL adaptor suppresses FAK/Src complex formation at the membrane and subsequent downstream signaling from collagen I-Itgβ1. [score:5]
Conversely, the ability of miR-200 expression to suppress cellular response to the ECM also explains the normalizing effects of laminin-rich matrices on tumor cells 30, a counter-balancing effect that enhances tumor cell adaptability to the microenvironment and facilitates the later steps in metastasis, such as distant colonization. [score:5]
This MET with expression of miR-200 significantly suppressed the migratory and invasive ability of the H157 cells (Fig. 1h). [score:5]
Consistently, the importance of miR-200 in modulating CRKL regulation of collagen I-Itgβ1 -dependent cell signaling was emphasized by results from multiple different experimental systems, including 2D and 3D in vitro assays with murine and human cells, knockdown -based strategies at several points in the pathway, and in vivo metastasis driven by loss of miR-200 expression in the syngeneic KP mo del. [score:4]
CRKL is a miR-200 target that regulates integrin -dependent signaling and is prognostic of patient outcome. [score:4]
Biochemically, the increased matrix responsiveness of tumor cells upon Zeb1 expression was due to enhanced FAK signaling, which was essentially shutoff with high miR-200 levels and phenocopied by CRKL or Itgβ1 knockdown. [score:4]
A very recent study from the Goodall lab 41 using breast cancer cells to identify transcriptome-wide miR-200 targets by an Ago-HITS-CLIP and sequencing approach identified multiple genes involved in invadopodia formation, MMP activity, and regulation of actin cytoskeletal dynamics. [score:4]
CRKL is a miR-200 target that regulates integrin -dependent signaling and correlates with patient outcome. [score:4]
However, the full complement of cellular functions altered during EMT that are specifically regulated by gain of Zeb1 expression and loss of miR-200 is unclear. [score:4]
The morphologic changes observed with Zeb1 expression were concordant with an EMT, as judged by the mRNA and protein levels of epithelial and mesenchymal markers (Fig. 1c) and decreases in the miR-200 family members (Fig. 1d). [score:3]
The morphologic changes, signaling activation and focal adhesion formation were completely abrogated by constitutive miR-200 expression in the cells (Fig. 5g,h and Supp Fig. S3i). [score:3]
Given the enhanced focal adhesion complex formation and signaling observed in 2D cultures, we studied the importance of the ECM in regulating tumor cell behavior in coordination with Zeb1/miR-200 expression changes in a well-established assay 33. [score:3]
This change was partially reversed by re -expression of miR-200, which restored cell-cell junctions (lower panel of Fig. 1a). [score:3]
Immunofluorescent staining demonstrated that the mesenchymal, invasive 344SQ and 393P_ZEB1 cells display extended cell protrusions, long actin stress fibers and thin cell bodies with enhanced cell matrix contact, while miR-200 expression produced rounded, clustered cells with cortical actin staining and minimal matrix contact (393P_vec or 344SQ_miR-200) (Fig. 1b). [score:3]
Zeb1 expression induces EMT/miR-200 repression and FAK pathway activation in previously non-invasive cells. [score:3]
Moreover, in the genetically manipulated 393P cells (Fig. 3b) and the inducible miR-200 -expressing human H157 cells (Fig. 3c) we observed an inverse correlation between the activation of this pathway and the miR-200 levels, with no clear relationship to the levels of Itgβ1 or total FAK. [score:3]
Our extensive prior bioinformatic analyses incorporating mRNA and proteomic profiles of tumor cells with high/low miR-200 expression revealed genome-wide changes altering the balance of cell-cell and cell-matrix interactions, along with substantial effects on the surrounding ECM composition 23. [score:3]
The most pronounced effect was seen upon combined miR-200a and b expression. [score:3]
How to cite this article: Ungewiss, C. et al. The microRNA-200/Zeb1 axis regulates ECM -dependent β1-integrin/FAK signaling, cancer cell invasion and metastasis through CRKL. [score:2]
Two point mutations were introduced in each miR-200 seed sequence (red). [score:2]
Based upon the multiple lines of in vitro and in vivo data included herein, a schema is presented that outlines our working mo del for the role of miR-200 in regulating tumor cell activation by interactions with the ECM (Fig. 5j). [score:2]
As a master EMT regulator, the Zeb1-miR-200 double -negative feedback loop has been shown by multiple groups to play a prominent role in tumor invasion and metastasis. [score:2]
To test whether total CRKL levels are regulated by miR-200, and could therefore modulate signaling downstream of Itgβ1, we constructed a luciferase reporter containing the wild-type CRKL 3′ UTR. [score:2]
These results suggest that miR-200 repression produces a cellular EMT while also potentiating the response of the cells to external stimulation from the collagen I-containing ECM, both of which are required to produce an invasive phenotype. [score:1]
miR-200 repression alters collagen I -dependent cell-matrix interactions. [score:1]
Zeb1/miR-200 balance induces a functional EMT in non-invasive epithelial tumor cells. [score:1]
In contrast, concomitant changes in the miR-200 levels and manipulation of the matrix composition by inclusion of type I collagen produced robust invasion. [score:1]
Two isogenic cell line pairs (344SQ_vector vs 344SQ_miR-200 and 393P_vector vs 393P_Zeb1) were used to measure the expression levels of six candidates, which again identified CRKL in strong relationship with Zeb1 and miR-200 levels (Fig. 4d and Supp. [score:1]
These findings suggest that during tumor progression miR-200 loss controls cell-intrinsic EMT features and coordinates complementary changes in the surrounding tumor microenvironment. [score:1]
Our previous work with metastasis-prone tumor cells from the KP murine mo del revealed that miR-200 repression is necessary in a subset of cells at the tumor periphery to produce EMT, invasion and distant metastasis 30 31. [score:1]
miR-200 repression potentiates cells to collagen I -dependent interactions. [score:1]
s of 344SQ, paralleling the normal changes in miR-200 levels upon 3D growth (Supp Fig. S1a). [score:1]
We wanted to further assess the importance of repression of this particular pathway as a key mediator of miR-200 action. [score:1]
[1 to 20 of 42 sentences]
22
[+] score: 124
To further explore the potential significance of the deletion overlap involving the miR-200 family, we examined gene expression in patients and found that a number of TargetScan-predicted targets of either miR-200a or miR-200b were collectively upregulated in the tumor compared to unaffected pair-matched myometrium (∼180 genes ranging from 1.25–10.3 fold upregulation). [score:12]
Detailed pathway analysis of the upregulated targets of the lost miR-15/16 family identified biological categories of pathways in cancer, endometrial cancer, transcription, melanoma, apoptosis, signaling pathways including insulin, MAPK, mTOR, VEGF, ErbB, JAK/STAT signaling, and cell-cell adhesion and cytoskeleton remo deling (see Supplemental Table 3)We also identified a subset of upregulated genes that are predicted as targets of both miR-200a/b and miR-15/16 microRNAs from the regions of deletion overlap on Chr1 and Chr3 (Table 3), including ACTR1A, BACH2, BCL2, CDC14B, CLASP1, CYP26B1, E2F3, EVI5, FUBP1, IKBKB, IRS2, IRS2, LRIG1, OTUD4, PCDH9, PCDH9, PELI2, PHF21A, PPAP2B, SLC2A3, SNTB2, TMCC1 and TUBB. [score:11]
Detailed pathway analysis of the upregulated targets of the lost miR-15/16 family identified biological categories of pathways in cancer, endometrial cancer, transcription, melanoma, apoptosis, signaling pathways including insulin, MAPK, mTOR, VEGF, ErbB, JAK/STAT signaling, and cell-cell adhesion and cytoskeleton remo deling (see Supplemental Table 3) We also identified a subset of upregulated genes that are predicted as targets of both miR-200a/b and miR-15/16 microRNAs from the regions of deletion overlap on Chr1 and Chr3 (Table 3), including ACTR1A, BACH2, BCL2, CDC14B, CLASP1, CYP26B1, E2F3, EVI5, FUBP1, IKBKB, IRS2, IRS2, LRIG1, OTUD4, PCDH9, PCDH9, PELI2, PHF21A, PPAP2B, SLC2A3, SNTB2, TMCC1 and TUBB. [score:11]
We selected 5 target genes of miR-200a that were all significantly upregulated in ULMs (Figure 3A) for functional testing as direct targets and for their roles in cell phenotype changes. [score:9]
These findings indicated that alteration (loss) of two overlapping genomic regions (7.09 Mb of Chr1 1p36.33-p36.23 and 24.56 Mb of Chr3 3q26.1-q27.2 harboring cancer related miRNAs may be related to the tumorigenesis of a subset of ULMs via deregulation of the miR200a/b and miR-15/16 gene targets and in part this process may be due to the loss of convergent inhibitory action of the miR-200 family and miR-15 and miR-16 on a small group of the same downstream target genes. [score:8]
B analysis of expression of five miR-200 predicted target genes in ULMs cell line UtLM with stable miR-200a expression (see Methods) and control (vector PGIPZ only). [score:7]
Collectively, these findings suggest that the loss of miR-200 family, identified by miRNA profiling and a CGH analysis, together with upregulation of its target genes may contribute to the tumor growth and underlie the mesenchymal character of ULMs. [score:6]
Conversely, loss of miR-200 shown to modulate growth as well as the UtLM morphology (Figure 4C,D), may lead to upregulation of genes (some of them convergent targets of lost miR-15/16) that contribute to the progression of ULM tumorigenesis. [score:6]
As shown above, downregulation of miR-200 family members appears a candidate event in leiomyomas in select patients due to loss of corresponding genomic DNA loci and broader reduction of miR-200 expression in ULMs (Table 3 and Figure S2). [score:6]
In the UtLM cell line with stable miR-200a overexpression, 3 of 5 mRNAs (TUBB, CYP1B1 and CTBP2 were suppressed by miR-200a in vitro (Figure 3B). [score:5]
A Scatter plot analysis of relative mRNA expression in five miR-200 predicted target genes in 10 ULMs and matched myometria (our data and GSE593). [score:5]
Importantly and as predicted by pathway analysis (Table S3), overexpression of miR-200a in UtLM cells led to growth inhibition compared to mock infected controls (Figure 3C), and reverted the fibroblastoid morphology towards more pronounced epithelial phenotype (Figure 3D), consistent with the established role of miR-200 family in epithelial-mesenchymal transition [33]. [score:4]
Focused pathway analysis (using GO, KEGG, Biocarta and Panther databases) of the predicted miR-200 family targets that are consistently upmodulated in ULMs including patient B4 (Table S3) implicates categories of regulation of transcription proliferation and cell cycle control, actin cytoskeleton and adherens, tight, gap and focal adhesion junction remo deling, as well as cancer related signaling pathways (MAPK, RAS, WNT, NOTCH, TGF-β, VEGF). [score:4]
Interestingly, members of cancer -inhibitory miRNA family miR-200a, miR-200b, miR-429 and miR-551a are located in the region of loss at 1p36 while the 3q26-27 region harbors miR-15b, miR-16-2 and other microRNAs including miR-1263, miR-720, miR-551b, miR-569, miR-1224. [score:3]
Stable miR-200a expression was validated by (see below). [score:3]
D. Photomicrographs illustrate stable viral control (upper panels) and miR-200a (lower panels) expression in UtLM cell lines. [score:3]
The stromal to epithelial morphology transition in UtLM cell line with miR-200a overexpression is evident (lower panels). [score:3]
Lentivirus expressing miR-200a shRNA were produced in HEK293T cells packaged by pMD2G and psPAX2. [score:3]
C Growth curves illustrate significantly reduced proliferative rate in UtLM cell line with miR-200a overexpression in comparison UtLM cell line with vector control only (PGPIZ). [score:3]
MiR-200 predicted target gene analysis in uterine ULMs. [score:2]
0012362.g003 Figure 3 MiR-200 predicted target gene analysis in uterine ULMs. [score:2]
Primers for 11 let-7 and 5 miR-200 predicted target genes are summarized in Table S1. [score:2]
We observed that miR-200a and miR-200b were significantly down regulated in 51 ULMs (net loss of −0.36±0.11 and −0.45±0.06, respectively). [score:2]
Candidate role of the loss of miR-200 family and miR-15 and miR16 in ULMs. [score:1]
shRNA miR-200a infection. [score:1]
Loss of miR-200 family is associated with epithelial and mesenchymal transition (EMT) and aggressive tumor phenotypes of ovarian cancer [30], [31]. [score:1]
Human miR-200a shRNA in pGIPZ was prepared. [score:1]
[1 to 20 of 27 sentences]
23
[+] score: 124
In addition, downregulation of miR-200 family members has been associated with resistance to cytotoxic chemotherapeutic agents and EGFR inhibitors [16, 22, 31, 49, 50]. [score:6]
The miR-200 family acts as key inhibitors of epithelial-to-mesenchymal transition (EMT) by directly targeting transcriptional repressors of E-cadherin, ZEB1, and ZEB2 [5]. [score:6]
In addition, the miR-200 family inhibits EMT by regulating a number of target genes such as ZEB1 and ZEB2 [5]. [score:6]
The tumor-suppressive roles of the miR-200 family have also been reported in gastric [8], breast [9], endometrial, [10] pancreatic cancers [11, 12], hepatocellular carcinoma [13], gliomas [14], and lung cancer [15, 16]. [score:3]
Supplementary Figure 3: Forest plot of hazard ratios for the prediction of overall (A) and progression-free survival (B) by high -expressing miR-200 family members according to individual tissue miRNA levels. [score:3]
Quantitative real-time PCR was performed in 22 studies, in situ hybridization in 2 studies, and two separate techniques in 2 studies to assess miR-200 family expression. [score:3]
MiR-200 family members are also likely downregulated during tumor progression. [score:3]
The results of this meta-analysis showed a pooled HR of 0.70 (95% CI 0.54–0.91), demonstrating that increased miR-200 family expression in cancer tissues is associated with a favorable outcome (P = 0.007). [score:3]
Moreover, expression of miRNA, including miR-200, may be an early predictor of chemotherapy outcomes in prostate and esophageal cancers [35, 37]. [score:3]
Overall Effects of miR-200 Expression in Cancer Tissues on OS and PFS. [score:3]
Supplementary Figure 2: Forest plot of hazard ratios for the prediction of overall (A) and progression-free survival (B) by high -expressing serum miR-200 family members according to tumor type. [score:3]
Overall Effects of Circulating miR-200 Expression on OS and PFS. [score:3]
In addition, the PFS analysis of seven studies revealed a protective role for increased miR-200 tissue expression (pooled HR = 0.63, 95% CI 0.52–0.76), as determined using a random-effects mo del (P = 0.03, I [2] = 44%; Figure 2(b)). [score:3]
The pooled results showed that high miR-200 expression was a favorable prognostic factor in patients with various types of cancer (pooled HR = 0.70, 95% CI 0.54–0.91). [score:3]
In the stratified analyses of PFS, increased tissue miR-200 expression was significantly associated with increased PFS in the ovarian cancer subgroup (pooled HR = 0.50, 95% CI 0.35–0.72) with low heterogeneity (P = 0.26, I [2] = 21%; Supplementary Figure  1B). [score:3]
Supplementary Figure 4: Forest plot of hazard ratios for the prediction of overall (A) and progression-free survival (B) by high -expressing miR-200 family members according to individual serum miRNA levels. [score:3]
In the breast cancer subgroup, circulating miR-200 expression showed a significantly negative correlation with PFS (pooled HR = 2.87, 95% CI 1.43–5.73) with low heterogeneity (P = 0.69, I [2] = 0%, Supplementary Figure  2B). [score:3]
This systemic review and meta-analysis showed that elevated cancer tissue expression of miR-200 was associated with longer survival in patients with multiple carcinoma types. [score:3]
Thus, expression of miR-200 family members could influence the cancer phenotype and prognosis of cancer patients [5]. [score:3]
A number of studies showed that miR-200 family members are aberrantly expressed in multiple human malignancies, suggesting that these miRNAs play a role in tumor pathogenesis during all stages of carcinogenesis. [score:3]
The pooled outcome from the OS and PFS analyses revealed HRs of 1.68 (P = 0.007) and 2.62 (P < 0.001), respectively, showing that increased circulating miR-200 family expression is associated with unfavorable survival. [score:3]
Supplementary Figure 1: Forest plot of hazard ratios for the prediction of overall (A) and progression-free survival (B) by high -expressing tissue miR-200 family members according to tumor type. [score:3]
Tissue (in 26 studies), serum (in 9 studies), and both tissue and serum samples (in 1 study) were used to determine miR-200 expression. [score:3]
We found that higher expression of circulating miR-200 significantly predicted poor OS (pooled HR = 1.68, 95% CI 1.15–2.46; Figure 3(a)). [score:3]
Pooled analyses of the brain tumor and pancreatic cancer subgroups indicated that tissue miR-200 family expression was positively correlated with OS (pooled HR = 0.51, 95% CI 0.32–0.82 in brain tumor subgroup; pooled HR = 0.35, 95% CI 0.21–0.60 in pancreatic cancer subgroup), with low heterogeneity among the studies analyzed (P = 0.71, I [2] = 0% in brain tumor subgroup; P = 0.26, I [2] = 26% in pancreatic cancer subgroup; Supplementary Figure  1A). [score:3]
These finding suggest that the miR-200 family members function as tumor suppressor genes. [score:3]
The decreased tumor expression of the miR-200 family was significantly associated with poor survival in patients with brain, pancreas, and ovarian cancers. [score:3]
In contrast, a pooled analysis of the colorectal cancer subgroup showed that serum miR-200 expression was negatively correlated with OS (pooled HR = 2.50, 95% CI 1.50–4.18) with low heterogeneity (P = 0.44, I [2] = 0%; Supplementary Figure  2A). [score:3]
The miR-200 family has regulatory functions in diverse biological processes. [score:2]
The authors proposed that the miR-200 family is potentially involved in promoting the last step of the metastatic cascade in the development of macroscopic metastatic masses at distant sites. [score:2]
Taken together, the miR-200 family can affect cancer progression by regulating various cell signaling and genetic pathways. [score:2]
MiR-200 expression is correlated with metastasis and relapse in breast cancer [34]. [score:2]
The miR-200 family includes five members (miR-200a, miR-200b, miR-200c, miR-141, and miR-429) and can be divided into two clusters based on chromosomal location. [score:1]
MiR-200b, miR-200c, and miR-429 have the same seed region (nucleotides 2–7), and miR-200a and miR-141 share a seed region with a difference in only the fourth nucleotide (U to C) among these regions [6]. [score:1]
org/10.1155/2017/1928021): miR-141, miR-200, or miR-429 combined with prognostic, prognosis, survival, tumor, cancer, neoplasm, or carcinoma. [score:1]
Of the remaining 145 studies, 74 were excluded because they did not have the survival data associated with miR-200 family. [score:1]
Although the miR-200 family is a determinant of epithelial cell phenotypes, its prognostic role has not yet been elucidated. [score:1]
Twenty-five studies on miR-200 expression in tissue samples were evaluated for OS analysis (Figure 2(a)) using a random-effects mo del due to high heterogeneity (OS, P < 0.00001, I [2] = 85%). [score:1]
In contrast, low circulating miR-200 levels were associated with a positive prognosis in patients with colon and breast cancers. [score:1]
The miR-200b/a/429 cluster is comprised of miR-200a, miR-200b, and miR-429 and is located on chromosome 1p36. [score:1]
PFS analysis of three studies (Figure 3(b)) demonstrated a significant association between circulating miR-200 levels and PFS (pooled HR = 2.62, 95% CI 1.68–4.07). [score:1]
Articles meeting the following criteria were included: (1) human patient versus animal study on any type of malignant cancer or neoplasm and (2) assessment data on patient survival (overall survival [OS] and progression-free survival [PFS]) and the miR-200 family with multivariate hazard ratios (HRs) included. [score:1]
However, due to small sample sizes and different detection methods used in previous studies, the prognostic role of miR-200 has not been clearly elucidated. [score:1]
Le et al. reported that miR-200 family members are secreted by highly metastatic epithelial breast cancer cells and that the secretion of these miRNAs results in increased metastatic potential in xenograft mo dels [45]. [score:1]
The miR-200 family was first reported to play a role in olfactory neurogenesis [7]. [score:1]
In addition, increasing evidence suggests that miRNAs have different roles in tumor tissues and blood [44, 45], and thus the prognostic roles of miR-200 family members in both tumor and serum samples were analyzed in this study. [score:1]
Interestingly, the miR-200 levels in plasma and tumor tissues had opposing associations with survival in this study. [score:1]
In contrast, high levels of miR-200 in serum were associated with poor prognosis. [score:1]
Therefore, we performed a literature -based meta-analysis of eligible studies to obtain evidence -based results on the prognostic role of miR-200 family members in various types of malignancies. [score:1]
In conclusion, our meta-analysis suggests that the miR-200 family members are potential biomarkers and accurate prognostic predictors in patients with various carcinomas. [score:1]
For future clinical application, large prospective studies are needed to validate the prognostic values of circulating miR-200 in individual cancer types. [score:1]
Therefore, further clarification on the clinical roles of circulating miR-200 family members in well-designed prospective studies is needed. [score:1]
For example, Song et al. identified a signature of 17 miRNAs, which included the miR-200 family, in patients with gastric cancer [24]. [score:1]
Some studies have shown no correlation between miR-200 levels in serum and tumor tissues [53]. [score:1]
Recently, two meta-analyses on the prognostic value of miR-200 were published. [score:1]
[1 to 20 of 55 sentences]
24
[+] score: 112
miR-155-5p showed clearly downregulated expression at the same time as miR-200a-3p showed upregulated expression in all three-murine lupus-like mo dels tested (Figure 3(a)). [score:11]
3.4. miR-155-5p Downregulation and miR-200a-3p Upregulation Seen through miRNA Expression Profiling Were Confirmed by qRT-PCR. [score:9]
In contrast, miR-200a-3p upregulation suppresses gene inhibitors for EED and EZH2 (KIF20A and HSD17B11 for EED and CDK6 for EZH2) and allows these two transcription factors to positively affect the transcription of interferons IFNA1 and IFNA2. [score:8]
Overexpression of miR-200a-3p also contributes positively by inhibiting the TLR4 signaling pathway through MYD88, acting directly on MAPK1 and JUN and interfering with the action of specific inhibitors for transcription factors such as EED and EZH2 involved in the production of interferons IFNA1 and IFNA2. [score:8]
A closer look into the signaling pathway showed that the overall effect of miR-155-5p downregulation and miR-200a-3p upregulation is an increased transcription of interferons (Figure 4). [score:7]
Interestingly, miR-155-5p and miR-200a-3p, which were statistically validated, play pivotal immune roles and may participate in the development of the lupus-like disease mo dels in BALB/c mice by increasing the production of anti-NPA antibodies, which are responsible for inducing the murine disease. [score:6]
The signaling network summarizing our current and previous results was developed using Cytoscape v3.4.0 [18] to assess interactions between the mRNA results found in TLR4 signaling pathways [7] and the known targets for miR-155-5p, miR-200a-3p, miR-21a-5p, and miR-146b-5p, trying to find the role of those miRNAs on the development of murine lupus-like disease. [score:6]
The downregulation of miR-155-5p and the upregulation of miR-200-3p in the mouse mo dels were detected in the PCR array and with the TaqMan probes, with significant differences compared to the healthy mice. [score:6]
All these effects of miR-200a-3p on the TLR4 signaling pathway are positive for interferon production, as its upregulation provokes a partial inhibition of the MYD88-dependant signaling branch and diminishes its possible genetic products (e. g., TNF-α, IL-6, IL-12A/B, and IL-1B) and helps to activate transcription factors relevant for the interferon-producing TICAM -dependent signaling branch (Figure 4). [score:6]
Interestingly, six of these miRNAs showed similar behavior in the three conditions tested, three of them were downregulated (miR-142a-3p, miR-146b-5p, and miR-155-5p) and three were overregulated (miR-21a-5p, miR-125a-5, and miR-200a-3p). [score:5]
Two deregulated miRNAs, miR-155-5p and miR-200a-3p, were found to contribute to the development of a murine lupus-like disease triggered by NPA, a recently described molecular association of phospholipids, different from the classical lipid bilayer, and induced by some specific inductors. [score:5]
Th17 cell differentiation has been linked to inflammatory processes [37]; in this way, miR-200a-3p overexpression would contribute to the inflammatory response, which leads to the production of IgG antibodies and the observed murine lupus-like disease in our mo dels. [score:5]
Six of them were down- (miR-142a-3p, miR-146b-5p, and miR-155-5p) or upregulated (miR-21a-5p, miR-125a-5p, and miR-200a-3p) in the three lupus-like murine mo dels while the other six were affected in two or only one of them (Figure 2(b)). [score:4]
Interestingly, miR-200a-3p has a direct inhibitory action on MAPK1 and JUN. [score:4]
Using the database of the Cancer miRNA Regulatory Network [19] and Cytoscape v3.4.0 [18], a signaling network was developed to find relationships among miR-155-5p, miR-200a-3p, miR-21a-5p, and miR-146b-5p and their own targets, which allowed us to highlight only miR-155-5p and miR-200a-3p of the original four miRNAs selected. [score:4]
SMAD2, GATA3, and FOXO3 could also be the miR-200a-3p targets in SLE and our lupus-like mo dels. [score:3]
miR-200a-3p is overexpressed in SLE [35]. [score:3]
The PCR amplification was run as described by the TaqMan Universal PCR Master Mix manual (Applied Biosystems) for the following differentially expressed miRNAs, as determined by PCR array analysis: miR-21a-5p, miR-125a-5p, miR-142-3p/5p, miR-146b/5p, miR-155-5p, and miR-200a-3p. [score:3]
Nevertheless, the expression of miR-155-5p and miR-200-3p, together with the anti-NPA antibodies, should be evaluated in other mouse mo dels of lupus and in SLE patients, to validate their possible role as biomarkers of this disease. [score:3]
Taking into account these findings and the presence of anti-NPA antibodies both in murine lupus-like and in human patients, we propose that the miRNAs miR-155-5p and miR-200a-3p and the anti-NPA antibodies may play an important role in the development of human LES. [score:2]
Only miR-155-5p and miR-200a-3p were statistically validated (p < 0.001) in the three lupus-like mo dels, while miR-21a-5p was validated (p < 0.05) only in those triggered by chlorpromazine- or promazine -induced NPA. [score:1]
Both miR-155-5p and miR-200a-3p cooperate to favor the signaling branch from TLR4 through TICAM1 and TICAM2 (TRAM) instead of that involving MYD88. [score:1]
Based on this knowledge, we propose miR-155-5p and miR-200a-3p, together with the anti-NPA antibodies, as key players in the murine lupus-like mo dels and possible biomarkers of the human SLE. [score:1]
Interestingly, miR-155-5p and miR-200a-3p stand out because of their strong influence on TLR4 signaling, mostly on transcription factors that, in turn, trigger interferon production. [score:1]
[1 to 20 of 24 sentences]
25
[+] score: 109
Other miRNAs from this paper: hsa-let-7e, hsa-mir-16-1, hsa-mir-16-2, hsa-mir-122
Additionally, miR-200a has been shown to be induced by the tumour suppressor p53 to mediate apoptosis in liver disease [31], and can target a number of anti-apoptotic and oncogenic proteins such as EGRF and hepatocyte growth factor receptor (c-Met) in non-small cell lung cancer [32], as well as Vasohibin 2, a protein that promotes angiogenesis and invasion, in HCC [33]. [score:7]
Yet, expression of miR-200a is significantly enriched in hepatocytes and its similar expression profile to miR-122 in this study suggests that changes in its expression in the circulation are due to its release from hepatocytes 24– 28. [score:7]
Previous studies have reported that expression of both miR-122 and miR-200a are dysregulated in the circulation during liver disease [18]. [score:6]
We next analysed whether the expression of miR-122 and miR-200a were differentially regulated in individuals who died from liver-related diseases. [score:6]
In conclusion circulating levels of miR-122 and miR-200a were clearly greater at baseline in the HIV-1-infected individuals, who suffered from some degree of liver disease whilst on continuous virally suppressive ART. [score:5]
For miR-200a and let-7e if cel-miR-39 and miR-122 was detected < 30 cycles in a sample but miR-200a or let-7e was not detected the sample was designated as having a Ct of 35 (the lower limit of detection) to signify extremely low expression or no expression of that particular miRNA. [score:5]
The data presented here, coupled with both miRNAs previous associations with liver disease in the literature, suggests that circulating miR-122 and miR-200a are promising predictive biomarkers for liver disease in the ART -treated HIV-1-infected populations. [score:5]
Secondly, the release of miR-122 and miR-200a into the circulation may be indicative of a specific cellular pathway, i. e. apoptosis, which is disrupted during liver disease, and further analysis of these miRNA may provide new avenues for therapeutics targeting this disrupted pathway. [score:5]
In a cellular context miR-200a is decreased in hepatocellular carcinoma (HCC), a disease in which hepatic cells avoid apoptosis, but increased in diseases characterised by hepatocyte cell death, such as fibrosis and Non-alcoholic fatty liver disease, suggesting a role for these miRNA in hepatic cell survival 27– 30. [score:5]
Additionally, we observed greater pre-ART levels of circulating miR-122 and miR-200a, compared to matched controls, in HIV-1 positive individuals who died from liver-related diseases whilst undergoing suppressive ART. [score:4]
Furthermore, in the PPPs of these liver cases and controls, the expression of miR-122 was significantly greater (p < 0.01, fold change = 3.3) and miR-200a showed a clear trend towards significance (p = 0.079, fold change = 4.5) in the liver cases compared to their matched controls, while, as expected, let-7e, which showed no association with liver disease in serum, showed no difference in the PPPs. [score:4]
Importantly out study is the first to associate elevated levels of miR-122 and miR-200a, at baseline, with the development of fatal liver disease in the future. [score:4]
Overall, the data presented here show that both miR-122 and miR-200a are promising biomarkers, whose increase may precede the development of severe liver disease in the ART -treated HIV-1-infected population. [score:4]
MiR-122 and miR-200a were greater in PEG-precipitated particles of individuals who develop fatal liver disease. [score:3]
Mir-200a may not be as specific to the liver, but it’s parallel expression with miR-122 indicate that it is also originating from the liver. [score:3]
Relative expression (normalised to miR-16) of (a) miR-122, (b) miR-200a and c) Let-7e were log10 normalised and plotted for the Liver Cases (n = 13) and their matched controls (n = 25). [score:3]
The data presented above clearly shows that miR-122 and miR-200a are greater in the circulation during liver disease. [score:3]
MiR-122 and miR-200a were greater in the serum of individuals who develop fatal liver disease. [score:3]
The correlations of miR-122 and miR-200a with IL-6 are interesting, as IL-6 is a marker of systemic inflammation, and it’s increase is associated with an increased risk of the development of SNAEs 16, 17. [score:2]
However, what is not clear from these cellular studies is if the elevated levels of miR-122 and miR-200a, seen in our study, are contributing to the increase in IL-6, or are merely a down-stream result of its increase. [score:1]
It is clear that future studies will have to fully characterise the location of circulating miR-122 and miR-200a in the context of HIV related liver disease. [score:1]
PPP -associated miR-122 and miR-200a correlate with levels of AST and ALT. [score:1]
Yet, future studies may benefit from further exploring the clinical utility of miR-122 and miR-200a when extracted from both serum and PEG precipitated serum – with and without the use of technologies such as the NanoSight– as these methodologies may be more easily adopted in resource limited settings. [score:1]
Figure 3Serum levels of miR-122, miR-200a and let-7e in liver cases and controls. [score:1]
Figure 4Levels of PPP -associated miR-122, miR-200a and let-7e in liver cases and controls. [score:1]
RNA was then extracted, before was carried out for miRs-122, miR-200a, let-7e and the spike-in control cel-miR-39, using individual qPCR probes and pre-amplified cDNA. [score:1]
Overall, the cellular data suggest that miR-122 and miR-200a may play a role in hepatocyte survival. [score:1]
Matching PCR results and ALT levels were available for 22/38 individuals for miR-122, 21/38 for miR-200a and 19/38 for Let-7e, while matching AST results were available for 17/38 individuals for miR-122, 15/38 for miR-200a and 17/38 for let-7e. [score:1]
Relative expression (normalised to cel-miR-39 and PPP number) of miR-122 and miR-200a, measured in the PPPs of the Liver cases and controls and controls from the SMART and ESPRIT studies, (a) ALT and (b) AST were log normalised and plotted. [score:1]
One interesting observation was that the differences between levels of miR-122 and miR-200a in liver cases and controls were much greater when serum was precipitated using ExoQuick reagent. [score:1]
In order to determine whether miR-122 and miR-200a were present in the circulation packaged in EVs, we precipitated the serum using the PEG -based ExoQuick reagent. [score:1]
One reaction of the reverse transcription mastermix consisted of 6 µl of a custom RT primer pool (consisting of primers for miRs-122, miR-200a let-7e and CEL-miR-39, made up according to manufacturer’s instructions), 0.3 µl of dNTPs, 2ul of reverse transcriptase, 1.5 µl of 10xRT buffer, 0.19 RNase inhibitor and 2.01 µl of nuclease free water. [score:1]
Matching xy pairs were available for 30 individuals in the miR-122 analysis and 31 individuals in the miR-200a and let-7e analyses. [score:1]
A 2 and 1.22 fold difference between means for miR-122 and miR-200a, respectively, were observed (Fig.   3a and b). [score:1]
MiR-122 and miR-200a represent a potential improvement on the current liver biomarkers AST and ALT. [score:1]
Correlation of miR-122 and miR-200a with IL-6. Discussion. [score:1]
Both miR-122 and miR-200a showed modest, but statistically significant positive correlations with AST (r = 0.37 & p < 0.0001 and r = 0.29 & p = 0.0003 respectively) and ALT (r = 0.42 & p < 0.0001 and r = 0.33 and p < 0.0001 respectively). [score:1]
XY pairs were available for 22 individuals in the miR-122 vs ALT analysis, 21 for miR-200a vs ALT, 17 in the miR-122 vs AST analysis, 15 for miR-200a vs AST. [score:1]
However, further work is clearly required on the exact purpose and mechanism of the release of miR-122 and miR-200a into the circulation. [score:1]
Serum levels of miR-122 and miR-200a were greater in ART -treated HIV/HCV co-infected individuals and correlate with AST and ALT levels. [score:1]
Only miR-122 significantly correlated with ALT (r = 0.65, p = 0.001) (Fig.   5a) while miR-200a was on the cusp of significance (r = 0.43, p = 0.05) (Fig.   5b). [score:1]
While the contribution of EV-free, AGO -associated miRNAs cannot be ruled out, this observation, along with the observation that there was no difference in size or number of particles between liver cases and controls, suggests that the observed increase in miR-122 and miR-200a is due to a release of these miRNAs in PPPs. [score:1]
However, the data presented above indicates a great deal of potential for miR-122 and miR-200a. [score:1]
was performed for miRs-122, miR-200a, let-7e and cel-miR-39 in 96 well plates on the Life Technologies Quantstudio7 machine according to manufacturer’s instructions. [score:1]
[1 to 20 of 44 sentences]
26
[+] score: 108
In the dataset we analysed in [86], all members of the miR-200 family appear to be highly up-regulated in cancer tissues (from 4- to 8- folds) and this up-regulation is counteracted by a similar, even if not comparable, overexpression of PVT1 that in cancer tissues appears to increase of about two folds. [score:9]
This observation is highly consistent with our hypothesis that the up-regulation of PVT1 in tumour samples is mostly due to the up-regulation of isoforms of the gene devoid of the key exons exerting the sponge activity on miR-200 family members. [score:7]
A large number of studies showed that the down-regulation of the miR-200 family members appears to promote the epithelial-mesenchymal transition, proving their suppressive effects on cancer cell proliferation, migration, and invasion [115– 118]. [score:6]
This up-regulation is counteracted by a similarly, but even more significant, overexpression of the miR-200 family members (see Fig 3A and 3C for the representative case of the miR-200b). [score:6]
Moreover, it revealed, in normal MMI-network, a net binding preference towards the miR-200 family, which it antagonizes to regulate the expression of hundreds of mRNAs known to be related to the cancer development and progression (e. g. GATA3, CDH1, TP53, TP63, TP73, RUNX1, and RUNX3). [score:5]
However, Park et al. [119] experimentally demonstrated how the down-regulation of all members of the miR-200 family would result in mesenchymal cell lines, while a their up-regulation would appear characteristic of an epithelial phenotype. [score:5]
From one hand, the absence in two PVT1 isoforms of the exon where the MREs for the all members of the miR-200 family reside could lead to support the hypothesis of a preferential expression in cancer tissues of these two isoforms, thus justifying the lack of the miRNA/target interaction with a consequent breakdown of the PVT1 ceRNA activity (i. e. the exon skipping mechanism). [score:5]
Specifically, PVT1 emerged as a putative ceRNA modulating the activity of all members of the miR-200 family on their target mRNAs, which are well-known to be drastically involved in breast cancer morphogenesis and development. [score:4]
The question, then, arises: if PVT1 and the miR-200 family are both up-regulated in cancer, why PVT1 stops working as sponge in cancer? [score:4]
From the other hand, the observation of a simultaneous up-regulation of the PVT1 gene and the miR-200 family members could lead to support the alternative hypothesis of different relative concentrations between each isoform and the miR-200 family members. [score:4]
This consideration together with the observed synchronised up-regulation of the PVT1 gene and the miR-200 family members encouraged us to hypothesize different scenarios that could be in principle compatible with the ceasing of the PVT1 sponge activity in breast cancer tissues. [score:4]
Interestingly, such a sponge mechanism resulted completely abolished in cancer tissues, although both PVT1 and the miR-200 family members appeared up-regulated in the pathological condition. [score:4]
This suggests the following argument of plausibility of the PCA analysis results: the first PC, which explain by alone about the 60% of the total variance of the analysed data (S2 Table), corresponds to the variation of the isoform that, missing the binding site, does not interact with the miR-200 family; while the second PC, explaining by alone about the 20% of the total variance of the analysed data (S2 Table), represents the variation of the isoform that, hosting the binding site for the miR-200b/200c/429 cluster, could be act as competitors of the targets of these miRNAs. [score:3]
The observation that both the isoforms, with and without the exons where the MREs of the miR-200 family memebrs reside, resulted expressed in both cancer and normal breast tissues undermine the truthfulness of the hypothesis rested on the exon skipping mechanism and corroborates the proposal based on the relative concentrations of the PVT1 isoforms and the miR-200 family members. [score:3]
In particular, inspiring by our amazing results of [86] and by the growing interest of the scientific community in the oncogenic role of the lncRNA PVT1, we focused on its activity as sponge modulator of the activity of the miR-200 family members on their targets and on the withdrawal of its decoy service in breast cancer tissues. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
S4 TableThis table reports the variations between cancer and normal tissues of the expression levels of all the PVT1 isoforms with respect to the variation of the TCONS_147501 isoform lacking the binding site for the miR-200 family members, showed in Fig 7A. [score:3]
According to that, a substantial decrease in cancer tissues of the relative variation of the isoform harbouring the binding site for one or more members of the miR-200 family could be due to a huge increase of the miR-200 family associated with a moderate growth in cancer of the expression levels of this PVT1 isoform. [score:3]
In particular, we thoroughly studied the intriguing phenomenon of the breakdown of the PVT1 functioning as sponge of the miR-200 family members in the breast invasive carcinoma by analysing the expression data of its multiple isoforms (S1 Table). [score:3]
We speculate that in the normal tissues only the red isoform of PVT1 gene acts as sponge regulator of the miR-200 family members. [score:2]
In both panels, the red slice corresponds to the isoform (TCONS_147426) with seed match for the miR-200b/200c/429 cluster and the blue slice corresponds to the isoform (TCONS_147501) lacking the binding site for any member of the miR-200 family. [score:1]
On the basis of the similarities of their seed sequences (i. e. 6 nucleotides at positions 2-7 from the miRNA 5’-end [113]), the miR-200 family members can be clustered into two groups only differing for one nucleotide in the seed sequence: miR-200a/141 (AA CACU) and miR-200b/200c/429 (AA UACU) [114, 115]. [score:1]
The analysis of the PVT1 genomic locus showed the existence of multiple isoforms (Fig 4 and S2 Fig) representing all the possible configurations: hosting the binding site for some (e. g. Iso6 or Iso7 in Fig 4) or all members of the miR-200 family (e. g. Iso1 in Fig 4); missing the binding site (e. g. Iso11 and Iso12 in Fig 4). [score:1]
The miR-200 family consists of five members: miR-200a, miR-200b, miR-200c, miR-141 and miR-429. [score:1]
It is connected to 753 different mRNAs (∼ 50% of total mRNAs in the network) and the miR-200 family members are arbitrating over the 80% of these interactions (Fig 2A). [score:1]
To shed light on which of the two hypothesised mechanisms lies the origin of the PVT1 stoppage as sponge, we looked at the PVT1 abundance in terms of its isoforms and we found that in both normal (Fig 5A and S3 Table) and cancer tissues (Fig 5B and S3 Table) only two isoforms represent the biggest slices: the first largest slice—which corresponds to the 50% (48%) of the PVT1 total abundance in normal (cancer) breast samples—represents the isoform missing the binding site for the miR-200 family (TCONS_147501); the second largest slice—which corresponds to the 15% (17%) of the PVT1 total abundance in normal (cancer) breast samples—represents the isoform hosting the binding site for the miR-200b/200c/429 cluster (TCONS_147426). [score:1]
S2 File This file contains the full genome sequences (in FASTA format) of the two PVT1 isoforms that mostly change between normal and cancer tissues: TCONS_147501 (missing the binding site for miR-200 family members) and TCONS_147426 (harbouring the binding site for the miR-200b/200c/429 cluster). [score:1]
0171661.g003 Fig 3The main actors of the normal MMI-network are the miR-200 family members and the long non-coding PVT1. [score:1]
The main actors of the normal MMI-network are the miR-200 family members and the long non-coding PVT1. [score:1]
More than the 80% corresponds to the miR-200 family members. [score:1]
In order to understand the meaning of these two PCs, we drew the score plot (Fig 6B and S2 Table) and found that the first PC is able to separate the contribution of the isoform missing the binding site for any members of the miR-200 family from the others, while the second PC is able to separate the contribution of the isoform hosting the binding site for the miR-200b/200c/429 cluster from the others. [score:1]
Among them, there are all members of the miR-200 family, whose importance in breast cancer is well-known and is related to the epithelial-mesenchymal transition. [score:1]
In particular, the principal component analysis suggested that the variations between cancer and normal breast tissues of all PVT1 isoforms can be explained by only two principal components: one corresponding to the isoform harbouring the binding site for the miR-200b/200c/429 cluster and the other one representing the isoform missing the binding site for any member of the miR-200 family members. [score:1]
In particular, the analysis of the normal miRNA -mediated interactions network, built in [86], pointed out how the main actors of this rewiring were PVT1 and the miR-200 family members. [score:1]
Studying the variation of each PVT1 isoform between normal and cancer breast tissues with respect to the variation of TCONS_147501, the results of PCA seems to be confirmed (Fig 7 and S4 Table): the isoform harbouring the binding site for the miR-200b/200c/429 cluster and the isoform missing the binding site for any member of the miR-200 family, are the only isoforms that change (Fig 7A). [score:1]
In this plot, it is possible to group isoforms in three classes: the isoform missing the binding site for the miR-200 family members (blue isoform, TCONS_147501), the isoform with the seed match for the miR-200b/200c/429 cluster (red isoform, TCONS_147426), and all the others. [score:1]
edu/) in order to obtain the S2 Fig. (GTF) This file contains the full genome sequences (in FASTA format) of the two PVT1 isoforms that mostly change between normal and cancer tissues: TCONS_147501 (missing the binding site for miR-200 family members) and TCONS_147426 (harbouring the binding site for the miR-200b/200c/429 cluster). [score:1]
Red boxes correspond to the binding sites for the miR-200 family members. [score:1]
In cancer tissues it stops working as sponge since its concentration is much lower than the concentration of the miR-200 family members (here is reported only the case of miR-200b). [score:1]
The role of the miR-200 family in epithelial-mesenchymal transition. [score:1]
The miR-200 family is one of the most wi dely studied for its crucial role in cancer initiation, metastasis, diagnosis, and treatment. [score:1]
0171661.g007 Fig 7(A) The variations between cancer and normal tissues of all the PVT1 isoforms with respect to the variation of the blue isoform lacking the binding site for the miR-200 family members (S4 Table). [score:1]
[1 to 20 of 42 sentences]
27
[+] score: 106
To test whether gain in regulatory microRNAs in undifferentiated BeWo cells, where the expression of the microRNAs is relatively low, lead to change in TTR expression, mature miR-200a-3p or miR-141-3p mimics were transfected into BeWo cells in the absence or presence of the respective inhibitors. [score:8]
In summary, we identified TTR as a direct target of miR-141-3p or miR-200a-3p and demonstrated that TTR and these microRNAs are reciprocally expressed during human trophoblast differentiation. [score:6]
Figure 4Overexpression and inhibition of miR-200a-3p and miR-141-3p regulate TTR and its function in human trophoblast cells. [score:6]
Successful reversal of this suppression phenomenon was observed with the addition of inhibitors for miR-200a-3p and miR-141-3p along with the respective mimics (Fig.   2b and d). [score:5]
Our data revealed that overexpression of miR-200a-3p or miR-141-3p repressed the expression of TTR in human trophoblast cells. [score:5]
Significant up-regulation of both miR-141-3p and miR-200a-3p levels was observed along with TTR down regulation in differentiating human trophoblast cells. [score:5]
Over expression of either miR-200a-3p or miR-141-3p using mimics in undifferentiated BeWo cells led to reduced expression of TTR transcript. [score:5]
These data strongly suggest that miR-200a-3p and miR-141-3p may regulate the expression of TTR and consequently TTR -mediated delivery of thyroxin hormone in placental trophoblast cells. [score:4]
Our finding that miR-141-3p and miR-200a-3p are involved in the regulation of TTR during trophoblast differentiation provides yet another mechanism by which microRNA adds a complementary layer of control at the post-transcriptional level to developmentally indispensible genes known to be transcriptionally regulated. [score:4]
Similarly microRNA inhibitors for miR-141-3p or miR-200a-3p (Ambion, USA) were transfected at a final concentration of 200 nM to prove the specificity of the microRNA action. [score:3]
To validate whether TTR mRNA is a direct target of miR-200a-3p and miR-141-3p, dual luciferase reporter assay was performed in HEK293 cells. [score:3]
These data indicate that miR141-3p and miR-200a-3p might play important roles in regulating TTR during normal placental development. [score:3]
Saha S Choudhury J Ain R MicroRNA-141-3p and miR-200a-3p regulate insulin-like growth factor 2 during mouse placental developmentMol. [score:3]
Recent studies reported that miR-141-3p, belonging to the miR-200 cluster, is overexpressed in IUGR as well as in preeclamptic placentas 42– 44. [score:3]
Our study on conserved microRNAs as plausible regulators of TTR biogenesis led to identification of two microRNAs, miR-200a-3p and miR-141-3p that directly bind to the 3′-UTR of TTR. [score:3]
In brief, BeWo cells were transfected with miR-141-3p or miR-200a-3p mimic alone or mimic plus inhibitors as described above. [score:3]
The putative binding sites for miR-141-3p and miR-200a-3p on 3′-UTRs of human and rat TTR were identified using the TargetScan mouse 6.0, PicTar, microRNA. [score:3]
Figure 3Differentiation of human trophoblast cells (BeWo) is associated with reciprocal expression of hTTR and miR-200a-3p, miR-141-3p. [score:3]
In line with our previous results, down regulation of TTR mRNA and protein upon differentiation was associated with significant up regulation of both miR200a-3p and miR-141-3p (Fig.   3f). [score:3]
Since TTR biogenesis by placental trophoblast cells is crucial for proper fetal development, our results on miR-141-3p and miR-200a-3p in regulating T [4] uptake by human trophoblast cells led to next set of experiments using IUGR rat mo del as well as in human IUGR placentas. [score:3]
This mutagenic reaction introduced two point mutations in the binding site of 141-3p and miR-200a-3p (5′-CGGTGCT-3′). [score:2]
Overexpression of either miR200a-3p or 141-3p led to almost 80% decrease in T [4] uptake by BeWo cells as early as 2 h, which persisted through 4 h time point as compared to scramble transfected cells (Fig.   4c). [score:2]
Figure 5Induction of IUGR during pregnancy in rats impacts TTR and the regulatory microRNAs, miR-200a-3p and miR-141-3p. [score:2]
Interestingly, our data highlight that in human IUGR placenta the regulation of TTR by miR-141-3p and not miR-200a-3p is physiologically relevant like that in rat. [score:2]
Mutated version of hTTR 3′UTR (5′-CGGTGCT-3′) were generated by introducing two point mutations in the seed region (5′-CAGTGTT-3′) of miR-141-3p and miR-200a-3p. [score:2]
This data clearly indicates that both miR-200a-3p and miR-141-3p have the ability to regulate endogenous TTR protein levels in human trophoblast cells. [score:2]
Cells were transfected with microRNA mimics for miR-141-3p or miR-200a-3p (Ambion, USA) individually at a final concentration of 200 nM (titrated for maximum down regulation of TTR prior to this experiment, data not shown) using Lipofectamine RNAiMAX (Invitrogen, USA) as per manufacturer’s instructions. [score:2]
MiR-141-3p or miR-200a-3p can regulate endogenous TTR protein levels as well as thyroxin uptake by human trophoblast cells. [score:2]
Both miR-141-3p and miR-200a-3p share a common microRNA response element (MRE) on the 3′UTR of TTR transcript, which is highly conserved across species including humans (Fig.   1c). [score:1]
Output from various microRNA prediction tools has been revealed that two members of miR-200 family, miR-200a-3p and miR-141-3p have conserved binding sites on the 3′UTR of TTR mRNA. [score:1]
In the first construct 14–263 nucleotide of 3′UTR of TTR containing the putative MRE for miR-200a-3p and miR-141-3p (5′-CAGTGTT-3′) was cloned downstream of the firefly luciferease reporter in the pmirGLO plasmid and was denoted as ‘wild type’. [score:1]
Leading on from this, we tested the role of miR-141-3p and miR-200a-3p in term placenta from human control and IUGR pregnancies. [score:1]
Figure 1Cellular source of TTR in developing rat placenta and miR-200a-3p, miR-141-3p binding sites on 3′-UTR of TTR mRNA (a) Quantitative real time PCR analysis of TTR mRNA from rat placental samples at different days of gestation. [score:1]
On the contrary, miR-200a-3p did not show any significant change between control and IUGR placentae (Fig.   5f). [score:1]
In contrast, miR-200a-3p remained unchanged in labyrinth zone of the placenta in control and IUGR rats indicating that miR-200a-3p is not physiologically relevant during IUGR in rat. [score:1]
These trophoblast cells can be used as an ex vivo mo del system for studying the effects of miR-141-3p and miR-200a-3p on endogenous TTR during trophoblast differentiation. [score:1]
Using various bioinformatic software, binding sites of two microRNAs, miR-141-3p and miR-200a-3p were identified to be present in the 3′-UTR of human TTR and were found to be conserved across species. [score:1]
[1 to 20 of 37 sentences]
28
[+] score: 102
2016.00140/full#supplementary-material Figure S1 miR-200 inhibitors up-regulate PTEN expression. [score:8]
Taken together, the miR-200 family, especially miR-200c, directly targets the 3′UTR of PTEN and inhibits its protein expression. [score:8]
To identify the binding site of miR-200 that plays the most important role in miR-200-regulated PTEN protein expression, we generated three different site-directed mutations on PTEN 3′UTR. [score:6]
To explore the potential roles of miR-200 family members in translational regulation of PTEN expression, we co -transfected a luciferase reporter construct containing PTEN 3′UTR together with different miR-200 family members. [score:6]
We provided evidence showing that upregulation of miR-200 family by ER stress exhibited protective roles via PTEN suppression in early phase of AD. [score:6]
In order to understand the role of miR-200 family in AD development, we employed the TargetScan (version 6.2, 2012) database to predict potential miR-200 target genes. [score:6]
On the other hand, transfection of miR-200 inhibitors to HCT116 colon cancer cells that have high endogenous levels of miR-200 resulted in increased expression of PTEN (Figure S1). [score:5]
Overexpression of miR-200 family inhibitors dramatically enhanced luciferase reading (Figure 1C). [score:5]
The mimic or inhibitors of miR-200 family and siPTEN/control siRNAs were synthesized by Life Technologies with sequences shown in Table 1. Table 1 Sequences of synthesized miR mimics/inhibitors or siRNA. [score:5]
The mimic or inhibitors of miR-200 family and siPTEN/control siRNAs were synthesized by Life Technologies with sequences shown in Table 1. Table 1 Sequences of synthesized miR mimics/inhibitors or siRNA. [score:5]
Among them, microRNA-200 family showed a dynamic expression profile during AD development in the APPswe/PSΔE9 transgenic mice. [score:4]
Among the three sites, site II seems to have the most important role in the regulation of PTEN expression by miR-200 family. [score:4]
Among them, miR-200a/b/c, miR-141, and miR-429 in the miR-200 family were significantly upregulated in early age AD in mice. [score:4]
In this study, we identified PTEN as a target of miR-200 family in neuronal cells. [score:3]
HCT-116 cells were transfected with different combinations of miR-200 inhibitors as indicated. [score:3]
As predicted by Targetscan (version 6.2, 2012), three miR-200 family bind sites (Site I and Site III for miR-141/200a, Site II for miR-200b/c/429) are highlighted. [score:3]
Identification of PTEN as a target of miR-200 family. [score:3]
Database prediction indicated that PTEN has three miR-200 family binding sites in its 3′UTR and may be one of the potential targets of miR-200 family (Figure 1A). [score:3]
Among miR-200 family, miR-200c is the major microRNA that targets PTEN. [score:3]
Members of the miRNA-200 family regulate olfactory neurogenesis. [score:2]
Among the five miR-200 family members, miR-200c plays the most important regulatory role and was used to represent miR-200 family in the following parts of the study (Figures 1D–F). [score:2]
Critical role of the miR-200 family in regulating differentiation and proliferation of neurons. [score:2]
In nerve system, miR-200 family is enriched in olfactory and has been implicated in neuronal proliferation and differentiation (Choi et al., 2008; Pandey et al., 2015). [score:1]
MiR-200 family can be divided into two groups according to the seed sequences (group I: miR-141 and miR-200a; group II: miR-200b, miR-200c, and miR-429). [score:1]
For luciferase activity assay, we introduced mutations on each miR-200 family miR binding site by overlap PCR. [score:1]
Name of miRs/siRNAs Sequence miR-200a 5′-UAACACUGUCUGGUAACGAUGU miR-200b 5′-UAAUACUGCCUGGUAAUGAUGA miR-200c 5′-UAAUACUGCCGGGUAAUGAUGGA miR-141 5′-UAACACUGUCUGGUAAAGAUGG miR-429 5′-UAAUACUGUCUGGUAAUGCCGU miR-NC 5′-UAACGUGUCACGUCUCCGACUA Anti-miR-200c 5′-UAACACUUGCCGGGUAAUGGUGUA Anti-miR-NC 5′-UCUUGCCGGGCCCGAUCCAACGA siCont 5′-UUCUCCGAACGUGUCACGU siPTEN 5′-AACCCACCACAGCUAGAACUU 2.3 kb PTEN 3′UTR was amplified by PCR from a human cDNA library. [score:1]
pMIR-Reporter constructs containing either wild type or mutant fragments of PTEN 3′UTR were co -transfected into 293T cells with miR-200 family miRs (miR-141/200a, miR-200b/c/429, or miR-200c). [score:1]
A series of truncations containing different miR-200 family binding sites were also amplified and cloned into the pMIR-REPORT vector. [score:1]
[1 to 20 of 28 sentences]
29
[+] score: 100
Upon removal of Dox on day 18, the Dox+/− cells gradually returned to an epithelial expression signature when analyzing all the parameters examined in the EMT process i. e. direct miR-200 targets (Zeb1, Zeb2, FHOD1, PPMIF and FN-1mRNA), Zeb1/Zeb2 regulated genes (miR-200c/141 locus, ESA, ESRP1, E-cadherin and Vimentin), splicing isoforms of CD44 and p120 catenin and the SRF target gene, CTGF (Figs 3 and 4). [score:9]
Expression levels of the indicated mRNAs after TuD-141/200c induction and a release from the functional inhibition of the miR-200 family. [score:5]
It was also recently reported that because of a single nucleotide difference in their core sequences (2 to 8 nt from the 5′ end), miR-200a and miR-200b have distinct target specificities, whereas a considerable number of target genes overlap between them 10. [score:5]
Protein expression levels of the indicated genes after a release from the functional inhibition of the miR-200 family. [score:5]
Expression levels of specific genes after TuD-141/200c induction and a release from the functional inhibition of the miR-200 family. [score:5]
Overall, these findings indicated that the inhibition of miR-200 family activity alone can trigger several layers of molecular events in a sequential manner including RNA interference, transcriptional repression and activation, switching of splicing isoforms and probably actin remo deling and subsequent SRF target gene induction. [score:5]
Our current results indicate that EMT induced by TuD -mediated miR-200 family inhibition is fairly reversible after a release from this inhibition. [score:5]
Since each MBS in TuD can efficiently suppress the activity of miRNAs with the same core sequence 17, this TuD hybrid, TuD-141/200c, would therefore efficiently suppress almost the entire miR-200 family (Fig. 1a). [score:5]
Of note, CTGF mRNA was induced by the miR-200 inhibition and repressed by the release from this inhibition with a slightly delayed kinetics compared with those of vimentin. [score:4]
EMT and MET induced by the regulated inhibition of miR-200 family activity. [score:4]
This would lead to the down-regulation of endogenous miR-200c/-141 production, confirming the establishment of a double -negative feedback loop between Zeb1/2 and the miR-200 family members in a quite early stage of EMT. [score:4]
To test whether our observations that the EMT induced by miR-200 suppression is highly reversible could be extended to another cell line, we tested the mammary tumor cell line, SUM149PT, as it has been reported to show phenotypic equilibrium in monolayer culture 27. [score:3]
Other miR-200 family targets, including FHOD1, PPMIF and FN1 mRNAs, were induced in a lesser extent with distinct kinetics for each gene (Fig. 3a). [score:3]
An miR-200 target, FHOD1 (formin homologue domain-containing protein 1) (Fig. 3a), as a member of the formins, is expected to contribute to actin polymerization (F-actin formation) during EMT. [score:3]
Kinetics of the multiple molecular events involved in the EMT induced by inhibition of the miR-200 family. [score:3]
Reversion of the observed multiple molecular events after the release from miR-200 -family inhibition. [score:3]
Importantly in culture C (ESA(−) cells originated from ESA(+) cells after the TuD-141/200c induction), Zeb1 and Zeb2 were drastically elevated among the miR-200 family targets. [score:3]
How to cite this article: Haraguchi, T. et al. Dynamics and plasticity of the epithelial to mesenchymal transition induced by miR-200 family inhibition. [score:3]
As early as 12–16 hours after Dox addition, representative miR-200 family targets, Zeb1 and Zeb2 began to increase their levels by more than 5-fold, indicating that their mRNAs are extremely sensitive to a reduction in miR-200 activity (Fig. 3a and Supplementary Figure S9). [score:3]
Importantly, all of the major mRNAs shown to be involved in miR-200 -mediated EMT in HCT116 cells had similar changes in SUM149PT cells upon induction of and release from TuD-141/200c expression, indicating that cascade of molecular events represented in Supplementary Figure S10 can be induced by modulation of the functional miR-200 family activity in different cell types. [score:3]
EMT and MET are also regulated by the activities of miR-200 family members in the SUM149PT triple -negative breast cancer cell line. [score:2]
Using our system described above for regulating miR-200 family activity, we performed time course analysis of the key molecular events that have been previously reported to be involved in the EMT. [score:2]
The cumulative evidence to date indicates that the miR-200 family members are among the key regulators of the EMT. [score:2]
12) is much higher than that of the other miR-200 members (which are transcribed from chr. [score:1]
Even with this limitation, we were still able to detect the reversibility of miR-200 -mediated EMT in this cell line. [score:1]
Considering that the core sequence of miR-200c is shared by miR-200b and -429, whereas that of miR-200a is identical to miR-141 (Fig. 1a), we designed a hybrid type TuD molecule with 2 miRNA binding sites (MBS) that are complementary to miR-200c and miR-141, respectively. [score:1]
Sequences of miR-200 family members as well as their seed sequences (grey box) are shown in the lower panel. [score:1]
The observed cascade of molecular events induced by modulation of the functional miR-200 family activity is schematically represented in Supplementary Figure S10. [score:1]
Our current results highlight the molecular basis of epithelial plasticity supported by the miR-200 family. [score:1]
MiRNA microarray analysis of HCT116 cells indicated that two miR-200 loci are transcribed at basal levels, whereas production of miR-200c/-141 (transcribed from chr. [score:1]
Hence, the major cascade of molecular events associated with miR-200 -dependent EMT that we observed in HCT116 cell system can be basically recapitulated in SUM149PT cells. [score:1]
This is mechanistically supported by the transcriptional reversibility of key genes downstream of the miR-200 family examined here including Zeb1, Zeb2, FHOD1, PPM1F, E-Cad, ESRP1, ESA, and CTGF. [score:1]
The asterisk indicates the nucleotides that differ between miR-200a/141 and miR-200b/c/429. [score:1]
Overall these observations support that miR-200 -mediated EMT is reversible in this cell line. [score:1]
[1 to 20 of 34 sentences]
30
[+] score: 99
MicroRNA-200a inhibition was performed using 5nM miR-200a -targeting and non -targeting control power inhibitors (Exiqon), transfected in tandem with a synthetic miR-200a target RenSP luciferase reporter plasmid (Switchgear Genomics, Carlsbad, CA) at a ratio of 1:5 (ng:nL) with Dharmafect Duo transfection reagent (GE Healthcare, Pittsburgh, PA). [score:11]
While expression of this miRNA increased with advancing cancer progression in rats on the ad libitum Control diet, miR-200a expression was significantly downregulated in CR tumors compared to Control tumors, indicating that the CR diet maintains miR-200a expression at levels closer to those seen in normal tissue. [score:9]
These findings deepen our understanding of the dysregulation of miRNA throughout cancer progression and suggest that miR-200a may be a novel intervention target for mimicking the suppressive effects of CR on mammary tumor development and growth. [score:7]
The majority of these progression -associated miRNAs, including miR-10a, miR10b, miR-124, miR-125b, miR-126, miR-145, were increasingly downregulated with increasing lesion severity, while 2 miRNAs, miR-21 and miR-200a, were upregulated with advancing tumor progression. [score:7]
Although the miR-200 family of miRNAs are most traditionally thought of as tumor-suppressive miRNAs because of their ability to target epithelial-to-mesenchymal transition-promoting transcripts, it is clear that miRNAs have many different functions through the targeting of hundreds of mRNAs, and thus different functions can be dominant in different biological settings [11, 28, 29]. [score:7]
When miR-200a function was inhibited in vitro in both rat and human luminal mammary cancer cell lines to mimic the effect of CR on this miRNA, cellular proliferation was significantly decreased compared to a non -targeting inhibitor control (LA7: P = 0.012, MCF7: P = 0.037)(Fig 4B and 4C). [score:6]
MiR-200a is upregulated in many types of cancerous tissue including mammary cancer, and this upregulation can contribute to tumorigenesis by affecting proliferation, oxidative stress responses, and/or resistance to cell death [30, 31, 32, 33]. [score:6]
The downregulation of progression -associated miR-200a by CR inhibits cellular proliferation. [score:6]
Further, we have shown that CR greatly reduces tumor initiation and growth, a protective effect that can be explained, at least in part, through CR’s normalization of miR-200a expression and resultant inhibition of cellular proliferation. [score:5]
This finding suggests that CR may reduce tumor burden by dampening cellular proliferation through the prevention of miR-200a upregulation. [score:4]
Moreover, we found that CR strongly suppresses DMBA -induced mammary tumor development, and that one of these progression -associated miRNAs, miR-200a, is highly responsive to CR and may be an important contributor to the anticancer effects of CR. [score:4]
However, the expression of miR-21 and miR-200a increased throughout progression, a pattern that suggests these miRNAs function as oncomiRs in this mo del. [score:3]
Specifically, miR-200a was downregulated by 57% in CR tumors compared to Control tumors (P = 0.002). [score:3]
This result indicates that miR-200a has a pro-proliferative function in mammary cancer cells and corresponds with the finding that its expression increases in vivo throughout progression of luminal mammary cancer. [score:3]
When miR-200a was inhibited in both rat and human luminal mammary cancer cell lines, mimicking CR’s effect on this miRNA, we found proliferation was significantly reduced. [score:3]
The 8 miRNAs we found from our profiling (specifically, miR-10a, miR-10b, miR-21, miR-124, miR-125b, miR-126, miR-145, and miR-200a) each showed progressive changes in expression with advancing lesion grade. [score:3]
0159686.g004 Fig 4(A), Real-time PCR quantification of tumoral miR-200a expression. [score:3]
Presently, we have shown that the regulation of miR-200a may be one such mechanism. [score:2]
In summary, we have presented, for the first time, a luminal mammary cancer progression -associated miRNA profile and have shown that CR prevents the dysregulation of one of these miRNA, miR-200a. [score:2]
Of the eight progression -associated miRNAs we identified, miR-200a was the only one found to be CR-responsive. [score:1]
Considering our results to this point, we hypothesized that miR-200a was acting as an oncomiR in this mo del and that CR’s normalization of miR-200a could be contributing to the protective effect of this dietary regimen. [score:1]
We identified 8 miRNAs that are associated with mammary tumor progression, and found that one of these, miR-200a, is associated with the potent anticancer effects of a 30% CR diet regimen. [score:1]
MiR-200a inhibition and proliferation assays. [score:1]
The 8 miRNAs we identified to be progression -associated were assessed in tumor RNA samples from Control and CR mice, and only one, miR-200a, was found to be CR-responsive (Fig 4A). [score:1]
[1 to 20 of 24 sentences]
31
[+] score: 89
Other miRNAs from this paper: hsa-mir-31, hsa-mir-29b-1, hsa-mir-200b, hsa-mir-200c, hsa-mir-370
The expression levels of miR-200a and miR-31 was significantly down-regulated in PCa tissues compared with matched normal glands (Fig. 3B and 3D), while there was no significant difference in the expression levels of miR-29b-1 or miR-370 (Fig. 3A and 3C). [score:7]
This suggests a possibility that the up-regulated expression of miR-200a and miR-31 during carcinogenesis plays an important role in the development of PCa by promoting the cell into the castration stage. [score:7]
MiR-29b-1, miR-200a, miR-370, and miR-31were selected for further validation of microarray results using real-time qPCR because they were not only the most down/up-regulated but also closely potentially target to the Dicer 3′ UTR. [score:6]
Moreover, miR-200a down-regulation in meningiomas promoted tumor growth by reducing E-cadherin expression and activating the Wnt/β-Catenin signaling pathway [26]. [score:6]
Previous studies demonstrated that the miR-200 family is a crucial modulator of epithelial to mesenchymal transition, and that it is down-regulated and exhibits tumor suppressive properties in renal, prostate, breast, bladder, pancreatic, and gastric cancers [3, 18]. [score:6]
Comparing the expression levels of miR-200a and miR-31 between primary tumor and adjacent normal glands in the present study, we observed a significant expression decrease in primary tumors, suggesting that miR-200a and miR-31 may be involved in prostate carcinogenesis. [score:5]
Correlation studies between Dicer and miR-29b-1, miR-200a, miR-370, and miR-31 expression in PCas showed that the expression of Dicer mRNA was moderately and negatively correlated with that of miR-200a and miR-31 (ρ [s] = -0.489, p < 0.0001; ρ [s] = -0.314, p < 0.0001, respectively). [score:5]
Expression of miR-29b-1 (A), miR-200a (B), miR-370 (C) and miR-31 (D) in prostate adenocarcinoma and matched normal glands, after normalization to U6. [score:3]
0120159.g003 Fig 3 Expression of miR-29b-1 (A), miR-200a (B), miR-370 (C) and miR-31 (D) in prostate adenocarcinoma and matched normal glands, after normalization to U6. [score:3]
In ovarian cancer stem cells, loss of miR-200a expression was thought to play a critical role in E-cadherin repression, thereby enhancing the migration and invasive abilities of CD133/1 [+] cells [25]. [score:3]
In the present study, we examined the expression levels of miR-29b-1, miR-200a, miR-370, and miR-31 in matched PCa tissues from 185 patients. [score:3]
Expression of miR-29b-1(A), miR-200a(B), miR-370(C) and miR-31(D) in androgen dependent and castration resistant PCa, fold changes of miRNAs levels in prostatic adenocarcinoma versus matched normal glands were log2 transformed on Y axis. [score:3]
Data analysis showed that miR-29b-1, miR-200a, miR-370, and miR-31 were down-regulated in prostate cancer samples compared with matched normal tissues. [score:3]
Expression of miR-29b-1 (A), miR-200a (B), miR-370 (C) and miR-31 (D) in localized and metastatic PCa, fold changes of miRNAs levels in prostatic adenocarcinoma versus matched normal glands were log2 transformed on Y axis. [score:3]
In conclusion, our findings showed that Dicer might be a possible target for miR-200a and miR-31. [score:3]
0120159.g004 Fig 4 Expression of miR-29b-1 (A), miR-200a (B), miR-370 (C) and miR-31 (D) in localized and metastatic PCa, fold changes of miRNAs levels in prostatic adenocarcinoma versus matched normal glands were log2 transformed on Y axis. [score:3]
0120159.g005 Fig 5 Expression of miR-29b-1(A), miR-200a(B), miR-370(C) and miR-31(D) in androgen dependent and castration resistant PCa, fold changes of miRNAs levels in prostatic adenocarcinoma versus matched normal glands were log2 transformed on Y axis. [score:3]
We showed that miR-200a, miR-31, and miR-370 expression levels were increased in metastatic PCa rather than in localized cancers. [score:3]
Our miRNA correlation study showed that the relative expression of miR-200a and miR-31 was moderately and negatively associated with. [score:3]
0120159.g001 Fig 1 For the comparison between miRNA array data and Real-Time qPCR results, miR-29b-1, miR-200a, miR-370 and miR-31determined to be differentially expressed in prostate adenocarcinoma compared to matched histologically normal glands in four patients by miRNA array were validated using Real-Time qPCR. [score:2]
Following log2 transformation of fold changes in prostatic adenocarcinoma versus matched normal glands, the relative expression levels of miR-200a and miR-31 was significantly lower in the androgen -dependent subgroup compared with the castration-resistant one (Fig. 5). [score:2]
For the comparison between miRNA array data and Real-Time qPCR results, miR-29b-1, miR-200a, miR-370 and miR-31determined to be differentially expressed in prostate adenocarcinoma compared to matched histologically normal glands in four patients by miRNA array were validated using Real-Time qPCR. [score:2]
Following the log2-transformation of miRNA fold changes in prostatic adenocarcinoma versus matched normal glands, the relative expression levels of miR-200a, miR-370, and miR-31 was higher in metastatic PCa compared with localized PCa (Fig. 4). [score:2]
In our cohort, the expression levels of miR-200a and miR-31 were higher in primary tumors of castration-resistant PCa compared with androgen -dependent PCa, and higher in primary tumors compared with paired normal glands. [score:1]
In vitro, the transient transfection of miR-200a was previously shown to significantly reduce PCa cell line proliferation but have no effect on invasiveness [24]. [score:1]
Additionally, the miR-200 family was shown to modulate the oxidative stress response, thus affecting tumorigenesis and chemosensitivity [19]. [score:1]
[1 to 20 of 26 sentences]
32
[+] score: 77
They found that miR-200 family inhibitors down-regulated pro-SP-C and SP-B expression. [score:8]
Of note, we did not observe upregulation of the primary direct targets of the miR-200 family in the transcriptome analysis of miR-200b [−/−] lungs. [score:7]
Others have shown that miR-200 is down-regulated in a mouse mo del of fibrotic lung disease and human patients with idiopathic pulmonary fibrosis (IPF) [21]. [score:6]
Although miR-200a and miR-429 were expressed lower in miR-200b [−/−] lungs, their expression was not undetectable like miR-200b. [score:5]
Knocking down miR-200b in our mice resulted in down-regulation of mature miR-200a and miR-429. [score:5]
Based on our studies, we cannot exclude that downregulation of miR-200a and miR-429 contributed to the observed lung phenotype in miR-200b deficient mice. [score:4]
Therefore, changes in proteins of the direct gene targets of the miR-200 family might not be reflected in the transcriptome of miR-200b [−/−] lungs. [score:4]
miR-200a and miR-429 were significantly downregulated, but no changes were observed in abundance of miR-200c and miR-141 ** P < 0.01, Student’s t-test, Data represent mean ± SEM of at least four independent experiments. [score:4]
However, it is unclear at this point what the influence of downregulation of miR-200a and miR-429 on the lung phenotype of miR-200b deficient mice is. [score:4]
Benlhabib H Guo W Pierce BM Men delson CR The miR-200 Family and Its Targets Regulate Type II Cell Differentiation in Human Fetal LungJ. [score:4]
Members of the miR-200 family are down-regulated in the lungs of patients with IPF and a mouse mo del of lung fibrosis [21]. [score:4]
MiR-200b belongs to the miR-200 family (miR-141, miR-429, miR-200a, miR-200b and miR-200c) and regulates epithelial-to-mesenchymal transition (EMT) in cancer and organ fibrosis 17– 20. [score:2]
Using human fetal lung cultures, Benlhabib, et al. showed previously that miR-200 family members regulate epithelial type II cell differentiation and function [33]. [score:2]
We showed that mature microRNAs transcribed in the same cluster - miR-200a and miR-429 - were still expressed, albeit lower compared to miR-200b [+/+] lungs (Fig.   1f, Supplementary Fig. 5). [score:2]
Du, J. T. et al. MicroRNA-200 family members are weakly expressed in the neurosensory epithelia of the developing zebrafish (Danio rerio) inner ear. [score:2]
miR-200b [−/−] lungs have dysfunctional surfactant and denser parenchyma with more fibroblast- like cellsSome of the lung function abnormalities in miR-200 [−/−] could result directly from changes in surfactant function or distal airway branching. [score:2]
Some of the lung function abnormalities in miR-200 [−/−] could result directly from changes in surfactant function or distal airway branching. [score:2]
Mature microRNAs transcribed in the same cluster–miR-200a and miR-429–were still expressed, albeit lower compared to miR-200b [+/+] lungs (wt). [score:2]
We also observed lower miR-200a and miR-429 in kidney tissues of miR-200b [−/−] mice (Supplementary Fig. 6). [score:1]
mRNA-Seq whole transcriptome analysis demonstrated that mRNAs of epithelial cell differentiation and surfactant genes are most affected in miR-200b [−/−] lungsIn order to evaluate the effect on downstream targets and associated pathways owing to loss of miR-200b on the lung tissue transcriptome, we performed Next Generation Sequencing (NGS) on total RNA samples from lungs of three 8-week-old miR-200b [−/−] mice and three miR-200 [+/+] (wt) mice. [score:1]
Although miR-200c has the exact same seed sequence as miR-200b, the abundance of this microRNA along with miR141 was not changed in lungs and kidneys of 8-week old miR-200b [−/−] mice suggesting the absence of any compensatory effects of these two miR-200 family members in miR-200b deficient mice. [score:1]
Therefore, we assessed the biophysical function of surfactant from miR-200b [−/−] and miR-200 [+/+] lungs using capillary surfactometry. [score:1]
In order to evaluate the effect on downstream targets and associated pathways owing to loss of miR-200b on the lung tissue transcriptome, we performed Next Generation Sequencing (NGS) on total RNA samples from lungs of three 8-week-old miR-200b [−/−] mice and three miR-200 [+/+] (wt) mice. [score:1]
We then scanned three complete sections per lung of three miR-200b [+/+] and three miR-200 [−/−] lungs using an Axio Scan. [score:1]
These two miR-200 family members share the same transcript with miR-200b. [score:1]
We observed lower percentages of airspace in miR-200 [−/−] lungs (Fig.   3d). [score:1]
[1 to 20 of 26 sentences]
33
[+] score: 76
We also found that treating Huh7.5 human hepatoma cell-derived tumor xenografts with DCLK1-specific siRNA resulted in tumor growth arrest, downregulation of DCLK1, and increased expression of tumor suppressor miRNAs let-7a, miR-200, and miR-143/145. [score:8]
Treatment of Huh7.5 human hepatoma cell-derived tumor xenografts with DCLK1-specific siRNA produced tumor growth arrest, DCLK1 downregulation, and increased expression of tumor suppressor miRNAs let-7a, miR-200, and miR-143/145. [score:8]
Inhibition of DCLK1 results in downregulation of EMT-related genes via miR-200. [score:6]
Figure 5Knockdown of DCLK1 results in inhibition of cMYC via let-7a and EMT via miR-200 A. Decreased expression of cMYC mRNA in NP-siDCLK1 -treated tumors. [score:6]
We analyzed the expression of various tumor suppressor miRNAs (miR-144, miR-145, and miR-200a, b, c) that are regulated by DCLK1. [score:6]
These results show that DCLK1 negatively regulates tumor and EMT suppressor miRNA miR-200 in liver cancer, and DCLK1 affects miR-200 downstream targets. [score:6]
Following DCLK1 knockdown, a significant downregulation (>50%, p < 0.01) in miR-200 -dependent luciferase activity was observed (Figure 5C). [score:5]
Tumor suppressor miRNAs miR-144 C. miR-145 D. and miR-200a, b, c E. were significantly (p < 0.0001, except for miR-200c) downregulated in HCC tumors compared with adjacent normal tissue. [score:5]
B. Increased expression of pri-let-7a and pri-miR-200a miRNAs following the knockdown of DCKL1 in tumor xenografts. [score:4]
Following DCLK1 knockdown, we observed a significant (p < 0.01) upregulation of miR-200a pri-miRNA (>2.5-fold) in tumors treated with NP-siDCLK1 compared with control and NP-siSCR -treated tumors (Figure 5B). [score:4]
Knockdown of DCLK1 results in inhibition of cMYC via let-7a and EMT via miR-200. [score:4]
We predicted that DCLK1 plays a regulatory role in EMT, and that DCLK1 negatively regulates miR-200. [score:3]
We observed significant downregulation of miR-144 (Figure 3C and 3F), miR-145 (Figure 3D and 3F), and miR-200a, b, c (Figure 3E and 3F) in HCC tumors compared with adjacent normal tissue. [score:3]
C. siRNA -mediated knockdown of DCLK1 resulted in a decrease in miR-let-7a and miR-200 -dependent luciferase activity was observed in Huh7.5 cells. [score:2]
To demonstrate that DCLK1 negatively regulates miR-200, we transfected the Huh7.5 cells with plasmid containing luciferase gene under the control of 3′UTR containing miR-200 binding site. [score:2]
In xenografts treated with NP-siDCLK1, we observed a reduction of miR-200 downstream targets ZEB1, ZEB2, (Figure 5D), SNAIL, and SLUG (Figure 5E), compared with controls and tumors treated with NP-siSCR. [score:2]
Plasmids containing binding sites for miR-200a, miR-200b, and miR-200c at the 3′UTR of the firefly luciferase gene were obtained from Switchgear Genomics (Menlo Park, CA). [score:1]
The crossing threshold value was noted for pri-let-7a, pri-miR-144, pri-miR-143, pri-miR-145, and pri-miR-200a miRNAs, and normalized with U6 pri-miRNA. [score:1]
[1 to 20 of 18 sentences]
34
[+] score: 72
Taken together with our later observations that targeting of the liver-specific miR-122-5p or poorly abundant miR-195-5p, miR-25-3p, miR-200a/b/c-3p, miR182-5p and the mutant miR-224-5p mut2 by 2′OMe AMOs (but not their LNA/DNA AMO counterparts) also resulted in significant inhibition of immunostimulatory ssRNA sensing, our work establishes sequence -dependent and miRNA-independent off-target inhibitory activity of 2′OMe AMOs on the immune sensing of pathogenic RNA by human and mouse phagocytes. [score:9]
Mutation or deletion of part of this motif resulted in the loss of inhibitory activity for miR-200a-3p, miR-122-5p and NC1 2′OMe AMO variants, while introduction of this motif to the poorly inhibitory miR-224-5p AMO significantly increased the inhibitory activity of the AMO on TLR7. [score:8]
The sequence-specific and miRNA-independent significant inhibition of immunostimulatory ssRNA sensing by 2′OMe AMOs targeting miR-195-5p, miR-25-3p, miR-122-5p, miR-200a/b/c-3p and miR182-5p (Figure 2B) was supported by the lack of inhibitory activity with LNA/DNA AMOs (Figure 2C), and the low abundance of these miRNAs (less than 100-fold the level of the most abundant miRNA in BMMs) (Figure 2A). [score:7]
In addition, truncation of miR-200a-3p 2′OMe AMO to a shorter form (miR-200a-3p short) directly impacting on the 5′ end of the inhibitory motif, also resulted in decreased inhibitory activity of miR-200a-3p in both human and mouse (Figure 4F). [score:6]
While a single base change in miR-200a-3p mut1 did not significantly affect the inhibitory activity of this 2′OMe AMO, the addition of another two changes significantly compromised the inhibitory effect of the miR-200a-3p mut2 2′OMe AMO in primary BMMs (Figure 4E), thereby underlining a critical role of this motif. [score:5]
Importantly, although miR-200a-3p and miR-200b-3p had similar inhibitory activities, miR-200c-3p was a less potent inhibitor (Figure 2B). [score:5]
Relying on the variations between the miR-200a-3p and miR-200b-3p AMOs, we defined a central core UUACCA sequence changed to UUACCC in miR-200c-3p, which is potentially directly involved in the inhibitory activity of these 2′OMe AMOs on TLR7 sensing (Figure 4C). [score:4]
To validate the TLR7 -inhibitory function of this motif in the miR-200 2′OMe AMOs, we synthesized two AMO variants of the miR-200a-3p 2′OMe AMO, with one (miR-200a-3p mut1) and three (miR-200a-3p mut2) base changes in the most conserved residues of the enriched motif (Figure 4C and D). [score:3]
We noted that miR-200a-3p, miR-200b-3p and miR-200c-3p 2′OMe AMOs had a strong inhibitory effect on immunostimulatory ssRNA sensing in primary BMMs. [score:3]
Critically, this core sequence overlapped with a significantly enriched motif found in all the inhibitory sequences of Class 2 AMOs previously identified, in 5′-3′ orientation (for miR-200a/b-3p, and miR-25-3p) or 3′-5′ orientation (for AMO-NC1, miR-182-5p, miR-122-5p and miR-195-5p) (Figure 4C and Supplementary Table S2). [score:3]
Noteworthy, we found that miR-200a-3p and NC1 2′OMe AMO variants conjugated with a 3′ cholesterol group (commonly used for in vivo administration and referred to as antagomiRs (4)) were also strong inhibitors of TLR7/8, with marginally less activity than native sequences (Supplementary Figure S2B). [score:3]
These results were confirmed in dose-response studies in primary BMMs, demonstrating that the miR-200a-3p 2′OMe AMO was significantly more inhibitory than the miR-200c-3p AMO (Figure 4A). [score:3]
While the native miR-200c-3p 2′OMe AMO was significantly less inhibitory than miR-200a-3p 2′OMe AMO, activity of its mutated variant miR-200c-3p mut (restoring the core UUACCA sequence) did not significantly differ from that of miR-200a-3p in either human PBMCs or mouse BMMs (Figure 4F). [score:3]
Our analyses of truncated variants of miR-122-5p and miR-200a-3p 2′OMe AMOs also show that disruption of the context of the inhibitory motif can significantly reduce its activity (Figure 4). [score:3]
While comparing the effects of miR-200 AMO variants, we noted that miR-200c-3p had a lesser capacity to inhibit TNF-α production, compared to miR-200a-3p and miR-200b-3p. [score:2]
Unpaired t-tests comparing miR-200a-3p+B-406AS-1 and indicated conditions are shown. [score:1]
Ordinary one-way ANOVA with Dunnett's multiple comparison tests to miR-200a-3p+B-406AS-1 (E) or NC1+B-406AS-1 (H and I) are shown. [score:1]
To define further the impact of this motif in the modulation of TLR7/8 sensing, we generated a set of AMO mutants and truncated variants (Figure 4D) based on miR-200a/c-3p, miR-122-5p and NC1 2′OMe AMOs. [score:1]
Unpaired t-tests comparing miR-200a-3p+B-406AS-1 (F) or RD+B-406AS-1 (G) and indicated conditions are shown (ns, not significant). [score:1]
Similar results were found with immunostimulatory ssRNA sensing in human PBMCs on TLR8, where the miR-200c-3p AMO was also significantly less potent than the miR-200a-3p AMO at reducing TNF-α production (Figure 4B). [score:1]
[1 to 20 of 20 sentences]
35
[+] score: 71
As shown in Figure 3A, miR-200b, miR-200a, miR-429 are highly expressed in VCaP and LNCaP cells, moderately expressed in 22RV1 cells, and weakly expressed in DU145 and PC3 cells. [score:7]
The miR-200 family inhibits cancer cell invasion and metastasis by suppressing epithelial-mesenchymal transition through targeting ZEB1 and ZEB2 [21– 24]. [score:7]
In agreement with its tumor suppressor role, the expression of miR-200 family members has been associated with favorable clinical outcome in many cancers [27– 29]. [score:5]
However, the expression levels of miR-200b, miR-200a, miR-429, and miR-205 in transgenic mice are similar to that of wild type litter mates, indicating that ERG cannot induce the expression of these four miRNAs in murine prostate. [score:5]
Genome-wide analysis of miR-200 targets in living cells has confirmed that miR-200 prevents cell migration and invasion through a coordinate control of actin cytoskeleton dynamics [25]. [score:3]
Next, in order to test whether expression levels of miR-200a, miR-200a, miR-429 are regulated by ERG in VCaP cells, we used siRNA to specifically knock down ERG and used qPCR to measure mature miRNA levels. [score:3]
Real-time qPCR was used to determine expression levels of human ERG, and mouse miR-200b, miR-200a, miR-429 and miR-205. [score:3]
As shown in Figure 1, out of 369 miRNAs, the average expression levels of four miRNAs including miR-200a, miR-200b, miR-429, and miR-205 were significantly higher in ERG -positive human prostate cancer samples. [score:3]
To construct a lentiviral vector for the simultaneous expression of miR-200b, miR-200a and miR-429 in mammalian cells, 2310 bp of human miR-200b/a/429 genomic DNA was amplified by PCR and cloned into EcoRI/BamHI site of the pCDH-CMV-MCS-Puro vector (System Biosciences, Mountain View, CA, USA), resulting in pCD-HmiR-200b/a/429. [score:3]
In addition, miR-200 family members can block tumor angiogenesis by targeting interleukin-8 and CXCL1 [26]. [score:3]
Another family of well-established tumor suppressive miRNAs is miR-200, consisting of miR-200a, −200b, −200c, −141, and −429, which are clustered at two genomic locations. [score:3]
Figure 3(A) Expression levels of miR-200a, miR-200b, miR-429, miR-205, and ERG in commonly used prostate cancer cell lines, including LNCaP, VCaP, 22RV1, PC3, DU145. [score:3]
Although the miR-200 family of miRNAs can also be regulated at post-transcriptional levels [46], our evidence indicate that ERG can directly bind to miR-200b/a/429 promoter to facilitate its transcription in prostate cancer cells. [score:3]
Our results are in agreement with numerous previous reports that the miR-200 family members inhibit cancer cell invasion in many cancer types. [score:3]
Previous reports show that miR-200 could promote breast cancer metastatic colonization by targeting Sec23a [54]. [score:3]
Taken together, our results indicate that miR-200b, miR-200a, and miR-429 are directly and positively regulated by ERG at the transcriptional level in VCaP cells. [score:3]
Log2 values of average expression for ERG positive/negative PCa and p-value for the four miRNAs that are the focus of this study are: miR-200a (10.85/9.49, p = 1.88e-05), miR-200b (11.99/10.51, p = 1.42e-06), miR-205 (11.50/9.84, p = 9.85e-04), miR-429 (9.73/8.22, p = 1.59e-05). [score:3]
As shown in Figure 2E, treatment of VCaP cells with two individual ERG siRNAs (Stealth siRNA, Invitrogen) for four days caused approximately 40% reduction in the expression levels of miR-200b, miR-200a, and miR-429. [score:3]
Strikingly, miR-200a, miR-200b and miR-429 are known to be transcribed as a single polycistronic transcript, suggesting that these three miRNAs are regulated by ERG at the transcriptional level. [score:2]
The roles of miRNA-200 family and miR-205 have been studied in many cancer types. [score:1]
Strikingly we found that miR-200a, b, −429, and −205 are the only four miRNAs significantly increased in ERG -positive tumors. [score:1]
High levels of miR-200 predict favorable survival in many cancers [27– 29]. [score:1]
[1 to 20 of 22 sentences]
36
[+] score: 70
Other miRNAs from this paper: mmu-mir-200b, hsa-mir-200b, mmu-mir-200a, hsa-mir-200c, mmu-mir-200c
It is of note that further down-regulation of Zeb1 in Zeb1 null MEF cells had little effects on miR-200 expression (Figure  4B), possibly due to [1] the level of Zeb1 protein in het MEF cells is low enough to relieve the repression on miR-200 family, further decrease in Zeb1 expression in null cells will not increase in miR-200 expression accordingly or/and [2] it is also possible that Zeb1 might down-regulate other unknown factor(s) that positively regulates expression of miR-200 family at the same time and thereby makes the regulation network more complex. [score:17]
Our results suggest that E2F-Rb1 binds constitutively to the Ets1 promoter and limits the level of expression, but a second major impact of Rb1 on Ets1 expression is mediated through Rb1 repression of Zeb1 [40] and in turn induction of miR-200, which targets Ets1. [score:7]
Knockdown of Zeb1 in the T KO MEFs using shRNA lenvirirus, as described previously [17], eliminated much of the induction of Ets1 (Figure  4D), suggesting that induction of Zeb1 and repression of miR-200 as Rb1 family members are mutated is contributing significantly to the upregulation of Ets1. [score:5]
Because miR-200 has been shown to target Ets1 [19], we wondered if Zeb1 might also affect expression of Ets1. [score:5]
We link the effect of Zeb1 to its regulation of miR-200, which in turn target Ets1. [score:4]
Such findings raised the possibility that Zeb1 might feedback to induce Ets1 via its repression of miR-200, and that Rb1 might also influence Ets1 expression via its regulation of Zeb1. [score:4]
Rrm2, ribonucleotide reductase, Ntf3, neurotrophin 3. Zeb1 is a target of the miR-200 family, but in a negative loop Zeb1 feeds back to repress transcription of miR-200 family members [20, 21]. [score:3]
We link Rb1 repression of Zeb1 to induction of miR-200 family members, which in turn target Ets1 mRNA. [score:3]
miR-200 also represses Zeb1, but in a double negative loop Zeb1 binds the promoters of miR-200 family members and represses their expression [20, 21]. [score:3]
These results suggest that Rb1-E2F binds the Ets1 promoter to limit its level of expression, but it is induction of Zeb1 and in turn repression of miR-200 when the Rb1 family activity is lost that is responsible for most of the induction of Ets1. [score:3]
Taken together, our results provide evidence of an amplification loop consisting of Ets1 and Zeb1, which is mediated by miR-200 and regulated by Rb1. [score:2]
Figure 8 Mo del depicting an Ets1-Zeb1 amplification loop that is dependent upon miR-200 and regulated by Rb1. [score:2]
These results imply that CtBP -dependent transcription repression of miR-200 family members by Zeb1 is important for regulation of Ets1 and for thymocyte differentiation. [score:2]
We propose that Ets1 and Zeb1 form an amplification loop that is dependent upon Zeb1 repression of miR-200 and regulated by the Rb1 family (Figure  8). [score:2]
These findings suggest that Ets1 and Zeb1 comprise an amplification loop that is dependent upon miR-200 and regulated by Rb1. [score:2]
As we demonstrated previously [16], mutation of Rb1 family members led to induction of Zeb1 and this induction of Zeb1 was accompanied by repression of miR-200 (Figure  4C) and, as shown above, Ets1 (Figure  1). [score:2]
Zeb1 repression of the miR-200 family is linked to induction of Ets1. [score:1]
Ets1 Zeb1 miR-200 Thymocyte differentiation Lung adenocarcinoma c-Ets1 was identified as a proto-oncogene based on v-ets in the genome of the avian leukemia retrovirus E26, and is the founding member of the Ets family of transcription factors [1]. [score:1]
Recent studies have found that Ets is repressed by miR-200 family members [19]. [score:1]
Taken together, these results suggest an amplification loop between Ets1 and Zeb1, where Ets1 increases transcription of Zeb1, and Zeb1 in turn represses miR-200 to further elevate Ets1. [score:1]
[1 to 20 of 20 sentences]
37
[+] score: 69
The choice of miRNAs for validation with real-time RT-PCR was based on their differential expression among the groups as well as their putative biological significance: miR-542-5p is predicted to target estrogen receptor alpha mRNA; miR-200a and miR-429 are both members of the miR-200 family; and miR-503 is the most down-regulated miRNA in both types of carcinoma and the precursor lesion. [score:8]
While most tumours have shown a down-regulation of the miR-200 family, the up-regulation observed in endometrial carcinoma is shared with a few other tumours including melanoma, ovarian carcinoma, and colorectal carcinoma. [score:7]
Recently, Castilla et al [38] have demonstrated differential miRNA expression levels between the epithelial and mesenchymal elements in uterine carcinosarcoma, with up-regulation of the miR-200 family in the epithelial part. [score:6]
In the studies of miRNA expression in endometrial carcinomas, the up-regulation of the miR-200 family may be influenced by estradiol and ERα and this possibility deserves further study. [score:6]
The most striking similarity among studies of miRNA expression in EEC is the up-regulation of the miR-200 family. [score:6]
Insights into the up-regulation of the miR-200 family in certain tumour types, including endometrial carcinoma, may be gained by examining the role of steroid receptors in the regulation of miRNAs. [score:5]
However, there are some tumour types in which an up-regulation of the miR-200 family has been observed. [score:4]
It may be that the less aggressive nature of ERα -positive endometrial carcinomas relates to the up-regulation of the miR-200 family, which, in turn, maintains an epithelial phenotype and resists the EMT transition. [score:4]
The entire miR-200 family (miR-200a/b/c, miR-141, and miR-429) was up-regulated in cases of EEC. [score:4]
Our data share some important similarities with previously published reports [22]– [26]; Table 4. The most striking similarity is the up-regulation of the miR-200 family (miR-141, 200a, 200b, 200c, 429) in EEC relative to normal controls. [score:4]
MicroRNAs which have similar expression changes in other studies of EEC are italicized and the miR-200 family miRNAs are bolded. [score:3]
Examination of miRNAs that are consistently dysregulated in various studies of EEC, like the miR-200 family, will aid in the understanding of the role that miRNAs play in tumorigenesis in this tumour type. [score:2]
A recent review by Cochrane et al [39] describes the regulation of the miR-200 family by estrogen receptor-α and estradiol. [score:2]
Studies have shown an association with low miR-200 family levels and an aggressive tumour phenotype [31], [32] consistent with the regulation of the EMT switch as described. [score:2]
Efforts to elucidate the role that miRNAs play in endometrial carcinoma should focus on the miR-200 family as well as the other miRNAs that are consistently dysregulated in the multiple studies of endometrial carcinoma to date. [score:2]
The miR-200 family consists of five members localized on two genomic clusters (miR-200a/b, miR-429 on chromosome 1, and miR-200c, miR-141 on chromosome 12) [27]. [score:1]
Specific kits used were as follows: miR-542-5p: ABI#002240; miR-200a: ABI#000502; miR-429: ABI#001024; miR-503: ABI#001048. [score:1]
Conversely, if ZEB1 and ZEB2 levels are low, as would be expected with high miR-205 and miR-200 family members, E-cadherin levels increase and an epithelial phenotype should be maintained. [score:1]
The miR-200 family has been implicated in the epithelial-to-mesenchymal transition (EMT) that occurs as a part of tumour invasion and metastasis [28]– [30]. [score:1]
[1 to 20 of 19 sentences]
38
[+] score: 68
Second, our studies past and present, have showed the mesenchymal-specific downregulation of miR-200 expression in a panel of OSCC [35] and pancreatic cancer cell lines, respectively, but not miR-205 and miR-655 expression. [score:8]
Our findings strongly suggest that the TGF-b -induced EMT can be suppressed by miR-655, independently of miR-200 family members, through translational inhibition of ZEB1 and TGFBR2 in cancer cells (Fig. 4E). [score:7]
Recently, the miR-200 family (miR-141, -200a, -200b, -200c, and -429) and miR-205 have been demonstrated as EMT-suppressive miRNAs directly targeting ZEB1 and ZEB2 [17]. [score:6]
The miR-200 family members are typical EMT-suppressive miRNAs targeting several components of TGF-b signaling pathways, including the miR-200-ZEB1-E-cadherin axis, which is crucial in EMT and was described to be deregulated in mesenchymal-like cancer cells [17], [18], [20]. [score:6]
On the other hand, overexpression of miR-655, as well as the miR-200 family, induced significant morphologic changes and inhibited cell migration and invasion in 3 pancreatic cancer cell lines and a breast cancer cell line, MDA-MB-231. [score:5]
Actually, miR-200a, -200b and -200c were discovered as EMT-suppressive miRNAs in previous studies, emerged at the top of a list of results of screening, suggesting the present cell -based reporter assay to be a powerful tool for high-throughput function -based screening of miRNAs, siRNAs and chemical compounds having EMT-suppressive effects. [score:4]
Although no correlation between the expression pattern of miR-655 and that of any of these marker genes was found in this panel, these cell lines all showed lower expression of miR-655 than the miR-200 family and miR-205, as compared with a normal pancreas. [score:4]
By using the system for the first time we identified miR-655 as a novel EMT-suppressive miRNA, the biological meaning of which was different from that of the miR-200 family. [score:3]
B, Confirmation of the expression of the ZsGreen1 protein in the cell -based reporter system following transfection of miR-200a or -200b. [score:3]
Although the miR-200 family and miR-205, like miR-655, target ZEB1, their biological functions were found to differ from those of miR-655. [score:3]
These differences between miR-655 and miR-200 family members indicate the biological function of each EMT-suppressive miRNA in physiological and pathophysiological processes, including EMT/MET. [score:3]
The present study is the first to show clearly that miR-655 targets ZEB1 and TGFBR2 inducing inactivation of the TGF-b signaling pathway, involving the miR-200-ZEB1-E-cadherin axis, strongly suggesting a potential role for miR-655 as a prognostic marker and therapeutic agent in human cancers. [score:3]
These EMT-suppressive effects of miR- 655 were observed in a miR-200 family-independent manner (data not shown). [score:3]
We noticed a consistent positive correlation among expression profiles of miR-200 family members and a slight correlation between CDH1/E-cadherin and miR-200 family members. [score:3]
Among these candidates, we excluded well-known EMT-suppressive miRNAs, such as miR-200a and -200c [8], [21], [37], [38], and selected 10 miRNAs (miR-96-5p, -132-3p, -183-5p, -139-5p, -217, -520d-3p, -526b-3p, -629-3p, -655, and -200b-3p) showing a consistent positive correlation between two sets of fluorescence data taken from the fluorescence microplate reader (Table S2) and fluorescence microscope (Fig. S1). [score:3]
First, besides ZEB1, TGFBR2 was characterized as a direct target of miR-655 in our study, but not the miR-200 family and miR-205. [score:2]
The miR-200-ZEB1-E-cadherin axis has been clarified to be a crucial pathway downstream of TGF-b in EMT while reciprocal repression between ZEB1 and the miR-200 family has recently been reported to promote EMT and invasion in cancer cells [18]– [22]. [score:1]
During the acquisition of EMT characteristics, cancer cells lose the expression of genes that promote cell-cell contact, such as E-cadherin and the miR-200 family, and gain the expression of mesenchymal markers, such as vimentin, fibronectin, and N-cadherin, leading to enhanced cancer cell migration and invasion [6]– [8] and to confer drug resistance characteristics on cancer cells [9]. [score:1]
[1 to 20 of 18 sentences]
39
[+] score: 68
Other miRNAs from this paper: hsa-mir-21, hsa-mir-200b, hsa-mir-200c
In contrast, we found that the CDF treatment with or without gemcitabine combination showed increased expression of both miR-200b, and miR-200c, but the effect with curcumin or its combination was minimal, suggesting the superiority of CDF in suppressing the expression of miR-21, resulting in the re -expression of PTEN, and re -expression of miR-200 which could be responsible for the reversal of EMT phenotype in cells treated with CDF. [score:11]
We also showed anti-tumor activity of CDF alone and in-combination with gemcitabine, which was consistent with inactivation of miR-21, and consequently increased expression of PTEN, attenuation of the DNA binding activity of NF-κB inhibition in the expression of COX-2, and activation in the expression of miR-200 in tumor remnants of a xenograft mouse mo del of human PC, all of which provide convincing in vivo activity of CDF which is consistent with in vitro findings. [score:9]
In contrast to miR-21, miR-200 family is known as tumor suppressor and they are usually down-regulated in some tumors including PC and the loss of expression of miR-200 family contribute to the acquisition of EMT phenotype and drug resistance. [score:8]
In a xenograft mouse mo del of human PC, CDF treatment significantly inhibited tumor growth, which was associated with decreased NF-κB DNA binding activity, COX-2, and miR-21 expression, and increased PTEN and miR-200 expression in tumor remnants. [score:7]
Down-regulation of miR-200 by siRNA technique has been shown to be associated with EMT phenotype while re -expression of miR-200 can result in the reversal of EMT phenotype [29], [30]. [score:6]
CDF exhibited anti-tumor activity in MIAPaCa-2 cells induced tumors in a xenograft mouse mo del, which was consistent with inhibition of NF-κB DNA binding, COX-2, miR-21, and caused re -expression of miR200 in tumor remnants. [score:5]
Modulation in the expression of miR-21 and miR-200 family in vivo We determined the expression levels of miR-21, miR-200b and miR-200c in MIAPaCa-2 tumors by real time RT-PCR. [score:5]
These results suggest that the anti-tumor activity of CDF is mediated via re -expression of miR-200 which may potentially results in the reversal of EMT phenotype and could also lead to overcome drug resistance in PC. [score:3]
In our previous publication [12], we demonstrated that CDF treatment could re-express miR-200 in PC cells. [score:3]
Modulation in the expression of miR-21 and miR-200 family in vivo. [score:3]
Recently, we have developed a novel synthetic analogue of curcumin, 3,4-difluoro-benzo-curcumin [we named it as Difluorinated-Curcumin or in short CDF [10], [11]], which showed greater bioavailability in pancreatic tissues, and also inhibited cell growth, DNA -binding activity of NF-κB, Akt, COX-2, and the production of PGE [2] and VEGF, and caused induction of miR-200 and inactivation of miR-21 in PC cells [12]. [score:3]
In the current study we showed, for the first time, that CDF could significantly inhibit the sphere-forming ability (pancreatospheres) of PC cells consistent with increased disintegration of pancreatospheres, which was associated with attenuation of CSC markers (CD44 and EpCAM), especially in gemcitabine-resistant (MIAPaCa-2) PC cells containing high proportion of CSCs consistent with increased miR-21 and decreased miR-200. [score:3]
In xenograft mouse mo del of human PC tumors induced by MIAPaCa-2 cells, CDF exhibits anti-tumor activity by regulating COX-2, PTEN, miR-21, miR-200, and NF-κB in vivo. [score:2]
[1 to 20 of 13 sentences]
40
[+] score: 66
Other miRNAs from this paper: hsa-mir-122
While pre-miR200a suppressed the expression of genes containing a-5p or-3p target site, presumably at the post-transcriptional level, miR200a-5p and miR200a-3p only suppressed expression of genes with-5p and-3p target sites, respectively (Supplementary Figure 5B). [score:13]
Based on comparative analyses of gene expression profiles between Hdo and HuH-7 cells, miR200a-3p that is highly expressed in Hdo cells and poorly-differentiated cells was identified as a host factor that negatively regulates HCV replication. [score:6]
miR-200a is a known tumor suppressor miRNA that inhibits epithelial-mesenchymal transition and the initiating step of metastasis; it is also involved in differentiation, modulation of cell division, and apoptosis [18]. [score:5]
Expression of miR-200a was normalized to that of Z30 snoRNA (SNORD7), and relative expression levels to HuH-7 cells with no induction treatment are shown. [score:5]
Interestingly, it appears that miR200a-3p expression in cells is dependent on hepatic differentiation stages and its expression levels in mature cells are quite low, e. g., miR200a-3p RNA level in HuH-7 cells was approximately 10-fold lower than that in Hdo cells (Figure 5B) and the level in iPS-derived hepatocytes was 35-, 41-, 116-, and 125-fold lower than that in iPS, iPS-derived definitive endoderm, early hepatic endoderm cells, and hepatoblasts, respectively (Supplementary Figure 5A). [score:5]
We also identified a novel host factor, miR200a-3p, that is highly expressed in Hdo cells and poorly-differentiated cells and functions as a negative regulator of HCV replication. [score:4]
In hepatic differentiated Hdo cells, expression of miR-200a was lower than that in non-differentiated cells (Figure 5B). [score:3]
The expression of miR-200a was high in hepatoblasts but markedly low in mature hepatocytes (Supplementary Figure 5A). [score:3]
Expression of miR-122 and miR-200a were normalized to that of Z30 snoRNA (SNORD7) and fold change was determined by the ∆∆CT method. [score:3]
It has been reported that several transcription factors rich in undifferentiated cells such as c-Myb, ZEB1/2, and SOX2 are involved in miR200a expression [18]. [score:3]
Among human genes, ZFR (NM_016107), RANBP6 (NM_012416), and ZEB2 (NM_001171653), whose roles in HCV replication have not been reported to date, were predicted as targets of miR200a-3p. [score:3]
However, from our miRNA array and subsequent analyses, miR200a-3p was identified as a novel host factor that is potentially involved in negative regulation of HCV replication. [score:2]
Analyses to address whether miR-200a is involved in regulation of the HCV life cycle were carried out as follows. [score:2]
As shown in Figure 4D, transfection with miR-200a resulted in marked reduction of the viral RNA level. [score:1]
B. Expression of miR-200a in HuH-7, Hdo-17, Hdo-23, and their respective hepatic induction cells and cholangiocytic induction cells were examined by qRT-PCR using the TaqMan microRNA Reverse Transcription Kit with miR-200a specific RT primer from the TaqMan microRNA Assay. [score:1]
Next, synthetic pre-miR-200a, miR200a-5p, or miR200a-3p was introduced into virus-infected cells (Figure 4E, upper) and replicon cells (Supplementary Figure 5C). [score:1]
We found that HCVcc propagation and replication of the viral subgenome were significantly impaired in HuH-7 cells treated with pre-miR200a or miR200a-3p but not in cells treated with miR200a-5p. [score:1]
Infectivity to HCVpp and VSVpp was not affected by the treatment (Figure 4E, lower), suggesting that miR200a-3p is potentially involved in HCV replication. [score:1]
Seed sequences are underlined (miR200a-5p: 5’- GTTTAAACGCGGCCG CACATCGTTACCAGACAGTGTTATCTAGA-3’, miR200a-5pmut: 5’ - GTTTAAACGCGGCCG CACATCGTTACCAGAGACTCTTATCTAGA-3’, miR200a-3p: 5’ - GTTTAAACGCGGCCG CTCCAGCACTGTCCGGTAAGATGTCTAGA-3’, miR200a-3pmut: 5’ - TTTAAACGCGGCCG CTCCAGCACTGTCCGCTTACATGTCTAGA-3’). [score:1]
Studies to evaluate the interaction of these candidate virus- and cell-derived targets with miR200a-3p and their involvement in HCV replication are under way. [score:1]
First, reporter constructs carrying sequences of miRNA target sites or respective mutants downstream of the Luc gene were used to quantitatively evaluate the activities of pre-miR-200a, miR200a-5p, and miR200a-3p. [score:1]
Susceptibility of Hdo cells to HCV RNA replication and involvement of miR-200a in replication. [score:1]
[1 to 20 of 22 sentences]
41
[+] score: 66
A total of seven miRNAs deregulated in R. rickettsii-infected endothelial cells were thus further confirmed in this study, of which four (miR-129-5p, miR-200a-3p, miR-200b-3p, and miR-595) were up-regulated and another three (miR-301b-3p, miR-548a-3p, and miR-377-3p) were down-regulated. [score:8]
Conversely, introduction of miR-200a-3p inhibitor reduced the cellular miRNA levels by ≥60% and infection -induced miR-200a-3p expression was also decreased by about 50% by the miR-200a-3p inhibitor (Figure 5B). [score:7]
Our data suggests an inhibitory cross-talk between miR-200a-3p and NOTCH1 expression and a potentially important role for this interrelationship in rickettsial biology, because NOTCH1 signaling interacts with several other cellular pathways, transcription, and growth factors regulating various mechanisms including determination of differentiation and cell fate, endothelial proliferation, and angiogenesis in the vasculature [49]. [score:6]
Figure 4 shows the relative expression of NOTCH1 (A), SMAD2 (B), SMAD3 (C), and RIN2 (D) mRNA as potential downstream targets of positively-regulated miRNAs miR-129-5p, miR-200a-3p, and miR-200b-3p. [score:6]
Accordingly, the mRNA expression levels of NOTCH1 were significantly reduced in cells transfected with miR-200a-3p mimic alone and those infected with R. rickettsii following delivery of miR-200a-3p mimic (Figure 5C), and opposite effects were clearly evident when the inhibitor of miR-200a-3p was used in these experiments (Figure 5D). [score:5]
A miR-200a-3p mimic, inhibitor, and the corresponding negative controls were delivered by transfection into endothelial cells and the resulting effects on the levels of miR-200a-3p and NOTCH1 expression were monitored by q-RT-PCR. [score:5]
Together, these findings suggest that miR-200a-3p directly regulates NOTCH1 expression during Rickettsia infection of endothelial cells. [score:5]
Again, q-RT-PCR based quantitation on day 3 post-infection (Figure 3) revealed about 7.0 ± 1.9-fold higher expression of miR-129-5p (A) and 4.7 ± 0.9-fold up-regulation of miR-200a-3p (B) in the lungs of infected mice when compared to the uninfected controls and a decrease of about 53 ± 5% in the levels of miR-301b-3p (C) and 51 ± 10% in miR-377-3p (D), respectively. [score:5]
Generally corresponding to the microarray results (Figure 1A), q-RT-PCR based analysis of miR-129-5p (B), miR-200a-3p (C), miR-200b-3p (D), and miR-595 (E) also revealed a pattern of significantly increased expression in infected host cells. [score:3]
Interestingly, infection with R. rickettsii resulted in further increase of miR-200a-3p expression in cells transfected with the mimic (Figure 5A). [score:3]
As an important corollary to these in vitro findings, we further analyzed the expression status of miR-129-5p, miR-200-3p, miR-301b-3p, and miR-377-3p in the lungs of mice infected with R. conorii, another spotted fever group pathogen phylogenetically and antigenically similar to R. rickettsii. [score:3]
As expected, the mimic resulted in a dramatic increase in miR-200a-3p expression. [score:3]
The mimic and inhibitor for miRNA-200a-3p along with the negative controls were purchased from Applied Biosystems and transfected into HMECs in culture using Lipofectamine [®] RNAiMAX according to the manufacturer’s recommendations for 48 h prior to infection with R. rickettsii. [score:3]
In addition, this analysis lends further support to the findings of this study illustrating the potential for regulation of NOTCH1 by miR-200a-3p and possibly by others namely miR-200b-3p and miR-129-5p (Figure 6). [score:2]
Considering that the NOTCH pathway can be easily manipulated with inhibitors of γ-secretase and metalloprotease, further investigations to elucidate the roles of miR200a-3p, miR-200b-3p, miR-129-5p and possibly other miRNAs that could be mechanistically linked with NOTCH and other signal transduction pathways should allow for their exploitation as a new therapeutic strategy. [score:1]
2.5. miRNA200a-3p Controls NOTCH1 in R. rickettsii-Infected Endothelial Cells. [score:1]
[1 to 20 of 16 sentences]
42
[+] score: 66
For example, miR-200a and miR-200c were upregulated in all subtypes (mucinous, endometrioid, and clear cells), miR-200b and miR-141 were upregulated in serous as well as endometrioid carcinomas, and miR-21, miR-203, and miR-205 were upregulated only in endometrioid carcinomas. [score:10]
miR-200a and miR-141 were identified as highly upregulated in cancer, whereas miR-199a, miR-140, miR-145, and miR-125b1 were most significantly downregulated. [score:7]
Yang et al. (2008a) identified 36 miRNAs differentially expressed between normal ovarian cells and tumors, including miR-199a*, miR-214, miR-200a which were found upregulated in 53, 56, and 43% tumor tissues respectively, and associated with high-grade and late-stage tumors. [score:6]
In contrast with these data, Eitan et al. (2009) identified miR-200a, miR-34a, and miR-449b as the most down-regulated miRNAs in the advanced (stage III) ovarian tumors with miR-200a associated in the early-stage disease to an improved overall survival. [score:6]
ZEB1/2, two transcription factors involved in the mediation of the epithelial to mesenchymal transition, can inhibit the expression of miR-200 family members by binding to the promoter of both miR-200 clusters thereby blocking transcription (Gregory et al., 2008). [score:5]
The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. [score:4]
In turn, over expression of miR-200 family members repress ZEB1/2 levels, and leads to higher levels of E-cadherin and an epithelial phenotype (Burk et al., 2008). [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
The miR-200 family controls beta-tubulin III expression and is associated with paclitaxel -based treatment response and progression-free survival in ovarian cancer patients. [score:3]
Leskelä et al. (2010) demonstrated instead that miR-200 family showed a significant association with treatment response to paclitaxel–carboplatin regimen: women lacking complete response to paclitaxel–carboplatin regimen had tumors with significantly lower miR-200c levels than the ones who had achieved complete response; in addition, higher expression of miR-200c was associated with lower relapse/progression rates. [score:3]
We can summarize that cancer cells after being triggered by molecular signaling, such as TGF-β or PDGF-D, increases their levels of ZEB1/2 which in turn decrease the expression of miR-200 and induce EMT. [score:3]
In another study, the levels of four miRNAs (miR-200a, b, c, and miR-182) were identified as differentially expressed between the serum of 28 patients with serous ovarian cancer and healthy age-matched volunteers (Kan et al., 2012). [score:3]
The analyses highlights the important role of a miRNA regulatory network consisting of eight key miRNAs for the mesenchymal subtype including miR-141 and miR-200, miR-29c, miR-101, miR-506, and miR-128. [score:2]
An important example of miRNA transcriptional control in ovarian cancer is represented by the miR-200 family, which has been shown highly modulated in ovarian cancer. [score:1]
A miR-200 microRNA cluster as prognostic marker in advanced ovarian cancer. [score:1]
miR-200a was also identified as predictor of favorable outcome in another profiling study of a cohort of 55 advanced ovarian tumors (Hu et al., 2009). [score:1]
Another member of the miR-200 family, miR-200c, was also identified by Marchini et al. (2011) as associated with progression-free survival, overall survival, or both in multivariate analysis of stage I ovarian cancers. [score:1]
Elevated levels of circulating microRNA-200 family members correlate with serous epithelial ovarian cancer. [score:1]
The miR-200 family contains miR-200a, miR-200b, miR-200c, miR-141, and miR-429 which are arranged in two clusters in the human genome. [score:1]
A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. [score:1]
miR-200a, miR-200b, and miR-429 are located on chromosome 1, while miR-200c and miR-141 are on chromosome 12. [score:1]
[1 to 20 of 21 sentences]
43
[+] score: 65
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200c, hsa-mir-429
ZEB1 expression is inversely correlated to that of miR-200 in the different cell lines tested, with high miR-200b and -200c and low ZEB1 expressions in the human gastric epithelial cell lines, and low miR-200b and -200c and high ZEB1 expressions in HeLa or HEK293 cells (Fig. S3A), accordingly to the reciprocal negative feedback loop linking ZEB1 and the miR-200. [score:7]
MiR-200 regulate ZEB1 expression in basal conditions and are up-regulated by H. pylori. [score:6]
In turn, miR-200 post-transcriptionaly silence ZEB1/2 by inhibiting translation of their mRNA. [score:5]
ZEB1/2 are reciprocally linked to the miR-200 family members in a negative feedback loop, each strictly regulating the expression of the other, thereby controlling both the stability and reversibility of the epithelial versus mesenchymal phenotypes [16]; [20]. [score:4]
MiR-200 are microRNA (miRNA), small noncoding RNA molecules that post-transcriptionaly regulate gene expression in a variety of biological process [21]. [score:4]
An attractive hypothesis of the role of that regulation could be that enhanced cdh1 and miR-200 gene expression in H. pylori-challenged epithelial cells could provide a feedback control that would keep in check the effects of excessive NF-κB -mediated ZEB1 production, impede EMT progression and allow the process to stay reversible. [score:4]
Thus, while the activation of the NFκB-ZEB1-miR-200 axis and the concomitant up-regulations of both epithelial and mesenchymal markers upon 24 hr infection is a common feature of the three gastric cell lines, each of them displays specific kinetics in the early time points of infection, likely dependent on their genetic background and their sensitivity to the pathogen. [score:4]
We identified a mechanism that partly could explain the paradoxical miR-200 up-regulation in infected cells: analyzing miR-200b-a-429 promoter, we unveiled a NF-κB binding site stimulating promoter activity and pri-miR-200b-200a-429 synthesis, and leading to higher miR-200b levels. [score:4]
We show here that these EMT-like morphological changes, specifically induced by cagPAI+ H. pylori in gastric epithelial cells, are associated to enhanced expression of mesenchymal genes and are regulated by a tripartite NF-κB/ZEB1/miR-200 signaling pathway. [score:4]
ZEB1 and miR-200 are Overexpressed in Human Gastric Mucosa in the Context of H. pylori -driven Inflammation. [score:3]
These histological observations of simultaneous NFκB activation and ZEB1, E-cadherin, miR-200 expressions in areas of H. pylori colonization and associated chronic inflammation corroborate our in vitro data on gastric cell lines. [score:3]
Table S2 Expression of the miR-200 family members in gastric epithelial cell lines. [score:3]
Changes in mesenchymal and epithelial gene expression and miR-200 levels. [score:3]
In NCI-N87 cells, miR-200a and miR-141, which belongs to the same clusters than miR-200b and miR-200c, respectively, are also positively affected by infection. [score:1]
However, the effects of miR-200 overproduction seem to be dominated by those of ZEB1, since infected cells nevertheless undergo an EMT. [score:1]
The miR-200 are produced from two miRNA clusters, miR-200b-200a-429 and miR-200c-141, the promoters of which harbor ZEB1/2 binding sites and are repressed by ZEB1/2 [22]; [23]. [score:1]
Collectively, these findings demonstrate the existence of NF-κB/ZEB/miR-200 signaling network that initiates mesenchymal transition of H. pylori-infected gastric cells. [score:1]
Contrarily to the miR-200 levels, which appear to be more versatile, ZEB1 could constitute an early marker of these preneoplastic lesions in cagPAI + H. pylori-infected mucosa. [score:1]
Whereas scrambled control oligonucleotide (sc200) affect neither miR-200 levels (Fig. S3B), nor the original cobblestone cell morphology, antisense oligonucleotides (as200b, as200c) specifically decreases by 75% the detectable miR-200b and miR-200c levels (Fig. S3B) and dramatically affects cell morphology, which turns for 62.88±28.53% cells (versus 3.44±1.85% in sc200 -treated cells, n = 9, p<0.001) in an extremely elongated shape similar to the one provoked by H. pylori (Fig. 2A). [score:1]
The other miR-200 family members miR-200a, -141 or -429 are diversely affected by the infection (Table S2B). [score:1]
Conversely, global miRNA analyses of H. pylori-infected human gastric mucosa revealed 30 miRNAs significantly decreased in the H. pylori -positive group, among which all the miR-200 family members [40]. [score:1]
At last, we demonstrated that ZEB1 and miR-200 were both dependent on cagPAI, which activates NF-κB. [score:1]
ZEB1 and miR-200 are Overexpressed in Human Gastric Mucosa in the Context of H. pylori -driven InflammationTo evaluate the in vivo relevance of these findings, ZEB1, miR-200b, E-cadherin expressions and the activation of NFκB were investigated on gastric mucosa tissue sections from patients infected with H. pylori (all with cagPAI positive strains, n = 3) or uninfected (n = 3). [score:1]
ZEB1 is Repressed by miR-200 in Gastric Epithelial Cells. [score:1]
[1 to 20 of 24 sentences]
44
[+] score: 65
Thus, low expression levels of miR-200 family members, together with low expression of miR-29, may create permissive conditions for high expression of ADAM12-L in claudin-low tumors and cell lines. [score:7]
Since the ADAM12-S 3′UTR lacks predicted target sites for these miRNA families and since miR-29, miR-30, or miR-200 levels are highly variable in breast cancer, selective targeting of the ADAM12-L 3′UTR by these miRNAs might explain why ADAM12-L and ADAM12-S expression patterns in breast tumors in vivo and in response to experimental manipulations in vitro often differ significantly. [score:7]
The miR-29, miR-30, and miR-200 families have potential target sites in the ADAM12-L 3′UTR and they may negatively regulate ADAM12-L expression. [score:6]
The miR-200 family, by forming a double -negative feedback loop with transcription factors of ZEB1 and ZEB2, is a key negative regulator of EMT and is down-regulated in breast cancer stem-like cells and in normal mammary stem/progenitor cells [29- 33]. [score:5]
Mutations within these two miR-200 target sites abolished the effect of transfected miR-200b/c mimics, suggesting direct interaction between miR-200b/c and the ADAM12-L 3′UTR. [score:5]
In this report, we examined whether three miRNA families, miR-29, miR-30, and miR-200, directly target the ADAM12-L 3′UTR in human breast cancer cells. [score:4]
The predicted miR-29, miR-30, and two miR-200 target sites in the ADAM12-L 3′UTR reporter plasmid were mutated by site-directed mutagenesis. [score:4]
In this report, we asked whether ADAM12-L expression in breast cancer cells is regulated by members of the miR-200, miR-29, and miR-30 families. [score:4]
The third miRNA family tested here, miR-200, has not been previously reported to regulate ADAM12 expression. [score:4]
Similar to miR-29, the miR-200 family is down-regulated in claudin-low tumors and cell lines. [score:4]
The ADAM12-L 3′UTR is a direct target of miR-29 and miR-200 family members. [score:4]
We focused on the miR-29, miR-30, and miR-200 families, which act as tumor suppressors in breast cancer. [score:3]
Of particular interest are the miR-200, miR-29, and miR-30 families, which all have been linked to the mesenchymal phenotype, invasion, or metastasis in breast cancer [28, 29], and which all have predicted target sites in the ADAM12-L 3′UTR, but not in the ADAM12-S 3′UTR. [score:3]
Finally, the ADAM12-L 3′UTR reporter activity was significantly reduced by miR-200b/c, despite the fact that the two predicted miR-200 target sites present in the ADAM12-L 3′UTR are not well conserved between species. [score:3]
Since the miR-29 and miR-200 families play important roles in breast cancer progression, these results may help explain the different prognostic and chemopredictive values of ADAM12-L and ADAM12-S in breast cancer. [score:1]
The miR-29 family consists of three members with the same seed sequence, miR-29a-c. The miR-30 family is made up of 5 members, miR-30a-e. The miR-200 family consists of five members: miR-200a-c, miR-141 and miR-429. [score:1]
[1 to 20 of 16 sentences]
45
[+] score: 64
As we found that hsa_circRNA_100395 was significantly downregulated in PTC tumors here, our analysis suggests that miR-141-3p and/or miR-200a-3p should be consequently upregulated in PTC tumors as a result of regulatory disinhibition. [score:10]
This upregulation of miR-141-3p and/or miR-200a-3p may have effects on several cancer-related target genes that have been previously associated with these two miRNAs, including E2F3, GLS, CCND2, PTEN, CCNG1, CDC25B, and ZFPM2 (Tables 4 and 5). [score:6]
By comparing the lists of top-ranking cancer-related target genes, we were able to identify seven promising cancer-related genes that may be targets of the hsa_circRNA_100395/miR-141-3p/ miR-200a-3p axis in PTC (in order of descending rank): E2F3, GLS, CCND2, PTEN, CCNG1, CDC25B, and ZFPM2 (Tables 4 and 5). [score:5]
With respect to the current study, both miR-141-3p and miR-200a-3p have been shown to regulate tumor growth and metastasis across several malignancies; however, the direction of miR-141-3p’s dysregulation is dependent upon the specific tissue type. [score:4]
Therefrom, we identified one promising downregulated circRNA in PTC tumors (hsa_circRNA_100395) that shows interactive potential with two cancer-related miRNAs (miR-141-3p and miR-200a-3p). [score:4]
From this analysis, we identified several promising cancer-related genes that may be targets of the dysregulated hsa_circRNA_100395/miR-141-3p/miR-200a-3p axis in PTC tumors. [score:4]
For example, miR-141-3p and miR-200a-3p have been shown to be downregulated in breast cancer cells [29, 30], gastric cancer cells [31], and renal cell carcinoma cells [32, 33]. [score:4]
Further studies should focus on the dysregulation of the hsa_circRNA_100395/miR-141-3p/miR-200a-3p axis in PTC tumor cells in order to conclusively determine which cancer-related target genes are affected. [score:4]
From this analysis, we identified several promising cancer-related genes that may be targets of the dysregulated hsa_circRNA_100395/ miR-141-3p/miR-200a-3p axis in PTC tumors. [score:4]
One downregulated circRNA (hsa_circRNA_100395) showed interactive potential with two cancer-related miRNAs (miR-141-3p and miR-200a-3p). [score:4]
0170287.g007 Fig 7(A) The targeted pathway heatmap analysis revealed significant correlations (depicted in red) between cancer-related pathways and two miRNA clusters: the miR-141-3p/miR-15a-5p/miR-23b-3p cluster and the miR-200a-3p/miR-214-3p cluster. [score:3]
Top-ten ranking cancer-related target genes for hsa-miR-200a-3p. [score:3]
In order to further investigate which miRNAs may be cancer-related, we applied several bioinformatics tools to identify one promising downregulated circRNA in PTC tumors (hsa_circRNA_100395) that shows interactive potential with two cancer-related miRNAs (miR-141-3p and miR-200a-3p) (Fig 7, S3, S4 and S5 Figs). [score:2]
From the initial list of 71 potential miRNAs identified from the aforementioned Arraystar analysis, the DIANA-miRPath platform was able to identify two cancer-related miRNA clusters within our pre-defined p-value<0.05 threshold: the miR-141-3p/miR-15a-5p/miR-23b-3p cluster and the miR-200a-3p/miR-214-3p cluster (Fig 7A, S3, S4 and S5 Figs). [score:1]
We then applied seed sequence matching on the IntaRNA platform to predict that hsa_circRNA_100395 has the potential to bind to both miR-141-3p and miR-200a-3p (Fig 7C). [score:1]
Interestingly, both miR-141-3p and miR-200a-3p are members of the miR-200 family, which contains two miRNA clusters located on human chromosomes 1 and 12 (miRs-200a/b/429 and miRs-141/200c) [28]. [score:1]
Moreover, our bioinformatics analysis suggests that the hsa_circRNA_100395/miR-141-3p/miR-200a-3p axis may be involved in the pathogenesis of PTC. [score:1]
Comparing these two miRNA clusters to the Arraystar network map (Fig 6), we were able to identify that hsa_circRNA_100395 interacts with two miRNAs (miR-141-3p and miR-200a-3p) from the identified cancer-related miRNA clusters (Fig 7B). [score:1]
Moreover, our bioinformatics analysis suggests that the hsa_circRNA_100395/miR-141-3p/ miR-200a-3p axis may be involved in the pathogenesis of PTC. [score:1]
The hsa_circRNA_100395/miR-141-3p/ miR-200a-3p axis may be involved in the pathogenesis of PTC. [score:1]
[1 to 20 of 20 sentences]
46
[+] score: 63
This process may be reversible, since an increase in miR-200 family miRNAs expression initiates MET, restoring E-cadherin expression and promoting an epithelial phenotype [77]. [score:5]
Histograms showing relative expression (RQ) of mesenchymal markers (A), epithelial markers (B) and miRNA predictive target genes (C) in MSCs, after one week of transfection with miR-200 mimics (black bars), or with a control miRNA (scramble, white bars), in respect to control cells (CTR, grey bars). [score:5]
0159163.g008 Fig 8Histograms showing relative expression (RQ) of mesenchymal markers (A), epithelial markers (B) and miRNA predictive target genes (C) in MSCs, after one week of transfection with miR-200 mimics (black bars), or with a control miRNA (scramble, white bars), in respect to control cells (CTR, grey bars). [score:5]
Moreover, MSCs transfection with miR-200 mimics reduced the expression of two miRNA targets from our predictive analysis, CCND1 and IGF-1R (Fig 8C). [score:5]
In fact, mature miR-200 family miRNAs promote E-cadherin expression with the acquisition of an epithelial cell phenotype via post-transcriptional repression of zinc finger E-box binding transcription factor 1 and 2 (ZEB1 and ZEB2) [77]. [score:3]
We showed that both EVs and miR-200 family miRNAs can effectively reduce CCND1 and IGF1R expression in MSCs. [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
In particular, we detected the expression of some miRNAs belonging to miR-200 family. [score:3]
Moreover, we observed an increased expression of ENPEP, indicating that the miR-200 miRNAs can induce the epithelial commitment of MSCs. [score:3]
After one week of transfection of bone marrow derived-MSCs with 5 synthetic miR-200 mimics, we observed a reduction in the expression of VIM and FN1, which is another mesenchymal marker involved in cell adhesion, cell migration, cell growth and cell differentiation [78]. [score:3]
Taken together, these results suggest that the miR-200 family carried by EVs can induce MET in MSCs by binding to the 3’UTR sequences of predicted target genes, like CCND1 and IGF1R (Fig 8D). [score:3]
A mixture of mimics was used to increase the expression of miR-200a, miR-200b, miR-200c, miR-141 and miR-429 in MSCs. [score:3]
We employed qRT-PCR to validate the expression levels of the five miRNAs belonging to miR-200 family, selected from the miRNA array. [score:3]
Luciferase-3’UTR reporter constructs (0.8 μg) or the empty expression vector (negative control) were co -transfected with miR-200a, miR-200b, miR-200c, miR-141 and miR-429 mimics (0.5 μg, MiScript miRNA mimics, Qiagen) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions. [score:3]
Analysis of mesenchymal and epithelial markers expression in MSCs transfected with miR-200 mimics. [score:3]
To assess whether miR-200 family can effectively repress translation through binding to CCND1 and IGF1R 3’UTR, we performed luciferase reporter assay. [score:2]
Recent studies on tumor cells [73– 76] have demonstrated that miR-200 family miRNAs (miR-200a, miR-200b, miR-200c, miR-141, miR-429) are involved in EMT. [score:1]
Among them, we found a subset of five miRNAs (miR-200a, miR-200b, miR-200c, miR-141 and miR-429) that belong to miR-200 family, known to be involved in EMT [40, 41]. [score:1]
These data suggest that EVs may contribute to the epithelial commitment of MSCs by transferring a small subset of miRNAs that belong to the miR-200 family. [score:1]
MSCs were transiently transfected with miR-200a, miR-200b, miR-200c, miR-141 and miR-429 mimics (20 μM, MiScript miRNA mimics, Qiagen) using the HiPerFect Transfection Reagent (Qiagen), according to the manufacturer’s protocol. [score:1]
The role of the miR-200 family in epithelial-mesenchymal transition. [score:1]
As a result, miR-200 family induced a 90% reduction of luciferase activity in transfected cells. [score:1]
Role of the miR-200 family in the epithelial commitment of MSCs. [score:1]
We evaluated the expression of CCND1 and IGF1R in MSCs after incubation with EVs or TOT-CM and after cell transfection with miR-200 mimics. [score:1]
[1 to 20 of 24 sentences]
47
[+] score: 61
In ovarian cancer, 11 miRs were upregulated (miR-16, miR-20a, miR-21, miR-23a, miR-23b, miR-27a, miR-93, miR-141, miR-200a, miR-200b, and miR-200c) and 12 were downregulated (miR-10b, miR-26a, miR-29a, miR-99a, miR-100, miR-125a, miR-125b, miR-143, miR-145, miR-199a, miR-214, and let-7b). [score:7]
Pecot et al. demonstrated that miR-200 members inhibit angiogenesis through direct and indirect mechanisms by targeting interleukin-8 and CXCL1 secreted from the tumor epithelial and cancer cells. [score:7]
Pecot et al. demonstrated that miR-200 inhibits angiogenesis through direct and indirect mechanisms by targeting interleukin-8 and CXCL1 that is secreted by tumor endothelial cells [58]. [score:7]
Of 29 miRs, they showed that only 4 (miR-141, miR-200a, miR-200b, and miR-200c) were upregulated and 25 were downregulated, including miR-199a, miR-140, miR-145, and miR-125b-1 in the cancer samples [21]. [score:7]
The miR-200 family plays a critical role in the suppression of epithelial-to-mesenchymal transition (EMT) and tumor cell migration, invasion, and metastasis by directly targeting ZEB1 (zinc finger E-box -binding homeobox 1) and ZEB2 [55, 56]. [score:6]
Eight key miRs (miR-25, miR-29c, miR-101, miR-128, miR-141, miR-182, miR-200a, and miR-506) were identified and predicted to regulate 89% of the targets in this network. [score:4]
The researchers compared the expression profiles of 8 miRs (miR-21, miR-141, miR-200a, miR-200b, miR-200c, miR-203, miR-205, and miR-214) between cancer tissues and exosomes collected from the peripheral sera of the corresponding patients, since these had been previously demonstrated to be overexpressed in ovarian cancer. [score:4]
Members of the miR-200 family (miR-141, miR-200a, miR-200b, miR-200c, and miR-429) are downregulated in the majority of ovarian cancers, as previously described [21, 23]. [score:4]
From integrated genomic analysis, 8 key miRs (miR-25, miR-29c, miR-101, miR-128, miR-141, miR-182, miR-200a, and miR-506) were predicted to regulate 89% of the miR targets in the network [26]. [score:4]
Both miR-141 and miR-200a target p38 and modulate the oxidative stress response, affecting tumorigenesis and chemosensitivity [55]. [score:3]
miR-200a or miR-200c inhibits cancer stem-like cell populations [56, 57]. [score:3]
They showed the therapeutic potential of miR-200 delivery in treating ovarian cancer or other malignancies [58]. [score:1]
Using several experimental mo dels, including mo dels of ovarian cancer, they showed that the delivery of the members of the miR-200 family into the tumor endothelium led to marked reduction in metastasis and angiogenesis and induced vascular normalization, resulting in ovarian cancer regression. [score:1]
6.1. miR-200 Family. [score:1]
Kan et al. found that miR-200a, miR-200b, and miR-200c were significantly elevated in the serum of patients and suggested that their presence could be used as a predictor of ovarian cancer [50]. [score:1]
Furthermore, it has been reported that miR-200 family members are associated with chemosensitivity in ovarian cancer. [score:1]
[1 to 20 of 16 sentences]
48
[+] score: 60
However, it has been shown that ZEB1 triggers a double negative feedforward loop, by downregulating its own inhibitors (i. e., the mir-200 family members) [47, 48]. [score:6]
As a case study, we propose two prototypes of pure sponge (Figure  5A) and mixed TF-sponge (Figure  6A) modules, extracted from the normal breast analysis: the first employs PTENP1, a growth-suppressive lncRNA already identified as ceRNA [22, 25]; the second engages PVT1 as a competitor of CDH1 for binding to the mir-200 family and ZEB1 as both a transcriptional repressor of CDH1 and a target of the mir-200 family. [score:5]
However, this mo del may be undermined by the evidence that PVT1 - the main sponge regulator of the mir-200 family in the normal network - also results upregulated (∼ 2-fold) in cancer. [score:5]
Specifically, ZEB1 results downregulated in our breast cancer dataset compared to normal samples, while both the mir-200 family members and CDH1 are overexpressed. [score:5]
This is suggestive of an epithelial-like phenotype maintained by high levels of the mir-200 family members, which inhibit ZEB1 and, hence, increases the expression of ZEB-repressed epithelial genes, such as CDH1 (also known as E-cadherin) [33, 47]. [score:5]
Interestingly, the mir-200 family members are well-known to be involved in cancer metastasis and are believed to play an essential role in tumor suppression by inhibiting epithelial-to-mesenchymal transition (EMT), the initiating step of metastasis [32- 34]. [score:5]
Along this line, the mir-200 family members appear highly upregulated in the cancer dataset that we analyzed (from 4- to 8-fold). [score:4]
Moreover, it reveals a net binding preference towards the mir-200 family (Figure  7A), which it antagonizes to regulate the expression of hundreds of mRNAs in the normal case. [score:4]
In particular, the switch to a mesenchymal state can be induced by the transforming growth factor TGF β, which increases ZEB1, while ectopic expression of the mir-200 family members, which reduces ZEB1, seems either to prevent TGF β -induced EMT or to initiate epithelial-like reversion in mesenchymal cells [33]. [score:3]
Moreover, the mir-200 family members have recently been associated to human breast cancer [35- 39] and their overexpression was shown to promote the mesenchymal-to-epithelial transition [40]. [score:3]
This marked pattern suggests the existence of specific miRNAs, particularly the mir-200 family, acting at global level as buffers of mRNA/lncRNA highly co-expressed pairs. [score:3]
We speculate that the withdrawal in cancer of the PVT1 ceRNA activity can be due to the preferential expression of the two isoforms missing the binding sites for the mir-200 family. [score:3]
Colored boxes correspond to exons where the seed-complementary sites - for mir-200a/mir-141 (red), and for mir-200b/mir-200c (purple) - occur. [score:1]
Particularly, ceRNA mechanisms orchestrated by the mir-200 family, which is preponderant in the normal breast scenario, disappear in the BRCA network, where other sponges appear to be activated. [score:1]
In particular, members of the mir-200 family can be grouped in two clusters based on the seed sequence (i. e., the mir-200b/c/429 and mir-200a/141 clusters), differing by one nucleotide. [score:1]
It is connected to 753 different mRNAs (∼50% of total mRNAs in the network) and the mir-200 family members are mediating over 80% of these interactions (Additional file 5: Tables S5 and S10). [score:1]
Note that two isoforms (Iso 11 and 12) lack seed matches for the mir-200 family. [score:1]
In particular, we observed an outstanding prevalence of the mir-200 family in the whole normal-MMI-network. [score:1]
Interestingly, PVT1 revealed a net binding preference towards the mir-200 family as the bone of contention with its rival mRNAs. [score:1]
Despite most of the PVT1 alternative isoforms harboring seed matches for both clusters (Figure  7C), two isoforms lack the putative MREs for the mir-200 family. [score:1]
Notably, the normal MMI-network (1738 nodes and 32375 edges) is marked by a clear segregation into two internally well connected components: a larger one (1354 nodes and 31417 edges) mainly dominated by the mir-200 family and a smaller one (378 nodes and 954 edges) mainly controlled by mir-452. [score:1]
[1 to 20 of 21 sentences]
49
[+] score: 60
Other miRNAs from this paper: hsa-mir-203a, hsa-mir-200b, hsa-mir-200c, hsa-mir-429, hsa-mir-203b
Conversely, miRNA expression analysis in endometrial carcinosarcomas, a bona fide example of EMT in vivo, revealed a marked downregulation of miR-203 and miR-200 family members in the mesenchymal areas, concomitant to the upregulation of EMT inducers, including SNAI1 [25]. [score:9]
MiR-200b (A), miR-200a (B), miR-429 (C) expression levels were determined by qRT-PCR and normalized to U44 expression and expression levels in non -induced MCF7-SNAI1 cells. [score:7]
Further expression profiling in human primary and metastatic cancers showed that miR-203 and miR-200 family members were significantly suppressed in the latter, suggesting a direct involvement in cancer metastasis [26]. [score:6]
Altogether these data suggest that SNAI1 regulates expression of miR-203 and both miR-200 clusters in a coordinated manner, and that these miRNAs co-act in SNAI1-regulated programs. [score:5]
Co-regulated overexpression of miR-203 and miR-200 family members has been reported during early stages of human stem cell differentiation into epidermal cells suggesting their participation to this process [24]. [score:4]
SNAI1 represses the transcription of both miR-200 clusters (our data) [7], [27], [28] and indirectly activates expression of the ZEB factors (our unpublished observation) [9]– [11]. [score:4]
Therefore, we decided exploring the regulation of miR-203 and miR-200 family members through SNAI1, and their integration into regulatory networks governing epithelial cell plasticity. [score:3]
The miR-200s regulate EMT through a double negative feedback loop with the ZEB factors, which, depending on the relative levels of miR-200 and ZEB, can direct the switch from epithelial- to mesenchymal-like states and back [5]– [8]. [score:3]
We combined these experimental results with miRNA expression signature analyses of four published datasets of epithelial and mesenchymal NCI60 cancer cell lines (Fig. 1A, Table S2) [20]– [23], and calculated expression correlations with the miR-200 epithelial marker family (Table S3). [score:3]
MiRNAs recently emerged as important regulators in EMT, the most prominent being the two clusters of the miR-200 epithelial marker family: miR-200b/200a/429 (miR-200b) and miR-200c/141 (miR-200c) [3], [4]. [score:2]
By a large-scale analysis on epithelial plasticity, we highlighted miR-203 and its molecular link with SNAI1 and the miR-200 family, key regulators of epithelial homeostasis. [score:2]
A) The top panel corresponds to the core network integrating described interactions between miR-203, miR-200s (miR-200), SNAI1, ZEB1, ZEB2 and E-cadherin (CDH1). [score:1]
We integrated the novel miR203/SNAI1 feedback loop together with the known miR200/ZEB feedback loops [5] into an a priori SNAI1-centered EMT core network (Fig. 3A), based on our present and published data. [score:1]
By combining computational biology and experimental approaches, we propose a novel EMT core network integrating two fundamental negative feedback loops, miR203/SNAI1 and miR200/ZEB. [score:1]
Also, SNAI1 has been shown to repress miR-200 family members during murine embryonic stem cell differentiation [28]. [score:1]
Here, we performed a large-scale analysis highlighting miR-203 as consistently associated with epithelial plasticity and correlated to the miR-200 family which plays a key role in epithelial homeostasis. [score:1]
During SNAI1 -induced EMT in MCF7 breast cancer cells, miR-203 and miR-200 family members were repressed in a timely correlated manner. [score:1]
EMT core network integrating the miR203/SNAI1 and miR200/ZEB double negative feedback loops. [score:1]
We integrated this novel miR203/SNAI1 with the known miR200/ZEB feedback loops to construct an a priori EMT core network. [score:1]
In silico analysis predicted two binding sites for miR-203, but none for miR-200 family members, within the 3′UTR of the SNAI1 mRNA (Fig. 2E) (microRNA. [score:1]
F, G) Relative luciferase activity of SNAI1-3′UTR wild type (wt) or mutant (mut) in MDA231 cells transfected with control (F, G), miR-203 (F) or miR-200a/c (G) precursors. [score:1]
Further, in agreement with in silico predictions, miR-200a and miR-200c (miR-200a/c), representing both seed sequences found within the miR-200 family, did not repress wild type SNAI1-3′UTR reporter activity (Fig. 2G). [score:1]
0035440.g003 Figure 3A) The top panel corresponds to the core network integrating described interactions between miR-203, miR-200s (miR-200), SNAI1, ZEB1, ZEB2 and E-cadherin (CDH1). [score:1]
[1 to 20 of 23 sentences]
50
[+] score: 59
Values are the mean ± S. E. F, shown are qRT-PCR data of zeb1a, zeb1b, and cdh1 mRNA expression in miR-200 family -deficient embryos relative to SCMO -injected control embryos at 2- and 6-somite stage (n = 5 per condition). [score:3]
We measured the expression of miR-141 and miR-200b, located in the two different miR-200 family clusters, in zeb1b -overexpressing embryos and zeb1a/b morphants by qRT-PCR. [score:3]
zeb1a, zeb1b, and cdh1 expression in control embryos was set to 1. Values are mean ± S. E. We also performed in silico analyses of the zebrafish miR-200 clusters and the 3′-UTRs of zeb1a and zeb1b (Fig. 7 A). [score:3]
To investigate their functional relevance, we generated miR-200 morphants by injection of a triple anti-miR-200 MO mix (miR-141 MO, miR-200b MO, and miR-429 MO) that was shown to efficiently knockdown all five members of the miR-200 family (23) and controlled our knockdown experiment for the absence of expression of these by whole-mount ISH of 2-day-old embryos (data not shown). [score:3]
Zebrafish miR-200a and miR-200b have similar but not identical seed sequences and are together sufficient to post-transcriptionally repress Zeb1b expression by binding to their miR response elements (MREs) in the zeb1b 3′-UTR (23) (Fig. 7 A). [score:3]
zeb1a, zeb1b, and cdh1 expression in control embryos was set to 1. Values are mean ± S. E. We also performed in silico analyses of the zebrafish miR-200 clusters and the 3′-UTRs of zeb1a and zeb1b (Fig. 7 A). [score:3]
Finally, our results show that zebrafish Zeb1 proteins control miR-200 family member expression. [score:3]
A recent study revealed the importance of Zeb1/miR-200 regulation for the development of the mouse palate, which requires coordinated cellular rearrangements driven by EMT (60). [score:3]
To verify the efficacy of anti-miR-200 family MOs, one-cell stage embryos were injected with an anti-miR-200 MO mix (miR-141, -200b, -429) or SCMO, fixed at 48 h post fertilization (hpf), and assayed for miR-141, 200a/b/c, and -429 expression by whole-mount ISH. [score:2]
The Regulatory Feedback Loop of Zeb1 and miR-200 Is Functional but Has Only Minor Impact on Zebrafish Gastrulation. [score:2]
D, shown are live control and miR-200 family knockdown embryos at the indicated stages. [score:2]
Choi P. S. Zakhary L. Choi W. Y. Caron S. Alvarez-Saavedra E. Miska E. A. McManus M. Harfe B. Giraldez A. J. Horvitz H. R. Schier A. F. Dulac C. (2008) Members of the miRNA-200 family regulate olfactory neurogenesis. [score:2]
Bracken C. P. Gregory P. A. Kolesnikoff N. Bert A. G. Wang J. Shannon M. F. Goodall G. J. (2008) A double -negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. [score:2]
Interestingly, our data show that the miR-200 family -based feedback loop controlling Zeb1 activity is functional but does not effectively contribute to control of the Zeb1-E-cadherin regulatory system during zebrafish gastrulation and segmentation stages (Fig. 8). [score:2]
Together with previously published data (23) showing miR-200 regulation of zeb1b, this reveals that the double -negative feedback loop is conserved in evolution from zebrafish to mammals. [score:2]
An additional level of adhesion regulation is established by the ZEB1/miR-200 feedback loop that controls cellular plasticity in cancer cells (14). [score:2]
In the triple anti-miR-200 MO injection, 4 ng of each MO were co -injected into the yolk at the one-cell stage. [score:1]
We analyzed the 3′-UTRs of zeb1a and zeb1b for potential MREs for the miR-200 family (Fig. 7 A, left side). [score:1]
The stem-loop sequences of miR-200b and miR-200a are separated only by a 49-base pair spacer sequence, whereas the spacer between miR-200a and miR-429 comprises 1569 base pairs. [score:1]
E, shown is quantification of epiboly progress in SCMO -injected embryos and miR-200 family -deficient embryos shown in D (shield, n = 25 embryos each; 75%-epiboly, n = 34 embryos each; 90% epiboly, n = 33 embryos each). [score:1]
Left side, shown is a scheme of the genomic organization of the zeb1b 3′UTR and the putative zeb1a 3′-UTR with their miR-200 family MREs. [score:1]
This finding and previously published data by Choi et al. (23) together reveal that the reciprocal ZEB1/miR-200 feedback loop, which plays an essential role in defining the EMT status and cellular plasticity of human cancer cell lines, is also conserved in teleosts. [score:1]
Recently we and others have shown that this morphological plasticity of cancer cells is mediated by a double -negative feedback loop between ZEB1 and the miR-200 family members (13, 14). [score:1]
The zeb1a 3′UTR contains 4, and the zeb1b 3′UTR 10 miR-200 family MREs. [score:1]
C, a comparative genomic analysis of the miR-200 family members in human (hsa) and zebrafish (dre) indicates extensive conservation with respect to the mature miR and the seed sequences. [score:1]
Studies in human cancer cell lines revealed that ZEB1 and the miR-200 family are linked in a reciprocal negative feedback loop (13, 14). [score:1]
A, shown is a schematic representation of the reciprocal Zeb1a/b-miR-200 feedback loop. [score:1]
So far little is known about Zeb1/miR-200 feedback loop functions during gastrulation. [score:1]
In summary, our in vivo and in silico data in combination with the data by Choi et al. (23) indicate that the reciprocal negative feedback loop between ZEB1 and the members of the miR-200 family is conserved through evolution. [score:1]
miR-200 morphant gastrulae displayed only a small delay of epiboly progression (Fig. 7, D and E), whereas deep cell layer thinning appeared unaffected (data not shown). [score:1]
Our results together with previously published data (23) demonstrate that the Zeb1/miR-200 double -negative feedback loop is conserved in teleosts. [score:1]
Finally, we show that Zeb1b represses transcription of miR-141 and -200b, two members of the miR-200 family. [score:1]
Burk U. Schubert J. Wellner U. Schmalhofer O. Vincan E. Spaderna S. Brabletz T. (2008) A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells. [score:1]
MOs against the miR-200 family are as published (23): anti-miR-141 (5′-GCA TCG TTA CCA GAC AGT GTT A-3′), anti-miR-200b (5′-GTC ATC ATT ACC AGG CAG TAT TA-3′), and anti-miR-429 (5′-ACGGCATTACCAGACAGTATTA-3′). [score:1]
FIGURE 7. Analysis of the potential reciprocal Zeb1a/b-miR-200 negative feedback loop. [score:1]
[1 to 20 of 35 sentences]
51
[+] score: 58
It has been suggested that different cell lines regulate miR-200 expression through distinct epigenetic mechanisms [27]. [score:4]
Downregulation of miR-200 family members might underlie kidney cyst formation in Dicer mutant kidneys. [score:4]
Members of the miR-200 family were highly expressed in the kidney, lung, small intestine, and exocrine glands (Figure 2(a)). [score:3]
Members of the miR-200 family are commonly expressed in tubular tissues, and it is impossible to classify these tissues using only the miR-200 family. [score:3]
The miR-200 family consists of five members (miR-200a, miR-200b, miR-200c, miR-141, and miR-429), which are clustered and expressed as the miR-200b-200a-429 cluster at chromosomal location 1p36 and the miR-200c-141 cluster at chromosomal location 12p13. [score:3]
In human tissues, the results of the miRNA array analysis showed that miR-200a, miR-200b, and miR-200c (miR-200 family) were highly expressed in the kidney, lung, salivary gland, trachea, colon, prostate, liver, and pancreas (Figure 1). [score:3]
As expected, members of the miR-200 family were highly expressed in exocrine glands and epithelial cells. [score:3]
The expression of miR-200a, miR-200b, miR-200c, miR-192, miR-194, and miR-449a was validated with real-time RT-PCR in rat tissues in order to discriminate the kidney from other tissues with a tubular structure. [score:3]
Members of the miR-200 family were highly expressed in the proximal tubule. [score:3]
Members of the miR-200 family were expressed at high levels in each tissue with a tubular structure (Figures 3(a)– 3(c)). [score:3]
To examine the miR-200 family in the kidney, miRNA array analysis was performed to compare expression in the proximal tubule and mesangial cells. [score:3]
The lacrimal gland and salivary gland are formed from the ectoderm, and the expression ratio of miR-200a/b and miR-200c might depend on the germ layer. [score:3]
Our results showed that miR-200 family members were expressed at high levels in various tissues with a tubular structure: the kidney (proximal tubule and collecting duct), lung, pancreas (duct cells), small intestine (intestinal villus), bile duct, and exocrine glands (duct cells). [score:3]
Members of the miR-200 family are highly expressed in the kidney and lung. [score:3]
On the other hand, urinary miR-200a increased after day 3 of administration (Figure 5(c)). [score:1]
Furthermore, the levels of miR-200a/b/c were higher in the proximal tubule than in the glomerulus. [score:1]
In our results, urinary miR-200a also increased, and the sensitivity was similar to that of urinary albumin excretion. [score:1]
We assessed whether the plasma concentrations of miR-200a, miR-200b, and miR-200c could be used as a biomarker for acute kidney injury (Figure 4). [score:1]
Plasma miR-200a was not detected (data not shown). [score:1]
We assessed whether the urinary concentrations of miR-200a and miR-200c could be used as a biomarker for renal tubular dysfunction (Figure 5). [score:1]
A significant increase in plasma miR-200a/b/c, miR-192, and miR-194 levels was observed in the AKI mo del. [score:1]
These results suggest that the miR-200 family is closely associated with tubular structure. [score:1]
The concentrations of miR-200a/b/c were estimated based on the analytical curve for synthetic miRNA. [score:1]
Although morphological changes were not observed and miR-200a was not detected in plasma, macrophage infiltration was induced [23]. [score:1]
In the future, we will assess the potential of the urinary miR-200 family as biomarkers of the renal tubular dysfunction in humans. [score:1]
Patel et al. have reported that miR-200 family members play important roles in renal tubule maturation by repressing Pkd1 in the kidney [25]. [score:1]
We assessed whether the miR-200 family could be used as a biomarker for kidney injury. [score:1]
Consistently, the plasma concentrations of the miR-200 family members and miR-192 and miR-194 increased significantly. [score:1]
[1 to 20 of 28 sentences]
52
[+] score: 58
miR-181, miR-183 and miR-200 miRNAs Families Members are Similarly down-regulated during in vitro DecidualizationInterestingly, three miRNAs families (miR-181, miR-183 and miR-200) were down-regulated during the decidualization process. [score:7]
Moreover, the transcription factor ZEB1, a validated target of the mir-200 family, is up-regulated during the secretory phase in the human endometrial stroma, and its misregulation has been implicated in endometrial cancer progression [51], [52]. [score:7]
Am J Obstet Gynecol 202: 466 e461–467 58 Snowdon J Zhang X Childs T Tron VA Feilotter H 2011 The microRNA-200 family is upregulated in endometrial carcinoma. [score:4]
Another miRNA family that is down-regulated during the decidualization process is the mir-200 family. [score:4]
Noteworthily, some of the differentially expressed miRNAs identified in our study during decidualization have been found to be misregulated in endometriosis (e. g., miR-9, miR-135b and miR-141) [56], [17], [43], preeclampsia (e. g., miR-155, miR-183 and miR-181b) [18], [19], [57] or endometrial cancer (e. g., the miR-200 family and miR-96) [54], [58], [59]. [score:4]
The molecular pathways potentially regulated by the mir-181, miR-200 and miR-183 families with the potential target genes are listed below the histograms. [score:4]
Interestingly, three miRNAs families (miR-181, miR-183 and miR-200) were down-regulated during the decidualization process. [score:4]
This family is located at two different loci (chromosomes 1 and 12) and includes the mir-141, mir-429, mir-200a, mir-200b and mir-200c, miRNAs that were significantly down-regulated in the decidualized hESCs (Figure 1C). [score:4]
miR-181, miR-183 and miR-200 miRNAs Families Members are Similarly down-regulated during in vitro Decidualization. [score:4]
These miRNAs share an identical seed region except for miR-141 and miR-200a which change one nucleotide at position 4. The number of shared potential targets was low and was included in the cell cycle pathway. [score:3]
We also analyzed the more enriched molecular pathways by the union of miRNAs targets for the 4 mir-200 family members. [score:3]
B, miR-181 C, miR-200 and D, miR-183 family members’ expression in the E+P decidualized hESCs for 9 days if compared to the non decidualized control hESCs. [score:2]
miR-181, miR-183 and miR-200 miRNAs families members are similarly regulated during in vitro decidualization. [score:2]
miRNA 200 b was not included in the 704 miRNAs of the PCR array; thus, we analyzed its expression in the same samples using specific miRNA-200 b primers (Qiagen). [score:2]
Another interesting finding is that all the members of three different miRNAs families (miR-181, miR-200 and miR-183) have been identified to be similarly regulated. [score:2]
The molecular pathways potentially regulated by the miR-200 family include renal cell carcinoma and ErbB signaling. [score:2]
[1 to 20 of 16 sentences]
53
[+] score: 57
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-mir-21, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-28, hsa-mir-30a, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30d, hsa-mir-34a, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-23b, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-152, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-194-1, hsa-mir-194-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-378a, hsa-mir-342, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-196b, hsa-mir-484, hsa-mir-486-1, hsa-mir-1271, hsa-mir-378d-2, bta-mir-26a-2, bta-mir-103-1, bta-mir-148a, bta-mir-21, bta-mir-27a, bta-mir-30d, bta-mir-484, bta-mir-99a, bta-mir-125a, bta-mir-125b-1, bta-mir-145, bta-mir-199a-1, bta-mir-27b, bta-mir-98, bta-mir-148b, bta-mir-200a, bta-mir-30a, bta-let-7a-1, bta-mir-342, bta-mir-23b, bta-let-7a-2, bta-let-7a-3, bta-mir-103-2, bta-mir-125b-2, bta-mir-34a, bta-mir-99b, hsa-mir-885, hsa-mir-103b-1, hsa-mir-103b-2, bta-mir-143, bta-mir-152, bta-mir-16a, bta-mir-194-2, bta-mir-196a-2, bta-mir-196a-1, bta-mir-196b, bta-mir-199a-2, bta-mir-26a-1, bta-mir-28, bta-mir-335, bta-mir-338, bta-mir-378-1, bta-mir-486, bta-mir-885, bta-mir-96, bta-mir-1271, bta-mir-2299, bta-mir-199c, bta-mir-1388, bta-mir-194-1, bta-mir-378-2, hsa-mir-378b, bta-mir-3431, hsa-mir-378c, hsa-mir-4286, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, bta-mir-4286-1, bta-mir-4286-2, hsa-mir-378j, bta-mir-378b, bta-mir-378c, hsa-mir-486-2, bta-mir-378d, bta-mir-194b, bta-mir-194b-2
Our analysis indicates that, about 3594 genes could be targeted by the eleven up-regulated miRNAs (bta-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-4286, miR-885, miR-196a, miR-23b-3p, bta-miR-199c and miR-3431) whereas 1163 genes could be targeted by the three down-regulated miRNAs (bta-miR-335, miR-200a and bta-miR-2299-5p) in linseed oil -treated cows. [score:11]
The expression of seven miRNAs including six up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b and miR-21-5p) and one down-regulated (bta-miR-200a) were significantly affected by both treatments. [score:9]
Seven miRNAs including six up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b and miR-21-5p) and one down-regulated (bta-miR-200a) were found to be regulated (P < 0.05) by both treatments, and thus considered core differentially expressed (DE) miRNAs. [score:9]
Seven of the DE miRNAs by safflower oil treatment (6 up-regulated: bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-148b, miR-21-5p; one down-regulated: bta-miR-200a) were also significantly affected by linseed oil supplementation. [score:7]
Out of this number, 11 were up-regulated (bta-miR-4286, miR-885, miR-199c, miR-199a-3p, miR-3431, miR-98, miR-196a, miR-378, miR-23b-3p, miR-148b and miR-21-5p) while only 3 were down-regulated (miR-200a, miR-335 and miR-2299-5p) (Table  2). [score:7]
When compared with the control period (day-14), we identified a total of 22 DE miRNAs at day+28 including 10 up-regulated (bta-miR-199c, miR-199a-3p, miR-98, miR-378, miR-21-5p, miR-148b, miR-34a, miR-152, miR-16a, and miR-28) and 12 down-regulated (bta-miR-200a, miR-145, miR-99a-5p, miR-125b, miR-99b, miR-125a, miR-96, miR-484, miR-1388-5p, miR-342, miR-486 and miR-1271) (Table  2). [score:6]
Target analysis showed that stearoyl-CoA desaturases, SCD1 and SCD5, which are involved in FA biosynthesis, are targeted by bta-miR-200a and miR-199a-3p respectively. [score:5]
Furthermore, miR-200a/miR-8 cluster has been shown to negatively regulate WNT signaling which blocks adipogenic differentiation in multipotent mesenchymal stem cells [68]. [score:2]
It should be noted that some of the core DE miRNAs in this study (miR-98, miR-21-5p and miR-200a) have been previously suggested to play important roles in the adipogenesis network [64, 65]. [score:1]
[1 to 20 of 9 sentences]
54
[+] score: 56
However, in PANC-1 cells, miR-200a and -155 showed upregulation of target gene expression at 24 hours after infection with the sensors; at 48 hours, miR-200b and -155 displayed upregulation of reporter expression; and at 72 hours, reporter gene expression was upregulated by miR-200a and -200b. [score:18]
Moreover, the Gluc/Fluc of miRNA200a and -155 was significantly higher than that of the control (14.86±5.59, p<0.05), which suggests that these miRNAs might upregulate the expression of the target protein. [score:8]
Eight miRNAs (miR-200a, -200b, -21, -96, -146a, -10a, -155, -221), which were reported to be related to various pancreatic diseases, were studied in three PDAC cell lines (BxPC-3, CFPAC-1, SW1990), one pancreatic epithelioid carcinoma (PANC-1), and human pancreatic nestin -expressing cells (hTERT-HPNE). [score:5]
Thus, based on our findings, miR-200a, miR-200b, and miR-155 induced the overexpression of the reporter gene in PANC-1, and miR-155 induced overexpression of the gene in hTERT-HPNE. [score:5]
To show the overexpression of the report gene (miR-200a, miR-200b, miR-155 in PANC-1 and miR-155 in hTERT-HPNE) compared with control, miRNA activity was expressed as Gluc/Fluc. [score:4]
miR-200a, -200b, -21, -96, -146a, -10a, -155, and -221 in three PDAC cell lines (BxPC-3, CFPAC-1, SW1990), pancreatic epithelioid carcinoma cells (PANC-1), and human pancreatic nestin -expressing cells (hTERT-HPNE) were monitored by Asensors. [score:3]
In this study, the real-time miRNA activity of miR-200a, -200b, -21, -96, -146a, -10a, -155, and -221 in three PDAC cell lines (BxPC-3, CFPAC-1, SW1990), one pancreatic epithelioid carcinoma (PANC-1), and human pancreatic nestin -expressing cells without causing cancer -associated changes (hTERT-HPNE) was monitored using their corresponding Asensors. [score:3]
miR-200a, -200b, -21, -96, -146a, -10a, -155, and -221 sensor plasmids were constructed by inserting one copy of the corresponding miRNA target sequence, miR-200a (UAACACUGUCUGGUAACGAUGU), miR-200b (UAAUACUGCCUGGUAAUGAUGA), miR-21 (UAGCUUAUCAGACUGAUGUUGA), miR-96 (UUUGGCACUAGCACAUUUUUGCU), miR-146a (UGAGAACUGAAUUCCAUGGGUU), miR-10a (UACCCUGUAGAUCCGAAUUUGUG), miR-155 (UUAAUGCUAAUCGUGAUAGGGGU), or miR-221 (AGCUACAUUGUCUGCUGGGUUUC), into the 3′-UTR of Gluc. [score:3]
The Gluc/Fluc of the control at this time point was 309.71±41.42, which was significantly lower than that of miR-200a and -200b (p = 0.008 and 0.001, respectively) (Figure 2). [score:1]
In hTERT-HPNE cells, the Gluc/Fluc of miR-200a, -200b, -21, -96, -146a, -10a, -155, -221, and the controls at 24 hours was 2.02±0.78, 2.77±0.21, 0.19±0.04, 0.65±0.14, 2.69±0.66, 0.58±0.25, 6.81±0.94, 0.58±0.05, and 31.85±9.72, respectively; at 48 hours, 55.95±12.37, 110.56±12.14, 1.45±0.10, 19.20±9.35, 61.73±3.93, 21.29±5.47, 226.71±96. [score:1]
In PANC-1 cells, miR-200a, 200b, -96, -10a, -155, and -221 maintained the lowest activity at all time points (Figures 2 and 3). [score:1]
Notably, in the PANC-1 cells at 24 hours, the Gluc/Fluc of miR-200a, -200b, -21, -96, -146a, -10a, -155, and -221 was 43.51±8.57, 23.25±24.44, 0.62±0.38, 5.25±2.25, 1.56±0.40, 22.64±2.03, 40.88±5.13, and 9.07±1.47, respectively. [score:1]
At 48 hours, the Gluc/Fluc of miR-200a, -200b, -21, -96, -146a, -10a, -155, and -221 was 251.81±58.32, 377.90±51.11, 3.56±1.42, 71.65±1.17, 15.46±4.98, 189.34±31.41, 350.06±27.48, and 48.72±3.66, respectively. [score:1]
At 72 hours, the Gluc/Fluc of miR-200a, -200b, -21, -96, -146a, -10a, -155, and -221 was 441.17±22.52, 702.38±76.97, 8.43±2.74, 260.46±29.95, 36.82±13.61, 358.30±118.84, 403.13±49.49, and 79.98±12.87, respectively. [score:1]
In SW1990 cells, miR-200a, -200b and -96 maintained the highest activity within 72 hours (Figure 3). [score:1]
[1 to 20 of 15 sentences]
55
[+] score: 56
Other miRNAs from this paper: hsa-mir-205, hsa-mir-200b, hsa-mir-141, hsa-mir-200c, hsa-mir-429
High expression of either member of the indicated mir-200 cluster was associated with substantial expression of CDH1 mRNA (R = 0.22, p = 0.034), whereas ZEB1 and CDH1 mRNA were negatively correlated (R = –0.23, p = 0.027). [score:5]
The outcome of breast cancer disease in connection to mir-200 expression in primary tumors was highly dependent on the adjuvant therapy regimen used. [score:5]
Analysis of the expression of mir-200 family in primary colorectal tumors with known metastatic status showed that low levels of mir-200c were significantly associated with a metastatic disease (p = 0.041; Figure 1b). [score:5]
After stratifying for mir-200 expression, RT reduced the risk of local recurrences in the group of patients with tumors expressing high levels of mir-200s (b) but not in the group of tumors showing low mir-200 levels (c). [score:5]
We also show for the first time that the expression of the mir-200 family was associated with larger but fewer metastases, indicating a better prognosis for these patients. [score:3]
Our data support the theory that loss of expression of mir-200 family members activates the EMT system, and could thereby lead to migration and spreading of cells, as has been reported in various types of cancers [27, 28, 34]. [score:3]
To selectively analyze the expression of mir-200 in the epithelial compartment, matched normal, primary, and metastatic FFPE tissue samples from patients with metastatic colorectal cancer were microdissected (Figure 2a). [score:3]
Radiotherapy significantly decreased the risk of local recurrence in the patients with tumors expressing high levels of mir-200 but not in the patients whose tumors had low mir-200 levels (Figure 3a, b and c ). [score:3]
Metastatic tumors show altered mir-200 expression. [score:3]
Conversely, low mir-200 expression was associated with pronounced benefits of CMF, chiefly with regard to distant recurrence-free survival (Figure 3d, e and f). [score:3]
In summary, high ZEB1/low mir-200 expression was associated with activation of the PI3K–AKT pathway and with FGF signaling. [score:3]
For the survival analyses, a combination variable, mir-200, was created and defined as high expression (upper quartile) of mir-141 and/or mir-200c. [score:3]
There are five members of the mir-200 family, which are clustered together at two polycistronic sites: mir-200a, mir-200b, and mir-429 are located on chromosome 1p36 [13]; and mir-200c and mir-141 are located on chromosome 12p13. [score:1]
0084815.g003 Figure 3The treatment predictive value of mir-200 was analyzed in tumors from women who had been randomized to treatment with radiotherapy (RT) or systemic chemotherapy (CMF: cyclophosphamide, methotrexate, 5-FU) (a, d). [score:1]
Several microRNAs have been associated with EMT and metastasis, and the microRNA-200 (mir-200) family is described most frequently in this context [11]. [score:1]
The interaction between the treatment effect and miR-200 was clearly significant (CMF vs. [score:1]
radiotherapy: mir-200 high HR = 3.3 [CI 95% 1.3–9.42; p = 0.013] and mir-200 low HR = 0.49 [CI 95% 0.24–1.03; p = 0.059]; test for interaction p = 0.0035). [score:1]
The aim of the present study was to examine the potential of microRNAs as clinical markers and to elucidate the participation of the mir-200–ZEB–E-cadherin pathway in the progression of human cancers by using patient materials from metastatic colorectal and breast cancer. [score:1]
It is also plausible that additional microRNAs and signaling systems can play important roles in the metastatic process in vivo, perhaps in synergy with mir-200–ZEB. [score:1]
A trend towards shorter time to progression was seen in patients with low levels of CDH1 (p=0.11; Figure 1c) as well as members of the mir-200a/mir-200b/mir-429 cluster (p=0.22, p=0.08 and p=0.10, data not shown). [score:1]
The EMT-related mir-200 cluster has prognostic value in breast cancer patients. [score:1]
To summarize, we have shown that the EMT-related mir-200–ZEB–E-cadherin signaling pathway is of clinical relevance in predicting metastatic progression of primary tumors and the responses to different treatments. [score:1]
The treatment predictive value of mir-200 was analyzed in tumors from women who had been randomized to treatment with radiotherapy (RT) or systemic chemotherapy (CMF: cyclophosphamide, methotrexate, 5-FU) (a, d). [score:1]
Expression levels of all the five members of the mir-200 family, ZEB1, and CDH1 were measured by RT-qPCR in frozen tissue samples, and the results showed that the relationships between these factors in metastatic tissues were comparable those observed in primary tumors. [score:1]
[1 to 20 of 24 sentences]
56
[+] score: 55
miR200 expression inhibits Suz12 action; silencing of miR200 leads to significantly increased Suz12 transcript and protein expression in the CSC population. [score:7]
The authors of this study note that while downregulation of miRNAs such as let7 occurs in both neoplastic transformation and CSC formation, expression of the miR200 family members is specifically altered in CSCs, suggesting a central role for miR200 in formation of this population. [score:6]
Korpal M. Lee E. S. Hu G. Kang Y. The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2J. [score:6]
Re -expression of miR200 family members or miR205 only partially reverses the stem cell phenotype, an observation that highlights the complex deregulation that occurs in carcinogenesis. [score:4]
Gregory P. A. Bert A. G. Paterson E. L. Barry S. C. Tsykin A. Farshid G. Vadas M. A. Khew-Goodall Y. Goodall G. J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat. [score:4]
In a mo del of Src oncogene-transformed breast epithelial cells, CSC formation is dependent upon downregulation of miR200 family members [24]. [score:4]
Overexpression of one miR200 family member, miR429, has been shown to reverse EMT in ovarian cancer cell lines [89]. [score:3]
Iliopoulos D. Lindahl-Allen M. Polytarchou C. Hirsch H. A. Tsichlis P. N. Struhl K. Loss of miR200 inhibition of Suz12 leads to polycomb -mediated repression required for the formation and maintenance of cancer stem cellsMol. [score:3]
Ali S. Ahmad A. Banerjee S. Padhye S. Dominiak K. Schaffert J. M. Wang Z. Philip P. A. Sarkar F. H. Gemcitabine sensitivity can be induced in pancreatic cancer cells through modulation of miR200 and miR21 expression by curcumin or its analogue CDFCancer Res. [score:3]
Overexpression of miR200 leads to CSC death, raising the possibility that miRNAs may be useful therapeutics, especially in combination with chemotherapeutic drugs better suited to kill the non-CSC tumor population. [score:3]
miR200 family members regulate the epithelial-mesenchymal transition (EMT), via mediation of growth factor signaling pathways including transforming growth factor-beta and platelet-derived growth factor D [88]. [score:2]
The miR200 family of miRNAs appears to play a central role in tumor invasion and metastasis via their negative regulation of ZEB1 and ZEB2, zinc finger proteins that act as transcriptional repressors of e-cadherin [86, 87]. [score:2]
The mechanism of action of miR200 in regulating CSC formation appears to be epigenetic. [score:2]
Given the feasibility of miRNA adenoviral delivery, these observations raise the possibility that miR200 “replacement”, could serve as a novel metastasis-directed therapy. [score:2]
Namely, miR200 interacts with Suz12, a component of the PRC2 polycomb complex. [score:1]
Tellez C. S. Juri D. E. Do K. Bernauer A. M. Thomas C. L. Damiani L. A. Tessema M. Leng S. Belinsky S. A. EMT and stem cell-like properties associated with miR205 and miR200 epigenetic silencing are early manifestations during carcinogen -induced transformation of human lung epithelial cellsCancer Res. [score:1]
miR200 Family and Breast Carcinoma. [score:1]
The effects of Suz12 on e-cadherin in particular may contribute to the invasive and metastatic potential of breast carcinoma, with high miR200, low Suz12 and high e-cadherin levels associated with primary tumors and low miR200, high Suz12, and low e-cadherin observed in metastatic tumors [24]. [score:1]
[1 to 20 of 18 sentences]
57
[+] score: 54
Conversely, miR-200 expression down regulates known targets, including TGF-β2, that are particularly up regulated in many cancers (Benlhabib et al. 2015). [score:7]
CD-11-0219) 22585994 Benlhabib H Guo W Pierce BM Men delson CR 2015 The miR-200 family and its targets regulate type II cell differentiation in human fetal lung. [score:4]
However, the redundancy of miR-200 downregulation in both the epithelial and stromal compartments is highly supportive of using miR mimetic of this species. [score:4]
However, miR-200 family members have been reported to be both up- as well as downregulated in ovarian cancer (Park et al. 2008, Kan et al. 2012). [score:4]
Examining miR silencing of Smad3 by miR-200a, for example, resulted in downregulation of a different set of ECM proteins (i. e., collagen I, collagen IV, fibronectin, PAI-1 and α-smooth muscle actin) (Wang et al. 2011). [score:4]
Yet, in multiple independent studies miR-200 family was upregulated in metastatic breast and prostate cancers (Lin et al. 2014, Taylor et al. 2016). [score:4]
In the breast CAF, miR-200 family members seem to contributed to ECM remo deling through the expression of fibronectin and lysyl oxidase to potentiate cancer epithelial invasion (Tang et al. 2016). [score:3]
In a specific example, ectopic expression of miR-200 members significantly reduced anaplastic thyroid carcinoma cell invasion in a ZEB1/ZEB2 -dependent manner (Fig. 1) (Braun et al. 2010). [score:3]
Several miRs, such as miR-21, miR-34a, and the miR-200 family cluster target TGF-β signaling in prostate, breast and thyroid cancer for their functions during tumor progression and promotion (Braun et al. 2010, Shen et al. 2012, Chen et al. 2016) (Fig. 1). [score:3]
Smad2 and Smad3 are targeted by miR-155 and miR-200a, respectively (Kong et al. 2008, Park et al. 2008, Louafi et al. 2010, Ahn et al. 2012). [score:3]
2013.405) 24096486 Park SM Gaur AB Lengyel E Peter ME 2008 The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
Another target of miR-200 is Zeb1/Zeb2 in the maintenance of cellular plasticity, a major hallmark of tumor cell morphology (Brabletz & Brabletz 2010). [score:3]
CAN-15-2321) 26676753 Ahn SM Cha JY Kim J Kim D Trang HT Kim YM Cho YH Park D Hong S 2012 Smad3 regulates E-cadherin via miRNA-200 pathway. [score:2]
22283) 18506891 D’Ippolito E Plantamura I Bongiovanni L Casalini P Baroni S Piovan C Orlandi R Gualeni A Gloghini A Rossini A 2016 MiR-9 and miR-200 regulate PDGFR -mediated endothelial differentiation of tumor cells in triple negative breast cancer. [score:2]
1090922) 14764882 Brabletz S Brabletz T 2010 The ZEB/miR-200 feedback loop – a motor of cellular plasticity in development and cancer? [score:2]
It turned out that miR-21 helped distinguish between healthy and prostate cancer patients, but miR-141 (miR-200 family member) enabled distinction between localized and metastatic subjects. [score:1]
Importantly, miR-16 and miR-200 family members silences TGF-β signaling and blocks EMT (Brabletz & Brabletz 2010, Wang et al. 2014 b, Tang et al. 2016). [score:1]
Although in the epithelia miR-205 and miR-200 family members (miR-200c, miR-200b and miR-141) are associated with EMT progression, in fibroblastic cells they clearly have a different function. [score:1]
[1 to 20 of 18 sentences]
58
[+] score: 54
These microRNAs are downregulated in high grade and poorly differentiated tumors, while forced expression of miR-200 microRNAs has been shown to inhibit TGF-β1 -induced EMT in MDCK cells. [score:8]
Expression of miR-200 family members correlated positively with E-cadherin expression and negatively with the miR-200 target Zeb1 [38]. [score:7]
Interestingly, Zeb1 can also directly suppress transcription of miR-200 family members miR-141 and miR-200c [40] indicating an interplay between Zeb1 and miR-200 family that regulates the differentiation state of pancreatic cancer cells. [score:5]
Recent surveys of global microRNA expression patterns in pancreatic cancer cell lines showed that 39 microRNAs, including the miR-200 family, were deregulated and have at least two-fold differential expression in PDAC cell lines compared to control nontransformed pancreatic ductal cell lines [38]. [score:5]
Restoring expression of miR-200 family micro -RNAs or, alternatively, targeting EMT signaling pathways such as Notch and Hedgehog, or their ultimate downstream mediators the EMT-inducing transcription factors, such as Zeb1, could also restore the epithelial state and make the tumors more sensitive to therapeutic agents. [score:5]
Li Y. VandenBoom T. G. Kong D. Wang Z. Ali S. Philip P. A. Sarkar F. H. Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells Cancer Res. [score:4]
The miR-200 family targets the key regulators of EMT, such Zeb1 and Sip1 (also known as Zeb2), and as such leads to increased E-cadherin levels [36, 37]. [score:4]
Gregory P. A. Bert A. G. Paterson E. L. Barry S. C. Tsykin A. Farshid G. Vadas M. A. Khew-Goodall Y. Goodall G. J. The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1 Nat. [score:4]
Ali S. Ahmad A. Banerjee S. Padhye S. Dominiak K. Schaffert J. M. Wang Z. Philip P. A. Sarkar F. H. Gemcitabine sensitivity can be induced in pancreatic cancer cells through modulation of miR-200 and miR-21 expression by curcumin or its analogue CDF Cancer Res. [score:3]
In lung cells, forced miR-200 expression abrogated the cells’ invasive and metastatic abilities. [score:3]
Further, microRNAs that are associated with EMT, such as the miR-200 family, which are repressed by Zeb1 [49], also regulate stem cell behavior [49, 50]. [score:2]
MicroRNAs of the miR-200 family (miR-200a, b, c, miR-141 and miR-429) and miR-205 have been identified as key negative regulators of both EMT and the metastatic ability of cancer cells [36, 37]. [score:2]
Recently, it was shown that treating pancreatic cancer cells with the circumin analogue CDF restored miR-200 levels and sensitized the pancreatic cancer cells to gemcitabine treatment in vitro [64]. [score:1]
Burk U. Schubert J. Wellner U. Schmalhofer O. Vincan E. Spaderna S. Brabletz T. A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells EMBO Rep. [score:1]
[1 to 20 of 14 sentences]
59
[+] score: 53
Enforced expression of the miR-200 family members repressed epithelial-mesenchymal-transition (EMT) by targeting and down -regulating ZEB1 and ZEB2 directly, resulting in enhanced E-cadherin expression and inhibition of tumor cell migration and cancer cell motility in vitro and in vivo as demonstrated previously [89, 90] and reviewed in [34]. [score:11]
Korpal M. Lee E. S. Hu G. Kang Y. The mir-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of e-cadherin transcriptional repressors ZEB1 and ZEB2 J. Biol. [score:6]
“Resistive-miR”-141 (which showed the best correlation with insensitivity to PDT) and miR-200a reveal BACH1, KEAP1and NOX1 as targets, whose inhibition by this “resistive-miRs” could possibly impair PDT efficacy. [score:5]
Pichler M. Ress A. L. Winter E. Stiegelbauer V. Karbiener M. Schwarzenbacher D. Schei deler M. Ivan C. Jahn S. W. Kiesslich T. miR-200a regulates epithelial to mesenchymal transition-related gene expression and determines prognosis in colorectal cancer patients Br. [score:4]
Gregory P. A. Bert A. G. Paterson E. L. Barry S. C. Tsykin A. Farshid G. Vadas M. A. Khew-Goodall Y. Goodall G. J. The miR-200 family and mir-205 regulate epithelial to mesenchymal transition by targeting zeb1 and sip1 Nat. [score:4]
Saydam O. Shen Y. Wurdinger T. Senol O. Boke E. James M. F. Tannous B. A. Stemmer-Rachamimov A. O. Yi M. Stephens R. M. Downregulated microRNA-200a in meningiomas promotes tumor growth by reducing e-cadherin and activating the wnt/beta-catenin signaling pathway Mol. [score:4]
Eades G. Yang M. Yao Y. Zhang Y. Zhou Q. miR-200a regulates Nrf2 activation by targeting keap1 mRNA in breast cancer cells J. Biol. [score:4]
A PDT-resistive phenotype was characterized by high expression of miR-200 family members, miR-203 and (in case of miR-cluster 200a/b-429) expression of differentiation markers Ck19 and Ck8/18. [score:3]
Park S. M. Gaur A. B. Lengyel E. Peter M. E. The miR-200 family determines the epithelial phenotype of cancer cells by targeting the e-cadherin repressors zeb1 and zeb2 Genes Dev. [score:3]
Summarizing these studies, a negative impact on EMT and a close association with a less malignant phenotype, which is less vulnerable to oxidative stress, could explain the high expression of miR-200 family members associated with PDT insensitivity in our set of BTC cell lines. [score:3]
MiR-141 has no enrichment in PDT-relevant GO term categories, miR-200a in “apoptotic mitochondrial changes”, “positive regulation of MAP kinase activity”, “response to hypoxia” and “G1/S transition of mitotic cell cycle”, which could correspond to a PDT-opposing function of this miR. [score:2]
Wei J. Zhang Y. Luo Y. Wang Z. Bi S. Song D. Dai Y. Wang T. Qiu L. Wen L. Aldose reductase regulates miR-200a-3p/141–3p to coordinate keap1-nrf2, TGFβ1/2, and zeb1/2 signaling in renal mesangial cells and the renal cortex of diabetic mice Free Radic. [score:2]
Among the 12 “resistive-miRs”, all five members of miR-200 family (highly significant: miR-141 and miR-200c) and the two miR-135 family members showed significant correlation with PDT insensitivity. [score:1]
Mongroo P. S. Rustgi A. K. The role of the mir-200 family in epithelial-mesenchymal transition Cancer Biol. [score:1]
[1 to 20 of 14 sentences]
60
[+] score: 50
Also inhibits metastasisClape 2009 [67], Xu 2011 [4], Friedman 2009 [73] miR-145 Tumor suppressor Inhibits migration, invasion and metastasisFriedman 2009 [73] miR-200 s Tumor suppressor Inhibit cell migration and invasion by reversing EMTKong 2009 and 2010 [69, 70] miR-221 Onco-miRNA Stimulates cell growth and influences cell cycle progressionZheng 2011 [78], Galardi 2007 [77], Sun 2009 [76], Pang 2010 [23]. [score:11]
It was also proved that significant down-regulation of the miR-200 family in PC3 PDGF-D cells and in PC3 cells exposed to purified active PDGF-D protein, resulting in the up-regulation of ZEB1, ZEB2, and Snail2 expression (a transcription factor which belongs to the snail protein family and plays critical roles in the formation of tissues during embryonic development) [69]. [score:10]
It is well known that NF-κB plays an essential role in facilitating the processes of EMT induced by different factors through up-regulation of ZEB1 and ZEB2, which in turn suppress the expression of miR-200 family members by binding to the E-box sequence of the miR-200 promoter [69]. [score:8]
From these facts, we can conclude that PDGF-D-stimulated attainment of the EMT phenotype in PC3 cells is, partly, an outcome of suppression of miR-200 and that new strategies in which miR-200 would be up-regulated will become an auspicious approach for the treatment of invasive prostate cancer [69]. [score:6]
Whereas miR-200 can down-regulate the expression of ZEB1 and ZEB2 by interacting with the 3'-UTR of ZEB1 and ZEB2 mRNA [69]. [score:6]
All of these findings suggest a double -negative feedback loop between miR-200 and ZEB1/ZEB2 that permits the preservation of the EMT phenotype, even after withdrawal of the initial inducing signal, which might become a critical target for the reversal of EMT [63]. [score:3]
Studies from our laboratory have shown that the miR-200 family controls epithelial-mesenchymal transition (EMT) by targeting zinc-finger E-box binding homebox 1 (ZEB1) and ZEB2 [63, 69, 74]. [score:3]
The role of miRNA-200. [score:1]
In a breast cancer mo del, our studies have shown that in vivo manipulation of miR-200b leads to significantly reduced pulmonary metastases of breast cancer cells [74] which further supports the role of miR-200 family in metastases of human cancers. [score:1]
Because the miRNAs are part of the cellular signaling circuit that controls EMT [60], it has been suggested that many miRNAs families, including miR-200 family and miR-205, play important roles in controlling EMT [61- 63]. [score:1]
[1 to 20 of 10 sentences]
61
[+] score: 50
Subsequently, we compared the expression levels of 410 co-expressed miRNAs between XY and YY testis (Table S5), and found a similar expression level for 93% co-expressed miRNAs, such as 5 dominantly expressed miRNAs, miR-26a, miR-7g, miR-200a, miR-200b and miR-103. [score:10]
Expression of five miR-200 family members (200a-3p, 200b-3p, 200c-3p, 141-3p, 429b-3p) was significantly up-regulated at 12 h, and were gradually rising to a higher value at 96 h after EE2 treatment compared to the expression of control group (Figure 6). [score:7]
Identification of potential targeting gene and further functional studies are needed to examine the role of miR-200 family members and other differently expressed miRNAs between XY and YY testes. [score:5]
The increased expression of miR-200 family members in male testis were observed after estrogen treatment, indicating that miR-200 family might play a role in inhibiting spermatogenesis. [score:5]
Hence, the relative low expression of miR-200 family members in YY testis may imply that their important function during testis development and spermatogenesis in yellow catfish. [score:4]
It was noticeable that miR-200 family members including miR-200a/b/c and their star sequences, miR-141 and miR-429/429a/429b all have a male-biased expression. [score:3]
The expression of six miR-200 members (miR-200a, -b, -c and their star sequences) in XY testis and YY testis are all significantly higher than XX ovary. [score:3]
Intriguingly, we found that miR-200 family had a male-bias expression in yellow catfish. [score:3]
Expression of several miR-200 family members, such as miR-141 and miR-429 were lower in YY testis than in XY testis. [score:3]
Relative expression of miR-200 family members in testis after EE2 treatment. [score:3]
In order to investigate whether miRNAs play some roles in testis development, we checked the expression of miR-200 family members in testis treated with high dose of estrogen that would impair testis development and cell proliferation [33]. [score:3]
Most miR-200 family members in yellow catfish have more normalized reads in XY testis than YY testis. [score:1]
[1 to 20 of 12 sentences]
62
[+] score: 49
Reexpression of the miR-200 family significantly inhibited EMT that was induced by TGF-β, while inhibition of the miR-200 family resulted in the induction of EMT phenotype. [score:7]
The miR-200 family has been shown to induce epithelial phenotype by suppressing the expression of EMT inducers, ZEB1 and ZEB2 [42, 43]. [score:5]
Due to the relatively high degree of overlap in target genes between the two clusters, all members of the miR-200 family are good candidates for targeting common subsets of genes, such as those that are involved in breast cancer metastasis [34, 35]. [score:5]
Emerging studies indicate that the miRNA-200 family could regulate the EMT process by targeting specific molecular markers of EMT [12]. [score:4]
In a pioneering work by Gregory et al. [43], it was suggested that the entire miR-200 family is downregulated upon exposure to transforming growth factor-β (TGF-β). [score:4]
It was revealed that ZEB1 can bind to highly conserved sites in the promoter and directly suppress transcription of an entire cluster of the miR-200 family. [score:4]
Another study [46] that focused on miRNAs suppressed by ZEB1 also showed that the most affected miRNAs were members of the miR-200 family. [score:3]
The gene sequence between the two clusters only differs by a single nucleotide, which suggests that the members of miR-200 can potentially target a common subset of genes for similar physiological effects [32, 33]. [score:3]
The miR-200 family targets specific molecular markers of EMT, including E-cadherin, which is the marker for epithelial phenotype, vimentin, and ZEB1 and ZEB2, which are the markers of mesenchymal phenotype [3, 39]. [score:3]
A recent study on miR-200 revealed that three miRNA clusters, miR-200c-141, miR-200b-200a-429, and miR-183-96-182, are all involved in the regulation of self-renewal in cancer stem cells (CSCs) and normal stem cells [47]. [score:2]
This suggests that miR-205 activity is very similar to that of the miR-200 family, which is also associated with negative regulation of EMT. [score:2]
Furthermore, there were increased levels of ZEB1 and ZEB2 following the induction of EMT, which suggests that the miR-200 family is a negative regulator of the mesenchymal markers, ZEB1 and ZEB2. [score:2]
Thus, evidence from all these studies suggests that the miR-200 family plays a crucial role in regulation of breast cancer metastasis and aggressiveness. [score:2]
The miR-200 family is comprised of five members: miR-200a, miR-200b, miR-200c, miR-141 and miR-429. [score:1]
3.1. miRNA-200 Family. [score:1]
These members are then divided into two clusters based on chromosomal location, with cluster one consisting of miR-200b, miR-200a, and miR-429, located on chromosome 1 in humans, and cluster two consisting of miR-200c and miR-141, located on chromosome 12 in humans [3]. [score:1]
[1 to 20 of 16 sentences]
63
[+] score: 49
The qRT-PCR analysis indicated that 2 miRNAs (miR-21 and miR-133b) were deregulated in both EAC and GC, and 6 miRNAs (up-regulated: miR-194, miR-31, miR-192, and miR-200a; down-regulated: miR-203 and miR-205) in EAC, as compared to BE but not in GC, indicating their potential unique role in EAC. [score:7]
We showed the up-regulation of miR-194, miR-192, miR-21, miR-31, and miR-200a (Figure 2, Table 3) and the down-regulation of miR-133b, miR-203, and miR-205 in EAC as compared to BE (Figure 3, Table 3). [score:6]
Our validation confirmed the up-regulation of miR-194, miR-192, miR-21, and miR-200a, and the down-regulation of miR-203, miR-205, miR-133b, and miR-31 in EAC as compared to NS. [score:6]
While miR-194, miR-192, and miR-200a were significantly up-regulated in EAC, they also displayed an interesting pattern with disease progression. [score:6]
Interestingly, the overexpression levels of miR-194, miR-200a, and miR-192 were significantly higher in early EAC stages, suggesting that these miRNAs may be involved in EAC tumor development rather than progression. [score:4]
Of note, the overexpression levels of miR-194, miR-200a and miR-192 were significantly higher in EAC stage I than in advanced stages (P [ANOVA] ≤0.0009, P [II&III] ≤0.003, and P [I&III] ≤0.006), suggesting that these miRNAs may be involved in tumor development rather than tumor progression (Figure 7). [score:4]
Four miRNAs (miR-194, miR-192, miR-31, and miR-200a) were up-regulated in EAC but not in GC (Table 4, Figure 5). [score:4]
On the other hand, miR-133b, miR-200a, miR-205, and miR-203 did not display any significant differential expression between isolated BE and BE adjacent to HGD (Figure 8, Table 5). [score:3]
The log10 values of fold expression of the 8 miRNAs (miR-192, miR-200a, miR-194, miR-21, miR-203, miR-205, miR-31, and miR-133b) were used for hierarchical clustering. [score:3]
The expression of 4 miRNAs (miR-192, miR-194, miR-21, and miR-200a) was evaluated using qRT-PCR in 46 NS, 13 BE, 17 HGD, and 34 EAC tissues. [score:1]
0064463.g005 Figure 5The expression levels of the 6 miRNAs (miR-194, miR-192, miR-203, miR-205, miR-200a, and miR-31) were measured by means of qRT-PCR in 13 BE, 34 EAC, 45 NG, and 33 GC tissue samples. [score:1]
The expression levels of the 4 miRNAs (miR-203, miR-194, miR-192, and miR-200a) were evaluated in EAC tissue samples of stages I, II and III by means of qRT-PCR. [score:1]
0064463.g007 Figure 7 The expression levels of the 4 miRNAs (miR-203, miR-194, miR-192, and miR-200a) were evaluated in EAC tissue samples of stages I, II and III by means of qRT-PCR. [score:1]
miR-194, miR-192, miR-200a, miR-21, miR-203, miR-205, miR-133b, and miR-31 were selected for validation using 46 normal squamous (NS), 23 Barrett’s esophagus (BE), 17 Barrett’s high grade dysplasia (HGD), 34 EAC, 33 gastric adenocarcinoma (GC), and 45 normal gastric (NG) tissues. [score:1]
0064463.g002 Figure 2 The expression of 4 miRNAs (miR-192, miR-194, miR-21, and miR-200a) was evaluated using qRT-PCR in 46 NS, 13 BE, 17 HGD, and 34 EAC tissues. [score:1]
[1 to 20 of 15 sentences]
64
[+] score: 49
The miR-200 family directly targets the 3′ UTRs of Zeb1 and Zeb2 to inhibit their expression, and Zeb1 and Zeb2, on the other hand, bind the promoters of both miR-200 family clusters to reciprocally inhibit their transcription [49]. [score:10]
The miR-200 family is largely known as tumor suppressive because of its inhibition of the epithelial-mesenchymal transition (EMT) through direct targeting of Zeb1 and Zeb2 TFs [45], [46]. [score:8]
Among the 5 clusters that down-regulated -mediated luciferase expression is 200b∼429, one of two clusters that comprise the miR-200 family (Figure 5 and Table 1). [score:6]
Recently, however, new tumor-suppressor targets of the miR-200 family have been discovered, suggesting this miRNA family may have a pro-proliferative function [12], [51], [52]. [score:5]
Also striking was up-regulation of Myc -mediated transcription by the entire miR-200 family (Clusters 200c∼141 and 200b∼429). [score:4]
miR-200a directly targets the human p53 gene. [score:4]
The most thoroughly studied function of the miR-200 family is inhibition of EMT. [score:3]
In miRNA clusters comprised of closely related family members, for example both clusters of the miR-200 family or many members of C19MC, similar or same seed sequences provide a clear mechanism for multiple cluster members to target identical sets of genes [13]. [score:3]
Annotated as in Figure 2. Annotated as in Figure 2. The miR-200 family is comprised of two clusters. [score:1]
Bottom: constructs with the wild type binding site (WT) or a mutated miR-200 binding site (Mut) in the 3′ UTR. [score:1]
Annotated as in Figure 2. The miR-200 family is comprised of two clusters. [score:1]
Our data support an oncogenic role for this miR-200 family and we performed ensuing studies to examine the role of in the pathway (see below). [score:1]
miR-200a. [score:1]
Ann Surg Oncol 51 Teleman AA (2010) miR-200 de-FOGs insulin signaling. [score:1]
[1 to 20 of 14 sentences]
65
[+] score: 48
ZEB1 suppresses the expression of all miR-200 family members, which in turn inhibits the translation of ZEB1 mRNA, resulting in the double -negative ZEB1/miR-200 feedback loop [79]. [score:9]
The miR-200 family miRNAs downregulate ZEB1 and ZEB2 expression, and effectively upregulate the cellular E-cadherin level to maintain a cell in a more epithelial-like state. [score:9]
Although the number of studies that analyzed the miRNA expression and/or functions in colorectal CSCs is still limited, miRNAs, such as miR-200 family miRNAs, miR-203, miR-137, miR-34a and miR-221, function as the regulator of stem cell properties in colorectal CSCs by targeting various genes involved in the regulation of CSC properties (Figure 2A). [score:7]
miR-200 family miRNAs function as a stem cell regulator through negative regulation of two key biological properties: EMT and self renewal [9, 79, 82]. [score:3]
We previously identified miRNAs, such as miR-200 families and miR-142, can target key elements of the self-renewal and multi-lineage differentiation pathways in human breast CSCs and normal mammary stem/progenitor cells by analysis of the surgical specimens of human breast cancer patients [9, 10]. [score:3]
The miR-200 cluster is an extensively studied tumor-suppressive miRNA cluster in the genome and composed of five miRNAs (miR-200a, miR-200b, miR-200c, miR-141 and miR-429). [score:3]
A large number of studies demonstrated that strong suppressive effects of miR-200 family on cell transformation, cancer cell proliferation, migration, invasion, tumor growth and metastasis [81]. [score:3]
Brabletz S. Brabletz T. The zeb/mir-200 feedback loop—A motor of cellular plasticity in development and cancer?EMBO Rep. [score:2]
In addition, super-enhancers, a new class of regulatory regions that consist of multiple enhancer-like elements, enhance both transcription and Drosha/DGCR8 -mediated processing of primary miRNAs, including miR-200 family miRNAs [80]. [score:2]
Coordinated Regulation of miR-200 and miR-203 in Colorectal CSCs. [score:2]
The miR-200 family members are also divided into two subgroups based on their seed sequences that differ by only 1 nt between the subgroups: miR-200b, miR-200c, and miR-429 (AA UACUG) and miR-200a and miR-141 (AA CACUG). [score:1]
Recent paper reported that miR-221 and miR-200 family miRNAs play crucial opposing roles in inducing differentiation state in breast cancers [117]: miR-200 family miRNAs promote a well-differentiated epithelial phenotype, while miR-221/222 promote a poorly differentiated, mesenchymal-like phenotype. [score:1]
3.1.2. miR-200 Family miRNAs. [score:1]
Based on the chromosomal locations, the miR-200 family is divided into two clusters: the miR-200ab/429 cluster is located on chromosome 1p36, and the miR-200c/141 cluster is located on chromosome 12p13 [78]. [score:1]
Howe E. N. Cochrane D. R. Richer J. K. The mir-200 and mir-221/222 microRNA families: Opposing effects on epithelial identityJ. [score:1]
[1 to 20 of 15 sentences]
66
[+] score: 47
Korpal M Lee ES Hu G Kang Y The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2J Biol Chem. [score:6]
In fact, the miR-200 microRNAs have been established as master regulators of the EMT program in both physiological and pathological conditions 19, 21, 27, 31. miR-200b was recently shown to suppress invasiveness and to modulate the cytoskeletal and adhesive machinery by targeting Kindlin-2 in oesophageal squamous cell carcinoma cells [32]. [score:6]
Expression levels of N-Cadherin, Fibronectin and Vimentin were significantly downregulated (p < 0.05) in the tumours derived from the miR-200b-overexressing MDA-MB-231 (miR200) cells compared to the tumours from the control (Scram) counterparts (Fig.   6F–H, respectively). [score:5]
Overexpression of miR-200b slowed the growth of primary tumours; at the 5-week time point when all the primary tumours were removed, the average volume of the tumours derived from the miR-200 -overexpressing MDA-MB-231 cells (miR200b) was more than 3-fold less (p < 0.01) than those derived from the control (Scram) cells (Fig.   6A). [score:5]
Gregory PA The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1Nat Cell Biol. [score:4]
Park SM Gaur AB Lengyel E Peter ME The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2Genes Dev. [score:3]
Mutation of the seed sequence of miR-200b in the 3′-UTR of K2 (K2 3′UTR with scrambled miR-200 seed sequence) abrogated the effect of the exogenous miR-200b (Fig.   5H); the levels of luciferase activity did not show any significant difference when compared to the control cells or those treated with the non -targeting microRNA (Fig.   5H). [score:3]
These cells remained either untreated (Ctrl) or transfected with either a non -targeting micro -RNA (NT-miR) or the miR-200b mimics (miR200). [score:3]
qt-RT-PCR analyses of total RNA from the primary tumours showed that Kindlin-2 mRNA levels were significantly lower in the tumours derived from the miR-200b -expressing MDA-MB-231 (miR200) cells (Fig.   6E) compared to those derived from the control (Scram) counterparts. [score:2]
Sossey-Alaoui K Bialkowska K Plow EF The miR200 family of microRNAs regulates WAVE3 -dependent cancer cell invasionJ Biol Chem. [score:2]
We used the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA), as per the manufacturer’s instructions, to generate the K2 3′-UTR variants, where seed sequences that are recognized by miR200 microRNA were deleted. [score:2]
Burk U A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cellsEMBO Rep. [score:1]
Kindlin-2 was also reported to promote BC invasion through epigenetic silencing of members of the miR-200 gene family [33]. [score:1]
In contrast, transfection of the 231-wild-type K2-3′UTR cells with miR-200b mimics (miR200) resulted in ~60% reduction (p < 0.05) in luciferase activity (Fig.   5G). [score:1]
Spaderna S Brabletz T Opitz OG The miR-200 family: central player for gain and loss of the epithelial phenotypeGastroenterology. [score:1]
Korpal M Kang Y The emerging role of miR-200 family of microRNAs in epithelial-mesenchymal transition and cancer metastasisRNA Biol. [score:1]
The miR-200 family is no stranger to EMT. [score:1]
[1 to 20 of 17 sentences]
67
[+] score: 45
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86]Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86] Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
MiR-200a and miR-223 were detected in lethal influenza virus infection presumably contributing to the extreme virulence of the r1918 influenza virus [85]. [score:1]
[1 to 20 of 3 sentences]
68
[+] score: 43
Other miRNAs from this paper: hsa-mir-205, hsa-mir-200b, hsa-mir-141, hsa-mir-200c, hsa-mir-429
MCAS is the cancer cell line with the highest level of E-cadherin expression (Figure 4B), the marginal reduction in E-cadherin protein expression suggests that the regulation may be at the translational level, or other mechanisms such as predominant overexpression of miR200 and suppression of TGFβ signaling might be involved in spheroid formation in MCAS cancer cells (below). [score:12]
qRT-PCR has confirmed elevated expression of miR-200 family in the cancer 3D mo dels, which was also consistent with the elevated expression of E-cadherin and downregulation of TGFβ2 in the cancer cells (Figure 4). [score:8]
MiR200 family is known to downregulate both the TGFβ2 pathway and a homeobox transcription repressor, TCF8/ZEB1, a repressor of E-cadherin expression [25, 26]. [score:5]
A network route was mapped based on canonical pathways and expression data to show the suppression of transforming growth factor beta II (TGFβ2) pathway by microRNA200 (miR200) family (Figure 3B, block route). [score:5]
The qRT-PCR data also showed dichotomous expression patterns of the miR200 family members. [score:3]
As shown in Figure 4A, the levels of miR200a, miR200b, and miR429 showed very similar expression patterns. [score:3]
Figure 4 A. qRT-PCR results of miR200 family members in the monolayer (2D) and 3D cultures. [score:1]
Our network analysis of microarray data has shown that miR200 family controls the switch between E-cadherin and TGFβ signaling (Figure 3). [score:1]
Quantitative real-time PCR to validate the microarray data and evaluate the miR200 expression in monolayer and 3D cell cultures. [score:1]
The miR200a, miR200b, and miR429 are clustered in chromosome 1p36, and miR200c and miR141 are clustered in chromosome 12p13 [26]. [score:1]
We performed qRT-PCR to verify the microarray gene expression data and to evaluate the miR200 levels in the monolayer and 3D structures of different cell lines. [score:1]
A. qRT-PCR results of miR200 family members in the monolayer (2D) and 3D cultures. [score:1]
This might be related to their chromosomal localization in two separate miR200 clusters. [score:1]
[1 to 20 of 13 sentences]
69
[+] score: 43
We and others found that miR-200 regulates the epithelial-to-mesenchymal transition (EMT) by suppressing the expression of mesenchymal genes and inducing expression of epithelial genes [5- 8]. [score:8]
From our analysis of the miR-200 family of miRNAs and its biological activities we realized that the combination of differentially expressed genes (both up and downregulated genes) can be used to deduce the biological activities of miRNAs [4]. [score:6]
Two clusters (V and X) significantly correlated with the expression of E genes suggesting that in GBM miRNAs other than miR-200, miR-7, miR-203, or miR-375 regulate the epithelial nature of the cancer cells. [score:4]
One group of miRNAs, which was preferentially expressed in epithelial cells, contained all 5 members of the miR-200 family. [score:3]
In GBM, none of the miR-200 family members or novel EMT regulators were found to be deregulated. [score:3]
This group of mesenchymal miRNAs, in turn, antagonized miRNAs that have been shown to be expressed in epithelial tissues including all members of the miR-200 family (highlighted in red in Figure  1A, B and C). [score:3]
miRNAs in cluster I contained the 5 miRNAs of the miR-200 family known to be strong EMT regulators. [score:2]
In GBM, none of the miR-200 family members are deregulated in cancer and were not part of the analysis. [score:2]
In addition to the miR-200 family members, the EMT signature also contained miR-7, miR-203, and miR-375, which we previously identified and validated as novel EMT regulating miRNAs [4]. [score:2]
Finally, in KIRC all miR-200 family members were found to be part of cluster VII, which together with cluster VI miRNAs most significantly correlated with E genes. [score:1]
miRNAs: red, miR-200 family; blue, miR-17 family; orange, other EMT-related miRNAs recently identified [4] (miR-7, miR-203, and miR-375). [score:1]
In contrast to the NCI60 cell analysis in which all members of the miR-200 family correlated with epithelial (E) genes (highlighted in red in Figure  1A), the situation in the primary cancers was more complex. [score:1]
The genomic clusters and seed families of the miR-17, miR-221/222 and miR-200 families. [score:1]
There could be a variety of reasons why the miR-200 family clustered so tightly in the NCI60 analysis. [score:1]
miRNAs: blue, miR-17 family; dark green, miR-221/222 family; red, EMT-related miRNAs (miR-200 family); orange, other EMT-related miRNAs (miR-7, 203 or 375). [score:1]
In OvCa, the cluster most significantly correlating with the E genes was cluster V. While this cluster contained the epithelial miRNA miR-375, all 5 members of the miR-200 family were part of cluster VI, which did not correlate with the E genes as significantly as cluster V miRNAs. [score:1]
Exact functional opposites were found in the miRNA group that contained the miR-200 families plus miR-7, miR-203, and miR-375 (Figure  1C). [score:1]
Although all 5 miR-200 family members, coded by two different gene clusters, were tightly clustered in the NCI60 cell lines, the situation was much different in the three primary cancers (Figure  2). [score:1]
However, in KIRC all 5 miR-200 family members were found to be part of a highly epithelial miRNA cluster, but within this large group they clustered according to their chromosomal localization. [score:1]
[1 to 20 of 19 sentences]
70
[+] score: 42
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-32, mmu-mir-1a-1, mmu-mir-133a-1, mmu-mir-134, mmu-mir-135a-1, mmu-mir-144, mmu-mir-181a-2, mmu-mir-24-1, mmu-mir-200b, mmu-mir-206, hsa-mir-208a, mmu-mir-122, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, hsa-mir-214, hsa-mir-200b, mmu-mir-299a, mmu-mir-302a, hsa-mir-1-2, hsa-mir-122, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-144, hsa-mir-134, hsa-mir-206, mmu-mir-200a, mmu-mir-208a, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-24-2, mmu-mir-328, hsa-mir-200c, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-214, mmu-mir-135a-2, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-302a, hsa-mir-299, hsa-mir-361, mmu-mir-361, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-367, hsa-mir-377, mmu-mir-377, hsa-mir-328, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, hsa-mir-20b, hsa-mir-429, mmu-mir-429, hsa-mir-483, hsa-mir-486-1, hsa-mir-181d, mmu-mir-483, mmu-mir-486a, mmu-mir-367, mmu-mir-20b, hsa-mir-568, hsa-mir-656, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, mmu-mir-744, mmu-mir-181d, mmu-mir-568, hsa-mir-892a, hsa-mir-892b, mmu-mir-208b, hsa-mir-744, hsa-mir-208b, mmu-mir-1b, hsa-mir-302e, hsa-mir-302f, hsa-mir-1307, eca-mir-208a, eca-mir-208b, eca-mir-200a, eca-mir-200b, eca-mir-302a, eca-mir-302b, eca-mir-302c, eca-mir-302d, eca-mir-367, eca-mir-429, eca-mir-328, eca-mir-214, eca-mir-200c, eca-mir-24-1, eca-mir-1-1, eca-mir-122, eca-mir-133a, eca-mir-144, eca-mir-25, eca-mir-135a, eca-mir-568, eca-mir-133b, eca-mir-206-2, eca-mir-1-2, eca-let-7f, eca-mir-24-2, eca-mir-134, eca-mir-299, eca-mir-377, eca-mir-656, eca-mir-181a, eca-mir-181b, eca-mir-32, eca-mir-486, eca-mir-181a-2, eca-mir-20b, eca-mir-361, mmu-mir-486b, mmu-mir-299b, hsa-mir-892c, hsa-mir-486-2, eca-mir-9021, eca-mir-1307, eca-mir-744, eca-mir-483, eca-mir-1379, eca-mir-7177b, eca-mir-8908j
Normalized expression levels of the most up- (a) and down-regulated (b) miRNA in Pony compared to Warmblood serum as well as eca-miR-200a (c) that is downregulated by HMGA2 We next selected a total of 177 target-genes of eca-miR-122 using TargetScan [28] and performed gene set enrichment analysis with GeneCodis [29] to assess their biological role. [score:12]
Normalized expression levels of the most up- (a) and down-regulated (b) miRNA in Pony compared to Warmblood serum as well as eca-miR-200a (c) that is downregulated by HMGA2 We next selected a total of 177 target-genes of eca-miR-122 using TargetScan [28] and performed gene set enrichment analysis with GeneCodis [29] to assess their biological role. [score:12]
For instance, we showed an increased expression of circulating serum miR-122 and miR-200 in ponies together with the predicted miRNA target genes that are required in the control of energy metabolism. [score:5]
Therefore, we can speculate that impaired HMGA2 has decreased capability to inhibit the miR-200 expression in ponies. [score:5]
A total of 50 miRNAs in serum proved to be potential biomarkers to differentiate specific breed types, of which miR-122, miR-200, miR-483 were over-expressed and miR-328 was under-expressed in ponies compared to Warmbloods. [score:4]
Both miR-200a and miR-200b were significantly upregulated in pony serum in our study with log2FC >3.5 (Fig.   7c, Additional file 3: Table S2). [score:4]
[1 to 20 of 6 sentences]
71
[+] score: 42
Of note, miR-200a targeted the largest pool of mRNAs from GoI-μG; in coherence, we also observed several of p38α encoding transcripts (MAPK1, MAPRE2 and MAPK14) inhibited in S-4 h. We observed a negative correlation between miR-146b-5p expression and the gravitational shift (expression shifted from modestly down-regulated to up-regulated as terrestrial gravity shifted to μG). [score:15]
Of note, miR-200a targeted the largest pool of mRNAs from GoI-μG; in coherence, we also observed several of p38α encoding transcripts (MAPK1, MAPRE2 and MAPK14) inhibited in S-4 h. We observed a negative correlation between miR-146b-5p expression and the gravitational shift (expression shifted from modestly down-regulated to up-regulated as terrestrial gravity shifted to μG). [score:15]
miR-200a (fold change: G 4 h: −0.03; S-4 h: 1.13; r = − 0.67; p =0.09) regulated the highest number of transcripts (119), which was 30% of all the mRNAs collectively targeted by 15 miRNA. [score:4]
Differential expression of miR-200a and miR-146b suggested the susceptibility of hosts in spaceflight to oxidative stress and further underscored the influence of microgravity on the immunity. [score:3]
The microRNAs of the miR-200 family are classified as the redox regulators [49], and increased miR-200a and ensuing p38α depletion were reported as the consequences of oxidative stress [50]. [score:2]
MicroRNA candidates such as miR-200a and miR-146b are typically associated with oxidative stress and immune regulation, respectively, and were found altered by the LPS assault in spaceflight. [score:2]
In consideration of μG as a potential stimulant of oxidative stress primarily induced by depletion of the energy [51], miR-200a could be a putative signature of the host response to LPS assault mediated by μG. [score:1]
[1 to 20 of 7 sentences]
72
[+] score: 42
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200c, hsa-mir-429
A transient upregulation was detectable after 6 h, but was no longer observed after 24 or 72 h. Moreover, miRNAs of the miR200 family have not been analyzed in human tubular cells and therefore, we chose three members of the miR200 family to assess their abundance, namely 200b, 200c and 141. miR200b showed the highest miRNA expression with a comparable expression in hPTECs and HKC-8 cells (Fig. 4C). [score:8]
A transient upregulation was detectable after 6 h, but was no longer observed after 24 or 72 h. Moreover, miRNAs of the miR200 family have not been analyzed in human tubular cells and therefore, we chose three members of the miR200 family to assess their abundance, namely 200b, 200c and 141. miR200b showed the highest miRNA expression with a comparable expression in hPTECs and HKC-8 cells (Fig. 4C). [score:8]
Our data are thus in line with the hypothesis that high levels of miRNAs of the miR200 family and the missing regulation by TGF-β contribute to the stability of E-cadherin expression in distal tubular cells. [score:4]
Analysis of transcription factors and miRNAs possibly involved in E-cadherin regulation revealed high levels of miRNAs of the miR200 -family, which may contribute to the stability of E-cadherin expression in human distal tubular epithelial cells. [score:4]
We identify differences between primary cells and cell lines in expression and regulation of miRNAs of the miR200 family providing a molecular explanation for the stability of E-cadherin. [score:4]
Prolonged autocrine signaling of TGF-β was necessary to drive sustained ZEB upregulation and miR200 silencing for maintenance of the mesenchymal state. [score:4]
Analysis of molecular mechanisms showed a role for Rho-kinases in hPTECs plasticity, and stable expression of ZEB transcription factors and miRNAs of the miR200 family as potential mediators of E-cadherin stability in distal cells. [score:3]
Given the selective regulation of miR141, a role of further members of the miR200 family, e. g. miR200a or miR429 cannot be excluded. [score:2]
It has been suggested that the interplay between transcription factors ZEB1 and ZEB2 and miRNAs of the miR200 family plays an essential role in TGF-β -mediated regulation of E-cadherin [34]. [score:2]
Recently, several groups showed a mutual negative feedback loop between ZEB1/2 and miRNAs of the miR200 family regulating cellular plasticity in cancer cells but also in renal tubular cell lines [34]. [score:2]
miScript primer assays (Qiagen, Hilden, Germany) were used to detect miRNA expression following the manufacturer’s instructions Hs_miR-200c_1, Hs_miR-200b_3, Hs_miR-141_1 were used to detect members of the miR200 family and. [score:1]
[1 to 20 of 11 sentences]
73
[+] score: 41
The most prominent targets of the miR-200 family are two E-box binding transcription factors, ZEB1 and ZEB2, keys regulators of a complex network of transcriptional repressors regulating E-cadherin expression and epithelial polarity. [score:7]
Conclusively, this systematic review and validation experiment demonstrated four up-regulated miRNAs (miR-200a, miR-200b, miR-200c and miR-141) and one down-regulated miRNA (miR-100) are promising important candidate biomarkers for EOC. [score:7]
Particularly, all of them (miR-200a, miR-200b, miR-200c, and miR-141), four up-regulated miRNAs of the five most consistently expressed miRNA among the eight profiling studies, belong to the miR-200 family. [score:6]
To validate the expression of the five most consistently reported miRNAs (miR-200a, miR-100, miR-141, miR-200b, and miR-200c), that may be the candidate biomarkers for EOC, the expression of these miRNAs between EOC and normal ovarian tissues were compared using qRT-PCR analysis. [score:4]
Figure 1 qRT-PCR analysis of miR-200a, miR-100, miR-141, miR-200b, and miR-200c expressions in the EOC and normal ovarian tissues. [score:3]
Additionally, high expression of miR-200a was identified to correlate with decreased progression-free survival and overall survival for EOC patients significantly, even as miR-200c [9, 16]. [score:3]
Furthermore, the increased expression of miR-200a might underlie genomic amplification. [score:3]
Consistent with this function, the miR-200 family was recently identified as a marker, as well as a powerful regulator of the epithelial-to-mesenchymal transition (EMT). [score:2]
Excitingly, among the 17 miRNAs, 5 promising differentially miRNAs (miR-200a, miR-100, miR-141, miR-200b, and miR-200c) were reported with the consistent direction in four or more studies. [score:2]
More importantly, 5 differentially miRNAs (miR-200a, miR-100, miR-141, miR-200b, and miR-200c) were reported with the consistent direction among four or more studies (Table  5). [score:2]
MiR-200a and miR-200b are located on chromosome 1, while miR-200c and miR-141 are on chromosome 12. [score:1]
MiR-200a and miR-100 were reported in 6 studies; MiR-141 and miR-99a were reported in 5 studies; MiR-200b and miR-200c were reported in 4 studies and 11 miRNAs (miR-143, miR-145, miR-214, miR-134, miR-154, miR-424, miR-29a, miR-21, miR-10b, miR-26a, and let-7d) were reported in 3 studies. [score:1]
[1 to 20 of 12 sentences]
74
[+] score: 39
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200c
Re -expression of miRNAs of the miR-200 family reduced expression of its target genes, including ZEB1, ZEB2, FN1 and class III β-tubulin (TUBB3), and inhibited ovarian cancer cell migration and invasion (Cochrane et al, 2009; Hu et al, 2009). [score:9]
Downregulation of the miR-200 family contributes to tumour metastasis (Park et al, 2008), and FN1 has been identified as a novel target of miR-200c (Howe et al, 2011). [score:6]
In our study, miR-200b and miR-200c were downregulated in six of the resistant variants, and inverse expression pattern was observed between the miR-200 family members and mesenchymal genes. [score:6]
MiR-200 maintains ‘epithelial-ness’ by directly targeting and suppressing ZEB1 and ZEB2. [score:5]
In particular, increasing evidence indicates an association between decreased expression of members of the miR-200 family, EMT, and increased TUBB3 expression and taxane resistance (Park et al, 2008; Cochrane et al, 2009; Hu et al, 2009). [score:5]
miR-200 family members miR-200b and miR-200c were downregulated in resistant cells, associated with epithelial to mesenchymal transition (EMT), with increased VIM, FN1, MMP2 and/or MMP9. [score:4]
The miR-200 family is a marker for epithelial cells and a regulator of EMT (Park et al, 2008; Cochrane et al, 2009). [score:2]
These alterations are linked to some extent at the regulatory level, that is, via the miR-200 family, but may also reflect independent selection events during prolonged drug selections. [score:2]
[1 to 20 of 8 sentences]
75
[+] score: 38
With an exceedingly stringent Sidak correction, only 4 differentially regulated miRs were identified; miR-200a, 345, 376c, and 888. miR345 is a methylation-sensitive miR (down-regulated) which is involved in cell proliferation and invasion in colorectal cancer [47], while miR-376c (here up-regulated) enhances ovarian cancer cell survival and has been implicated in chemoresistance [48]. [score:8]
Global gene expression studies showed down-regulation of numerous epithelial markers (CDH1 and CLDNs) and major decreases in the miR200 family, known regulators of the EMT. [score:7]
Recently, Lliopoulos et al. showed a decrease in the ratio of Akt1 versus Akt2 in cells induced the down-regulation of miR-200, and promoted the EMT and a CSC-like phenotype [33]. [score:4]
Considering all analyses, the miR-200 family members (miR-429, 200a(a*), 200b(b*), 200c(c*), and miR-141) were consistently identified as differentially regulated in response to altered HtrA1 expression (Table 2). [score:4]
The central finding from our miR analyses was that the entire miR-200 family was down-regulated in our analyses of MCF10A/siRNA cell lines (Table 2). [score:4]
The miR-200 family members showed highly significant decreases in expression with ranged from ∼40% to more than 90%. [score:3]
Effects of Altered HtrA1 Expression Levels on the miR-200 Cluster. [score:3]
PLoS One 13 e8697 67 Davalos V Moutinho C Villanueva A Boque R Silva P 2011 Dynamic epigenetic regulation of the microRNA-200 family mediates epithelial and mesenchymal transitions in human tumorigenesis. [score:2]
Cluster 1 contained miR-200a, 429, 200b, and 200a*, while Cluster 6 contained 200c*. [score:1]
This initial screening identified a small group of miRs, most of which were members of the miR-200 family. [score:1]
Importantly, the miR-200 transcriptional cluster has recently been found to be epigenetically controlled by methylation of the miR-200 promoter [65], [66], [67], so this may represent a mechanism underlying our results. [score:1]
[1 to 20 of 11 sentences]
76
[+] score: 38
The miR-200 gene family (miR-200a, miR-200b, miR-200c, miR-141, and miR-429) and miR-205 encode key regulators of EMT that act by directly targeting zinc finger E-box binding homeobox 1 (ZEB1) and ZEB2, which are transcriptional repressors that downregulate E-cadherin (CDH1; Gregory et al., 2008; Korpal et al., 2008; Park et al., 2008). [score:8]
The miR-200 family inhibits epithelial–mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2. [score:6]
The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. [score:4]
In normal mammary epithelial cells and fibroblasts, expression of miR-200 family and miR-205 genes is regulated by DNA methylation, histone modifications, or a combination of the two (Vrba et al., 2010), but aberrant DNA methylation leads to the silencing of these miRNAs in cancer (Ceppi et al., 2010; Neves et al., 2010; Wiklund et al., 2011). [score:4]
Loss of miR-200 inhibition of Suz12 leads to polycomb -mediated repression required for the formation and maintenance of cancer stem cells. [score:3]
In addition, miR-200a and miR-200b are overexpressed in pancreatic cancer due to their hypomethylation, and their elevation in the serum of pancreatic cancer patients means they could potentially serve as diagnostic biomarkers (Li et al., 2010). [score:3]
The miR-200 family determines the epithelial phenotype of cancer cells by targeting the E-cadherin repressors ZEB1 and ZEB2. [score:3]
Pancreatic cancers epigenetically silence SIP1 and hypomethylate and overexpress miR-200a/200b in association with elevated circulating miR-200a and miR-200b levels. [score:3]
Dynamic epigenetic regulation of the microRNA-200 family mediates epithelial and mesenchymal transitions in human tumorigenesis. [score:2]
Coordinated epigenetic repression of the miR-200 family and miR-205 in invasive bladder cancer. [score:1]
Within the human genome, miR-200 family genes are grouped into two polycistronic units, miR-200b/200a/429 and miR-200c/141, located on chromosomes 1 and 12, respectively (Davalos et al., 2012). [score:1]
[1 to 20 of 11 sentences]
77
[+] score: 38
Other miRNAs from this paper: hsa-mir-34a, hsa-mir-200b, hsa-mir-200c
As we noted earlier, the Raschella group initially reported that MYB expression was upregulated in ER -positive human breast cancer cell lines after TGF-β treatment because of transcriptional activation, release of miR-200 family suppression, and protein stabilization, and was instrumental in promoting EMT effects [67]. [score:8]
In further contrast to our results, it has been shown that TGF-β -induced EMT of ER -positive breast cancer cells is dependent on MYB upregulation, in which putative miR-200 family binding sites were identified in the MYB mRNA, and the downregulation of these miRs was pinpointed as the mechanism driving this EMT [67]. [score:7]
We have observed a significantly higher level of expression of miR-200 family in LA cells compared with ET (unpublished observation), but increased MYB expression in the LA cells that overexpress all miR-200 family members. [score:6]
Since our manuscript was submitted, the Raschella group published a follow-up article [79] showing that MYB also activates the expression of the miR-200 family, which blocks ZEB1 expression. [score:5]
The authors also support our proposal of contextual issues surrounding MYB regulation of EMT processes in response to signals such as TGF-β, because in the combined presence of MYB and ZEB1, the ZEB1 suppression of miR200 is dominant. [score:4]
MYB seems poised for only transient expression in the epithelial setting because of the MYB-miR-200 feedback loop. [score:3]
Conversely, miR-200 family members, which target ZEB mRNA for degradation [4], have been shown to have a pro-proliferative role [25, 26], thus promoting the growth of breast cancer cell metastases [27]. [score:3]
Thus, similar to the ZEB1-miR200 reciprocal regulatory relation [4], our data suggest a mutually antagonistic negative-feedback loop between ZEB1 and MYB. [score:2]
[1 to 20 of 8 sentences]
78
[+] score: 37
Other miRNAs from this paper: hsa-mir-200b, hsa-mir-141, hsa-mir-200c, hsa-mir-429
Table S1 Real-Time PCR results of the mRNA expression analysis of eleven different genes and the expression analysis of members of the miR-200 family. [score:5]
On the other hand, the mesenchymal marker zinc finger E-box binding homeobox 1 (ZEB1) was detectable and vimentin (VIM) showed a high expression, while members of the miR-200 family showed a relatively low expression. [score:5]
Here, all five members of the miR-200 family showed only a minor increase in expression and had, in general, higher expression levels (Figure 1). [score:5]
The miR-200 family showed an expression profile for each cell line with similarities between UROtsa-4, HUEPC, and RT4 while in UROtsa-3, HeLa, and T24 the miRNAs were barely detectable (Figure 3). [score:3]
Figure S2 Time course of miRNA expression (miR-200 family) in UROtsa-3/T24 cells. [score:3]
Time course of miRNA expression (miR-200 family) during long-term culturing of authentic UROtsa-4 cells. [score:3]
The miR-200 family, comprising miR-200a, miR-200b, miR-200c, and miR-429, showed similar expression profiles of its individual members (miR-141 was not detectable). [score:3]
Quantification of the miR-200 family was performed because in urothelial tissues ZEB1 is regulated by miRNAs of this family [35], [42], [43]. [score:2]
Individual TaqMan miRNA Assays (Applied Biosystems) were used to analyze the expression of the following miRNAs: miR-141 (000463), miR-200a (000502), miR-200b (002251), miR-200c (000505), and miR-429 (001024) on a 7900 HT Fast Real-Time PCR System according to the manufacturer's instructions. [score:2]
0064139.g001 Figure 1 Normalized levels of miR-141 (yellow), miR-200a (red), miR-200b (green), miR-200c (blue), and miR-429 (orange) are shown as determined by Real-Time PCR. [score:1]
Normalized levels of miR-141 (yellow), miR-200a (red), miR-200b (green), miR-200c (blue), and miR-429 (orange) are shown as determined by Real-Time PCR. [score:1]
Normalized levels of miR-141 (yellow), miR-200a (red), miR-200b (green), miR-200c (blue), and miR-429 (orange) were determined in HeLa, T24, UROtsa-3/T24, UROtsa-4, primary urothelial cells (HUEPC), and RT4. [score:1]
0064139.g003 Figure 3Normalized levels of miR-141 (yellow), miR-200a (red), miR-200b (green), miR-200c (blue), and miR-429 (orange) were determined in HeLa, T24, UROtsa-3/T24, UROtsa-4, primary urothelial cells (HUEPC), and RT4. [score:1]
Indeed, ZEB1 and the miR-200 family were inversely correlated during the UROtsa-3 long-term experiment. [score:1]
The normalized levels of miR-200a (red), miR-200b (green), miR-200c (blue), and miR-429 (orange) are shown as determined by Real-Time PCR. [score:1]
[1 to 20 of 15 sentences]
79
[+] score: 37
miR-200 family members, including the downregulated miR-200a, are predicted to target genes that regulate synaptic function, neurodevelopment and neuronal survival [50]. [score:8]
Main miR-200 family target genes in the uterus, Stat5b, Zeb1 and Zeb2, were downregulated by multigenerational stress in the F1 generation. [score:6]
Furthermore, ZEB1 serves as transcription factor to inhibit the miR-200 family, thus enhancing Stat5b expression [19]. [score:5]
The qRT-PCR confirmed changes of the selected miRNAs (Figure  4B), decreased expression of miR-96, miR-141, miR-182, miR-183, miR-200a, miR-200b, miR-429 and miR-451 in F2-SSS compared to F0-S animals, whereas miR-23b and miR-200c showed increased expression levels. [score:4]
Including the downregulated miR-200b, the miR-200 family may exert peripheral effects to control uterine quiescence and contractility during pregnancy and labour [18]. [score:4]
Furthermore, stress altered miRNA expression patterns in the brain and uterus of F2 mothers, including the miR-200 family, which regulates pathways related to brain plasticity and parturition, respectively. [score:4]
Target genes of the miR-200 family include three particular genes, Stat5b, Zeb1 and Zeb2, all involved in pregnancy maintenance [18]. [score:3]
In order to validate miRNAs, we performed quantitative real time PCR (qRT-PCR) analysis of these differentially regulated miRNAs (n = 3 per group for F0, F1 and F2 generations, three replicates per sample): miR-23b, miR-96, miR-141, miR-181a, miR-182, miR-183, miR-200a, miR-200b, miR-200c, miR429 and miR-451. [score:2]
Ancestral programming by stress particularly involved the miR-200 family. [score:1]
[1 to 20 of 9 sentences]
80
[+] score: 37
These studies reveal in primary breast tumours that miR-200 levels are low, which would lead to increased ZEB1/ 2 expression and E-cadherin down-regulation [142] and are associated with EMT initiation and subsequent invasion into the blood stream. [score:6]
Korpal M. Lee E. S. Hu G. Kang Y. The miR-200 family inhibits epithelial-mesenchymal transition and cancer cell migration by direct targeting of E-cadherin transcriptional repressors ZEB1 and ZEB2 J. Biol. [score:6]
In TNBC the miR-200 family has also been shown to sensitise cell lines to cell death and to inhibit metastatic growth through inhibition of protein kinase (PKCα) [95, 143]. [score:5]
Basal like breast tumours have lower levels of the miR-200 family than luminal or HER2 over -expressing subtypes [138], this also causes higher levels of their target genes (SNAI1/ 2, and ZEB2). [score:5]
Of the miR-200 family, miR-200c shows the strongest association with the histopathology and disease course, this miRNA is also almost non-existent in TNBC [65, 139]. [score:3]
As an example, the miR-200 family targets ZEB1/ ZEB2, Suz 12, EphA2, MSN, FN1, TrkB, XIAP, all of which are important for cell proliferation, invasion, and migration [66, 67, 68, 69]. [score:3]
Other members of the miRNA-200 family, miR-221/222 have the opposite effect compared to miR-200c, where low miR-221/222 expression improves the differentiation status [135]. [score:2]
Gregory P. A. Bracken C. P. Smith E. Bert A. G. Wright J. A. Roslan S. Morris M. Wyatt L. Farshid G. Lim Y. Y. An autocrine TGF-β/ZEB/miR-200 signaling network regulates establishment and maintenance of epithelial-mesenchymal transition Mol. [score:2]
Various studies have also shown that the miR-200 family has dual functions in breast cancer progression [140, 141]. [score:1]
Howe E. N. Cochrane D. R. Richer J. K. The miR-200 and miR-221/222 microRNA families: Opposing effects on epithelial identity J. Mammary Gland Biol. [score:1]
Burk U. Schubert J. Wellner U. Schmalhofer O. Vincan E. Spaderna S. Brabletz T. A reciprocal repression between ZEB1 and members of the miR-200 family promotes EMT and invasion in cancer cells EMBO Rep. [score:1]
In particular, the miR-200 family has roles in proliferation, migration and invasion [130, 132, 135, 136] and has been well-studied in breast cancer research. [score:1]
At the secondary site, miR-200 levels rise and initiate mesenchymal-epithelial transition (MET) culminating in metastatic colonisation. [score:1]
[1 to 20 of 13 sentences]
81
[+] score: 36
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, hsa-mir-200b, hsa-mir-200c
In rat INS-1 cells and mouse islets, miR-200 has been found to inhibit EMT by direct targeting of Zeb1 transcripts, thereby increasing E-cadherin expression 39. miR-200c levels increased more than 3-fold following ZEB1 inhibition. [score:10]
miR-200c was found to be significantly upregulated 3.3-fold following ZEB1 inhibition (Fig. 6A), while miR-200a and miR-200b were not significantly affected (see Supplementary Fig. S4 online). [score:6]
miR-200 family