sort by

512 publications mentioning hsa-mir-29c (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-29c. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 543
1005238.g007 Fig 7 (A&B) Knockdown of miR-29 in IMR-90 cells or PASMCs leads to upregulation of KLF4 expression (n = 3); increased miR-29 levels by mimic in PASMCs suppress the expression of KLF4 (n = 3); (C) miR-29 suppresses 3’UTR luciferase reporter of KLF4 which depends on an intact miR-29 binding site (n = 3); (D) Knockdown of KLF4 in PASMCs, in which miR-29 is also knocked down, restore the expression of CNN1 and α-SMA (n = 3). [score:17]
In general, miRNAs are negative regulators of their targets, therefore, we hypothesized that miR-29 indirectly upregulates the expression of SMC-related genes by targeting a negative regulator of SMC differentiation. [score:13]
Since there is no predicted miR-29 binding site in the 3’UTR of FBXO32 mRNA, it is likely that miR-29 indirectly suppresses the expression of FBXO32 by targeting Foxo3a, which is also upregulated in miR-29 knockdown cells. [score:12]
While expression of miR-29 is suppressed by treatment of PDGFB, miR-29 is known to directly target the expression of components of the PDGF pathway, such as PDGFRB [29 – 31 ]. [score:10]
Future implications are to study the expression and function of miR-29 in human pulmonary vascular diseases, which might lead to establishing miR-29 as a therapeutic target for disease intervention. [score:9]
This reduced expression of α-SMA is associated with upregulation of COL1A1(red), a known direct target of miR-29. [score:9]
Most recently, it has been shown in a vascular injury mo del that upregulation of miR-29 suppresses the expression of PDGFRB in modulating SMC phenotype [32 ]. [score:8]
Interestingly, knockdown of miR-29 leads to significant upregulation of all PDGF ligands and receptors (15%-30% upregulation, p<0.05), except for PDGFB (Fig 9A). [score:8]
Interestingly, KLF4 is a predicted target of miR-29 (TargetScan) and the binding site of miR-29 within 3’UTR of KLF4 is evolutionarily conserved among all species of vertebrates (total 22 species, TargetScan). [score:7]
Upregulation of miR-29 expression during postnatal lung development. [score:7]
Indeed, in miR-29 knockdown IMR-90 cells, expression of all components of the PDGF pathway, except for PDGFB, is significantly upregulated (Fig 9A). [score:7]
We then investigated whether KLF4 is under the control of miR-29 in PASMCs, and found that over -expression of miR-29 with its mimic resulted in a two fold reduction of KLF4 mRNA, while knockdown of miR-29 resulted in about a two fold upregulation of KLF4 expression in PASMCs (Fig 7B). [score:7]
As expected, knockdown of miR-29 alone results in more than a two fold upregulation of KLF4 and significantly reduced expression of α-SMA and CNN1 (Fig 7D). [score:7]
The postnatal growth retardation and lethality are coincident with the drastic upregulation of miR-29 expression in multiple organs during postnatal development. [score:7]
Disruption of miR-29 leads to upregulation of Klf4 expression in vSMCs in vivo. [score:6]
Disruption of miR-29 leads to upregulation of Klf4 expression in vSMCs in vivo We then investigated the expression of Klf4 in miR-29 null mouse lungs. [score:6]
Moreover, by targeting a large number of ECM-related genes, miR-29 plays a significant role in collagen vascular diseases that has been increasingly recognized as potential causes for the development of PAH. [score:6]
Our next inquiry was to determine how miR-29 up-regulates the expression of SMC-related genes. [score:6]
It has been showed that down-regulation of miR-29 is associated with dystrophic muscles[54, 60] and restoration of miR-29 expression improved dystrophy pathology[60]. [score:6]
miR-29 also directly suppresses the expression of ECM-related genes associated with synthetic phenotypes, such as collagen [22, 23, 68]. [score:6]
This upregulation of FBXO32 is not presented in SMCs of airway and large proximal vessels, consistent with the expression pattern of miR-29 (S4A and S4B Fig). [score:6]
Here we showed that KLF4 is directly targeted by miR-29 in vSMCs and our data indicates that Klf4 is a physiological target of miR-29 in vivo. [score:6]
As expected, and consistent with miR-29 expression pattern, we found that the prominent upregulation of COL1A1 is associated with distal vessel walls of miR-29 null lungs (Fig 4A–4D). [score:6]
We selected hsa-miR-29c-3p miRCURY LNA microRNA inhibitor (product#: 4105460–001, and sequence: CCGATTTCAAATGGTGCT) and miRCURY LNA microRNA inhibitor negative control (product#: 199007–001, sequence: AGAGCTCCCTTCAATCCAA) for knockdown assay based on our published data that hsa-miR-29c LNA antisense (50nM) can efficiently reduce the endogenous levels of all three miR-29 family members. [score:5]
Upregulation of components of PDGF pathway in both miR-29 knockdown cells and miR-29 null lungs. [score:5]
Together, these results suggest that it is highly relevant to examine the expression and function of miR-29 in vSMCs of pulmonary vascular diseases. [score:5]
The most drastic upregulation of miR-29 (S2 Table and S3 Fig, about 20–40 folds) happens during postnatal development, a period in which distal vSMCs gradually switch from synthetic to contractile phenotypes in human or animal lungs. [score:5]
One of the most upregulated genes in miR-29 knockdown human lung myofibroblast cells is FBXO32 (Atrogin-1), together with its activator FOXO3a (Fig 10A). [score:5]
Moreover, it has been shown in vitro that MYOCD induces the expression of miR-24 and miR-29 and promotes SMC differentiation by suppressing PDGFRB [32]. [score:5]
This analysis showed that upregulation of KLF4 by miR-29 knockdown is reversed by co-transfection of KLF4 siRNA, which leads to even lower KLF4 levels, as compared to cells of miR-29 knockdown alone. [score:5]
Upregulation of Foxo3a and Fbxo32 in both miR-29 knockdown cells and miR-29 null lungs. [score:5]
We found that knocking down levels of endogenous miR-29 resulted in about 25–50% reduction of both α-SMA and calponin1 (CNN1), while increased miR-29 levels resulted in about a two fold upregulation of α-SMA and CNN1 in PASMCs (Fig 6A). [score:5]
Previously we showed that levels of miR-29 are significantly upregulated during embryonic and postnatal lung development that was confirmed by Next Generation of Sequencing and qRT-PCR [23] (S2 Table and S3 Fig). [score:5]
First, we examined whether targets of miR-29 are derepressed in D KO lungs by staining COL1A1, a well-known target of miR-29 [22, 23]. [score:5]
Together, our study showed that miR-29 is a central player in promoting SMC differentiation by suppressing the expression of KLF4, PDGFRB and ECM-related synthetic genes. [score:5]
1005238.g004 Fig 4 (A&B) Increased COL1A1 IHC signal is prominently associated with vessel walls, where endogenous miR-29 expression is highly expressed. [score:5]
This analysis revealed that knockdown of endogenous miR-29 results in 20–35% reduction of about 15 smooth muscle- and actin cytoskeleton-related genes including well-known SMC markers (all p<0.05), such as CNN1, CNN3 (calponin3), ACTG2 (actin, gamma 2, smooth muscle, enteric), ACTA2 (α-SMA), SMTN (smoothelin), TAGLN, as well as MYOCD, a master regulator of SMC gene expression (Fig 6B and S1 Table). [score:5]
Together our ISH analysis revealed a vessel specific expression of miR-29 in vSMCs in both human and mouse lungs, suggesting a conserved expression pattern in vSMCs of distal vessels including those of distal pulmonary arteries. [score:5]
Disruption of miR-29 expression in vivo results in aberrant vSMC differentiationSince expression of miR-29 family members (miR-29a/b/c) transcribed from both loci are enriched in vSMCs (Fig 1F), we decided to investigate the role of miR-29 in vivo by generating mutant mice in which both loci were deleted (double knockout or miR-29 null mice). [score:4]
This confirmed that KLF4 is a direct target of miR-29. [score:4]
Together, our results identified that FBXO32 is a novel downstream gene of miR-29, suggesting miR-29 might regulate smooth muscle protein degradation by modulating the expression of Foxo3a/Fbxo32. [score:4]
However, little is known regarding the expression and function of miR-29 during development in vivo. [score:4]
Disruption of miR-29 leads to upregulation of components of the PDGF pathway. [score:4]
We then examined whether reduction of KLF4 by siRNA can rescue defects in the expression of contractile markers of miR-29 knockdown cells. [score:4]
In the course of our study, KLF4 proved to be the direct target of miR-29 in cancer cell lines [65, 66]. [score:4]
This is consistent with the decreased expression of MYOCD and a large number of SMC contractile markers in miR-29 knockdown cells and miR-29 null lungs (Fig 5 and Fig 6). [score:4]
Then, we examined whether reduction of KLF4 by siRNA can restore the expression of α-SMA and CNN1 in miR-29 knockdown PAMSCs. [score:4]
We then performed co-immunofluorescence staining of α-SMA with FBXO32, and found that levels of FBXO32 are drastically upregulated specifically in the distal vessel walls of miR-29 null lungs, negatively correlated with the reduced α-SMA staining (Fig 10C–10F). [score:4]
Suppression of KLF4 rescues the defective SMC phenotype of miR-29 knockdown cells. [score:4]
We found that miR-29 family members are abundantly, selectively and dynamically expressed during mouse and human lung development. [score:4]
Levels of Foxo3a and Fbxo32 are significantly upregulated in miR-29 deficient cells. [score:4]
This might be due to the upregulation of Foxo3/Fbxo32 in the skeletal muscle of miR-29 null mice, which requires careful examination. [score:4]
Moreover, disruption of miR-29 leads to significant upregulation of Foxo3a/Fbxo32, a pathway well known for skeletal muscle wasting, which might lead to excessive degradation of important smooth muscle cell proteins. [score:4]
Together, our results suggested that miR-29 suppresses the PDGF pathway in promoting vSMC differentiation during lung development in vivo. [score:4]
1005238.g006 Fig 6 (A) qRT-PCR results of α-SMA and CNN1 mRNAs in PASMCs in which the level of miR-29 is either elevated by miR-29 mimic or knocked down by miR-29 antisense LNA oligos (n = 3); (B) mRNA levels of contractile SMC markers in IMR-90 cells, in which miR-29 is knocked down (n = 3, Affymetrix array data); (C) Levels of α-SMA protein in IMR-90 cells, in which endogenous miR-29 is knocked down. [score:4]
Upregulation of KLF4 in miR-29 null lungs. [score:4]
While we were working on this project, it was reported that Foxo3a is a direct target of miR-29 during chondrogenic differentiation[41]. [score:4]
Moreover, our work also suggests a novel role of miR-29 in regulating the expression of Foxo3a/Fbxo32 in distal vSMCs. [score:4]
Instead, mRNA levels of both CNN1 and α-SMA in these cells are 30–70% higher than those of cells with miR-29 knockdown alone, negatively correlated with reduced KLF4 expression. [score:4]
We then investigated whether miR-29 directly target KLF4 to exert its effects on SMC gene expression. [score:4]
We found that the level of Pdgfrb is significantly upregulated in miR-29 null lungs (Fig 9B). [score:4]
# CN-001000-01) were transfected at 5nM for upregulation of miR-29 in cultured cells. [score:4]
By investigating the expression and function of miR-29 in vivo, we found a vessel selective enriched expression and function of miR-29 during mouse lung development. [score:4]
To ask whether the PDGF pathway is under the control of miR-29 in vSMCs, we first examined their expression in our array data of miR-29 knockdown IMR-90 cells. [score:4]
In distal lung vSMCs, miR-29 promotes the differentiation of vSMCs by targeting Klf4 and the PDGF pathway, two major negative regulators of vSMC maturation. [score:4]
KLF4 is a direct target of miR-29 in SMCs. [score:4]
Upregulation of COL1A1 in distal vasculature of miR-29 D KO lungs. [score:4]
We first performed qRT-PCR for Foxo3a and Fbxo32, and found that both of them are significantly upregulated in miR-29 null lungs, as compared to littermate controls (Fig 10B). [score:3]
To determine whether KLF4 is a direct target of miR-29, we conducted a 3’UTR luciferase assay. [score:3]
Together, these results for the first time showed that KLF4 is a physiological target of miR-29 in vivo, and increased KLF4 in distal vSMCs of miR-29 null lungs likely contribute to the immature vSMC phenotype. [score:3]
This suppression was abolished by mutating the miR-29 complementary binding site in KLF4 3’UTR(Fig 7C). [score:3]
To examine the expression pattern, we performed in situ hybridization (ISH) for miR-29 using DIG-labeled LNA probes. [score:3]
Luciferase reporter analysis revealed that the activity of reporter containing wild type 3’UTR of KLF4 was significantly suppressed (about 40% reduction) by miR-29, but not by miR-365 (Fig 7C). [score:3]
This strongly suggests that endogenous miR-29 promotes the expression of vSMC contractile markers. [score:3]
In this study, we found that miR-29 expression is selectively enriched in vSMCs of distal vessels of mouse lungs, a pattern that is also conserved in human lungs. [score:3]
miR-29 promotes the expression of contractile SMC markers. [score:3]
To further examine miR-29 expression in SMCs, we sorted and collected SMCs (α-SMA-EGFP transgenic mice) or type I epithelial cells (T1α-EGFP transgenic mice, gift from Dr. [score:3]
Expression of miR-29 in vasculature of mouse lungs. [score:3]
Expression of miR-29 in mouse lungs. [score:3]
1005238.g005 Fig 5Disruption of miR-29 expression in vivo leads to aberrant vSMC differentiation. [score:3]
In this study, we also showed that Pdgfrb is a physiological target of miR-29 in vivo (Fig 9B–9F). [score:3]
In this study, we found that the expression of contractile SMC markers is significantly attenuated in miR-29 null lungs, preferentially affecting vSMCs of distal pulmonary vasculature. [score:3]
A evolutionarily conserved miR-29 binding site is present in the 3’UTR of Foxo3a (Targetscan). [score:3]
We showed that miR-29 promotes vSMCs differentiation by targeting Klf4, the PDGF pathway and ECM-related synthetic markers. [score:3]
By co-staining with α-SMA, we found that miR-29 ISH signal co-localizes with α-SMA within vessel walls suggesting an enriched expression in vSMCs (Fig 1D). [score:3]
Interestingly, disruption of miR-29 results in defects in vSMCs differentiation of distal vessels, reminiscent of vSMC phenotype observed in the early stage of PAH in which immature/synthetic vSMCs of distal arteries failed to differentiate and were unable to tune down the expression of collagens and other extracellular-related genes. [score:3]
We found that the level of KLF4, a known negative regulator of SMC differentiation, is significantly increased (more than 40%, P<0.01) in miR-29 knockdown cells (Fig 7A). [score:3]
Together, results from these two cell lines suggest that expression of KLF4 is under the control of miR-29. [score:3]
Expression of miR-29 in human lung vasculature. [score:3]
This strongly suggests that derepression of KLF4 contributes to the negative regulation of SMC differentiation in miR-29 knockdown cells. [score:3]
Expression of miR-29 in mouse lungs is abundant, selective and dynamic. [score:3]
Our data suggested that miR-29 promotes SMC differentiation at least partially by suppressing KLF4 and components of the PDGF signaling pathway. [score:3]
Disruption of miR-29 expression in vivo results in aberrant vSMC differentiation. [score:3]
Disruption of miR-29 expression in vivo leads to aberrant vSMC differentiation. [score:3]
Together, these results suggested that miR-29 is part of the miRNA regulatory network in promoting SMC differentiation. [score:2]
This is the first evidence that miR-29 selectively regulates vSMCs differentiation and vessel wall formation. [score:2]
1005238.g010 Fig 10 (A) Affymetrix array data of Foxo3a and Fbxo32 in miR-29 knockdown cells (n = 3). [score:2]
Here, we report a vessel specific role of miR-29 in promoting the differentiation of vSMC during mouse lung development. [score:2]
Here, we report that miR-29 is required for postnatal growth and development. [score:2]
miR-29 also plays a critical role in regulating the PDGF pathway in multiple cell types [29, 32]. [score:2]
miR-29 regulates KLF4. [score:2]
Due to the nature of systemic knockout of miR-29 in animals examined in this study, and diverse functions of miR-29 in different cell types and organs, failure of multi-organs might contribute to the growth retardation and lethality. [score:2]
To do this, we repeated the experiment, in which miR-29 was knocked down alone in PASMCs. [score:2]
S3 Fig Levels of miR-29 a/b/c in RNA samples of mouse lungs at different stages of postnatal development (qRT-PCR, n = 3). [score:2]
We first turned to our array data of IMR-90 cells, in which endogenous miR-29 was knocked down. [score:2]
These findings suggest that miR-29 is specifically required for the proper differentiation of vSMCs of distal lung vasculature during development. [score:2]
The immature/synthetic vSMC phenotype of distal lung vessels of miR-29 null mice indicates a potential dysregulation of miR-29 in the pathogenesis of PAH. [score:2]
Since expression of miR-29 family members (miR-29a/b/c) transcribed from both loci are enriched in vSMCs (Fig 1F), we decided to investigate the role of miR-29 in vivo by generating mutant mice in which both loci were deleted (double knockout or miR-29 null mice). [score:2]
Unlike miR-29, there is little change in levels of miR-143/145 during embryonic and postnatal development (S2 Table). [score:2]
miR-29ab1 [+/-]; miR-29b2c [+/-] mice are viable and fertile, and were used to breed for generation of double knockout (miR-29 null) mice with mixed genetic background containing 129/SvJ and C57BL/6. [score:2]
1005238.g009 Fig 9 (A) Affymetrix array data of components of PDGF signaling pathway in miR-29 knockdown cells (n = 3). [score:2]
In addition, Western Blot analysis showed a more than 60% reduction in α-SMA protein in miR-29 knockdown cells (Fig 6C). [score:2]
Smooth muscle related genes reduced in miR-29 knockdown IMR-90 cells. [score:2]
Generation of miR-29 knockout mice. [score:2]
The strongest ISH signal of miR-29 in adult mouse lungs was detected in distal vascular structures (Fig 1B and 1C). [score:1]
In addition, we also found potent activity of miR-29 in promoting SMC differentiation in vitro. [score:1]
S5 Fig A) Hearts of miR-29 D KO and WT littermates at age four weeks were fixed overnight in 4% paraformaldehyde, paraffin-embedded, sectioned, and stained with H&E. [score:1]
In embryonic day 18.5 (E18.5) lungs, in which α-SMA positive cells are found in limited numbers of distal vessels with relatively thick walls, a typical morphological feature before extrauterine adaptation; high levels of miR-29 were also selectively detected in α-SMA positive cells of these vessel walls (Fig 1E). [score:1]
miR-29 null mice began to die around 4 weeks of age and none of them survived to the age of 6 weeks (Fig 3D). [score:1]
Interestingly, levels of miR-29 in the media layer of large arteries, such as the dorsal aorta, where vSMCs reside, are much lower (S1A and S1B Fig). [score:1]
We first manipulated miR-29 levels in PASMCs by transfecting with miR-29 mimic or LNA antisense oligos. [score:1]
Previously, we have carried out Affymeritx array profiling for downstream genes of miR-29 in human fetal lung fibroblast cells (IMR-90) [23]. [score:1]
hsa-miR-29c-3p mimic (Dharmacon, cat. [score:1]
#002497) and mmu-miR-29c (Cat. [score:1]
Examination of the lungs of miR-29 D KO mice at age four weeks revealed significant defect in differentiation of vSMCs. [score:1]
Interestingly, results from different cell types showed a potential reciprocal negative feedback loop of miR-29 and components of the PGDF pathway. [score:1]
Luciferase reporters were co -transfected with miR-29 mimic or miR-365 mimic, an unrelated miRNA as negative control. [score:1]
Postnatal growth retardation and lethality of miR-29 null mice. [score:1]
miR-29 D KO mice develop smaller hearts. [score:1]
#11995) and co -transfected with 10ng of luciferase reporter plasmid together with either 5nM of hsa-miR-29c-3p mimic (Dharmacon, Cat. [score:1]
Due to the difficulty in isolation and culture of mouse lung SMCs, and also based on the selectively enriched expression of miR-29 in vSMCs of human lungs, we decided to investigate the role of miR-29 in human pulmonary arterial smooth muscle cells (PASMCs). [score:1]
We then investigated the expression of Klf4 in miR-29 null mouse lungs. [score:1]
After pre-hybridization (50% formamide, 10mM Tris-HCl pH8.0, 600mM NaCl, 1X Denhardt’s solution, 200μg/mL tRNA, 1mM EDTA, 0.25% SDS, 10% dextran sulfate) at RT for 2 hrs, hybridization was carried out at 50°C overnight in the same hybridization buffer containing 25nM of miR-29c (TAGCACCATTTGAAATCGGTTA) or miR-29a (TAGCACCATCTGAAATCGGTTA) and miR-29b (TAGCACCATTTGAAATCAGTGTT) DIG-labeled LNA probes. [score:1]
1005238.g002 Fig 2 (A, B&C) High miR-29c ISH signal (purple) co-localizes with α-SMA IF staining signal (red) of small vessels (black arrow), while the level of miR-29c in vSMCs (media layer) of nearby large pulmonary arteries (highlighted area by dashed lines) is much lower. [score:1]
This analysis revealed much higher PDGFRB staining in distal vessel walls of miR-29 null lungs, negatively correlated with reduced signal of α-SMA staining (Fig 9C–9F). [score:1]
All miR-29 null mice die within 6 weeks of birth, while none of wild type littermates died in the same period. [score:1]
S4 Fig (A&B) Double IF staining of FBXO32 (red) and α-SMA (green) in WT control and miR-29 D KO lungs. [score:1]
However, we observed a significant postnatal growth retardation, and miR-29 D KO are consistently smaller with about 25%, 40% and 50% reduction of body weight at ages of two, three and four weeks, respectively (Fig 3B and 3C). [score:1]
Since both miR-29 loci were systemically deleted in D KO mice, the observed vSMC phenotype may results of secondary or accumulated causes. [score:1]
Endogenous miR-29 is required for proper SMC differentiation in vitro Since both miR-29 loci were systemically deleted in D KO mice, the observed vSMC phenotype may results of secondary or accumulated causes. [score:1]
Most of these miR-29 null mice develop a hunchback, indicating weakness of the skeletal muscles. [score:1]
Endogenous miR-29 is required for proper SMC differentiation in vitro. [score:1]
Human fetal lung fibroblasts (IMR-90) and human pulmonary arterial smooth muscle cells (PASMCs) were cultured and transfected with miR-29 mimics, miR-29 LNA antisense or KLF4 siRNA as described [23, 73]. [score:1]
However, by examining the weight of hearts of miR-29 null and wild type littermates, there is no significant sign of heart failure. [score:1]
In distal small arteries, miR-29 specifically co-localizes with α-SMA staining (Fig 2D, 2E and 2F). [score:1]
To examine the levels of PDGFRB in distal vessel wall of miR-29 null lungs, we performed co-immunofluorescence staining of α-SMA and PDGFRB. [score:1]
By double immunofluorescence staining of KLF4 and α-SMA, we found significantly increased Klf4 staining in the nucleus of cells associated with distal vessel walls of miR-29 null lungs, inversely correlated with the reduced staining of α-SMA (Fig 8A–8D). [score:1]
A fragment of the 3’UTR of KLF4 containing the wild type or mutated miR-29 binding sites was cloned into the psiCHECK2 dual luciferase reporter plasmid. [score:1]
miR-29 is known for its roles in fibrosis, cell proliferation/apoptosis, tumor and adaptive and innate immunity [42– 54]. [score:1]
Scale bar: 100μM (TIF) A) Hearts of miR-29 D KO and WT littermates at age four weeks were fixed overnight in 4% paraformaldehyde, paraffin-embedded, sectioned, and stained with H&E. [score:1]
Levels of COL1A1, α-SMA and KLF4 are not significantly altered in airway SMCs of miR-29 D KO lungs. [score:1]
This indicates a critical role of miR-29 in the postnatal vSMC maturation. [score:1]
Together, these analyses suggest that defects in vSMC differentiation in miR-29 null lungs, might lead to the reduction in pulmonary arterial pressure. [score:1]
However, there is no significant difference between miR-29 null and control mice in heart weight when normalized to body weight (S5C Fig). [score:1]
We then performed qRT-PCR to examine the levels of Pdgfrb in miR-29 null or wild type lungs. [score:1]
This was further confirmed by western blot analysis (Fig 8F and 8G), in which protein levels of KLF4 of miR-29 null lungs are significantly higher than those of control littermates. [score:1]
S1 Fig (A) in situ hybridization of miR-29c in dorsal aorta of adult mouse, followed by IF staining of α-SMA (B). [score:1]
We found that there is a significant reduction in heart weight, left ventricle weight and right ventricle weight when normalized to tibial length in miR-29 null mice (S5B Fig). [score:1]
1005238.g001 Fig 1 (A) miR-29 family members are the most abundant miRNAs in adult mouse lungs, representing about 19% of total reads of known miRNAs (Next Generation of Sequencing). [score:1]
This profiling revealed that miR-29 family members (miR-29a/b/c) transcribed from two genomic loci, miR-29a/b1 and miR-29b2/c, are the most abundant miRNAs in adult mouse lungs (Fig 1A). [score:1]
Moreover, levels of miR-29 in airway SMCs is also much lower than those present in the distal vascular structure (Fig 1B and 1C). [score:1]
We then examined whether this vessel specific pattern is also present in human lungs, and found that high levels of miR-29 is selectively detected in vSMCs of small arteries including pulmonary arteries, but not in the vSMCs (media layer) of large pulmonary arteries (Fig 2A, 2B and 2C). [score:1]
This indicates a reduction of heat size in miR-29 null mice. [score:1]
[1 to 20 of 163 sentences]
2
[+] score: 369
As expected, the enforced expression of miR-29c induced the expression of p53 transcriptional targets p21 and p27 (Figure 3H, the left panel), the cyclin -dependent kinase inhibitors, due to the upregulation in p53 Ser15 phosphorylation [42]. [score:12]
miR-29c functions as a tumor suppressor that plays a crucial role in the development of hepatocellular carcinoma via targeting WIP1 (Figure 5A and 5B), and it may represent a target molecule for therapeutic intervention for this disease. [score:10]
Interestingly, we noted that the expression pattern of miR-29c in the IR-exposed human hepatocellular carcinoma cell line HepG2 appeared to differ from that in female liver of mice exposed to IR because it was upregulated in normal female mouse liver and downregulated in liver carcinoma HepG2 cells in response to low-dose IR (Figure 1C and 1D). [score:9]
showed that WIP1 was upregulated in two of the examined human hepatocellular carcinoma cell lines (Figure 2E), which was inversely correlated with miR-29c expression (Figure 2B), although WIP was downregulated in mouse Hepa 1–6 cells (Figure 2D). [score:9]
showed that AGO2 was downregulated at 12 and 24 hours post IR and upregulated at 96 hours after it (Figure 1E), which may contribute to the IR-responsive miR-29c expression in HepG2 cells. [score:9]
miR-29c is downregulated in liver carcinoma cells and directly targets WIP1. [score:7]
qRT-PCR indicated that low-dose IR had no effect on the expression of miR-29c in HepG2 cells at 96 hours post IR, whereas IR did suppress its expression at 12 and 24 hours after IR (Figure 1D). [score:7]
For the first time, we have established a causal relationship between the downregulation of miR-29c and the upregulation of WIP1 in liver carcinomas. [score:7]
In addition to miR-29c, another well-defined tumor suppressor, miR-34a, is also transcriptionally regulated by the phosphorylated p53 at Ser-15 [40], suggesting an important role of p53 Ser-15 phosphorylation in transcriptional regulation of tumor suppressor miRNAs. [score:7]
Although this is the first report of the existence of an inverse correlation between cellular levels of miR-29c and WIP1, the downregulation of miR-29c has been found in medulloblastoma [57], glioma [58] and gastric cancer [59]; however, the upregulation of WIP1 has also been reported in these carcinomas [60– 62], implicating a possible inverse correlation between these two molecules. [score:7]
Downregulated miR-29c may contribute to the upregulation of WIP1 in liver carcinoma tissues. [score:7]
miR-29c inhibitor, however, had no effect on the expression of p21 and p27 and the levels of cleaved caspase 3, but it reduced the expression of BAX (Figure 3H, the right panel). [score:7]
WIP1 was overexpressed in 45.4% of our liver carcinoma tissue samples, whereas miR-29c was downregulated in 50.6% of the samples (Figure 4A and 4B). [score:6]
This study has, for the first time, revealed that WIP1 is a direct target of miR-29c, and it has also disclosed an inverse correlation between miR-29c expression and WIP1 levels in liver carcinoma cell lines and tissues. [score:6]
The downregulated BAX may contribute to the miR-29c inhibitor -mediated reduction in apoptosis (Figure 3G) through the activation of caspases other than caspase-3, for instance, capase-7 [45]. [score:6]
Because oncogene sirtuin 1 (SIRT1) and two antiapoptotic molecules, B-cell CLL/lymphoma 2 (BCL2) and myeloid cell leukemia sequence 1 (MCL1), have been identified as direct targets of miR-29c [22, 23], we also analyzed their expression in Hepa 1–6, C3A, and HepG2 cell lines. [score:6]
Figure 2miR-29c is downregulated in liver carcinoma cells and directly targets WIP1 (A and B) Total RNA isolated from an epithelial cell line NMuLi derived from normal mouse liver, a mouse hepatoma cell line Hepa 1–6, human hepatocellular carcinoma cell lines HepG2 and C3A, and human normal liver tissue (HNLT) was subjected to real-time RT-PCR analysis using the miR-29c primer assays. [score:5]
The ectopic expression of miR-29c significantly suppresses liver carcinoma cell proliferation and induces apoptosis and cell cycle arrest (Figure 3). [score:5]
Although this is the first description of miR-29c in the maintenance of p53 activity via targeting WIP1, other studies have indicated that miR-29 may also activate p53 by targeting p85 alpha and CDC42 [41]. [score:5]
Conversely, miR-29c inhibitor promoted WIP1 expression (Figure 3H, the right panel), resulting in a decrease in the phosphorylated p53. [score:5]
To better understand the role of miR-29c and identify its novel targets, we performed a bioinformatics analysis where WIP1 was predicted as a potential target of miR-29c (Figure 2C). [score:5]
Figure 5 (A) In normal liver cells, the normally expressed miR-29c may contribute to the maintenance of normal p53 activity via targeting WIP1 phosphatase, thus maintaining a normal growth, proliferation, and apoptosis. [score:5]
Conversely, miR-29c inhibitor significantly promoted liver carcinoma cell proliferation (Figure 3E and 3F; p < 0.05) and slightly inhibited apoptosis (Figure 3G), although it had no effect on cell cycle (data not shown). [score:5]
Conversely, miR-29c inhibitor increases the expression of WIP1, thus leading to a reduction in the phosphorylated p53 at Ser-15 (Figure 3H, the right panel). [score:5]
These results suggest that miR-29c plays a suppressive role in hepatocellular carcinoma by targeting WIP1. [score:5]
Potential hsa-miR-29c targets were predicted by both TargetScan and RNAhybrid software applications. [score:5]
Although we (and other authors) have clearly demonstrated the suppressive role of miR-29c in liver carcinoma, the underlying mechanisms (key target molecules of miR-29c, in particular) remain largely unknown. [score:5]
Unlike p21 and p27, a miR-29c inhibitor remarkably attenuated BAX expression (Figure 3H, the right panel) due to the reduction in p53 Ser15 phosphorylation. [score:5]
To explore an expression pattern of miR-29c in human hepatocellular carcinoma HepG2 cells in response to low-dose IR, HepG2 cells were exposed to 0.3 Gy X-ray, and the expression of miR-29c was then determined. [score:5]
The ectopic expression of miR-29c inhibits hepatocellular carcinoma cell proliferation and induces apoptosis and G1 cell cycle arrest. [score:5]
Although the mechanism is still unclear, alterations in AGO2 expression may contribute to the low-dose IR-triggered differential expression of miR-29c. [score:5]
The enforced expression of miR-29c also led to an induction in p21 and p27 expression and an increase in the cleaved caspase 3 (Figure 3H, the left panel). [score:5]
To confirm that miR-29c directly targets WIP1, we generated luciferase reporters bearing either the wild-type or mutant 3′ UTR of WIP1 (Figure 2F). [score:4]
We also show that miR-29c is downregulated in both mouse hepatoma and human hepatocellular carcinoma cells. [score:4]
WIP1 is a novel direct target of miR-29cTo determine the role of IR-responsive miR-29c in liver cancer, we measured the expression of miR-29c in hepatocellular carcinoma cells. [score:4]
WIP1 is a novel direct target of miR-29c. [score:4]
We have found that miR-29c is downregulated in liver carcinoma cell lines and tissues, which is consistent with previous reports showing frequent reductions of miR-29c in human malignancies, including hepatocellular carcinomas [22, 23]. [score:4]
We also provide strong evidence for the tumor-suppressive role of miR-29c in the development of hepatocellular carcinoma. [score:4]
We provide evidence that miR-29c directly targets wild-type p53 -induced phosphatase 1 (WIP1). [score:4]
Furthermore, the FISH analysis shows that miR-29c was downregulated in 50.6% of the human hepatocellular carcinoma specimens examined (n = 255). [score:4]
In summary, low-dose IR-responsive miR-29c is downregulated in liver carcinoma cells and tissues. [score:4]
The FISH analysis showed that miR-29c was downregulated in 50.6% (n = 255) of the liver carcinoma tissues examined (Figure 4A and 4B). [score:4]
These results suggest that WIP1 is a direct target of miR-29c. [score:4]
The upregulation of cleaved caspase-3, however, may play a crucial role in miR-29c -induced apoptosis (Figure 3C). [score:4]
qRT-PCR showed that miR-29c was significantly downregulated in both mouse (Hepa 1–6) and human (HepG2, C3A) hepatocellular carcinoma cells (Figure 2A and 2B; p < 0.01), which was consistent with the previous report [23]. [score:4]
In contrast, the knockdown of miR-29c promotes liver carcinoma cell growth and inhibits cell apoptosis. [score:4]
We therefore explored the expression of miR-29c in liver tissue of mice exposed to IR and determined the contribution of miR-29c to the development of hepatocellular carcinoma. [score:4]
To date, many other oncogene mRNAs have been identified as targets of miR-29c, such as cyclin D2 (CCND2) [17], matrix metalloproteinase-2 (MMP2) [17, 18, 21], integrin β1 [18], mammalian SIRT1 [22], BCL2 [23], MCL1 [23], T-cell lymphoma invasion and metastasis 1 (TIAM1) [25], and cyclin E [27]. [score:3]
Hsa-miR-29c expression in liver carcinoma specimens (LVC481 and LVC2281 tissue arrays; Pantomics, Richmond, CA) was determined by FISH, as detailed elsewhere [63]. [score:3]
We have concluded that the expression level of miR-29c is inversely correlated with that of WIP1 in both normal liver and carcinoma tissues (Figure 4A and 4B). [score:3]
miR-29c may function as a tumor suppressor in hepatocellular carcinoma. [score:3]
The Pearson correlation was used to determine the statistical significance in has-miR-29c and WIP1 expression between normal and tumor tissues. [score:3]
The Student's t-test was used to determine the statistical significance of differences between groups in hsa-miR-29c and WIP1 expression, cell growth, cell cycle, apoptosis, luciferase activity, and the correlation of WIP1 with HCC clinical grades. [score:3]
miR-29c was bioinformatically predicted to target WIP1. [score:3]
However, the expression of miR-29c in response to IR in the liver and the role of miR-29c in hepatocellular carcinogenesis are not completely understood yet. [score:3]
qRT-PCR also showed a differential expression of miR-29c in the liver tissue of mice exposed to IR at the indicated time points (supplementary Figure S1). [score:3]
The ectopic expression of miR-29c also induced apoptosis and G1 cell cycle arrest (Figure 3C and 3D). [score:3]
A differential expression of miR-29c in liver tissues of female mice exposed to IR and human HepG2 cells. [score:3]
Luciferase miR-29c target reporters were generated as described previously [12]. [score:3]
Interestingly, the ectopic expression of miR-29c also caused an elevation in cleaved caspapse-3 with no effect on BAX (Figure 3H, the left panel), although a Bax -dependent caspase-3 activation has been shown to be essential for p53 -induced apoptosis in neurons [44]. [score:3]
A mo del for the suppressive role of miR-29c in liver carcinoma. [score:3]
To validate the inverse correlation between miR-29c and WIP1 in a large number of samples, we determined the expression of these two molecules in liver carcinoma tissue arrays and subsequently performed a correlation analysis. [score:3]
The expression of miR-29c was inversely correlated with that of WIP1 in the tissues (Pearson r = −0.8488). [score:3]
HepG2 cells grown to 90% confluence were transiently transfected with either 100 nM miR-29c mimic, a 100 nM inhibitor, or 100 nM AllStars negative control. [score:3]
We have shown that the ectopic expression of miR-29c reduces the levels of WIP1; as a result, the phosphorylated p53 at Ser-15 is elevated in HepG2 cells (Figure 3H, the left panel). [score:3]
It has been shown that the re-induction of miR-29c suppresses cell proliferation [18, 22, 27], migration and invasion [18, 21, 25], induces apoptosis [23] and attenuates tumor xenograft growth in vivo [17, 23, 27]. [score:3]
The expression of miR-29c and WIP1 in hepatocellular carcinoma tissues. [score:3]
The data presented in this paper indicate that low-dose IR triggers a profound induction of miR-29c expression in mouse liver tissue. [score:3]
Low-dose IR triggers a differential expression of miR-29c in female mouse liver and human HepG2 cells. [score:3]
indicated that miR-29c reduced WIP1 expression (Figure 3H, the left panel), leading to an elevation in phosphorylated p53 at Ser-15. [score:3]
This study for the first time reveals that low-dose IR induces miR-29c expression in female mouse liver. [score:3]
HepG2 cells grown to 90% confluence were transiently transfected with either 100 nM miR-29c mimic, 100 nM miR-29c inhibitor, or 100 nM AllStars negative control (QIAGEN) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. [score:3]
Fluorescence in situ hybridizationHsa-miR-29c expression in liver carcinoma specimens (LVC481 and LVC2281 tissue arrays; Pantomics, Richmond, CA) was determined by FISH, as detailed elsewhere [63]. [score:3]
Recently, a comprehensive study indicated an miR-29 -induced cellular senescence in aging muscles through targeting multiple signaling pathways, including p85a, IGF-1 and B-myb [47]. [score:3]
The suppressive role of miR-29c in hepatocellular carcinogenesis. [score:3]
With transient transfection, the MTT assay showed that miR-29c significantly suppressed hepatocellular carcinoma cell proliferation (Figure 3A and 3B; p < 0.05). [score:2]
In contrast, the knockdown of miR-29c promotes cell proliferation and represses apoptosis. [score:2]
NMuLi, Hepa 1–6, C3A, and HepG2 cells or HepG2 cells transfected with either 100 nM miR-29c mimic, a 100 nM inhibitor, or 100 nM AllStars negative control were washed twice with ice-cold PBS and lysed in radioimmunoprecipitation assay buffer (RIPA). [score:2]
miR-29c belongs to the miR-29 family which includes three other members in humans: miR-29a, miR-29b-1, and miR-29b-2 [14]. [score:1]
The correlation between miR-29c and WIP1 was predicted using miRGator (http://mirgator. [score:1]
This may contribute to miR-29c -induced apoptosis and cell cycle arrest (Figure 3C and 3D) [39]. [score:1]
HEK293 cells grown to 90% confluence in 6-well plates in antibiotic-free DMEM/High Glucose (Thermo Scientific) containing 10% FBS were transiently cotransfected with either 0.5 μg of Luc-WT-WIP1 or Luc-MT-WIP1 reporter, 5-ng pRL-TK plasmid, and the indicated concentration of hsa-miR-29c mimic (QIAGEN) using Lipofectamine 3000 (Invitrogen) according to the manufacturer's instructions. [score:1]
miR-29a and miR-29b-1 are transcribed together as a polycistronic primary transcript [15, 16], while miR-29b-2 and miR-29c are transcribed together. [score:1]
To determine the role of IR-responsive miR-29c in liver cancer, we measured the expression of miR-29c in hepatocellular carcinoma cells. [score:1]
Further studies are needed to dissect the role of miR-29c and WIP1 in carcinogenesis and cancer. [score:1]
Among miRNAs, miR-29c is significantly influenced in the IR-exposed liver tissue. [score:1]
The microRNA microarray analysis showed that miR-29c was remarkably elevated in response to low-dose IR (Figure 1A and 1B). [score:1]
Figure 4 (A) Representatives of hsa-miR-29c and WIP1 stainings in the same sections of liver carcinoma tissue arrays. [score:1]
After deparaffinization, the sections were prehybridized for 20 minutes at 55°C followed by 1 hour hybridization at the same temperature with a 1:1000 dilution of a miRCURY LNA™ hsa-miR-29c detection probe (Exiqon, Vedbaek, Denmark). [score:1]
Interestingly, recent studies have found that miR-29c enhances the sensitivities of human nasopharyngeal carcinoma to both chemotherapy and radiotherapy [46]. [score:1]
This may contribute to the miR-29c -induced G1 arrest [43] (Figure 3D). [score:1]
A large body of evidence has demonstrated that miR-29c is frequently reduced in human malignancies, including gastric cancer [17], metastatic lung cancer [18], chronic lymphocytic leukemia [19], metastatic medullary thyroid carcinoma [20], peripheral nerve sheath tumors [21], hepatocellular carcinoma [22, 23], meningioma [24], and nasopharyngeal [25, 26] and esophageal squamous cell carcinomas [27]. [score:1]
Next we performed the bioinformatics analysis of the correlation between miR-29c and WIP1 levels using a number of publically available deep sequencing datasets. [score:1]
miR-29 has also been linked to aging. [score:1]
Next, we determined the role of miR-29c in liver carcinogenesis using HepG2 as a mo del system. [score:1]
[1 to 20 of 95 sentences]
3
[+] score: 368
In bladder cancer, miR-29c overexpression inhibited cell growth, suppressed cell migration and resulted in an accumulation of cells in the G1 phase during the cell cycle through the target gene CDK6 [6]. [score:9]
Further studies on liver carcinoma that focused on the suppressive role of ionizing radiation-responsive miR-29c in the development of the disease via targeting WIP1 [9]. [score:8]
Inhibition of miR-29c by anti-miR-29c in SNU-1 cells down-regulated NASP expression (A), promoted cell proliferation (B), reduced apoptosis (C) and decreased cell percentage at G1/G0 phase (D). [score:8]
Based upon the analysis of the expression level of miR-29c in gastric cancer tissues and cell lines, we hypothesized that miR-29c re -expression might lead to an inhibition of cell growth. [score:7]
We searched candidate target genes of miR-29c through TargetScan, miRBase Target and PicTar algorithms. [score:7]
Our study also demonstrates that the expression level of miR-29c is lower in 67 cases of gastric cancer compared with matched normal tissues, and the expression also decreases in nine gastric cancer cell lines versus GES-1. The relationship between the miR-29c expression level and the clinicopathological factors in human gastric cancer samples was further analyzed. [score:6]
Furthermore, 47.8% (32/67) of tumor tissues displayed more significant down-regulation of miR-29c (relative expression ratio < 0.5). [score:6]
In present study, we indicate that miR-29c acts as a tumor suppressor by suppressing cell growth through CCK-8 and colony formation assays, promotes apoptosis and arrests cell cycle at G1/G0 stage by targeting NASP. [score:6]
MiR-29c has been shown to be down-regulated in gastric cancer, but the downstream targets differ and it is not clear how miR-29c mediates cell responses in varying cell contexts. [score:6]
In summary, we have clarified a novel pathway regulating cell proliferation in gastric cancer, which is, miR-29c inhibits cell proliferation, promotes apoptosis and arrests cell cycle at G1/G0 phase by targeting NASP. [score:6]
These data demonstrate that miR-29c represses NASP expression at the post-transcriptional level, likely through directly targeting the 3′UTR of NASP. [score:6]
Fig. 1Expression of miR-29c was down-regulated in gastric cancer tissues and cell lines. [score:6]
Another research group verified the downregulation of miR-29c in gastric cancer patients and assessed proliferation and colony formation ability of miR-29c by targeting RCC2 [13]. [score:6]
Among these samples, 80.6% (54/67) of tumor tissues showed down-regulation of miR-29c in comparison to matched normal tissues (relative expression ratio < 1.0). [score:6]
In lung cancer, miR-29c was shown to suppress cell adhesion and metastasis by targeting integrin β1 and MMP2 [10]. [score:5]
Further, NASP was overexpressed in SGC-7901 cells and then transfected with miR-29c mimics, the inhibitory effect of miR-29c on cell proliferation was partially reversed, and the progressions toward apoptosis and G1/G0 cell cycle arrest were also hindered (Additional file 4: Figure S3). [score:5]
These data suggest that miR-29c inhibits proliferation in gastric cancer and could potentially serve as an early biomarker and a novel therapy target. [score:5]
The results indicate that overexpression of miR-29c can induce gastric cancer cell apoptosis and cell cycle arrest in G1/G0 phase, which contributes to growth inhibitory properties of miR-29c. [score:5]
As shown in Fig.   1a and b, miR-29c expression level was significantly down-regulated in gastric cancer tissues compared with matched normal tissues (P < 0.001). [score:5]
miR-29c expression negatively correlates with NASP protein expression in gastric cancer cell lines. [score:5]
To explore the target gene of miR-29c by which inhibits cell proliferation in gastric cancer. [score:5]
Furthermore, we demonstrated that miR-29c can decrease NASP expression and the effects observed following miR-29c overexpression are partially due to NASP depletion. [score:5]
The relative intensity was normalized to GES-1 and determined by Image J. b Scatter plot of miR-29c expression versus NASP protein expression in GES-1 and 9 gastric cancer cell lines. [score:5]
Taken together, these data provide evidence that the function of miR-29c inhibit cell proliferation in gastric cancer is at least partially through targeting NASP. [score:5]
Among them, SGC-7901, MKN-45, MKN-28 and BGC823 expressed much higher levels of NASP while these cell lines exhibited lower miR-29c expression levels (Fig.   1c). [score:5]
We indicate that overexpression of miR-29c inhibits cell proliferation, promotes apoptosis and arrests cell cycle at G1/G0 phase. [score:5]
Overexpression of miR-29c reduced cell proliferation by promoting apoptosis and inducing cell cycle G1/G0 arrest in vitro, and inhibited the ability of tumorigenesis in gastric cancer cells in vivo. [score:5]
Among the predicted targets, NASP, required for DNA replication, cell proliferation and normal cell cycle progression [11], was chosen as one of the targets of miR-29c and further identified two potential binding sites within its 3′UTR which located at position 289–296 (8-mer) and position 348–354 (7-mer), respectively (Fig.   4a). [score:5]
Next, we examined whether miR-29c overexpression could suppress the tumor growth in vivo. [score:5]
It was showed that all the members of miR-29 family were down-regulated in gastric cancer and miR-29c was more significant as a signature miRNA than miR-29a or 29b for gastric cancer. [score:4]
Together, these data indicate that miR-29c was prominently down-regulated in gastric cancer. [score:4]
It also has been reported that miR-29c regulates the expression of many oncogenes, such as CDK6, CDC42, p85α, DNMT3a and DNMT3b in other types of cancers [6, 15, 16]. [score:4]
In this study, we demonstrate that miR-29c is down-regulated in gastric cancer tissues and cell lines. [score:4]
Furthermore, the down-regulation of NASP can elite the phenotypes caused by miR-29c. [score:4]
The result from Western blot was confirmed that the protein level of NASP was indeed down-regulated in SGC-7901-RV-miR-29c cells (Fig.   5b), and the NASP mRNA level still had no change after RV-miR-29c infection (Fig.   5c). [score:4]
MiR-29c was shown to inhibit cell growth, cell migration and invasion in pancreatic cancer by targeting ITGB1 [5]. [score:4]
miR-29c targets NASP directly. [score:4]
Furthermore, they demonstrated that miR-29 family directly targeted CCND2 and MMP2 to influence gastric cancer progression [14]. [score:4]
Knockdown of NASP elicits the phenotypes caused by miR-29c overexpression in gastric cancer cells. [score:4]
Our study suggests one mechanism that contributes to the elevated NASP levels in tumors is a deregulation of miR-29c and further supports targeting NASP as a therapeutic strategy in gastric cancer. [score:4]
As hypothesized, we found that miR-29c overexpression leads to cell growth inhibition through CCK-8 cell proliferation assay (Fig.   2b). [score:4]
Han et al. reported that miR-29c involved in the initiation of gastric carcinogenesis by directly targeting ITGB1 [12]. [score:4]
An inverse correlation was observed between miR-29c and NASP protein expression level, as shown in Additional file 2: Figure S1C. [score:3]
Thus, all of these results suggest that miR-29c is a potential marker for diagnose and therapeutic target for treatment in gastric cancer. [score:3]
Taken together, these results suggest that miR-29c exerts a growth inhibitory effect in gastric cancer cells. [score:3]
In contrast, inhibition of miR-29c in SNU-1 promoted cell proliferation, reduced cell apoptosis and decreased cell percentage in G1/G0 phase (Additional file 3: Figure S2). [score:3]
So the reduced tumor growth in mice was, at least in part, because of decreased proliferation which caused by miR-29c overexpression. [score:3]
The percentage of cells in S phase and G2/M phase appeared to reduce in miR-29c overexpression cells, however, these differences had no statistically significance (Fig.   3b). [score:3]
Therefore, miR-29c can inhibit tumorigenicity in vivo. [score:3]
Pearson χ [2] test was applied to examine the relationship between the miR-29c expression level and clinicopathologic parameters, unpaired t test was used to analyzed the differences between two groups. [score:3]
miR-29c inhibits gastric cancer cell proliferation in vitro. [score:3]
MiR-29c is down-regulated in gastric cancer tissues and cell lines. [score:3]
Moreover, the repression of luciferase activity caused by miR-29c overexpression was clearly abrogated by MUT1 (Fig.   4c). [score:3]
On the basis of relative expression ratio < 0.5, the 67 gastric cancer tissues were classified into two groups: low-miR-29c group (n = 32) and high-miR-29c group (n = 35). [score:3]
c miR-29c expression in GES-1 and nine gastric cancer cell lines (SNU-1, SNU-16, AGS, MKN-45, MKN-28, BGC-823, NCI-N87, KATOIII and SGC-7901). [score:3]
They found restoration of miR-29c inhibits cell proliferation, adhesion, invasion and migration in gastric cancer. [score:3]
However, miR-29c expression level did not show any correlation with the clinicopathological parameters. [score:3]
b Expression of miR-29c in 67 pairs of gastric cancer and normal tissues. [score:3]
a qPCR analysis of miR-29c expression levels in SGC-7901-RV-miR-control and SGC-7901-RV-miR-29c cells. [score:3]
SGC-7901 was chosen for subsequent functional studies because of its lowest expression level of miR-29c. [score:3]
And the miR-29c expression level was 129.7 ± 12.24 fold higher in SGC-7901-RV-miR-29c cells than that in control cells (P = 0.003, Fig.   5a). [score:3]
These data indicate that miR-29c may target NASP through the 8-mer seeding region of 3′UTR. [score:3]
Expression of miR-29c was normalized to U6 small nuclear RNA and analyzed by the 2 [-ΔΔCt] method. [score:3]
a miR-29c expression level in SGC-7901 transfected with miR-control or miR-29c detected by qPCR. [score:3]
We additionally show that miR-29c exerts these effects by targeting Nuclear autoantigenic sperm protein (NASP). [score:3]
MiR-29c down-regulation by CpG dinucleotide methylation of the promoter has been participated in cell invasion and increased sensitive to chemotherapy in basal-like breast tumors [8]. [score:3]
displayed that an enforced miR-29c expression resulted in a decrease of NASP protein level in SGC-7901 cells (Fig.   4d). [score:3]
Overexpression of NASP rescued the effect of miR-29c in gastric cancer cells, including cell growth (B), cell apoptosis (C) and cell cycle analysis (D). [score:3]
a Schematic graph of the putative binding sites of miR-29c in the NASP 3′UTR predicted by TargetScan. [score:3]
Relationship between miR-29c expression level and clinicopathologic features in 67 gastric cancer tissues. [score:3]
The expression levels of miR-29c in nine gastric cancer cell lines and one immortalized normal gastric mucosal epithelial cell line GES-1 were also assessed (Fig.   1c). [score:3]
Our study highlights the potential apply of miR-29c as an early biomarker and therapeutic target of gastric cancer. [score:3]
miR-29c suppresses tumorigenicity in vivo. [score:3]
Unfortunately, miR-29c expression level did not show any correlation with gender, age, location, Borrmann classification, differentiation, local invasion, lymph node metastasis or TNM stage (Additional file 1: Table S1). [score:3]
Furthermore, we checked the influence of miR-29c on the expression of NASP by dectecting the protein and mRNA level of NASP after transfecting miR-29c mimics or miR-control. [score:3]
MicroRNA-29c (miR-29c) acts as a tumor suppressor in different kinds of tumors. [score:3]
Fig. 6NASP knockdown elicits the phenotypes of miR-29c in gastric cancer cells. [score:2]
a miR-29c expression in 67 pairs of gastric cancer tissues compared to matched adjacent normal tissues. [score:2]
MiR-29c plays the role as tumor suppressor in several kinds of tumors. [score:2]
All of the gastric cancer cell lines have a significant decrease in the levels of miR-29c compared with GES-1. Significantly, SGC-7901 expressed the lowest level of miR-29c among these cell lines. [score:2]
To test if miR-29c overexpression decreases cell viability, SGC-7901cells were transfected with 100 nM miR-29c mimics, and miR-29c was elevated by 17.2 ± 2.19 fold compared to miR-control (P = 0.009, Fig.   2a). [score:2]
MiR-29c belongs to the miR-29 family, which is composed of four species with identical seed sequences, namely miR-29a, miR-29b-1, miR-29b-2 and miR-29c [4]. [score:1]
As Fig.   5g shown, the percentage of Ki-67 positive cells was much lower in the nodules derived from SGC-7901-RV-miR-29c group than that in the control group (34.7% ± 9.29% vs. [score:1]
To evaluate the significance of miR-29c in gastric cancer, we first detected miR-29c expression level in 67 pairs of gastric cancer tissues and adjacent normal tissues by qPCR. [score:1]
HEK 293 T cells (1 × 10 [6] cells/well) were seeded in 6-well plates 24 h prior to transfection, 2 μg of retroviral construct containing either miR-29c or miR-control, 2 μg of gag/pol and 2 μg of VSVG were cotransfected into HEK 293 T cells using 18 μl FuGENE6 HD (Roche, Indianapolis, IN, USA) in each well. [score:1]
d Photographs of tumors derived from nude mice injected with SGC-7901-RV-miR-control and SGC-7901-RV-miR-29c cells. [score:1]
Furthermore, there was a negative correlation between miR-29c and NASP protein level (r = −0.644, P = 0.044, Fig.   6b). [score:1]
As shown in Fig.   5d, tumors grew slower in the SGC-7901-RV-miR-29c group than those in the control group. [score:1]
GFP positive cells were sorted by flow cytometry and named RV-miR-29c and RV-miR-control, respectively. [score:1]
Cells transfected with miR-29c mimics were resuspended with 0.3% soft agar in RPMI-1640 containing 10% FBS, then layered onto 0.6% solidified agar in RPMI-1640 containing 10% FBS in 6-well plates (1 × 10 [3] cells/well) at 24 h post-transfection. [score:1]
SGC-7901 cells (100 μl, 1 × 10 [6] cells) infected with RV-miR-29c or RV-miR-control were injected into the right flank region of 4-week-old male nude mice (Institute of Zoology, Chinese Academy of Sciences, Shanghai, China). [score:1]
A genomic region including the primary transcript of miR-29c was cloned into the EcoRI-Xhol modified pMSCV-GW-RfA-PGK-EGFP retroviral vector, no insert vector as a control. [score:1]
c qPCR analysis of NASP mRNA levels in SGC-7901-RV-miR-control and SGC-7901-RV-miR-29c cells. [score:1]
Similarly, the tumor weight in SGC-7901-RV-miR-29c group was significantly less than that from the miR-control group (1.550 ± 0.530 g vs. [score:1]
b of NASP in SGC-7901-RV-miR-control and SGC-7901-RV-miR-29c cells. [score:1]
In HEK 293 T cells pre-seeded 24-well, 100 ng pMIR/NASP-WT or MUT, together with 2 ng pRL-TK vector containing Renilla luciferase and 100 nM miR-29c mimics or miR-control were cotransfected by Lipofectamine 2000 (Invitrogen). [score:1]
Moreover, depletion of NASP can elite the phenotypes caused by miR-29c. [score:1]
a Representative histograms depicting apoptosis in SGC-7901 cells transfected with miR-29c or miR-control. [score:1]
Our data showed that the apoptotic rate was significantly increased in cells transfected with miR-29c mimics in comparison with miR-control (15.2% ± 1.29% vs. [score:1]
f Average weight of tumor derived from nude mice injected with SGC-7901-RV-miR-control and SGC-7901-RV-miR-29c cells. [score:1]
Moreover, the tumor derived from RV-miR-29c showed weeker immunohistochemical staining of NASP than that derived from the control group (Fig.   5h). [score:1]
Quantitative PCR was performed to evaluate miR-29c expression level in 67 patient gastric cancer tissues and 9 gastric cancer cell lines. [score:1]
After 24 h, cells transfected with miR-29c mimics or NASP siRNA were seeded into 96-well plates (2 × 10 [3] cells/well), and the proliferation was monitored everyday for 5 days. [score:1]
MiR-29c was displayed to mediate the epithelial to mesenchymal transition (EMT) and negatively regulated Wnt/β-catenin signaling pathway via PTP4A and GNA13 in human colorectal carcinoma [7]. [score:1]
miR-29c NASP Gastric cancer Proliferation Gastric cancer is the fifth most common malignancy and the third leading cause of cancer-related deaths, according to the GLOBOCAN series of the International Agency for Research on Cancer [1]. [score:1]
SGC-7901 cells mediated with RV-miR-29c or SGC-7901-RV-miR-control retrovirus were obtained as described in the Material and methods. [score:1]
miR-29c promotes gastric cancer cell apoptosis and induces cell cycle arrest in G1/G0 phase. [score:1]
Among 15 candidate miRNAs selected from microRNA array, miR-29c showed no correlation with the clinicopathological features assessed by qPCR in 40 pairs of gastric cancer samples. [score:1]
In the present study, we qualified the expression of miR-29c in gastric cancer tissues and evaluated its role in cell proliferation and induction of cell apoptosis. [score:1]
b Representative histograms depicting cell cycle profiles of SGC-7901 cells transfected with miR-29c or miR-control. [score:1]
Fig. 3The effect of miR-29c on SGC-7901 apoptosis and cell cycle progression. [score:1]
Oligonucleotides hsa-miR-29c mimics (miR-29c), miR-control and siRNAs for NASP were purchased from GenePharma (Shanghai, China). [score:1]
Wild type NASP-3′ UTR or mutant NASP-3′ UTR containing the putative miR-29c binding sites were synthesized by Sangon, Shanghai, China. [score:1]
For WT1 reporter transfected with miR-29c mimics, the luciferase activity was significantly decreased (P < 0.05), while for WT2 reporter, the activity was not affected after miR-29c transfection. [score:1]
More samples and further studies are needed to disclosure the relationship between miR-29c and the clinicopathological features in gastric cancer. [score:1]
Moreover, we measured miR-29c expression and NASP protein level in 4 pairs of gastric cancer and matched normal tissues. [score:1]
Liu et al. evaluated the role of miR-29c, miR-124, miR-135a and miR-148a in predicting lymph node metastasis and tumor stage in gastric cancer, they showed a week relationship between miR-29c expression level and gastric cancer stage on the basis of P = 0.049 in 60 gastric cancer tissues [22]. [score:1]
[1 to 20 of 117 sentences]
4
[+] score: 331
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2
We analyzed the expression of miR-29c and Wnt-regulated gene signatures via GSEA [27] in published PANC patient expression profiles, finding that miR-29c expression levels were inversely correlated with the Wnt-activated gene signatures and positively correlated with Wnt -suppressed gene signatures (Figure 4A). [score:10]
Herein, we found that miR-29c directly targeted and suppressed the expression of four β-catenin upstream effectors (FRAT2, LRP6, FZD4, FZD5), thereby suppressing Wnt signaling and leading to decreased PANC cell migration, invasion and stem cell-like phenotypes. [score:10]
As miRNAs exert their functions by targeting multiple transcripts, we screened for targets of miR-29c using TargetScan, identifying four potential targets (FRAT2, LRP6, FZD4, FZD5) (Figure 5A). [score:9]
Real-time PCR analyses of miR-29c -overexpressing PANC cells revealed that the expression levels of six classically recognized Wnt/β-catenin target genes were remarkably decreased (Figure 4D). [score:7]
Immunoblotting analysis showed that miR-29c overexpression repressed FRAT2, LRP6, FZD4 and FZD5 expression levels, while miR-29c inhibition increased them (Figure 5B). [score:7]
E, Expression and correlation of miR-29c with CD44, MYC, and MMP7 mRNA expression, as well as FRAT2, LRP6, FZD4, FZD5 and p-Smad3 protein expression in 10 freshly collected pancreatic cancer samples. [score:7]
Moreover, immunoblotting showed that reintroducing miR-29c decreased the expression levels of multiple pluripotency -associated factors (CD24, CD44) and mesenchymal factor (vimentin) in vivo, while inhibiting miR-29c increased them, but the opposite was true for epithelial factor (E-cadherin) expression levels (Figure 3B). [score:7]
Figure 4A, GSEA plot showing that miR-29c expression is inversely correlated with Wnt-activated gene signatures and positively correlated with Wnt -suppressed gene signatures in published pancreatic cancer patient gene expression profiles (TCGA, n = 96). [score:7]
A, GSEA plot showing that miR-29c expression is inversely correlated with Wnt-activated gene signatures and positively correlated with Wnt -suppressed gene signatures in published pancreatic cancer patient gene expression profiles (TCGA, n = 96). [score:7]
Taken together, our data show that miR-29c inhibits PANC tumorigenicity and invasion through direct suppression of multiple Wnt signaling core regulatory genes. [score:7]
As FRAT2, LRP6, FZD4 and FZD5 are the upstream regulatory genes of Wnt signaling, we assumed that exogenous β-catenin expression would restore the invasive and carcinogenic ability of miR-29c -overexpressing PANC cells, which our findings validated (Figure 5E, 5F). [score:6]
The miR-29 family members (miR-29a, miR-29b, miR-29c), which differ at their last few 3′ end nucleotides, act as tumor suppressors and are downregulated in human cancers, such as aggressive chronic lymphocytic leukemia [45], colon cancer [46], non-small cell lung cancer [47] and nasopharyngeal carcinoma [48]. [score:6]
Collectively, our data confirm that the TGF-β/Smad3 pathway decreases miR-29c expression by directly targeting the MIR29C promoter in PANC cells. [score:6]
Reintroducing miR-29c into PANC cells significantly suppressed the PANC cell malignant phenotype and the stem cell–like phenotype by targeting Wnt signaling pathway regulators. [score:6]
C, Real-time PCR analysis of miR-29c expression in the indicated cells, either treated with 100 pM TGF-β for 3 hours or treated with or without the TβRI inhibitor (2 μM) or a neutralizing anti-TGF-β antibody (2 μg/ml) for 3 hours. [score:5]
The miR-29c levels in 10 freshly collected PANC samples were inversely correlated with the mRNA levels of the following Wnt cascade downstream targets: MYC (r = −0.782, P = 0.008), CD44 (r = −0.810, P = 0.004) and matrix metalloproteinase-7 (MMP-7, r = −0.888, P = 0.001); and four bona fide targets of miR-29c: FRAT2 (r = −0.641 P = 0.046), LRP6 (r = −0.667, P = 0.035), FZD4 (r = −0.639, P = 0.047) and FZD5 (r = −0.734, P = 0.016); and p-Smad3 (r = −0.812, P = 0.004) (Figure 6E). [score:5]
Furthermore, cellular fractionation showed that miR-29c overexpression decreased nuclear accumulation of β-catenin (Figure 4C), indicating that miR-29c suppresses the Wnt/β-catenin pathway by decreasing nuclear β-catenin accumulation. [score:5]
Reducing miR-29c not only promoted PANC cell stemness, but also PANC cell migration and invasion abilities by suppressing Wnt cascade inhibition both in vitro and in vivo. [score:5]
Figure 6A, GSEA plot showing that miR-29c expression is inversely correlated with TGF-β-activated gene signatures in published pancreatic cancer patient gene expression profiles (TCGA, n = 96). [score:5]
β-Catenin/T cell factor (TCF) activity was significantly decreased in miR-29c -overexpressing PANC cells, but was increased in miR-29c–inhibited cells (Figure 4B). [score:5]
The chromatin immunoprecipitation (ChIP) assay showed that endogenous Smad3 proteins bound to a sterol regulatory element (SRE) in the MIR29C promoter (Figure 6B); Figure 6C shows that miR-29c expression was decreased in PANC cells treated with TGF-β, but was increased in cells treated with a type I TGF-β receptor inhibitor or a neutralizing anti-TGF-β antibody. [score:5]
A, GSEA plot showing that miR-29c expression is inversely correlated with TGF-β-activated gene signatures in published pancreatic cancer patient gene expression profiles (TCGA, n = 96). [score:5]
MiRNA expression was defined based on the comparative threshold (Ct); relative expression levels were calculated as 2^(Ct miR-29c - Ct U6) after normalization with reference to the quantification of U6 small nuclear RNA expression. [score:5]
TGF-β/Smad3 inhibits miR-29c expression and clinical relevance of the TGF-β/Smad3/miR-29c/Wnt axis in pancreatic cancer. [score:5]
To summarize our findings, our study reveals that miR-29c regulates PANC migration, invasion and stem cell-like phenotypes via a novel mechanism, i. e. by modulating multiple Wnt cascade regulators, intimating that miR-29c might function as a tumor-suppressive miRNA in human PANC. [score:5]
These data further support the notion that a hyperactive TGF-β/Smad3 pathway suppresses miR-29c expression, resulting in Wnt signaling activation and the consequent promotion of malignant PANC phenotypes, high tumor recurrence rate and poor prognosis of clinical PANC. [score:5]
Interestingly, TGF-β/Smad3 regulated miR-29 expression negatively [30]. [score:4]
Interestingly, miR-29c was also downregulated in patients who had died from PANC, as well as patients with proven tumor recurrence (Figure 1A). [score:4]
Figure 3MiR-29c upregulation attenuated tumorigenicity and invasion in vivo A, The tumors formed by miR-29c-transduced BxPC-3 cells were smaller than the vector control tumors. [score:4]
We retrieved miRNA expression profiles from two data sets: TCGA and the Gene Expression Omnibus dataset GSE24279 [23], and found that miR-29c was significantly decreased in PANC tissues compared with normal pancreatic tissues. [score:4]
However, we believe that downregulated miR-29c plays important roles in PANC cells. [score:4]
Lastly, we showed that TGF-β/Smad3 regulated miR-29c expression negatively by binding to the MIR29C promoter, leading to the loss of miR-29c in PANC cells. [score:4]
MiR-29c upregulation attenuated tumorigenicity and invasion in vivoTo understand whether miR-29c is involved in PANC cell tumorigenesis and invasiveness in vivo, we subcutaneously inoculated 10 [3]–10 [6] cells into the inguinal folds of nude mice. [score:4]
MiR-29c directly suppressed Wnt cascade–activated regulatory genes. [score:4]
MiR-29c directly suppresses multiple Wnt cascade activate regulatory genes. [score:4]
We found that restoring miR-29c suppressed Wnt signaling in PANC cells, attenuated cell migration and invasion and stem cell-like phenotypes in vitro and in vivo. [score:3]
We used a stable miRNA sponge strategy to inhibit miR-29c in vivo, and the inguinal tumors formed by miR-29c-sponge-transduced cells were clearly larger than the sponge-vector control tumors. [score:3]
D, Luciferase activities of FRAT2-3′UTR, LRP6-3′UTR, FZD4-3′UTR or FZD5-3′UTR in vector- or miR-29c-transduced cells, or in miR-29c-transduced cells transfected with miR-29c-mut, or in vector-transduced cells transfected with NC or miR-29c inhibitor. [score:3]
Our data validate the premise that reintroducing miR-29c suppresses the tumorigenic and invasive behavior of PANC in vivo. [score:3]
In this context, we found that Smad3 binding to the MIR29C promoter led to reduced miR-29c expression in PANC cells. [score:3]
Moreover, the GSEA showed that the miR-29c expression levels were correlated with the TGF-β-activated gene signatures in PANC cells. [score:3]
Taken together, these findings indicate that miR-29c greatly suppresses PANC cell migration and invasion. [score:3]
Next, we demonstrated that FRAT2, LRP6, FZD4 and FZD5 are bona fide targets of miR-29c. [score:3]
Restoring miR-29c suppressed PANC cell migration and invasion and attenuated the stem cell–like phenotype. [score:3]
Additionally, GSEA showed remarkable correlation between miR-29c expression levels and the TGF-β-activated gene signatures (Figure 6A). [score:3]
A, Predicted miR-29c target sequences in FRAT2-3′UTR, LRP6-3′UTR, FZD4-3′UTR and FZD5-3′UTR. [score:3]
Furthermore, the xenograft tumor mo del showed that miR-29c inhibited PANC tumorigenesis in vivo. [score:3]
We explored the molecular mechanism that mediates the reduction of miR-29c in PANC cells, using Genomic Identification of Significant Targets in Cancer (GISTIC) tools [28, 29] to identify copy number alterations (CNAs) in PANC tissues, but found no alteration in the miR-29c genomic region (Figure S2A). [score:3]
Reduced miR-29c expression in pancreatic cancer with poor prognosis. [score:3]
D, Real-time PCR analysis of miR-29c expression in 8 indicated pancreatic cancer cell lines and normal pancreas cell line hTERT-HPNE. [score:3]
Figure 5A, Predicted miR-29c target sequences in FRAT2-3′UTR, LRP6-3′UTR, FZD4-3′UTR and FZD5-3′UTR. [score:3]
In summary, our findings indicate that miR-29c augments PANC tumorigenicity and invasion by suppressing Wnt signaling. [score:3]
B, Statistical analysis of miR-29c expression in normal pancreas tissues (n = 5) and pancreatic cancer specimens of different WHO grades (n = 132). [score:3]
Although the methylation level detected was inversely correlated with miR-29c expression levels (Figure S2B-b), it was not associated with PANC progression, which contradicted the earlier results (Figure 1B). [score:3]
Stable cell lines expressing miR-29c and miR-29c sponge were generated via retroviral infection using HEK293T cells as described by Li et al [52] and selected with 0.5 μg/mL puromycin for 10 days. [score:3]
To validate the expression pattern of miR-29c in PANC, quantitative reverse transcription-PCR was conducted on five normal pancreatic tissue samples and 132 frozen PANC samples. [score:3]
Furthermore, we determined that TGF-β/Smad3 signaling decreased miR-29c expression levels in clinical PANC samples. [score:3]
Herein, we reveal that following inhibition by transforming growth factor-β (TGF-β)/Smad3 signaling, miR-29c was remarkably decreased in PANC cells. [score:3]
TGF-β/Smad3 signaling inhibited miR-29c in PANC. [score:3]
C, Kaplan-Meier curves of pancreatic cancer patients with low- versus high -expression of miR-29c (n = 132; P = 0.003). [score:3]
MiR-29c upregulation attenuated tumorigenicity and invasion in vivo. [score:3]
We next tested whether miR-29c suppressed Wnt signaling. [score:3]
TGF-β is a significant growth factor in PANC that promotes tumor growth and progression [51], and TGF-β/Smad3 signaling promotes renal fibrosis by inhibiting miR-29 [30]. [score:3]
Analysis of previously published gene expression profiles from PANC tissues indicated that the miR-29c reduction was not correlated with CNA or with promoter methylation level. [score:3]
MiR-29c suppresses pancreatic cancer cells migration and invasion as well as attenuates stem cell-like phenotype in vitro. [score:2]
MiR-29c expression correlated with Wnt cascade hyperactivation and Smad3 activity in clinical PANC. [score:2]
The Hoechst 33342 dye exclusion assay showed that miR-29c overexpression decreased the proportion of side population -positive (SP+) cells from 3.65% to 0.90% in BxPC-3 cells, and from 3.09% to 0.81% in Capan-2 cells (Figure 2E). [score:2]
Analysis of miR-29c expression in PANC tissues compared with that in normal pancreas tissues was using a published microarray -based high-throughput assessment (n=148, P<0.001; NCBI/GEO/GSE24279). [score:2]
As miR-29c levels are particularly decreased in patients with proven tumor recurrence, we suggest the potential role of miR-29c in the development and maintenance of the stem cell-like property of PANC cells. [score:2]
Additionally, miR-29c expression was reduced in the eight PANC cell lines tested compared with that in the normal hTERT-HPNE cell line (Figure 1D). [score:2]
MiR-29c suppressed Wnt signaling. [score:2]
E, Hoechst 33342 dye exclusion assay showing that overexpressing miR-29c attenuated the SP cells in the indicated cells. [score:2]
MiR-29c suppresses Wnt signaling. [score:2]
We synthesized cDNA using a TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems, Foster City, CA, USA) and quantified miR-29c expression using a miRNA-specific TaqMan MiRNA Assay Kit (Applied Biosystems). [score:2]
Furthermore, the CD44+ population and the expression of multiple pluripotency -associated factors were dramatically decreased in miR-29c -transfected cells compared with the control cells (Figure 2F). [score:2]
We used the Transwell invasion assay to determine the effect of miR-29c expression on PANC cell invasion. [score:2]
C, miRNP IP assay showed association of miR-29c with FRAT2, LRP6, FZD4, FZD5, DNMT3A and GAPDH were used as positive and negative controls, respectively, and 5S rRNA was used as a control for overall expression levels. [score:2]
To understand whether miR-29c is involved in PANC cell tumorigenesis and invasiveness in vivo, we subcutaneously inoculated 10 [3]–10 [6] cells into the inguinal folds of nude mice. [score:1]
These findings suggest a possible link between miR-29c reduction and human PANC progression. [score:1]
MiR-29c sponge was constructed by annealing, purifying, and cloning oligonucleotides containing six tandem “bulged” miR-29c -binding motifs into the pMSCV vector. [score:1]
Significantly, restoring miR-29c greatly abrogated PANC cell aggressiveness. [score:1]
Our findings reveal a novel pathway by which epigenetic modulation of miR-29c renders the PANC cell abilities of robust self-renewal and aggressive metastasis ineffective. [score:1]
Therefore, we suggest another mechanism reduces miR-29c in PANC. [score:1]
Analysis of two public data sets revealed that miR-29c was decreased in patients who had died from PANC and in patients with proven tumor recurrence. [score:1]
We examined whether activation of the TGF-β/Smad3/miR-29c/Wnt axis identified in our PANC cell mo dels was also evident in clinical PANC. [score:1]
Collectively, our results reveal that miR-29c restoration attenuates the PANC cell self-renewal ability. [score:1]
B, Schematic of typical SRE of the MIR29c promoter. [score:1]
Statistical analysis revealed that miR-29c was associated with shorter overall survival (P = 0.003) (Figure 1C). [score:1]
The human MIR29C gene was PCR-amplified from genomic DNA and cloned into a pMSCV-puro retroviral vector. [score:1]
A, The tumors formed by miR-29c-transduced BxPC-3 cells were smaller than the vector control tumors. [score:1]
Conversely, the tumors formed by miR-29c-sponge-transduced BxPC-3 cells were larger than the tumors formed by the sponge-vector cells. [score:1]
Cells were cotransfected with a plasmid that encodes hemagglutinin-tagged (HA)-Ago1 and miR-29c (100 nM), followed by HA-Ago1 immunoprecipitation (IP) using an anti-HA antibody. [score:1]
In the present study, we identified miR-29c as a major mediator of two hallmarks of aggressive PANC: limitless replicative potential, and tissue invasion and metastasis. [score:1]
The tumors formed by miR-29c-transduced PANC cells were visibly smaller than the vector control tumors (Figure 3A). [score:1]
Furthermore, we assessed the methylation status of miR-29c in normal pancreatic tissues and PANC tissues by analyzing the publicly available data from TCGA (Figure S2B-a), finding that the methylation level detected by probe cy08855249 was higher in PANC tissues than in normal pancreatic tissues. [score:1]
Reduced miR-29c levels in PANC correlated with patient prognoses. [score:1]
The microribonucleoprotein immunoprecipitation and luciferase activity assays demonstrated that miR-29c associated directly with the 3′ UTR of FRAT2, LRP6, FZD4 and FZD5 (Figure 5C, 5D and Supplementary Figure S1A,1B). [score:1]
[1 to 20 of 97 sentences]
5
[+] score: 329
Since expression of the miR-29 family in the MSC chondrogenesis mo del was inversely correlated with expression of SOX9, we examined the role of SOX9 in the regulation of miR-29 expression. [score:8]
Overexpression of SOX9 in SW1353 cells leads to a decrease in expression of the miR-29 family, whilst knockdown of SOX9 increased their expression (Fig.   2c). [score:8]
An enrichment of potential miR-29 targets was identified in upregulated genes, when expression of the miR-29 family was low (data not shown) suggesting functional involvement of the miR-29 family. [score:8]
Expression of the miR-29 family was measured by qRT-PCR after overexpression or knockdown of SOX9; data were normalised to U6 RNA expression (mean ± SEM, Student’s t test, n = 3 (overexpression), n = 4 (siRNA). [score:8]
Of the genes whose expression was decreased when expression of the miRNA was increased, there was an enrichment of potential miR-29-3p targets identified and vice versa (Fig.   1a). [score:7]
Among these modulated miRNAs, the expression of miR-29b-3p, a member of miR-29 family, was increased at 1 day post-surgery when it was regulated in the opposite direction to its potential targets. [score:7]
The TGFβ, IL-1, and Wnt pathways regulate and/or are regulated by the miR-29 family highlighting a nonlinear system, with outcomes on the expression of matrix or matrix-degrading genes In summary, we have shown that the miR-29 family has a role in osteoarthritis, including early disease. [score:7]
Having shown the miR-29 family to be expressed in mo dels of OA and cartilage development and regulated directly by Sox9, we explored the regulation of the miR-29 family in chondrocytes by cytokines and growth factors known to be important in cartilage homeostasis and OA. [score:7]
This latter can be seen through LPS repression of miR-29 expression, but also an increased expression of miR-29 upon treatment with an NFκB inhibitor, both pre-miR-29 and at the level of the pri-miR-29a/b1 promoter. [score:7]
These are positive regulators of the Wnt pathway, and targeting them is likely to suppress Wnt signalling, which is the outcome of miR-29 action (Fig.   5). [score:6]
Similarly, the induction of miR-29 precursors was also augmented by inhibiting NFκB (Fig.   4c), suggesting that NFκB acts as a negative regulator of miR-29 expression. [score:6]
Our data also show that there is no direct relationship between SOX9 and growth factor regulating the miR-29 family, in agreement with studies showing SOX9 -dependent and independent regulation of gene expression by growth factors [42]. [score:6]
Wnt3a also decreases SOX9 expression by approximately threefold, yet has no effect on miR-29 expression (data not shown). [score:5]
Data were normalized to 18S rRNA expression for primary and precursor miRNA and to U6 expression for mature miR-29 and then vehicle control (mean ± SEM, ANOVA, n = 3). [score:5]
Empty bars, control; black bars, treatmentSimilarly, miR-29-3p repressed NFκB signalling, inhibiting IL-1 induction of a κB-luc construct, whilst the inhibitor of miR-29b-3p augmented the response (Fig.   5b). [score:5]
This figure demonstrates that the miR-29 family adds an additional level of regulation across key pathways of cartilage homeostasis, and its dysregulation could either lead or contribute to disease. [score:5]
The miR-29 family was regulated in both human and mouse mo dels of cartilage development though decreased expression of the miR-29 family in mo dels of chondrogenesis has been described before [37, 40, 41]. [score:5]
Mutation of miR-29 seed sites (1–5 sites, depending on gene), abolished this repression, demonstrating that all these genes are direct targets of the miR-29 family (Fig.   6a). [score:5]
Empty bars, control; black bars, treatment Similarly, miR-29-3p repressed NFκB signalling, inhibiting IL-1 induction of a κB-luc construct, whilst the inhibitor of miR-29b-3p augmented the response (Fig.   5b). [score:5]
Whilst Wnt3a does not regulate miR-29 expression in primary HACs, miR-29 can repress canonical Wnt signalling, on the TOPFlash construct and the Axin2 gene. [score:4]
Transforming growth factor beta (TGFβ) is a key factor in OA and has been shown to regulate miR-29 expression in fibrosis [18]. [score:4]
Several Wnt-related genes are direct targets of the miR-29 family. [score:4]
The NFκB pathway is repressed by miR-29 though there are opposing effects on miR-29 expression regulated by either IL-1 or LPS. [score:4]
Amongst these, FZD3, FZD5, DVL3, FRAT2, and CK2A2 were validated as direct targets of the miR-29 family. [score:4]
In these data, we have identified and validated a number of genes as new direct targets of the miR-29 family. [score:4]
Interestingly, Axin2 expression, readout of canonical Wnt signalling, was decreased in hip OA cartilage compared to NOF (Fig.   6b) where miR-29 expression was increased (Fig.   1d). [score:4]
Constructs were transfected into DF1 fibroblasts with miR-29 mimics or non -targeting controls (50 nM) and assayed for luciferase activity after 24 h. Data were normalised to Renilla luciferase and then the non -targeting control (mean ± SEM, ANOVA, n = 6). [score:4]
From data above, we hypothesised that SOX9 was a negative regulator of miR-29 expression in chondrocytes. [score:4]
This intersection contained a number of known direct targets for miR-29 (e. g. COL1A1 and COL3A1), see Supplementary Table 3. Pathway analysis (DAVID) highlighted the Wnt signalling pathway, including DVL3, (Dishevelled 3); CSNK2A2, (casein kinase 2 alpha 2 polypeptide); FRAT2, (Frequently Rearranged In Advanced T-Cell Lymphomas 2, a GSK-3 binding protein); FZD3, (Frizzled family receptor 3) and FZD5, (Frizzled family receptor 5). [score:4]
Expression of the miR-29 family is regulated in cartilage during osteoarthritis. [score:4]
Negative regulation of canonical Wnt signalling by miR-29 has been shown to be via targeting of DNMT3A and 3B to demethylate WIF-1 in non-small-cell lung cancer [55]. [score:4]
Fig. 6The miR-29 family directly targets members of the Wnt pathway. [score:4]
Expression of the microRNA-29 family in chondrocyte differentiation and regulation by SOX9. [score:4]
This showed SOX9 as a negative regulator of miR-29 expression, and we further demonstrated that this was via the promoter for the miR-29a/b1 cluster. [score:4]
The miR-29-3p mimic repressed Wnt3a induction of this construct (with no effect on the control FOPFlash), whilst it was augmented by the miR-29b-3p inhibitor (Fig.   5c). [score:3]
SOX9 represses expression of the miR-29 family in chondrocytes. [score:3]
Further, expression of the miR-29 family was significantly increased in human cartilage from end-stage OA. [score:3]
IL-1 induces the miR-29 family in a p38 MAPK -dependent manner, though the NFκB pathway represses miR-29 expression. [score:3]
Expression of primary miR-29b2/c, the precursor and mature miR-29b and miR-29c were significantly repressed by TGFβ1 in monolayer culture. [score:3]
The frequency of predicted miR-29 targets in mRNA with seed sites of either 6mer or 7mer m8 was calculated (see Material and Methods) across fold changes of gene expression. [score:3]
A p38 inhibitor (SB203580) blocked induction of the miR-29 family by IL-1, showing that this was, at least in part, dependent on the p38 pathway (Fig.   4c). [score:3]
One hundred nanogram of the plasmid and 10 ng of constitutive Renilla plasmid were co -transfected into SW1353 cells with 50 nM miR-29 mimic, inhibitor or control. [score:3]
However, microRNA-29 expression was not modulated by Wnt3a with no effect on the miR-29a/b1 promoter (data not shown). [score:3]
In other cell lines, NFκB has been shown to act as an inhibitor of miR-29 [52– 54]. [score:3]
Since expression of the miR-29 family is increased immediately post-surgery in the DMM mo del and is increased upon hip cartilage avulsion, this may be a response to injury, a known phenomenon for miRNAs in several areas of physiology and pathology, including cartilage, e. g. [38, 39]. [score:3]
Whilst this shows a correlation with miR-29 expression for IL-1, this is not true for TGFβ1 and LPS. [score:3]
It is moot if the same mechanism(s) increase expression of the miR-29 family in cartilage from end-stage human OA. [score:3]
Fig. 2Expression of the miR-29 family in chondrocyte differentiation. [score:3]
Wnt3 -induced Axin2 expression was significantly, though minimally, repressed by miR-29 family mimics (Fig.   5c). [score:3]
Expression of the microRNA-29 family in osteoarthritis. [score:3]
b In man, the miR-29 family is expressed from two loci, with the primary miR-29a/b1 on chromosome 7 (the last intron of the primary transcript GenBank accession EU154353) and primary miR-29b2/c on chromosome 1 (the last exon of the primary transcript GenBank accession numbers EU154351 and EU154352) [29]; mature sequences of miR-29a, b and c (3p) have identical seed sequences. [score:3]
Figure 5a shows that TGFβ1 -induced ADAMTS4 expression was repressed by transfection of miR-29 family mimics, verifying the effect on an endogenous gene. [score:3]
The 3’ UTR of all these genes was cloned into a luciferase reporter and co-transfection of the miR-29-3p mimics resulted in significant repression of luciferase expression (Fig.   6a). [score:3]
Factors controlling expression of the miR-29 family. [score:3]
In micromass culture, IL-1 increased expression of all primary and precursor transcripts and the mature miR-29 family (Fig.   4b). [score:3]
Expression of the miR-29 family was highest in human articular cartilage tissue, decreasing with cell passage in monolayer culture. [score:3]
Interestingly, miR-29 gain- and loss-of-function microarray experiments in primary HACs highlighted a number of genes from the Wnt signalling pathway as potential targets of miR-29 in articular chondrocytes. [score:3]
Data were normalised to U6 RNA expression Expression of the miR-29 family was also measured across dedifferentiation of human articular chondrocytes upon serial passage in monolayer culture. [score:3]
We performed gain-of-function and loss-of-function experiments to identify miR-29 targets in primary HACs. [score:3]
Human primary chondrocytes were transfected with miR-29-3p family mimics or non -targeting control (50 nM) for 24 h, after culture in low serum (0.5 % v/ v FCS) for 24 h, cells were stimulated with TGFβ1 (4 ng/ml) (a), IL-1β (5 ng/ml) (b) or Wnt3a (100 ng/ml) (c) for 24 h. Gene expression (ADAMTS4 a; MMP3 b; Axin2 c) was measured by qRT-PCR and normalized to 18S rRNA (mean ± SEM, ANOVA, n = 3). [score:3]
In human MSC differentiation to form cartilage discs over 14 days, the miR-29 family decreased in expression to 7 days, returning to starting levels by 14 days (Fig.   2a). [score:3]
This gives a feed forward loop where TGFβ1 reduces levels of miR-29 which are repressing the Smad pathway and therefore allows a greater increase in Smad -dependent gene regulation. [score:2]
Whilst miR-29 expression is not regulated by Wnt3a, we measured the impact of miR-29 on canonical Wnt signalling, using the TOPFlash construct. [score:2]
These data identify the miR-29 family as microRNAs acting across development and progression of OA. [score:2]
Since TGFβ1 regulated expression of the miR-29 family, we measured the Smad 2/3/4 pathway using transient transfection of the p(CAGA) [12]-luc Smad-responsive plasmid. [score:2]
The miR-29 family regulates key signalling pathways. [score:2]
The miR-29 family negatively regulates Smad, NFκB, and canonical Wnt signalling. [score:2]
Fig. 3Regulation of the miR-29 family by TGFβ1. [score:2]
The miR-29 family is regulated by a number of factors known to be important in OA and has a functional impact on several relevant signalling pathways. [score:2]
The expression of miR-29a-3p, miR-29b-3p and miR-29c-3p was increased in osteoarthritis compared to NOF (Fig.   1d). [score:2]
Hence, we investigated the expression of the miR-29 family in a number of mo dels relevant to cartilage and OA and their regulation and function in chondrocytes. [score:2]
The miR-29 family is regulated by TGF-β1 and IL-1 in chondrocytes. [score:2]
There is no simple relationship between regulation of SOX9 by these factors and that of miR-29. [score:2]
Axin2 gene expression in osteoarthritic hip cartilage compared to a fracture control is inversely correlated with that of miR-29 in the same tissue. [score:2]
The miR-29 family negatively regulated Smad, NFκB, and canonical WNT signalling pathways. [score:2]
The 3’ UTR of mRNAs containing the predicted binding site of miR-29-3p were subcloned into pmirGLO (Promega), using QuikChange (Agilent) to introduce mutations. [score:2]
Data from this study have identified a complex interplay between the miR-29 family and key signalling pathways which regulate cartilage homeostasis. [score:2]
Fig. 4Regulation of the miR-29 family by interleukin-1 and LPS. [score:2]
In a mouse mo del of cartilage injury and in end-stage human OA cartilage, the miR-29 family was also regulated. [score:2]
They showed SOX9 negatively regulating miR-29 which allowed an increase in FOXO3A leading to the differentiation of MSC into chondrocytes [37]. [score:2]
Expression of the miR-29 family and SOX9 was measured by qRT-PCR from RNA a obtained from human mesenchymal stem cells induced through chondrogenesis to form cartilage discs at day 0, 3, 7 and 14 (mean ± SEM, ANOVA, n = 6); empty bars, miR-29a; grey bars, miR-29b; black bars, miR-29c. [score:1]
The action of the miR-29 family in articular chondrocytes. [score:1]
These data show a complex role for the miR-29 family in cartilage homeostasis and OA. [score:1]
In micromass culture, the converse was true (Fig.   3b), with no effect (or an increase) on primary miR-29b2/c or precursors for miR-29b2 and miR-29c, though the mature miR-29c-3p was still reduced. [score:1]
A similar pattern was seen for miR-29b2 and miR-29c, though this did not reach significance (data not shown). [score:1]
Empty bars, pri-miR29a/b1; light grey bars, pri-miR29-b2/c; dark grey bars, pre-miR-29; black bars, mature miR-29; horizontal line at 1, vehicle control. [score:1]
The family is encoded at two human genomic loci on chromosome 1 (encoding a primary transcript for miR-29a and miR-29b1) and chromosome 7 (encoding a primary transcript for miR-29b2 and miR-29c). [score:1]
Fig. 1Identification of the miR-29 family in osteoarthritis. [score:1]
TGFβ1 is known to repress the miR-29 family in a number of cell types (e. g. [18, 47], and this is the same in primary chondrocytes. [score:1]
We pursued the relationship between these three factors and the miR-29 family in primary HACs since the literature suggests that this is cell-type specific. [score:1]
Expression of the miR-29 family was measured in human articular cartilage from hip replacement surgery for OA or fracture to the neck-of-femur (NOF, control). [score:1]
The MMP3 gene, which is responsive to NFκB, as well as other transcription factors, was induced by IL-1 and significantly repressed by miR-29 family mimics (Fig.   5b). [score:1]
Fig. 7 A schematic of the role of the miR-29 family in cartilage. [score:1]
Several of these have been validated, showing the functional capability of miR-29 on this pathway in cartilage. [score:1]
No significant induction of pri-miR-29b2/c or pre-miR-29b2 or pre-miR-29c was seen, though IL-1 increased the mature miR-29c-3p (Fig.   4a). [score:1]
Figure 7 shows the relationships, we have identified amongst cytokines, growth factors and signalling pathways with the miR-29 family. [score:1]
The impact of TGFβ1 on miR-29 expression in chondrocytes was investigated in monolayer culture and in three-dimensional micromass culture. [score:1]
In human osteoblasts, miR-29 is induced by canonical Wnt signalling and miR-29 potentiates Wnt signalling, demonstrating the cell type-specific nature of miR-29 function [27, 56]. [score:1]
Empty bars, pri-miR-29a/b1; dark grey bars, pre-miR-29; black bars, mature miR-29; horizontal line at 1, vehicle controlThe Wnt pathway has also been implicated in OA [35]. [score:1]
The miR-29 family in human and mouse consists of miR-29a, miR-29b (b1 and b2 which are identical mature miRNAs) and miR-29c, with the mature microRNAs differing only in two or three bases. [score:1]
All seed sites of the miR-29 family were altered to non -binding sequences (number of sites shown) to create mutant constructs. [score:1]
Empty bars, miR-29a; grey bars, miR-29b; black bars, miR-29c. [score:1]
However, in both cases, all three mature members of the miR-29 family were repressed. [score:1]
Empty bars, miR-29a; grey bars, miR-29b and black bars, miR-29c. [score:1]
Empty bars, pri-miR-29a/b1; light grey bars, pri-miR-29b2/c; dark grey bars, pre-miR-29; black bars, mature miR-29, horizontal line at 1, vehicle control. [score:1]
Since the replay of chondrogenesis and altered cell differentiation can contribute to OA [31], expression of the miR-29 family was investigated in appropriate mo dels. [score:1]
Empty bars, pri-miR-29a/b1; dark grey bars, pre-miR-29; black bars, mature miR-29; horizontal line at 1, vehicle control The Wnt pathway has also been implicated in OA [35]. [score:1]
Measurement of the miR-29-3p family in this mo del showed a significant increase in expression at 12–48 h post-explantation of cartilage, with a trend to increase for miR-29a and c at 6 h (Fig.   1c). [score:1]
Striped bars, control; empty bars, miR-29a; grey bars, miR-29b; black bars, miR-29c. [score:1]
Data were normalised to U6 RNA expressionExpression of the miR-29 family was also measured across dedifferentiation of human articular chondrocytes upon serial passage in monolayer culture. [score:1]
[1 to 20 of 110 sentences]
6
[+] score: 296
Other miRNAs from this paper: hsa-mir-22
In this study, we demonstrated that Sp1 could be targeted by miR-29c in translational level, and TGF-β1 inhibit the expression of miR-29c and up-regulate expression of Sp1 in vitro. [score:14]
But we found that ectopically expressing miR-29c inhibitors without the treatment of TGF-β1 inhibited the mRNA expression of TTF-1 and E-cadherin, and enhanced the expression of vimentin and α-SMA, which indicated that the inhibition of miR-29c could be sufficient to induce EMT in lung cancer. [score:13]
On one hand, ectopically expressing miR-29c in 95C cells without the treatment of TGF-β1 could significantly inhibit the mRNA expression and overexpression of miR-29c in 95C cells with treatment of TGF-β1 was also able to down-regulate the TGF-β1 expression when compared to the 95C cell transfected with negative control miRNA (Figure 6A). [score:13]
Thus, the role of Sp1 in EMT was analyzed and the results indicated that overexpression of Sp1 in 95C cells could abrogate the miR-29c -induced inhibition of EMT by the up-regulation of TTF-1 and E-cadherin, and down-regulation of vimentin and α-SMA in mRNA (Figure 5A and 5C) and protein level (Figure 5B and 5D). [score:11]
In this study, we found that TGF-β1 could inhibit the expression of miR-29c, which up-regulate the Sp1 expression for the induction of EMT. [score:10]
The mRNA of EMT -associated markers were analyzed and we found that overexpression of miR-29c significantly repressed the TGF-β1 -induced down-regulation of TTF-1 and E-cadherin, and up-regulation of vimentin and α-SMA (Figure 3A and 3D). [score:9]
Although miR-29c was reported to directly target the 3′ UTR of Sp1 to repress its expression and regulated type I collagen production under TGF-β1-stimulated kidney fibrosis [15], the relationship between Sp1 and miR-29c in TGF-β -induced EMT during the development of lung cancer was incompletely known. [score:8]
Additionally, miR-29c suppresses lung cancer cell adhesion to extracellular matrix (ECM) and metastasis by directly inhibiting integrin β1 and MMP2 expression and by further reducing MMP2 enzyme activity [18]. [score:8]
The results shown that overexpression of miR-29c inhibitors could enhance the ability of migration and invasion of 95C and A549 cells (Figure 2B and 2C), which indicated that the inhibition of miR-29c was conducive to the metastasis in lung cancer. [score:7]
Figure 3The mRNA and protein expression of TGF-β1 -induced EMT -associated markers including TTF, E-cadherin, vimentin and α-SMA were analyzed in (A– C) 95C and (D– F) A549cells with ectopically expressing miR-29c inhibitors or mimics. [score:7]
95C cell and A549 cells were ectopically expressed of miR-29c mimics and Sp1 could remarkably enhance the ability of migration and invasion (Figure 4C and 4D) which indicated that the overexpression of Sp1 could abrogate the miR-29c -induced inhibition of metastasis in lung cancer. [score:7]
These findings implied that miR-29c could directly target Sp1 and the down-regulation of miR-29c might participate in the tumor metastasis. [score:7]
To conform the directly target relationship, ectopically expressing miR-29c mimics in 95C cell line could significantly reduce the protein levels of Sp1, although the mRNA level of Sp1 was unchanged (Figure 1E and 1F). [score:6]
Inhibition of miR-29c or Sp1 overexpression dramatically enhanced the cell migration and invasion via the regulation of TGF-β -induced EMT. [score:6]
Moreover, ectopically expressing miR-29c mimics in 95C cells could repress the Sp1 -induced enhancement of TGFB1 transcription via directly targeting Sp1 (Figure 6G). [score:6]
MiR-29c targets Sp1 and is down-regulated in lung cancer tissues and high-metastatic lung cancer cell lines. [score:5]
Thus, miR-29c could serves as a tumor metastasis suppressor, which negatively controls the cancer metastasis via targeting many molecules including Sp1, GNA13, PTP4A, integrin β1 and MMP2. [score:5]
Sp1 overexpression could restore the miR-29c -induced inhibition of EMT. [score:5]
The results from Q-PCR indicated decreased mRNA expression of miR-29c and enhanced expression of Sp1 in lung cancer tissues (Figure 1A and 1B). [score:5]
The 95C and A549 cells were ectopically expressed miR-29c inhibitors (Figure 2D). [score:5]
The transcriptional factors Sp1 was reported to be the target of miR-29c in kidney tubular epithelial cells and we found that the expression of Sp1 was enhanced in lung cancer cell lines 95C, 95D and A549 than that in normal human epithelial cell line BEAS-2B. [score:5]
Figure 5The mRNA and protein expression of TGF-β1 -induced EMT -associated markers including TTF, E-cadherin, vimentin and α-SMA were analyzed in (A– B) 95C and (C– D) A549 cells with ectopically expressing miR-29c mimics or pcDNA-Sp1. [score:5]
The mRNA and protein expression of TGF-β1 -induced EMT -associated markers including TTF, E-cadherin, vimentin and α-SMA were analyzed in (A– B) 95C and (C– D) A549 cells with ectopically expressing miR-29c mimics or pcDNA-Sp1. [score:5]
Whereas, the treatment of miR-29c inhibitor promote the tumor progression with enhanced of Sp1/ TGF-β1 expression (Figure 6D and 6E). [score:5]
MiR-29c targets Sp1 and is down-regulated in high-metastatic lung cancer cell lines. [score:5]
Overexpression of Sp1 impairs miR-29c -induced inhibition of EMT. [score:5]
Figure 6(A) The TGF-β1 expression in overexpression of miR-29c mimics or negative control was analyzed by Q-PCR in 95C cells with or without the treatment of TGF-β1. [score:5]
MiR-29c could inhibit Sp1/TGF-β1 expression and lung cancer progression. [score:4]
We here demonstrated that Sp1 could remarkably enhance the ability of migration and invasion of lung cancer, and miR-29c could directly target the Sp1-3’UTR and impair the TGF-β1 -induced EMT via Sp1. [score:4]
Summary diagram describes the miR-29c/Sp1 network that regulates TGF-β1 expression and TGF-β1 -induced EMT. [score:4]
TGF-β1 could inhibit the miR-29c/Sp1 axis, and in turn, the impaired miR-29c/Sp1 axis formed an auto-regulatory loop with TGF-β1, which enhances TGFB1 transcription for TGF-β1 -induced EMT. [score:4]
In addition, miR-29c impaired the CRC cells migration and invasion abilities in vitro and cancer metastasis in vivo by directly targeting guanine nucleotide binding protein alpha13 (GNA13) and protein tyrosine phosphatase type IVA (PTP4A) [14]. [score:4]
Oligonucleotide sequences of miR-29c mimics, inhibitor, siRNA-Sp1 was purchased from RiboBio (Guangzhou, china). [score:3]
The miR-29c mimics, inhibitor or negative control (10 nM per injection) were purchased from RiboBio (Guangzhou, china) and were delivered via intra-tumoral injection for six times, three days apart. [score:3]
Moreover, the level of Sp1 was increased upon the treatment of TGF-β1 in two lung cancer cells (Figure 2A), suggesting that miR-29c might function as a tumor suppressor and impair the TGF-β1 -induced EMT. [score:3]
The results showed that miR-29c mimics and siRNA-Sp1 could significantly impair the luciferase activity of TGFB1 (Figure 6D and 6E), but overexpression of Sp1 could, in turn, enhance the transcription of TGFB1 (Figure 6F). [score:3]
Meanwhile, TGF-β1 could be restored by decreased miR-29c/Sp1 signals, leading to enhanced TGF-β1 expression. [score:3]
Although Sp1 was found to be targeted by miR-29c, this relationship in TGF-β -induced EMT in carcinogenesis is unknown. [score:3]
We had confirmed that overexpressed the miR-29c mimics into 95C cells and A549 cells were able to significantly impair the TGF-β1 -induced EMT. [score:3]
In addition, we overexpressed the miR-29c mimics into 95C cells with the treatment of TGF-β1. [score:3]
We had demonstrated that the miR-29c could inhibit the migration and invasion of 95C and A549 cells, then the effects of miR-29c on EMT was determined. [score:3]
The mice treated with miR-29c mimics had decreased Sp1/ TGF-β1 expression in tumor tissue and showed a delayed tumor growth with less tumor volume than that treated with PBS or negative control (Figure 6H and 6I). [score:3]
miR-29c inhibits TGF-β1/Sp1 network and tumor progression in vivo. [score:3]
In human colorectal carcinoma (CRC), zhang et al. had found that miR-29c could inhibit EMT and impair Wnt/β-catenin signaling pathway. [score:3]
These data indicated that miR-29c could target Sp1/TGF-β1 loop to repress carcinogenesis of lung cancer in vivo. [score:3]
Inhibition of miR-29c significantly elevates the migration and invasion. [score:3]
The miR-29c mimics, inhibitor or negative control were delivered via intra-tumoral injection for six times, three days apart. [score:3]
Our study provides the evidence that, in lung cancer, Sp1 could be repressed by miR-29c in translational level. [score:3]
Besides, in renal fibrosis, miR-29c/Sp1 signals could inhibit type I collagen production under TGF-β1-stimulated kidney fibrosis [15]. [score:3]
Interestingly, zhang et al. had found that miR-29c could inhibit EMT and abrogate Wnt/β-catenin signaling pathway in human colorectal carcinoma. [score:3]
The Q-PCR results had shown that the expression of miR-29c was lower in lung cancer cell lines 95C, 95D and A549 than that in the normal human epithelial cell line BEAS-2B (Figure 1C). [score:3]
Sp1 could restore the miR-29c -induced inhibition of metastasis. [score:3]
Thus, we determined the expression of the miRNA-29c in TGF-β1 stimulated 95C and A549 cells and found that miRNA-29c was decreased by TGF-β1 (Figure 2A). [score:3]
These results support the idea that TGF-β1 not only impaired the miR-29c/Sp1 axis, but could be inhibited by miR-29c, which leading to forming the miR-29c/Sp1/TGF-β1 network in lung cancer progression (Figure 7). [score:3]
Figure 2(A) The expression of mir-29c and Sp1 in TGF-β1 -treated cells. [score:3]
Transwell assay was performed and (B– C) the migration and invasion of 95C and A549 cells transfected with miR-29c inhibitors were determined. [score:2]
Interestingly, we also found the expression of miR-29C is remarkably lower in the paired high-metastatic lung cancer cell line 95D when compared to the low-metastatic lung cancer cell line 95C. [score:2]
Moreover, miR-29c/Sp1 could form an auto-regulatory loop with TGF-β1, which impaired TGFB1 transcription. [score:2]
For investigate the tumor suppressive role of miR-29c in vivo, 3 × 10 [6] A549 cells were subcutaneously injected in rear flank of nude mice (6 per group). [score:1]
Xiao et al. revealed that miR-29c/Sp1 signals participated into the chemotherapy resistance to temozolomide (TMZ) in glioma [17]. [score:1]
The protein levels of EMT -associated markers were also confirmed by western blotting which shown the similar results, indicating that miR-29c could reverse the TGF-β1 -induced EMT in 95C cell line (Figure 3B and 3C) and A549 cell line (Figure 3E and 3F). [score:1]
Figure 1(A– B) The level of miR-29c and Sp1 in lung cancer tissues and (C– D) cell lines including BEAS-2B, the paired low-metastatic 95C and high-metastatic 95D and A549 were determined by Q-PCR and. [score:1]
The 95C cells were co -transfected containing 200 ng firefly Luciferase vector, 40 ng Renilla luciferase pRL-TK vector (Promega, USA) and pcDNA-Sp1 or siRNA-Sp or miR-29c. [score:1]
de/apps/zmf/mirwalk/) showed that the 3′-UTR of Sp1 mRNA existed binding sites of miR-29c. [score:1]
We next estimated the role of miR-29c in tumor progression in vivo. [score:1]
These findings were confirmed in vivo and the mice treated with miR-29c mimics showed impaired tumor progression. [score:1]
95C cell line was transfected with miR-29c mimics or negative control. [score:1]
[1 to 20 of 67 sentences]
7
[+] score: 246
We report here that downregulation of the microRNA miR-29 is likely regulating the induction of extracellular matrix protein expression with quiescence: as miR-29 levels decline with quiescence, levels of miR-29 targets increase, and miR-29 overexpression represses the levels of these targets. [score:13]
The genes encoding miR-29 targets followed a general pattern of increasing expression as fibroblasts are serum-starved, decreasing expression as they are restimulated, and highest expression in cells that were contact -inhibited for 7 or 14 days (Figure 3C). [score:11]
As expected, genes predicted to be miR-29 targets by TargetScan were more likely to be repressed by miR-29 overexpression than genes not predicted to be miR-29 targets (Figure 3B). [score:9]
Gene expression microarrays for quiescence and mir-29 targetsContact -inhibited fibroblast gene expression microarrays and serum starvation and restimulation arrays have been previous described [52, 54]. [score:9]
By analyzing the gene expression patterns of microRNA target genes with quiescence, we discovered a strong regulatory function for miR-29, which is downregulated with quiescence. [score:9]
In addition, although TGF-ß can regulate collagen expression independently of miR-29 [76, 77], the similar phospho-Smad3 levels in proliferating and quiescent fibroblasts implies that changes in TGF-ß activity are unlikely to significantly regulate collagen biosynthesis in quiescence, further emphasizing the importance of miR-29 as a regulator of quiescence -associated changes in ECM expression. [score:8]
miR-29 expression is strongly associated with proliferation (Additional File 1, Figure S4), and its predicted targets are upregulated by both methods of quiescence induction. [score:8]
We identified miR-29 targets in dermal fibroblasts by overexpressing miR-29 in asynchronously proliferating fibroblasts and analyzing the ensuing changes in gene expression by microarray analysis. [score:7]
microRNAs downregulated in quiescent cells included miR-18, miR-20, miR-29, and miR-7, and microRNAs upregulated with quiescence included let-7b, miR-125a, miR-30, miR-181, miR-26, and miR-199. [score:7]
If a competition exists for translational resources between the synthesis of proteins required for cell duplication and the synthesis of proteins targeted for secretory pathways, then miR-29 may be able to direct resources between those two processes depending on the proliferative state of the cell. [score:6]
These results suggest that the downregulation of miR-29 expression levels in quiescent fibroblasts is an important contributor to the induction of extracellular matrix genes with quiescence. [score:6]
Although exogenous TGF-ß can downregulate miR-29, immunoblots for Smad3 phosphorylation levels showed no significant difference in autocrine TGF-ß signaling between proliferating and quiescent fibroblasts (Additional File 1, Figure S5B), indicating that the TGF-ß signaling pathway is unlikely to be responsible for the reduction in miR-29 expression in quiescent fibroblasts. [score:6]
These three miR-29 targets were also strongly repressed at the protein level by transfection of miR-29 as compared to transfection of a negative control, non -targeting microRNA, while protein levels of GAPDH and α-tubulin (two proteins from genes not targeted by miR-29) were unaffected (Figure 3D). [score:6]
Target genes annotated by TargetScan 5.1 [55, 56, 112] were considered well-conserved miR-29 targets if P [CT ]>0.5. [score:6]
RCC2 -1.21 Cell cycle SERPINH1 -1.09 ECM SPARC -1.34 ECM TBC1D7 -1.12 N/AGenes listed were significantly repressed by miR-29 transfection according to a one-sided t-test at 5% FDR, had log [2 ]fold changes of <-1.0, and are evolutionarily conserved miR-29 targets as annotated by TargetScan. [score:5]
Immunoblotting for miR-29 targetsFibroblasts were reverse transfected with miR-29b or a negative control microRNA as above, but cells were plated at either 7,500 cells/cm [2 ](proliferating and mitogen-starved conditions) or 750,000 cells/cm [2 ](contact -inhibited condition). [score:5]
The microarray data generated for this study (the and the miR-29 overexpression microarrays) have been deposited in the NCBI Gene Expression Omnibus (GEO) [114] as one SuperSeries under the accession number GSE42614. [score:5]
miR-29 regulates collagen and collagen-chaperone genesGene ontology analysis of predicted, evolutionarily conserved miR-29 targets revealed an enrichment for multiple categories including collagen fibril organization and extracellular matrix formation (Additional File 1, Table S3), indicating that miR-29 most likely regulates extracellular matrix (ECM) biosynthesis in fibroblasts, consistent with previous reports on miR-29 in fibroblasts and other cell types [67- 72]. [score:5]
Gene expression microarrays for quiescence and mir-29 targets. [score:5]
Using microarrays and immunoblotting, we confirmed that miR-29 targets genes encoding collagen and other extracellular matrix proteins and that those target genes are induced in quiescence. [score:5]
We suggest an alternative possibility: relieved of the commitment to translate and fold extracellular matrix proteins like collagen, miR-29 -overexpressing cells may be able to commit more rapidly to the cell cycle. [score:5]
miR-29 targeting of DNA methyltransferases 3A and 3B, for example, can inhibit lung cancer cell tumorigenicity [104]. [score:5]
miR-29 can also induce apoptosis in cholangiocarcioma cells via the miR-29 target MCL-1 [105], and induce replicative senescence in HeLa cells by targeting B-MYB [106]. [score:5]
This may reflect the activity of a miR-29 target gene; indeed, one target, RCC2 (TD-60), is repressed about 57% upon miR-29 transfection (Figure 3A and Table 1), and it plays an essential role in progression through metaphase [79]. [score:5]
Gene ontology analysis of predicted, evolutionarily conserved miR-29 targets revealed an enrichment for multiple categories including collagen fibril organization and extracellular matrix formation (Additional File 1, Table S3), indicating that miR-29 most likely regulates extracellular matrix (ECM) biosynthesis in fibroblasts, consistent with previous reports on miR-29 in fibroblasts and other cell types [67- 72]. [score:4]
Because our data indicate that the activity of the TGF-ß signaling pathway is similar in proliferating and quiescent fibroblasts, it is not likely that TGF-ß is regulating the changes in miR-29 expression between these states. [score:4]
Besides miR-29, however, there were few microRNAs with strongly anti-correlated target genes. [score:3]
Although miR-29 has been reported to be an oncogene (transgenic mice overexpressing miR-29 in their B cells develop B-cell chronic lymphocytic leukemia [107]) our microarray data revealed no clear candidate cell cycle genes that would explain the early re-entry phenotype we observed in our mo del system. [score:3]
To further explore the effects of miR-29 expression on the cell cycle, we transfected miR-29 or a negative control microRNA into asynchronously cycling fibroblasts. [score:3]
Autocrine TGF-ß is unlikely to mediate miR-29 expression changes in quiescence. [score:3]
We investigated three proteins encoded by miR-29 targets (collagen I, collagen III, and collagen VI) by immunoblot analysis of protein lysates isolated from proliferating cells and cells made quiescent by mitogen (PDGF) withdrawal or contact inhibition. [score:3]
Immunoblots to GAPDH and α-Tubulin are shown as examples of genes not targeted by miR-29 and as loading controls. [score:3]
The findings place miR-29 among the very few molecules discovered, along with FoxO [98- 100], and FoxP [101, 102] transcription factors, and the regulators of miR-29 itself, to regulate the induction (as opposed to the repression) of genes in quiescent cells. [score:3]
From this perspective, it is particularly interesting that miR-29 overexpression results in more rapid cell cycle entry. [score:3]
For miR-29 overexpression microarrays, fibroblasts were transfected as described below with Pre-miR miR-29b or Negative Control #2 oligonucleotide duplexes (Life Technologies). [score:3]
Immunoblotting for miR-29 targets. [score:3]
Reporter assays by multiple independent groups have found in several different cell types that miR-29 directly targets collagens COL1A1, COL3A1, and COL4A2 in a seed sequence -dependent manner [95- 97]. [score:3]
Autocrine TGF-ß is unlikely to mediate miR-29 expression changes in quiescenceTGF-ß signaling leads to an increase in collagen synthesis [73] and can repress miR-29 [69, 74, 75]. [score:3]
These genes were therefore highly anti-correlated with the pattern of expression for miR-29 itself (Additional File 1, Figure S4). [score:3]
The miR-29 family's targets had the most statistically extreme mean proliferation index, with a P value <10 [-4 ](the lowest P value possible based on the 10 [4 ]bootstrap resamplings taken). [score:3]
In addition, overexpression of miR-29 resulted in more rapid cell cycle re-entry from quiescence. [score:3]
miR-29 overexpression thus hastens re-entry into the cell cycle from a quiescent state. [score:3]
miR-29 regulates collagen and collagen-chaperone genes. [score:2]
We suggest that the role of miR-29 in hastening cell cycle re-entry, however, may reflect its effects not on validated cell cycle regulators, but instead on extracellular matrix proteins. [score:2]
When compared to cells transfected with a control non -targeting microRNA, cells transfected with miR-29 contained fewer cells in G [0]/G [1 ]and more cells in S phase at 20 and 24 h post transfection (Figure 4A, P = 1. [score:2]
Based on those studies and our microarray and immunoblot results, miR-29 likely also represses collagens directly in proliferating fibroblasts. [score:2]
Other possible candidates for miR-29 transcriptional regulation include NF-κB and sonic hedgehog [70, 103]. [score:2]
We sought to confirm whether miR-29 regulates not just transcript abundance, but also protein levels of extracellular matrix components in quiescent cells. [score:2]
We identified genes that both changed significantly in the microarray analysis and contained predicted miR-29 binding sites. [score:1]
At 28 and 32 h after transfection, cells transfected with miR-29 contained fewer cells in S phase and more cells in G [2]/M phase than those transfected with the control (P = 0. [score:1]
We also tested whether miR-29 has a role in the cell cycle transition between proliferation and quiescence by simultaneously restimulating serum-starved fibroblasts to proliferate with full serum medium and transfecting them with miR-29. [score:1]
Repression of RCC2 could explain the G [2]/M arrest phenotype seen with miR-29 transfection. [score:1]
TGF-ß signaling leads to an increase in collagen synthesis [73] and can repress miR-29 [69, 74, 75]. [score:1]
miR-29 hastens cell cycle re-entry from quiescence. [score:1]
miR-29's role in quiescence. [score:1]
We confirmed that exogenous addition of TGF-ß repressed miR-29 expression, as measured by qRT-PCR (Additional File 1, Figure S5A), in our dermal fibroblast mo del. [score:1]
miR-29 hastens cell cycle re-entry from quiescenceWe also tested whether miR-29 has a role in the cell cycle transition between proliferation and quiescence by simultaneously restimulating serum-starved fibroblasts to proliferate with full serum medium and transfecting them with miR-29. [score:1]
Figure 3 miR-29 repression of extracellular matrix protein production with quiescence. [score:1]
Thus, miR-29 transfection in proliferating cells led to G [2]/M arrest rather than increased mitosis. [score:1]
We monitored the functional roles of let-7 and miR-125 on cell cycle re-entry from quiescence using the same method we used for miR-29 as described above. [score:1]
Figure 4Cell cycle and cell size effects of microRNAs let-7, miR-125, and miR-29. [score:1]
As expected considering that cells in the G2/M phase tend to be larger than cells in other phases of the cell cycle, miR-29 transfection also led to larger cells (Figure 4D). [score:1]
Further experimentation revealed that miR-29 transfection resulted in fewer cells than the negative control transfection (Figure 4C, P = 0. [score:1]
miR-29's role in quiescenceOne of the functional changes that we previously observed in quiescent fibroblasts is an overall induction of extracellular matrix proteins [52]. [score:1]
Forty-eight hours post transfection, miR-29 transfection led to more cells in G [2]/M (Figure 4B). [score:1]
[1 to 20 of 65 sentences]
8
[+] score: 239
Taken together, the present study shows that bladder outlet obstruction, such as that seen in elderly men with enlarged prostate glands, leads to reduced expression of miR-29b and miR-29c in the bladder and that this is associated with increased expression of miR-29 targets, including the matrix proteins elastin and Sparc. [score:7]
Expression of all six of these targets peaked at the nadir of miR-29c expression (compare Figure 3B with Figure 2A), and they declined sharply on de-obstruction when the miR-29c level recovered. [score:7]
Human detrusor cells were transfected with miR-29c inhibitor and eight validated miR-29 targets, most of which were represented among the top 50 predicted targets in Figure 3A, were examined using western blotting. [score:7]
We also demonstrate that genetic depletion of miRNAs, including miR-29, increases bladder elastin expression and stiffness independently of outlet obstruction and that miR-29 inhibitor transfection in vitro replicates several of the expression changes associated with miR-29 repression in outlet obstruction. [score:7]
Together, these circumstances may well explain the more widespread apparent impact of miR-29 repression in outlet obstruction (8/8 examined target proteins increased) compared to inhibitor transfection (4/8 examined target proteins increased). [score:6]
Four of the eight selected miR-29 targets, including Eln (elastin or tropoelastin), Fos (also known as c-Fos), Sparc (osteonectin) and sprouty homolog 1 (Spry1), were significantly increased following inhibitor transfection (Figure 3D, left row). [score:5]
For tropoelastin, whose mRNA correlated inversely and significantly with miR-29 in outlet obstruction, we found that transfection of a miR-29c inhibitor resulted in increased tropoelastin expression. [score:5]
To address the functional impact of miR-29, we transfected a miR-29 inhibitor and mimic in vitro and conditionally deleted Dicer in vivo [5] and examined the effect of these interventions on tropoelastin expression and on tissue mechanical properties. [score:5]
Currently, we can only speculate on the role of these proteins in outlet obstruction, but it is of considerable interest that the miR-29 target Spry1 [14], which is an established ERK1/2 inhibitor [49], increases after prolonged outlet obstruction. [score:5]
Of the 30 miRNAs that are highly expressed in the mouse detrusor [5, 41] none except miR-29 is predicted to target tropoelastin. [score:5]
For miR-29c inhibitor and mimic experiments, cells were transfected with miR-29c inhibitor (Thermo Scientific, Pittsburgh, PA, USA; 20nM), mimic (Mission miRNA: Sigma-Aldrich, St. [score:5]
Some predicted and confirmed miR-29 targets, including Fbn1, which is an integral part of the elastic fiber meshwork, and Lamc1, a protein present in the basement membrane, were increased in outlet obstruction but were not significantly affected at the protein level following inhibitor transfection (not shown). [score:5]
Additional regulatory inputs on miR-29 expression include c-Myc and NF-κB [11], and recent work has provided considerable insight into c-Myc -mediated repression, which appears to depend on a repressor complex consisting of c-Myc, histone deacetylae 3 (Hdac3) and enhancer of zeste homologue 2 (Ezh2) [18]. [score:4]
Detrusors from smooth muscle-specific Dicer knockout mice were used to examine if reduction of miR-29 in vivo increases tropoelastin expression. [score:4]
We found that Dicer knockout reduced miR-29b and miR-29c by about half and increased tropoelastin expression. [score:4]
Sparc, Spry and Fos were similarly reciprocally regulated by miR-29c inhibitor and mimic, and increased in outlet obstruction. [score:4]
The extracellular matrix molecule elastin is one of the best established targets of miR-29, and its message has 14 binding sites dispersed over the coding sequence and the 3’UTR [12]. [score:3]
Expression of (E) miR-29c and (F) miR-29b in vehicle -treated (control) and TGF-β1 -treated human urinary bladder smooth muscle cells. [score:3]
Time courses of (A) miR-29c and (B) miR-29b expression following rat bladder outlet obstruction. [score:3]
Transfection of miR-29c inhibitor and mimic. [score:3]
0082308.g002 Figure 2Time courses of (A) miR-29c and (B) miR-29b expression following rat bladder outlet obstruction. [score:3]
Repression of miR-29 after outlet obstruction is associated with increased levels of miR-29 target proteins. [score:3]
We first examined expression of miR-29b and miR-29c following 5 weeks of Dicer deletion and found both miRNAs to be reduced (Figure 6A, B). [score:3]
MiR-1 (not shown), miR-29b, and miR-29c returned significant associations with target mRNA levels. [score:3]
We plotted the mean expression of these mRNAs versus the mean miR-29c level in sham-operated control bladders, after 10 days and 6 weeks of obstruction, and after 10 days of de-obstruction. [score:3]
Outlet obstruction and transforming growth factor β (TGF-β1) stimulation leads to reduced expression of miR-29. [score:3]
0082308.g005 Figure 5(A) Western blots for eight miR-29 targets in sham-operated control bladders and at 6 weeks of obstruction. [score:3]
We also examined if the reduction of miR-29 correlated with altered miR-29 target mRNAs, including tropoelastin and Sparc. [score:3]
6 weeks) of the top 50 mRNA targets of miR-29 when miR-29 was repressed at 10 days and when miR-29 recovered after de-obstruction (c. f. Figure 2A and B). [score:3]
sham) of miR-29 target messenger RNAs (mRNA; black circles) and proteins (white circles). [score:3]
Considerably more time was moreover allowed for de-repression of miR-29 targets in the in vivo setting (6 wk vs. [score:3]
It may be argued that a miRNA other than miR-29 is responsible for altered tropoelastin expression in Dicer KO bladders. [score:3]
Outlet obstruction and TGF-β reduce miR-29 expression. [score:3]
MiR-29b and miR-29c were among the 63 differentially expressed miRNAs in outlet obstruction (q=0; n=6−8; GEO accession number GSE47080). [score:3]
This revealed a pronounced increase around individual cells and around muscle bundles in obstructed bladders, consistent with its increased mRNA level and with the fact that it is a miR-29 target [48]. [score:3]
We next set out to determine miR-29 expression. [score:3]
Time courses of expression for miR-29c and miR-29b from the microarray experiment are depicted in Figure 2A and 2B. [score:3]
A previous microarray study [31] with close to genome-wide coverage showed that overexpression of miR-29c reduced six mRNAs: Col4a1; Fbn1; Lamc1; collagen, type XV, α1 (Col15A1); thymine-DNA glycosylase (Tdg); and collagen, type III, α1 (Col3A1). [score:3]
Real-time quantitative PCR to confirm reduced expression of miR-29. [score:3]
The experimental support for an impact of miR-29 on protein synthesis in the bladder following outlet obstruction extends well beyond a significant correlation between miR-29b/c and target mRNAs. [score:3]
Stimulation with TGF-β1 for 48h led to reduced expression of miR-29c and miR-29b (Figure 2E and F). [score:3]
We next tested whether TGF-β1 reduces miR-29 expression using cultured smooth muscle cells from human bladder. [score:3]
Repression of miR-29 during outlet obstruction is associated with increased levels of miR-29 target messenger RNAs (mRNAs). [score:3]
The matricellular protein Sparc is a confirmed miR-29 target [13] that influences collagen fibril morphology and function [47]. [score:3]
We also predicted the free energies of miR-29c binding to proximal sites in the Eln and Sparc 3’UTRs and found them to be within the range of authentic miRNA-target pairs (Figure S1A, B). [score:3]
Bladder outlet obstruction increases miR-29 target protein levels. [score:3]
Type I and type III collagens are however established targets of miR-29 [10], and their mRNAs were largely unchanged at 10 days and at 6 weeks (Col1a1 at 10 days: up by 15%, q=2.7, p=0.05; Col3a1 at 10 days: up by 12%, q=8.7, p=0.12). [score:3]
Unlike other miRNAs, miR-29 also targets a large battery of collagens, including collagens I and III [10]. [score:3]
This would repress miR-29, and hence it would be more difficult to see an effect of miR-29 inhibition. [score:3]
Our studies support a mo del in which multiple signaling pathways converge on repression of miR-29 in outlet obstruction, facilitating matrix protein expression and leading to altered mechanical properties of the urinary bladder. [score:3]
Real-time quantitative PCR for miR-29c and miR-29b (Figure 2C and D) confirmed reduced expression of both miRNAs at 10 days. [score:3]
MiR-29 target mRNAs change in outlet obstruction. [score:2]
Thus, several independent lines of evidence support a regulatory role of miR-29 in tropoelastin synthesis in the bladder, consistent with the large number of miR-29 binding sites in its mRNA [10, 12]. [score:2]
Several of the miR-29 targets that we studied, including Col15a1, Tdg and Spry1, have not been considered previously in the context of hypertrophic growth and remo deling of the bladder. [score:2]
SMAD proteins belong to a conserved family of TGF-β signal transducers that are regulated by phosphorylation [17], and the repression of miR-29 by TGF-β was shown to involve SMAD3 [16]. [score:2]
The matricellular protein Sparc has three miR-29 binding sites clustered in its proximal 3’ UTR, and, similar to elastin, this protein is effectively regulated by miR-29 in vitro [13]. [score:2]
Real-time quantitative polymerase chain reaction (n=5-7) for miR-29b (A), miR-29c (B) and elastin (Eln, C) in control (Ctrl) and Dicer knockout (KO) mouse bladders. [score:2]
Figure S1 Free energies (ΔG [0]) of miR-29c binding to the proximal 3’UTR site in rat, mouse and human elastin (Eln, panel A) and osteonectin (Sparc, panel B), respectively. [score:1]
Our starting hypothesis was that TGF-β/SMAD3 signaling would repress miR-29 in outlet obstruction. [score:1]
Figure S2 Flow chart showing the mo del proposed for miR-29 repression in outlet obstruction and for miR-29 -mediated matrix remo deling and altered passive mechanical properties. [score:1]
The reduced level of miR-29 leads to increased levels of mRNAs encoding extracellular matrix proteins (3), including elastin and Sparc (osteonectin), but possibly also collagens and fibrillin-1. The resulting protein synthesis and matrix deposition (4) leads to increased detrusor stiffness (5) (and increased elastic modulus) which counteracts (6) further distension. [score:1]
Together, these findings support the view that repression of miR-29, independent of surgical obstruction of the urethra, leads to matrix remo deling. [score:1]
We therefore hypothesized that outlet obstruction leads to SMAD3 phosphorylation repressing miR-29, and that this in turn has an impact on protein synthesis and mechanical properties of the bladder. [score:1]
Studies using cultured cells support the idea that transforming growth factor-β (TGF-β), a central mediator in fibrogenesis, represses miR-29 [16]. [score:1]
Independent confirmation of reduced (C) miR-29c and (D) miR-29b in the obstructed bladder by real-time quantitative polymerase chain reaction (n=6). [score:1]
sham), a time point when miR-29 was reduced (c. f. Figure 2A and B). [score:1]
The miR-29 cluster has gained recognition as a modulator of extracellular matrix production [7- 10]. [score:1]
This hypothesis was based on a handful of prior studies demonstrating increased mRNA levels for different TGF-β isoforms shortly after outlet obstruction (e. g. 24), and on the documented repression of miR-29 by TGF-β/SMAD3 [11]. [score:1]
Thus we measured the eight validated miR-29 target proteins (the same ones measured after inhibitor transfection) at 6 weeks of obstruction. [score:1]
c-Myc and NF-κB are also known to repress miR-29 [11, 18], and both pathways have previously been shown to be activated in outlet obstruction and by mechanical distension [37- 39]. [score:1]
The proposed mo del fits the data presented in this article, but alternative interpretations are possible and steps upstream of miR-29 repression need in vivo corroboration. [score:1]
This supported the possibility that c-Myc and NF-κB, but not SMAD3, might be involved in the repression of miR-29b and miR-29c at 10 days. [score:1]
SMAD3 activation, which is known to be involved in TGF-β -mediated repression of miR-29, was not significantly increased at 10 days when miR-29b and miR-29c appeared to be maximally repressed. [score:1]
Our findings do not provide any further guidance as to which possibility is correct, but they do indicate that SMAD3, which is specific for the miR-29b2/c gene [11], may be involved in chronic repression of miR-29c, but not in its acute reduction. [score:1]
c-Myc -mediated repression of miR-29 involves a complex consisting of c-Myc (Myc), histone deacetylase 3 (Hdac3) and enhancer of zeste homolog 2 (Ezh2) which binds to conserved sequences in the promoters of the miR-29a/b1 and miR-29b2/c genes [18]. [score:1]
MiR-29 -mediated extracellular matrix remo deling has been demonstrated in the infarcted heart [10] and during aortic aneurysm progression [7- 9], but miR-29 also plays roles in cell proliferation, muscle differentiation and apoptosis [11]. [score:1]
It comprises three miRNAs (miR-29a, miR-29b, and miR-29c) derived from two independent genes [10]. [score:1]
Therefore, reduction of miR-29b and miR-29c could well promote collagen production at an unchanged mRNA level at these times. [score:1]
This in turn (2) activates multiple signaling pathways including c-Myc, NF-κB and TGF-β/SMAD3 that in turn repress miR-29. [score:1]
With the possible exception for tropoelastin, transfection of miR-29c mimic was associated with a reduction of these proteins (Figure 3D, right row). [score:1]
Added to the correlation between miR-29c and Col4a1 mRNA this favors a causal relationship between the repression of miR-29 and the increase of Col4a1 in outlet obstruction. [score:1]
Combined, these findings provide support for our hypothesis that miR-29 reduction contributes to increased protein synthesis in the bladder following outlet obstruction and that this in turn influences matrix properties and stiffness (Figure S2). [score:1]
We hypothesized that miR-29 repression may contribute to increased detrusor stiffness in outlet obstruction. [score:1]
We propose that bladder distension leads to repression of miR-29 via three distinct mechanisms and that this has an impact on tropoelastin and Sparc synthesis and on tissue mechanical properties. [score:1]
To address this hypothesis we examined if SMAD proteins are phosphorylated and whether miR-29 is reduced in outlet obstruction. [score:1]
Right row in D shows effect of miR-29c mimic. [score:1]
Eln correlated significantly with miR-29c (Figure 3E) and with the mean of miR-29b and miR-29c (not shown). [score:1]
De-repression of Sparc may thus also contribute to a miR-29 -mediated change of detrusor stiffness in outlet obstruction. [score:1]
Our lack of evidence for SMAD2/3 activation at 10 days, when miR-29b and miR-29c appeared maximally repressed, forced us to consider alternative mechanisms. [score:1]
In view of this outcome we tested if Eln and Sparc mRNAs were individually correlated with miR-29 in outlet obstruction. [score:1]
Sparc correlated with the mean of miR-29b and miR-29c (Figure 3F). [score:1]
For miR-29c this would give three waves of repressive influences that together ensure a rapid yet longstanding decrease in outlet obstruction. [score:1]
We therefore propose that c-Myc/Hdac3/Ezh2 and NF-κB are jointly responsible for repression of miR-29b and miR-29c at 10 days and that SMAD3 is responsible for the sustained repression of miR-29c. [score:1]
The impact of miR-29 in outlet obstruction is likely underestimated by measuring levels of mRNAs because an important mechanism of miRNAs is translational repression. [score:1]
[1 to 20 of 94 sentences]
9
[+] score: 224
Mechanistically, miR-29 binds to seed regions in the 3′-untranslated region of HIV-1 mRNA and targets it to cellular P bodies resulting in viral mRNA degradation and suppression of translation 18. [score:9]
The mechanism of miR-29 downregulation in activated and memory CD4 T cells might involve nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) as stimulation with anti-TCR/CD28 antibodies (which downregulated miR-29) activates NF-κB, a repressor of miR-29 gene expression in myoblasts 47. [score:9]
Together, these results from human subjects are consistent with a protective role for miR-29 in HIV-1 control and suggest that downregulated miR-29 expression could represent a signature of progressive HIV-1 disease. [score:8]
Interestingly, we found that CD4 T cells from HIV-1-infected HLACs showed a marked downregulation of all miR-29 species (Fig. 4a), suggesting that virus -induced mechanisms downregulated miR-29 transcription. [score:7]
Importantly, the ability of IL-21 to overcome HIV-1 -induced miR-29 downregulation was consistent with its ability to also suppress HIV-1 infection when added to HLACs after CD4 T cells have been infected with HIV-1 (Fig. 1e). [score:6]
While splenic CD4 T cells activated with plate-bound anti-CD3 and anti-CD28 antibodies downregulated miR-29, IL-21 treatment still promoted miR-29 expression in these cells (Supplementary Fig. 6a). [score:6]
Using miRNA species-specific quantitative PCR, we detected markedly upregulated expression of all mature miR-29 species in CD4 T cells in IL-21 -treated splenic CD4 T cells from HIV-1 -negative donors (Fig. 2a). [score:6]
Abrogation of IL-21 -mediated miR-29 induction on STAT3 blockade coupled with enriched STAT3 binding to putative regulatory sites within MIR29 genes support STAT3 as a positive regulator of miR-29 expression in CD4 T cells during HIV-1 infection. [score:5]
Intracellular delivery of miR-29 antagomir LNA and inhibition of miR-29 activity in CD4 T cells was confirmed by the enhanced expression of TBX21 and IFNG, two miR-29-repressed genes 31 (Supplementary Fig. 8). [score:5]
Evidence that not all ECs express protective human leucocyte antigen (HLA) class I alleles 32 and that expression of classical HIV-1 restriction factors are indistinguishable between Progs and ECs 46 suggests that an IL-21–miR-29 axis might represent a non-classical HIV-1 restriction mechanism in these individuals. [score:5]
Pharmacological inhibition of STAT3 with the inhibitor WP1066 but not other downstream IL-21R signalling pathways abrogated IL-21 -mediated induction of miR-29, implicating STAT3 in MIR29 gene induction (Fig. 2c and Supplementary Fig. 7b). [score:5]
Conversely, using the human CD4 T-cell line CEM-GXR25 that expresses GFP driven by HIV-1 LTR in a Tat -dependent manner 25, we confirmed that constitutive inhibition of endogenous miR-29 by lentivirus-encoded antisense ‘miR-29-ZIP' enhanced infection with CXCR4-tropic HIV-1 [NL4-3] (Supplementary Fig. 5b). [score:5]
IL-21 did not modulate expression of miR-142-5p, which is expressed in haematopoietic cells 26 (Fig. 2a), indicating that it acted selectively on the miR-29 locus and not on miRNAs generally. [score:5]
MicroRNA-29 also downregulates HIV nef transcripts and nef protein expression which, as nef is essential for optimal HIV-1 production, compromises overall HIV-1 production 17. [score:5]
We quantified miR-29 expression in peripheral blood CD4 T cells from uninfected, treatment naïve HIV-infected progressors (Prog) and EC who suppress HIV in the absence of antiretroviral drugs 32. [score:5]
Indeed, as we report here, severely reduced miR-29 expression is a hallmark of progressive HIV-1 disease 43 45. [score:5]
Consequently, we wondered whether IL-21 regulated expression of the HIV-1-restrictive miR-29 family 17 18, a cluster of highly conserved and co-regulated miRNA that includes miR-29b1/29a and miR-29b2/29c on human chromosome 7 and 1, respectively 23. [score:5]
Relationship between miR-29 expression and HIV-1 disease in humans. [score:5]
These results indicate that IL-21 is able to overcome miR-29 downregulation during HIV-1 infection and that HIV-1 infection did not impair IL-21R signalling in CD4 T cells. [score:4]
IL-21 reverses HIV-1 -induced miR-29 downregulation. [score:4]
Because IL-21 impaired HIV-1 infection when administered before or after viral exposure, we asked whether it can reverse HIV-1 -associated downregulation of miR-29. [score:4]
Taken together, these results implicate an IL-21–miR-29 axis in direct HIV-1 suppression in CD4 T cells and suggest that pretreatment with IL-21 can limit the magnitude of the initial HIV-1 infection in vivo. [score:4]
These results demonstrate that endogenous miR-29 critically regulates the extent of HIV-1 infection of CD4 T cells and suggest that miR-29 likely inhibits early HIV-1 replication steps. [score:4]
On binding to its heterodimeric receptor composed of IL-21Rα and γ [c]-chain, IL-21 activates STAT3, PI3-kinase as well as the MAPK/Erk pathways 3. Thus, to elucidate how IL-21 regulated miR-29 expression, we blocked individual signalling pathways downstream of IL-21R in IL-21 -treated splenic CD4 T cells. [score:4]
The molecular details of miR-29 gene regulation are not well defined but appear to be disease and cell-type specific and likely involves proximal and long-range distal acting cis elements 23. [score:4]
Indeed, we confirmed that splenic CD4 T cells from an HIV-1-infected subject significantly upregulated miR-29 in response to IL-21 treatment (Fig. 4b). [score:4]
These results identify IL-21 as a regulator of miR-29 biogenesis and suggest that IL-21 -mediated inhibition of primary HIV-1 infection was effected through miR-29. [score:4]
By contrast, TCR/CD28 activation of CD4 T cells, which promotes HIV infection 1, downregulated miR-29 (Supplementary Fig. 6a). [score:4]
To address this question, we compared miR-29 expression in purified CD4 T cells isolated from untreated or IL-21 -treated HLACs that were equally infected with HIV-1. As shown in Fig. 4a, treatment with IL-21 completely restored expression of all miR-29 species. [score:4]
To elucidate how IL-21 promoted miR-29 expression, we assessed whether it regulated early steps in miR-29 biogenesis. [score:4]
HLACs were particularly invaluable to our study because mitogen-activated CD4 T cells not only downregulated miR-29 but typically also produce cytokines including IL-2 and IL-15, which promote lentivirus entry 50, potentially obscuring the antiviral effect of IL-21. [score:4]
Quantification of pri-miR-29 transcripts revealed that IL-21 promoted the first step in the miR-29 biogenesis pathway as stimulation with IL-21 increased expression of pri-miR-29 transcripts peaking at about 4 h (Fig. 2b and Supplementary Fig. 7a). [score:3]
Even though memory CD4 T cells contained lower levels of miR-29 compared with naïve T cells, they significantly upregulated miR-29 in response to IL-21 (Supplementary Fig. 6b). [score:3]
Interestingly, we found that humanized mice treated with exogenous IL-21 were largely protected from early HIV-1 infection and reduced viral load in these animals correlated with higher miR-29 expression in splenic CD4 T cells. [score:3]
Not only did IL21 mRNA levels correlate with miR-29 in splenic CD4 T cells (Fig. 7e), we observed a significant inverse correlation between miR-29 expression and plasma HIV-1 titres (Fig. 7f). [score:3]
In further support of its STAT3 dependency, the STAT3-activating cytokines IL-6 and IL-10 also promoted miR-29 expression. [score:3]
Consistent with their ability to activate STAT3, IL-6 and IL-10 also induced miR-29 and suppressed HIV-1 infection in HLACs (Supplementary Fig. 9b). [score:3]
To understand the contribution of miR-29 to IL-21 -mediated suppression in early HIV-1 protection in BLT humanized mice, we evaluated the expression of miR-29 and IL-21 in splenic CD4 T cells from IL-21 -treated and HIV-1-infected animals. [score:3]
We similarly assessed miR-29 expression in total, naïve and memory CD4 T cells, which include highly HIV-1-permissive CD4 T cells 27 28. [score:3]
To determine whether IL-21 -mediated suppression of HIV-1 infection required miR-29, purified splenic CD4 T cells were nucleofected with synthetic miR-29 ‘antagomir' locked nucleic acids (LNA). [score:3]
In this study, we report a novel antiviral activity of IL-21 that is mediated by miR-29 and results in suppressed HIV-1 infection in primary lymphoid CD4 T cells. [score:3]
d. of duplicate wells) of mature miR-29a, miR-29b, miR-29c and miR-142-5p in purified total human splenic CD4 T cells from untreated (medium) or IL-21 -treated HLACs after 12 h. (b) Kinetics of expression (average±s. [score:3]
Collectively, these findings demonstrate a novel and rapid miR-29 -mediated antiviral activity of IL-21 that acts through STAT3 in target CD4 T cells to limit initial HIV-1 infection. [score:3]
IL-21 -mediated HIV-1 suppression requires miR-29. [score:3]
Of note, in contrast to interferon-α (IFNα) that suppressed HIV-1 replication through classical cell-intrinsic restriction factors 22, the antiviral activity of IL-21 coincided with its ability to induce miR-29 compared with other Th1 and Th17 effector cytokines (Supplementary Fig. 9a). [score:2]
Our study is the first to describe an IL-21/STAT3 axis as a regulator of miR-29 transcription. [score:2]
Mir-29 is required for IL-21 -mediated viral suppression. [score:2]
Compared with control-LNA antagomirs, mir-29-LNA antagomirs significantly abrogated the ability of IL-21 to inhibit HIV-1 infection in CD4 T cells (Fig. 3a), indicating that the antiviral activity of IL-21 was at least in part mediated by miR-29. [score:2]
MicroRNA-29 is associated with control of HIV-1 disease. [score:2]
Quantitative PCR analysis with primers across an ∼15 kb upstream of MIR29 showed significantly enriched STAT3 binding to two putative regulatory regions upstream of MIR29B1/29A after IL-21 treatment (Fig. 2d). [score:1]
Together, these results strongly suggest that the IL-21-activated STAT3 transcription factor contributes to the induction of miR-29 genes in CD4 T cells. [score:1]
Given the ability of IL-21 to promote HIV-1 resistance in CD4 T cells through miR-29, it is likely that depletion of IL-21-producing T cells compromises this line of defense against HIV-1, which would suggest that higher pre-infection levels of IL-21-producing cells would indicate better HIV-1 prognosis. [score:1]
Our preceding results strongly supported a significant contribution of an IL-21–miR-29 axis in HIV-1 control prompting us to next determine the relationship between miR-29 and HIV-1 infection in human subjects. [score:1]
To determine specifically whether STAT3 regulates miR-29 transcription, we performed chromatin immunoprecipitation (ChIP) assay with anti-STAT3 antibody on untreated or IL-21 -treated primary human splenic CD4 T cells (Figs 2d,e). [score:1]
Notably, the STAT3 -binding regions we identified overlapped with highly conserved sequences and predicted DNase I hypersensitivity sites in MIR29 genes 47. [score:1]
Pri-miR-29 induction preceded the accumulation of mature miR-29 species, which peaked at about 12 h (Fig. 2b). [score:1]
IL-21 promotes antiviral miR-29 biogenesis. [score:1]
In uncovering an antiviral IL-21–miR-29 axis that impairs early HIV-1 infection, our present study suggests that endogenous IL-21 and strategies that exogenously augment IL-21 or induce pre-existing cellular sources of IL-21 would be beneficial in not only promoting adaptive antiviral immunity but also contribute to limiting the magnitude of the initial HIV-1 infection. [score:1]
Because IL-21 was administered 2 weeks after SIV infection at peak viremia in that study 51, it is possible that already established lentiviral infections escape protective mechanisms induced by IL-21 (including miR-29) rendering this cytokine ineffective at curbing virus dissemination. [score:1]
d. of duplicate wells) of pri-miR-29 (normalized to ACTB) and mature miR-29 (normalized to U6) species in purified CD4 T cells isolated from IL-21 -treated splenocytes. [score:1]
For microRNA depletion, total splenic CD4 T cells were purified using the untouched human CD4 T cell isolation kit (Miltenyi Biotec, #130-096-533) and then nucleofected using the unstimulated human T-cell protocol (VPA-1002; programme U-014; Nucleofector II) with 30 pmol of pooled antagomir LNA against miR-29 (Exiqon #4101448-101, #4100754-101) or control antagomir (Exiqon #199006-101), rested for 4–6 h and re-combined with the CD4 -depleted (Miltenyi Biotec, #130-045-101) splenic HLAC fraction. [score:1]
These results are significant as they demonstrate induction of miR-29 by IL-21 in HIV-1 permissive CD4 T cells that account for productive HIV-1 infection. [score:1]
How to cite this article: Stanley, A. et al. IL-21 induces antiviral microRNA-29 in CD4 T cells to limit HIV-1 infection. [score:1]
Induction of miR-29 by IL-21 is STAT3 dependent. [score:1]
Similarly, fewer HIV-1 late reverse transcripts (RT) and integrated HIV-1 DNA were detected in IL-21 -treated samples (Figs 3c,d), suggesting that the IL-21–miR-29 axis interfered with early HIV-1 replication steps. [score:1]
IL-21 induces antiviral miR-29 through STAT3. [score:1]
[1 to 20 of 66 sentences]
10
[+] score: 171
Specifically, in the heart, miR-29 family up-regulation is associated with cardiac development and growth regulation [59] whereas its down-regulation is involved in cardiac tissue remo deling after myocardial infarction [43]. [score:9]
Age -dependent miR-29 family up-regulation correlates with regulation of collagen and methylation levels in Nothobranchius furzeri heartMiR-29 family, one of the most upregulated miRNAs, was further evaluated for its well-known role during aging and cardiovascular diseases. [score:8]
Red dots show miR-29-sponge up-regulated genes, blue dots show Wild Type up-regulated genes. [score:7]
The increased expression levels of col1a1, col1a2 and col15a1, all known direct targets of miR-29, further confirmed an accumulation of collagen deposition in the miR-29-sponge heart (Fig.   6 panel C). [score:6]
In HCF derived from old donors, all miR-29 family members were upregulated (Figure  S1 panel A), with a parallel decrease of col3a1 expression (Figure  S1 panel B) and global 5mC level (Figure  S1 panel C). [score:6]
Consistently, the DNMT inhibitor RG108 exerted the same effect of miR-29a or miR-29b mimics (Fig.   9 panel C), further suggesting a potential role for miR-29 family in preventing hypoxia -dependent hypermethylation via down-regulation of DNMTs 66, 67. [score:6]
Interestingly, the analysis of miRNA expression performed in different Nfu organs, including brain, liver, heart and skin, revealed miR-29 family together with miR-27d as one of the only two consistently up-regulated miRNAs during aging in all the four tissues (Figure  S5) [34]. [score:6]
Age -dependent miR-29 family up-regulation correlates with regulation of collagen and methylation levels in Nothobranchius furzeri heart. [score:5]
Noteworthy, the ROS scavenger N-acetyl cysteine (NAC) counteracted the effect of H [2]O [2] on expression of miR-29 expression (Figure  S2 panel A and Fig.   4 panel A) suggesting a link between miR-29 and oxidative stress. [score:5]
To functionally analyze the role of miR-29 in the heart we generated a transgenic zebrafish mo del where miR-29 biological activity was antagonized by the stable expression of a competitive inhibitor (a 3′-UTR containing seven repeats of the miR-29 binding site: miR-29-sponge) under the control of the actin beta-2 promoter (actb2:eGFP-sponge-29) of Danio renio 35, 62. [score:5]
Full-length blot is presented in Supplementary Figure 6. (B) qRT-PCR mRNA analysis of hypoxia associated genes: erythropoietin alpha (epoa); hexokinase2 (hk2); heme oxygenase1a (hmox1a); lactate dehydrogenase A (ldha); cyclin -dependent kinase inhibitor 1B (p27) in Wild Type (black circles; n = 4) and miR-29-sponge (gray squares; n = 4) Zebrafish hearts expressed as fold-change versus Wild Type samples. [score:5]
miR-29 family knock-down changes global methylation level and collagen expression in Zebrafish. [score:4]
Of note, the knock-down of miR-29 family in zebrafish transgenic animal embryo by expression of a specific sponge (miR-29-sponge) [35] compromised cardiac function and morphology, enhancing both fibrosis and global DNA methylation. [score:4]
Genes regulated by miR-29 depletion ( ± 0.5 log2 fold change, basemean > 5, fdr < 0.05) derived from mRNASeq of zebrafish samples were imported into the Ingenuity Pathways Analysis Software (Qiagen - Version 39480507) to reveal top disease affected categories by genetic networks. [score:4]
Biological function gene ontology of up-regulated genes in miR-29-sponge Zebrafish hearts (red bars). [score:4]
Given the up-regulation of miR-29 during aging in multiple organs, this protective action could represent a general phenomenon. [score:4]
List of genes is provided also in supplemental table  5. (B) Volcano plot of differentially regulated genes expressed in the heart of Wild Type and miR-29-sponge Zebrafish. [score:4]
Figure 3Age -dependent miR-29 family up-regulation affects collagen and methylation levels in N. furzeri heart. [score:4]
Despite age -dependent upregulation, antagonism of miR-29 exacerbates brain aging indicating that miR-29 has a protective role in neurons [35]. [score:4]
Intriguingly, after treatment with H [2]O [2], the transcripts coding for miR-29 target genes, including col1a1, col11 and dnmt1, dnmt3a and dnmt3b, were down regulated while NAC partially restored their normal mRNA levels (Fig.   4 panels B and C). [score:4]
Moreover, gene ontology analysis of biological functions obtained by Gene set enrichment analysis (GSEA) pointed out an up-regulation of cellular response to stress and methylation (Fig.   7 panel D; red bar graph) as well as a down-modulation of response to oxidative stress and cardiac morphology and functions (Fig.   7 panel D; blue bar graph), which fully correlate with our experimental evidences on miR-29 sponge fish in comparison to Wild Type. [score:4]
Myocardial infarction, in fact, induces a down-regulation of miR-29 which event, in turn, is partially responsible for fibrosis [43]. [score:4]
MiR-29 family, one of the most upregulated miRNAs, was further evaluated for its well-known role during aging and cardiovascular diseases. [score:4]
Interestingly, these miRNAs control the expression of collagen genes and are themselves controlled by TGF-β [44] suggesting for a direct link between miR-29 family and the progress of inflammatory responses. [score:4]
Figure 9Hypoxia affects miR-29 family and its related targets. [score:3]
Similarly, expression of miR-29 counteracts age -dependent oxidative damage in the brain [35]. [score:3]
Figure 4Oxidative stress affects miR-29 family and its targets. [score:3]
Of note, exogenous expression of miR-29a/b mimics rescued the hypoxic and fibrotic phenotype (Fig.   9 panel B) suggesting a possible protective role of miR-29 family to counteract hypoxia-related collagen deposition and consequently fibrosis. [score:3]
Oxidative stress induces expression of microRNA-29 family. [score:3]
Upon miR-29 knockdown, no significant changes were detected in terms of survival during the first year of age (data not shown). [score:2]
Ingenuity pathway analysis on genes regulated by miR-29 depletion ( ± 0.5 log2 fold change, basemean > 5, fdr < 0.05) revealed a predicted activation of the hypertrophic response in miR-29 sponge fish, perfectly fitting with the observed cardiac phenotype (Fig.   7 panel C). [score:2]
Interestingly, 350 transcripts were found up regulated in the miR-29-sponge compare to Wild type hearts (suppl. [score:2]
Taken altogether, these data suggested that miR-29 family is regulated by ROS. [score:2]
In the cardiovascular system, miR-29 family has multiple roles: i) is known to be involved in atrial fibrillation [69]; ii) may act as a negative regulator of fibrosis counteracting miR-21 function 43, 70, 71; iii) controls cardiomyocytes apoptosis and aortic aneurism formation 30, 72. [score:2]
In addition, miR-29 has been described to be up regulated during cardiac aging in mouse [30]. [score:2]
In the present study, by using human cardiac fibroblasts, we demonstrated for the first time that miR-29 family is regulated by oxidative stress level. [score:2]
To further explore the effect of miR-29 family depletion on the cardiac molecular phenotype, RNA sequencing (RNA-seq) was performed on the whole heart of wt and miR-29-sponge fish. [score:1]
Calibration bar = 1 mm (B) Representative echocardiography of Wild Type (left panels) and miR-29-sponge (right panels) Zebrafish hearts showing end-diastolic area (EDA; first and third panel) and end-systolic area (ESA; second and fourth panel) Calibration bar = 1 mm. [score:1]
Hence, we propose here that the physiological accumulation of oxidative stress during aging may control miR-29 family establishing a protective mechanism to limit cardiac fibrosis. [score:1]
Figure 8Hypoxic markers accumulate in miR-29-sponge Zebrafish hearts. [score:1]
This evidence prompted us to investigate miR-29 family expression in cardiac fibroblasts maintained in the presence of 1% O [2], the standard in vitro hypoxic condition. [score:1]
Specifically, miR-29 sponge fish showed a FAC of 16%, whereas control animals had values of about 30% (Fig.   5 panel D). [score:1]
For long RNA sequencing, RNA was isolated from 3 zebrafish hearts for each condition (wt and miR-29-sponge) using the miRNeasy micro Kit (Qiagen) combined with on-column DNase digestion (DNase-Free DNase Set, Qiagen) to avoid contamination by genomic DNA. [score:1]
In order to assess cardiac function in Wild type and miR-29-sponge zebrafish, animals were anesthetized with low-dose tricaine solution (0.04 mg/mL) and placed in a Petri dish filled with a custom-made sponge, with the ventral side upward. [score:1]
To investigate the effect of hypoxia on miR-29 family and its targets, HCFs were exposed to 1% O [2] concentration for 48 hours. [score:1]
In this perspective, miR-29 family members are of particular interest for cardiac pathophysiology. [score:1]
miR-29 family resulted sensitive to 200 µM H [2]O [2] already after 24 h of treatment (Figure  S2 panel A and Fig.   4 panel A). [score:1]
Morphologically, we found a significant cardiac spherization in fish injected with miR-29-sponges detectable by 2D-echo analysis (Fig.   5 panel B) and visible hypertrophy that were confirmed by histological examinations (Fig.   5 panel E). [score:1]
Indeed, our results suggest that the miR-29 family strongly affects gene transcription possibly via age-associate DNA methylation changes in Nfu. [score:1]
Because of its biological relevance in cardiac pathophysiology, we focused our attention on miR-29 family. [score:1]
Moreover, miR-29 family play a role during DNA methylation / demethylation control [57] and cellular reprogramming [58]. [score:1]
The sensitivity of miR-29a and miR-29b to O [2] reduction was confirmed also by pri-miR-29 analysis. [score:1]
Hematoxylin/eosine-stained sections were prepared to visualize ventricle of wt and miR-29-sponge zebrafish. [score:1]
To investigate the potential relationship between the accumulation of ROS in the heart (see Fig.   1 panels D and E) and the increase in miR-29 family member expression (Fig.   3 panel A), differentiated H9C2 rat cardiomyoblasts and human cardiac fibroblasts (HCF) were exposed to H [2]O [2] [46]. [score:1]
Hypoxia induces hypermethylation and fibrosis by miR-29 family down-modulation. [score:1]
Figure 7Identification of miR-29 associated cardiac transcriptome. [score:1]
In these experiments, we detected a transient down-modulation of miR-29a and miR-29b leading to collagen deposition and fibrosis, a molecular scenario similar to that observed in the heart of the miR-29-sponge transgenic fish. [score:1]
Calibration bar = 25 µm (B) Collagen deposition quantification in sections derived from Wild Type (black circles; n = 8) and miR-29-sponge (gray squares; n = 8) Zebrafish hearts. [score:1]
[1 to 20 of 58 sentences]
11
[+] score: 145
Gene ontology terms that are significantly enriched in a cluster are marked to the right of the heatmap miR-29 targets involving extracellular matrix are stabilized during quiescenceTo identify potential regulators responsible for a coordinated change in the stability and expression of genes, we used predicted miRNA targets from TargetScan [24] as gene set references and identified gene sets for which the differences in corrected decay constants (see ) between conditions were different for the genes in each miRNA target set as compared to genes outside of the target set [25]. [score:13]
We observed that experimentally-validated miR-29 targets exhibited an even stronger gene expression-stability signature of upregulation of gene expression and transcript stabilization with quiescence than the set of computationally predicted targets (Fig.   4b). [score:12]
Regulators of gene expression such as miR-29 serve as candidate targets for affecting the expression of extracellular matrix expression, for instance, in fibrotic disease. [score:12]
Since miRNA target prediction can include many false positives and targets that are only regulated in specific biological contexts, we refined this target set even further by focusing on the specific transcripts that we found to be regulated when miR-29 was introduced into primary human dermal fibroblasts [26]. [score:9]
Downregulation of miR-29 during quiescence resulted in a relief of negative regulation of these miR-29 targets, and thus, they are expressed at higher levels in quiescent than proliferating cells. [score:9]
Enrichment tests and violin plots displaying the differences in decay constants P [constant] – CI7 [constant] for targets of each miRNA were performed using the GSEAMA package (David Robinson – Princeton University) implemented in R. The difference in decay constants between P and CI7 fibroblasts from miR-29 targets were compared to non-targets using a Chi-squared test for independence to test whether miR-29 targets versus non-targets had a higher proportion of genes that decayed faster during proliferation as compared to quiescence. [score:9]
The decay and gene expression profiles of computationally-predicted miR-29 collagen-related targets show a strong pattern of stabilization of miR-29 targets in the quiescent state, and higher expression of the associated genes in the quiescent compared with the proliferating state (Fig.   4a). [score:8]
Our data identified examples of both cases where a portion of miRNA targets were more stable during quiescence (including miR-29 targets), and a portion of targets were less stable during quiescence. [score:7]
Moreover, miR-29, a negative regulator of collagen gene expression, is downregulated during quiescence induction. [score:7]
Gene expression and RNA decay constant changes for computationally predicted a and experimentally validated b miR-29 targets. [score:5]
Upregulation of miR-29 during proliferation leads to negative regulation of these same transcripts, which share a common biological function, by decreasing their stability. [score:5]
Analysis of miR-29 target decay rates suggests that microRNA -induced changes in RNA stability are important contributors to the quiescence gene expression program in fibroblasts. [score:5]
Out of the 485 differentially stabilized transcripts, mRNA targets of miR-29, let-7, miR-137, and miR-130 were stabilized with quiescence while miR-17 and miR-200 targets were stabilized with proliferation. [score:5]
The number of transcripts in the distribution is displayed in parentheses after the miRNA family name on the y-axis Fig. 4Gene expression and stability change heatmap for collagen-related miR-29 targets. [score:5]
In summary, miR-29 levels decrease with quiescence and this relief of negative regulation correlates with our observation of increased stability of miR-29 targets. [score:4]
By monitoring transcript decay rates, we can now conclude that the observed miR-29 regulation of quiescence targets reflects changes in mRNA stability. [score:4]
Notably, a stability-regulated cluster was defined by targets of the quiescence -associated miRNA, miR-29, giving further insight into its mechanism of action. [score:4]
We decided to focus on miR-29 targets based on our previous demonstration that miR-29 plays an important functional role in quiescence [26]. [score:3]
In this current analysis, targets of the miR-29 family (miR-29abcd) were significantly more stable during quiescence (χ [2], 1, p < 0.05). [score:3]
Additionally, targets of a quiescence -associated microRNA (miR-29) were significantly enriched in the fraction of transcripts that were stabilized during quiescence. [score:3]
In our previous study, targets of the miR-29 family were more likely to change in abundance with quiescence than the targets of any other microRNA investigated [26]. [score:3]
miR-29 targets are significantly stabilized with quiescence, and are enriched for genes that encode proteins that are found in the ECM or are involved in ECM remo delling. [score:3]
miR-29 targets involving extracellular matrix are stabilized during quiescence. [score:3]
Quiescence mRNA stability miR-29 Gene expression Post-transcriptional regulation Cell-cycle Cellular quiescence is a state of cell cycle arrest that is characterized by the unique ability of cells to exit and re-enter the cell division cycle upon presentation of the appropriate stimulus. [score:2]
The results are also consistent with our findings that miR-29 hastens cell cycle re-entry from quiescence [26]. [score:1]
These results are consistent with our own analysis in which the levels of miRNAs were monitored by microarray and miR-29 levels were discovered to decline relative to other miRNAs in quiescent cells [26]. [score:1]
[1 to 20 of 26 sentences]
12
[+] score: 115
Notably, we also tested whether it is the vmPFC-aIns FC that mediates an indirect path from the level of expressed miR-29c to the subjective stress experience and found no significant mediating effect (indirect effect: -0.21, 95% CI = -0.86 to 0.13). [score:5]
Secondly, we assume that the relationship between miR-29c expression and neural connectivity is due to parallel expression patterns between peripheral blood and relevant brain regions. [score:5]
Of the 6 miRNAs that presented stress -induced changes varying among participants, we focused on miR-29c, previously shown to be expressed in the human prefrontal cortex and involved in psychopathologies such as schizophrenia and bipolar disorder [39], and brain disorders such as Alzheimer's [44], Huntington's [45] and Parkinson's [46] diseases. [score:5]
To test this, we performed a mediation analysis [42], indicating that enhanced vmPFC-aIns FC during stress indeed led to a lasting subjective stress experience via enhanced miR-29c expression (indirect effect = 39.41*, 95% CI = 1.45 to 116.47, Fig 5). [score:4]
Yet, in the current context of acute-stress the relation between enhanced mir29c and dlPFC function is linked to reduced FC with the vmPFC; possibly suggesting a relationship between miR-29c expression and the failure in its recruitment for emotion regulation via a more cognitive process. [score:4]
The additional finding of decreased vmPFC-dlPFC FC related to increased miR-29c expression may reflect the neuro-epigenetic regulation of both the sustained emotional response and the parallel disturbance of cognitive processing. [score:4]
A positive correlation (r = 0.31, p = 0.042, two-sided, Fig 4A) was found between individual miR-29c expression changes and the degree of change in vmPFC-aIns FC (during stress compared to control), and a negative correlation between individual miR-29c expression changes and vmPFC-dlPFC FC (r = -0.36, p = 0.017, two-sided, Fig 4B). [score:4]
Studies point to the up-regulation of miR-29c in schizophrenia and bipolar disorder, both involved in affective and executive control deficits [39]. [score:4]
Due to the temporal trajectory of these neural and behavioral features, we further explored the possibility that vmPFC-aIns FC during stress has an indirect effect on post-stress subjective reports (R4-R3) by the engagement of miR-29c expression change. [score:4]
Relationship between vmPFC FC, mir-29c expression and subjective stress. [score:3]
Measuring the expression of miR-29 family (miR-29a, b, c) in the PFC of mice (see S1 Fig) demonstrated a stress-related increased expression of miR-29b, and further implies the cross species contribution of miR-29 as a family to stress response. [score:3]
Changes in expression levels of miR-29c for all participants is presented in Fig 2A. [score:3]
Out of these, we further examined hsa-miR-29c, based on the previously found expression in the human prefrontal cortex and its suggested involvement in CNS disorders [38, 39]. [score:3]
We further present the novel relationship between the epigenetic level of response and the subjective experience of stress; enhanced miR-29c expression corresponded with sustained stress feelings (Fig 2B). [score:3]
From the neuroimaging perspective, our interpretation of regulation processes might be based on reverse inference, thus we encourage further research investigating whether different stress regulation techniques might have an effect on miR-29c expression along with the perceived subjective stress. [score:3]
27 participants presented a decrease in miR-29c post-stress expression, while 22 participants presented an increase. [score:3]
Specifically, enhanced vmPFC-aIns FC led to higher reported stress levels through increases in miR-29c expression. [score:3]
It is yet unclear how miR-29c mediates this brain-behavior relationship, though one possible mechanism is through the miR-29 family's abundant expression in astorcytes [68]. [score:3]
Our results indicate that increased miR-29c expression is linked with both enhanced vmPFC-aIns FC during stress (Fig 4A) and subjective stress sustainment (Fig 2). [score:3]
0146236.g002 Fig 2 A. MiR-29c stress -induced fold-change (axis y) for all participants (coded in axis x); B. ANOVA analysis between groups revealed that increase in miR-29c expression was related to sustained stress. [score:3]
Correspondence between mir-29c expression change and subjective stress. [score:3]
Although the change in miR-29c expression is relatively modest, it could exert a meaningful impact on cell physiology (for example: [48, 49], see S1 Table). [score:3]
A. MiR-29c stress -induced fold-change (axis y) for all participants (coded in axis x); B. ANOVA analysis between groups revealed that increase in miR-29c expression was related to sustained stress. [score:3]
With regard to the temporal effect of miR-29c, we assume that stress -induced expression changes may occur minutes after induction, thus impacting one’s subjective experience. [score:3]
An ANOVA analysis revealed a larger miR-29c expression change in the stress sustainment group (F(1, 47) = 6.5, p = 0.014, two-sided), with a large effect size (Cohen's d = 0.72). [score:3]
Moreover, post-mortem studies on patients with schizophrenia report altered miR-29c expression in the dlPFC [66, 67]. [score:3]
MiR-29c individual expression. [score:2]
Following the finding of correlation between the miR29c and the enduring of perceived stress we speculated that stress sustainment may have resulted from a failure in spontaneous regulation and thereby the molecular-behavioral association was driven by changes in relevant neural circuits. [score:2]
MiR-29 expression in mice subjected to a social defeat stress. [score:2]
These findings, along with the presumed localization of miR-29c in astrocytes, lead to an intriguing notion: miR-29c may serve as a biomarker in the blood for plastic stress -induced alterations in functionally-distinct neural circuits, reflecting affective-cognitive regulation processes. [score:2]
Consequentially, we ran a series of TaqMan real-time PCR assays to deduce miR-29c expression in all participants (Fig 2A). [score:2]
To further investigate the link between mir-29 and stressful experience, the expression of miR-29 family (miR-29a, b and c) was further acquired and analyzed from brain tissue of socially defeated mice (see S1 File). [score:1]
Raw TLDA data for miR-29c and its endogenous control miR-425. [score:1]
No relationship was found between miR-29c expression and cortisol responsiveness [repeated-measures ANOVA: p = 0.67; and Pearson correlation with AUCi: p = 0.86]. [score:1]
Mediating role of miR-29c in stress sustainment. [score:1]
A. miR-29c fold-change was positively correlated to vmPFC FC with the aIns; B. miR-29c fold-change was negatively correlated to vmPFC FC with the dlPFC. [score:1]
This idea nicely corresponds with our mediation analysis results indicating that vmPFC-aIns FC enhancement is linked to sustainment of subjectively estimated stress (i. e. 20 min following the stress induction) via the neuro-molecular fold change of miR-29c (Fig 5). [score:1]
Correlations between miR-29c fold-change and vmPFC functional connections. [score:1]
0146236.g004 Fig 4 A. miR-29c fold-change was positively correlated to vmPFC FC with the aIns; B. miR-29c fold-change was negatively correlated to vmPFC FC with the dlPFC. [score:1]
Indeed, we found that fold changes in miR-29c were greater on the one hand with increased vmPFC-aIns connectivity and on the other with decreased vmPFC-dlPFC connectivity during stress induction. [score:1]
We present rapid responsiveness of miR-29c to stress induction in PBMCs of healthy humans. [score:1]
miR-29c shows dynamic relations with vmPFC functional connections. [score:1]
A marginally significant correlation was found between the miR-29c fold-change and individual changes in stress ratings in R4-R3 (r = 0.27, p = 0.064). [score:1]
recovery (n = 31, 63.3%) was related to the miR-29c fold-change (Fig 2B). [score:1]
Stress -induced change in miR-29c and sustained subjective stress. [score:1]
The analysis revealed 6 miRNAs that presented stress -induced change: hsa-let-7b, miR-342-3p, hsa-miR-20b, hsa-miR-345, hsa-miR-30c, hsa-miR-29c. [score:1]
[1 to 20 of 46 sentences]
13
[+] score: 112
Among the 7 miRNAs dynamically regulated over the course of normal lung development (Group A), 5 of these miRNAs (miR-411, miR-431, miR-699, miR-29a and miR-29c) were up-regulated by oxygen exposure, suggesting that prolonged hyperoxia alters the expression of miRNAs utilized during normal lung development. [score:9]
Downregulated Ntrk2 expression, regulated by miR-29c, may play an important role for the development of hyperoxia -induced bronchopulmonary dysplasia and clearly represents an avenue for further research. [score:8]
After overexpression of miR-29 was confirmed, we examined mRNA expression for 23 of 25 predicted target genes, excluding 2 with no defined function. [score:7]
Interestingly, we observed increased expression of miR29c in conjunction with decreased expression of its predicted mRNA target Ntrk2. [score:7]
Based on computational predictions from both miRBase and TargetScan, there are a total of 25 predicted target mRNAs for miR-29 within our data displaying decreased expression. [score:7]
For this specific cell type in vitro, one of many in the developing lung, miR-29 was shown to directly modulate expression of predicted target mRNAs. [score:6]
A number of genes identified as predicted miR-29 targets were also validated in a miR-29 overexpression mo del using BASC cells. [score:5]
Figure 4 Effects of hyperoxia on the expression of miR-29 and predicted mRNA targets. [score:5]
Expression of the MiR-29 family is increased during normal mouse lung development, and is known to play an important role in the pathogenesis of lung diseases such as pulmonary fibrosis [28, 29]. [score:5]
MiR-29 targeted gene expression in BASC cells following transfection with miR-29 mimics. [score:5]
Direct miR-29 targets were further validated in vitro using bronchoalveolar stem cells. [score:4]
In our miRNA array and real-time PCR data, miR-29a and miR-29c were increased during normal lung development, and expression was dramatically increased with the induction of hyperoxia (Figure 4A). [score:4]
To investigate direct targets of miR-29, we identified candidate mRNAs by overlapping computational prediction with opposite expression patterns in our miRNA and mRNA data. [score:4]
MiR-29 was then overexpressed in vitro by transfection of miR-29a and miR-29c mimics into bronchoalveolar stem cells (BASC), isolated and cultured in our laboratory as previously described [31]. [score:3]
MiR-29 was prominently increased in the lungs of hyperoxic mice, and several predicted mRNA targets of miR-29 were validated with real-time PCR, western blotting and immunohistochemistry. [score:3]
Ntrk2 mRNA expression was decreased by 43% and 44% (n = 3, p < 0.05) after transfection of miR-29a and miR-29c respectively. [score:3]
MiR-29a and miR-29c overexpression were confirmed by real-time PCR (Additional file 1: Figure S1). [score:3]
We observed a limited degree of coincident expression increases of either miR-29a or miR-29c after transfection of respective miR-29a or miR-29c mimics (Additional file 1: Figure S1). [score:3]
Figure 5 Validation of predicted miR-29 targets. [score:3]
In Group A, the expression values of four miRNA were decreased (Pattern 1; miR-322*, miR-411, miR-431, miR-609) and three were increased (Pattern 2; miR-146b, miR-29a, miR-29c). [score:3]
Relative miR-29 expression in BASC cells after transfection of miR-29 mimics. [score:3]
The overexpression of miR-29a and miR-29c were confirmed by Real-time based TaqMan MicroRNA Assay (Applied Biosystems). [score:2]
MiR-29 modulates predicted target mRNAs in mouse bronchoalveolar stem cells (BASCs). [score:2]
MiR-29 modulates development in the neonatal mouse lung exposed to hyperoxia through Ntrk2. [score:1]
MiRNA mimics including miR-29a mimic, miR-29c mimic and miRNA mimic negative control (Applied Biosystems) were transfected respectively at the final concentration of 25 nM. [score:1]
Analysis of normal lung has shown the presence of miR-29 in subsets of cells in the alveolar wall and entrance to the alveolar duct [28]. [score:1]
Transfection of miR-29 mimics. [score:1]
miR -negative control, * p < 0.05 miR-29c vs. [score:1]
Total mRNA were isolated after 24 hours transfection of BASC cells with miR-29a mimic, miR29c mimic and non-specific miRNA -negative control. [score:1]
The sequence for the miR-29a mimic is UAGCACCAUCUGAAAUCGGUUA; for the miR-29c mimic UAGCACCAUUUGAAAUCGGUUA. [score:1]
After 24 hours following transfection, mRNAs were isolated and miR-29 expression measured by RT- PCR. [score:1]
[1 to 20 of 31 sentences]
14
[+] score: 110
Moreover, miR-29 targets Mcl-1 in human hepatocellular carcinoma cells and acute myelogenous leukemia cells, and its expression is down-regulated in both types of cancer [14]. [score:8]
The regulation of miR-29 expression has been previously studied, and NFκB was shown to negatively regulate miR-29 expression [19], [20]. [score:7]
However, further examination of the expression levels of miR-29 family members in pDCs from SLE patients is necessary to determine whether such factors are abnormally expressed in the diseased state. [score:7]
The results indicated that miR-29 overexpression inhibited both Bcl-2 and Mcl-1 expression (Figure 6B). [score:7]
Transfection of miR-29 enhanced its expression level by approximately 16-fold in comparison to the control group, whereas transfection of the miR-29 inhibitor dramatically reduced its expression level (Figure S4). [score:7]
In our study, we found that the expression of miR-29b and miR-29c were both inhibited by TLR9 stimulation. [score:5]
pDCs were transfected with control (Ctrl), miR-29b mimic, miR-29c mimic, miR-29b inhibitor or miR-29c inhibitor. [score:5]
miR-29b and miR-29c Promote pDC Apoptosis by Targeting Mcl-1 and Bcl-2. miR-29 promotes pDC apoptosis by targeting Mcl-1 and Bcl-2.. [score:5]
Considering that the NFκB pathway is activated by TLR9 in human primary pDCs, it is reasonable to hypothesize that TLR -inhibited miR-29 expression facilitates the function of NFκB in alleviating Dex -induced pDC apoptosis. [score:5]
As other molecules may also be involved in Dex -induced pDC apoptosis, overexpression of miR-29b or miR-29c could not completely eliminate the inhibitory effect of CpG on Dex -induced apoptosis. [score:5]
Further analysis showed that 6 miRNAs were predicted to target Bcl-2 family members, and functional screening demonstrated that miR-29b and miR-29c were involved in TLR -inhibited Dex -induced pDC apoptosis. [score:5]
In this study, we demonstrated that down-regulation of miR-29 was correlated with drug resistance in pDCs, supporting the idea that miR-29 is a pro-apoptotic factor during this process. [score:4]
Although miR-29b and miR-29c show relative low expression levels in fresh pDCs, they could be induced to relatively medium levels during Dex stimulation (Table S3). [score:3]
Therefore, in addition to its previously proposed role as a TLR7/9 antagonist, miR-29 could also represent a new target for anti-autoimmune drug discovery. [score:3]
However, there was no difference in the expression of miR-16 between the Dex- and Dex+CpG -treated samples, indicating that TLR stimulation does not function through miR-16; instead, our results indicated that miR-29b and miR-29c may participate in pDC apoptosis. [score:3]
To verify the effect of miR-29b and miR-29c in pDC apoptosis during Dex stimulation alone, we transfected miR-29b or miR-29c inhibitors to verify their effect on pDC apoptosis after stimulation with Dex alone. [score:3]
Previous reports have demonstrated that both Mcl-1 and Bcl-2 are inhibited by miR-29 in various cell types [14], [15]. [score:3]
Both miR-29b and miR-29c were inhibited by TLR9 stimulation (Figure 6C), and as their miRNA levels decreased, the protein levels of Mcl-1 and Bcl-2 increased. [score:3]
The inhibition of miR-29b and miR-29c was shown to promote pDC survival (Figure S5). [score:3]
We also found that the 3′-UTRs of Mcl-1 and Bcl-2 were targets of miR-29 (Figure 6A). [score:3]
miR-29b and miR-29c are involved in TLR -inhibited Dex -induced pDC apoptosis. [score:3]
Several reports have demonstrated that all 3 miR-29 paralogs are expressed at increased or decreased levels in different types of cancers in comparison to corresponding normal tissues [16]– [18]. [score:3]
Figure S5 Inhibition of miR-29b or miR-29c partly ameliorated Dex -induced pDC apoptosis. [score:3]
Our study further found that miR-29b and miR-29c induced less apoptosis in comparison to Dex treatment alone (Figure 5). [score:1]
0069926.g005 Figure 5 (A, B) Primary pDCs were transfected with control (Ctrl), miR-1, miR-101, miR-148, miR-29b, or miR-29c mimics. [score:1]
Notably, miR-29 has been hypothesized to positively associate with p53 to induce apoptosis. [score:1]
miR-29b and miR-29c Rescue Dex -induced pDC Apoptosis during CpG Stimulation. [score:1]
These results further indicated that miR-29b and miR-29c are involved in pDC apoptosis. [score:1]
In support of this notion, miR-29 -deficient mice were shown to have significantly greater numbers of Th1 cells and increased IFN-γ production [20]. [score:1]
A total of 120 miRNAs were induced by Dex, including many known pro-apoptotic miRNAs, such as those of the let-7 family, miR-16, -23a, -31, -98, and -101, the miR-29 family, the miR-30 family, and the miR-320 family, among others. [score:1]
[1 to 20 of 30 sentences]
15
[+] score: 104
Thus, low expression levels of miR-200 family members, together with low expression of miR-29, may create permissive conditions for high expression of ADAM12-L in claudin-low tumors and cell lines. [score:7]
We have selected to study two representative miRNAs from each family: miR-29b (a potent inhibitor of breast tumor metastasis [34]) and miR-29c (associated with a significantly reduced risk of dying from breast cancer [41]), miR-30b and miR-30d (both significantly down-regulated in ER -negative and progesterone receptor (PR) -negative breast tumors [42]), and miR-200b and miR-200c (both representing key negative regulators of EMT and anoikis resistance [30- 32]). [score:7]
Furthermore, the miR-29 family members directly target Krüppel-like factor 4 (KLF4), a transcription factor required for the maintenance of breast cancer stem cells, and down-regulation of miR-29 family members results in increased stem-like properties in vitro and in vivo [35]. [score:7]
Since the ADAM12-S 3′UTR lacks predicted target sites for these miRNA families and since miR-29, miR-30, or miR-200 levels are highly variable in breast cancer, selective targeting of the ADAM12-L 3′UTR by these miRNAs might explain why ADAM12-L and ADAM12-S expression patterns in breast tumors in vivo and in response to experimental manipulations in vitro often differ significantly. [score:7]
Mutation of the single miR-29 target site in the ADAM12-L 3′UTR blunted the effect of miR-29b/c on the reporter activity, confirming direct targeting of the ADAM12-L 3′UTR region by miR-29b/c. [score:7]
The miR-29, miR-30, and miR-200 families have potential target sites in the ADAM12-L 3′UTR and they may negatively regulate ADAM12-L expression. [score:6]
Down-regulation of miR-29 members also results in increased expression of the transcription factor KLF4 and expansion of stem-like cell populations in vitro and in vivo [35]. [score:6]
Similar to miR-29, the miR-200 family is down-regulated in claudin-low tumors and cell lines. [score:4]
The miR-29 family, in particular miR-29b, is enriched in luminal breast cancers and inhibits metastasis by repressing regulators of angiogenesis, collagen remo deling, and tumor microenvironment [34]. [score:4]
The predicted miR-29, miR-30, and two miR-200 target sites in the ADAM12-L 3′UTR reporter plasmid were mutated by site-directed mutagenesis. [score:4]
The ADAM12-L 3′UTR is a direct target of miR-29 and miR-200 family members. [score:4]
miR-29 has been also implicated in the regulation of Adam12 expression in response to transforming growth factor β (TGFβ) in experimental renal fibrosis in mice [46]. [score:4]
The miR-29 family is down-regulated in claudin-low cell lines and tumors, in which ADAM12-L, but not ADAM12-S, is strongly elevated. [score:4]
In this report, we examined whether three miRNA families, miR-29, miR-30, and miR-200, directly target the ADAM12-L 3′UTR in human breast cancer cells. [score:4]
In this report, we asked whether ADAM12-L expression in breast cancer cells is regulated by members of the miR-200, miR-29, and miR-30 families. [score:4]
Disruption of the predicted miR-29 target site by site-directed mutagenesis largely diminished the effects of miR-29b/c. [score:4]
The miR-29 family was reported previously to target the Adam12 transcript in NIH3T3 cells [45]. [score:3]
We focused on the miR-29, miR-30, and miR-200 families, which act as tumor suppressors in breast cancer. [score:3]
The levels of the ADAM12-S splice variant were not changed by miR-29b/c, consistent with the lack of any predicted miR-29 target sites in the ADAM12-S 3′UTR. [score:3]
Thus, increased expression of ADAM12-L in claudin-low cell lines and tumors could be facilitated, at least in part, by low levels of miR-29 family members. [score:3]
Of particular interest are the miR-200, miR-29, and miR-30 families, which all have been linked to the mesenchymal phenotype, invasion, or metastasis in breast cancer [28, 29], and which all have predicted target sites in the ADAM12-L 3′UTR, but not in the ADAM12-S 3′UTR. [score:3]
Adam12 is the only splice variant known to exist in mice and, similar to human ADAM12-L, it contains a miR-29 target site. [score:3]
The miR-29 family consists of three members with the same seed sequence, miR-29a-c. The miR-30 family is made up of 5 members, miR-30a-e. The miR-200 family consists of five members: miR-200a-c, miR-141 and miR-429. [score:1]
We observed that both miR-29b and miR-29c strongly diminished the level of ADAM12-L protein in both cell lines (Figure  2B). [score:1]
Since the miR-29 and miR-200 families play important roles in breast cancer progression, these results may help explain the different prognostic and chemopredictive values of ADAM12-L and ADAM12-S in breast cancer. [score:1]
[1 to 20 of 25 sentences]
16
[+] score: 96
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2
Thus, the understanding of molecular pathways and targets regulated by the tumor-suppressive miR-29 family may provide new insights into the EMT process in cervical SCC and facilitate the development of more effective strategies for future therapeutic interventions for this disease. [score:9]
Thus, down-regulation of the miR-29 family and dysregulation of HSP47 and ECM components are key events contributing to the pathogenesis of diseases, suggesting that these molecules are potential therapeutic targets. [score:9]
Interestingly, members of the miR-29 family have been shown to be involved in regulating ECM proteins and multiple studies have indicated that aberrant expression of miR-29 family members contributes substantially to the development of disease (26). [score:7]
Restoration of miR-29 family members directly suppresses TGF-β1 and TGF-β2 and disrupts the expression of ECM proteins (32). [score:6]
Expression analysis of miR-29 family miRNAs in cervical SCC clinical specimens showed that miR-29a was the most highly downregulated miRNA in the clinical specimens, thus, we focused on miR-29a in this study. [score:6]
Recent studies of miRNA expression signatures of hypopharyngeal SCC and maxillary SCC have indicated that expression of miRNA-29 family miRNAs (miR-29a/b/c) is significantly reduced in cancer tissues, suggesting that these miRNAs may contribute to the oncogenesis and metastasis of cervical SCC (13, 14). [score:5]
Furthermore, restoration of miR-29a in cervical cancer cells inhibited cancer cell migration and invasion, suggesting that miR-29 a functions as a tumor suppressor and may contribute to metastasis in cervical SCC. [score:5]
Aberrant expression of the miR-29 family miRNAs has been reported in several types of human cancers; however, the expression status varies according to the cancer type. [score:5]
According to gene expression data and in silico database analysis, a total of 29 genes were selected as candidate miR-29 a targets. [score:5]
In contrast, upregulation of the miR-29 family was reported in breast cancer, colon cancer and acute myeloid leukemia (16). [score:4]
In conclusion, downregulation of miR-29 a is a frequent event in cervical SCC. [score:4]
When we compared two miRNAs (miR-29a and miR-29c) after normalization to the expression of RNU48, miR-29a was more abundantly expressed in both normal and cancer tissues. [score:4]
The TGF-β pathway is a prominent inducer of the EMT and expression of the miR-29 family has been shown to have an inverse relationship with the TGF-β pathway. [score:3]
Expression of miR-29 -family miRNAs in clinical cervical SCC specimens. [score:3]
Decreased expression of the miR-29 family has been observed in cholangiocarcinoma, nasopharyngeal cancer, non-small cell lung cancer, hepatocellular carcinoma, malignant peripheral nerve sheath tumors and mantle cell lymphoma. [score:3]
The expression levels of miR-29a and miR-29c were significantly lower in tumor tissues than in non-cancer tissues. [score:3]
In cervical cancer, it was reported that miR-29 targets the HPV-related gene (17). [score:3]
The reason for this is not yet clear, and further elucidation of the molecular mechanisms controlling the expression of miR-29 family miRNAs in cancer cells is necessary. [score:3]
Previous reports have indicated that the miR-29 family plays a dominant role in the regulation of extracellular matrix (ECM) genes. [score:2]
Although the miR-29b-1/miR-29a and miR-29b-2/miR-29c formed cluster miRNAs are located within the same chromosomal regions, and share transcriptional units, the expression of miR-29b was not reduced in cancer tissues compared to normal tissues in this study. [score:2]
These miRNAs were clustered at two different human genomic loci, miR-29b-1 and miR-29a at 7q32.3 and miR-29b-2 and miR-29c at lq32.2. [score:1]
Thus, it will be necessary to identify the transcription factors that contribute to the silencing of the miR-29 family in cervical SCC. [score:1]
We evaluated the expression of miR-29 -family miRNAs in 18 clinical specimens and 11 non-cancer tissues. [score:1]
The sequences and chromosomal locations of miR-29 -family miRNAs (miR-29a/b/c) in the human genome are shown in Fig. 1A. [score:1]
Analysis of the promoter region of miR-29 family miRNAs in the human genome has revealed that the miR-29b-1/miR-29a promoter region contains two putative E-box sites (MYC -binding sites), a Gli -binding site and four NF-KB -binding sites (18). [score:1]
[1 to 20 of 25 sentences]
17
[+] score: 93
The fibrosis -associated downregulation of miR-29 is of particular interest because these miRNAs target the transcripts of a large number of ECM proteins including several collagens, elastin, and fibrillin. [score:6]
Consistent with prior reports [21, 23], we observed downregulation of miRNAs belonging to the miR-29 family (miR-29a, miR-29b, and miR-29c) among a larger set of dysregulated miRNAs in the livers of mice treated with CCl [4] for up to eight weeks (Fig 1B and 1C). [score:5]
Antisense -mediated inhibition of miR-29 also strongly de-repressed endogenous type I collagen expression (S1 Fig). [score:5]
miR-29 family members have been shown to inhibit the synthesis of collagen and other important ECM proteins and the anti-fibrotic effects of miR-29 expression in multiple tissues including liver, lung, heart, and muscle have been demonstrated [10, 23, 28– 30]. [score:5]
Second, miR-29 is detectably expressed in normal hepatocytes and we observed that exposure of these cells to the profibrotic cytokine TGF-β decreased expression of miR-29a/b/c (Fig 1D). [score:5]
While such tight regulation of miR-29 production could limit the utility of this approach in settings where supraphysiologic miRNA levels are required to reach the therapeutic threshold, it also provides natural protection against potential toxicity from virally-derived miR-29 overexpression. [score:4]
The mutations created in each of the miR-29 target sites in the luciferase reporter construct used in b are shown in red. [score:4]
Third, the importance of maintaining normal miR-29 expression in hepatocytes is highlighted by a previous report which showed that hepatocyte specific knockout of miR-29 was associated with increased susceptibility to liver fibrosis [28]. [score:4]
Numerous extracellular matrix (ECM) proteins including several collagens, elastin and fibrillin are validated targets of the miR-29 family [10– 15], which includes miR-29a, miR-29b and miR-29c. [score:3]
Primary and mature miR-29 expression levels in murine liver and isolated human hepatocytes. [score:3]
S2 Fig In vitro and in vivo miR-29 expression levels associated with AAV. [score:3]
Nevertheless, use of a clinically relevant delivery system to restore hepatic miR-29 expression and reverse existing liver fibrosis, the likely clinical scenario in which this therapy would be implemented, has not yet been demonstrated. [score:3]
In vitro and in vivo miR-29 expression levels associated with AAV. [score:3]
This is significant because activated stellate cells and their derivatives are responsible for most if not all of the ECM production in liver fibrosis and restoration of normal miR-29 expression in activated stellate cells could repress ongoing ECM protein synthesis and thus provide significant anti-fibrotic protection. [score:3]
While elucidation of specific therapeutic mechanisms and further refinement of delivery methods will aid ongoing efforts to develop clinically viable strategies, the antifibrotic protection associated with parenchymal transgene expression suggests that therapeutic miR-29 delivery may be effective in treating a variety of fibroproliferative disorders. [score:3]
eGFP treated mice exhibited normal hepatic miR-29 expression (Fig 3C), lacked any histologic evidence of fibrosis (Fig 3D and 3E) and had only a slight increase in total collagen (Fig 3F). [score:3]
Mutating the binding sites or inhibiting endogenous miR-29 with antisense oligonucleotides de-repressed a COL1A1 3' UTR luciferase reporter construct upon transfection into primary fibroblasts (S1 Fig). [score:3]
miR-29, a potent regulator of ECM production, is down regulated in fibrotic livers and TGF-β treated hepatocytes. [score:3]
Here we report that AAV -mediated restoration of miR-29 expression in a mouse mo del of liver fibrosis provides significant anti-fibrotic protection. [score:3]
Liver injury and associated hepatocyte proliferation are known to rapidly dilute AAV vector genomes [27] and 8 weeks after injection (12 weeks total CCl [4]) viral genomes were very low in both control and miR-29 treated animals (Fig 4B) and miR-29a expression was repressed in both scAAV8. [score:3]
scAAV8 transduction and miR-29 expression levels in murine liver. [score:3]
We determined that miR-29 family members are also expressed in purified human hepatocytes and that stimulation of hepatocytes with TGF-β, a potent fibroproliferative cytokine, resulted in decreased mature miR-29a/b/c without a significant reduction in pri-miR-29a (Fig 1D), similar to the pattern observed in liver samples of CCl [4] treated mice. [score:3]
The primary transcript of miR-29a was significantly increased after 1 and 4 weeks of CCl [4] exposure suggesting that altered processing and/or decreased stability of the mature miRNA contributes to the observed reduction in mature miR-29 (Fig 1C). [score:1]
In humans and mice these miRNAs are encoded by two distinct transcripts (miR-29a/miR-29b-1 and miR-29b-2/miR-29c) and fibrosis -associated decreases in mature miR-29 levels have been reported in diverse tissues [10, 16– 22]. [score:1]
miR29. [score:1]
miR-29. [score:1]
AAV vectors are being used in several clinical trials [24] and our data provides the first evidence that a clinically relevant miR-29 delivery platform can reverse established liver fibrosis. [score:1]
Our findings highlight the potential of clinically viable miR-29 -based therapies for treating established organ fibrosis in chronically injured tissues. [score:1]
In support of this possibility, the transfer of functional miRNAs, including miR-29, to other cells via gap junctions or exosomes has been described [33– 38]. [score:1]
To facilitate therapeutic delivery of miR-29 to injured livers we adapted a previously described AAV vector system [25]. [score:1]
Importantly though, the residual genomes were sufficient to maintain normal miR-29a levels (Fig 3C) and it therefore appears that processing of virally-derived miR-29 transcripts can counteract the decrease in endogenous miR-29 levels that otherwise occurs in the setting of chronic liver injury. [score:1]
eGFP was sufficient to maintain normal miR-29 levels and thereby block de novo fibrosis in the setting of chronic liver injury. [score:1]
miR-29 family members indicated with arrows. [score:1]
Coordinated Regulation of Extracellular Matrix Synthesis by the MicroRNA-29 Family in the Trabecular Meshwork. [score:1]
Activated stellate cells and their derivatives are responsible for most if not all of the ECM production in liver fibrosis and previous studies have shown that inflammatory stimuli decrease miR-29 levels in purified stellate cells [21]. [score:1]
[1 to 20 of 35 sentences]
18
[+] score: 88
In addition, the combination of miR-29c expression and CEA had an AUC of 0.757 (P<0.0001, 95% CI: 0.651–0.844), the combination of miR-429 expression and CEA had an AUC of 0.659 (P = 0.0128, 95% CI: 0.547–0.759), and the combination of miR-29c expression, miR-429 expression, and CEA had an AUC of 0.833 (P<0.0001, 95% CI: 0.736–0.906). [score:9]
Levels of miR-29c and miR-93 expression were upregulated in NSCLC tissues, while serum levels of miR-29c were also upregulated, but levels of serum miR-429 were decreased in NSCLC. [score:9]
However, for the combination of miR-29c expression and CEA, the data showed an AUC of 0.712 (P<0.0001, 95% CI: 0.622–0.792); for the combination of miR-429 expression and CEA, the AUC was 0.707 (P = 0.0007, 95% CI: 0.616–0.787); and for the combination of miR-29c expression and miR-429 with CEA, the AUC was 0.797 (P<0.0001, 95% CI: 0.713–0.865). [score:7]
However, miR-29c expression was significantly increased serum from NSCLC patients (P = 0.0012), and miR-429 expression was significantly decreased (P = 0.0001, Figure 1B). [score:5]
We found that increased miR-93 expression was strongly associated with NSCLC histology (P = 0.031, Table 2), whereas serum miR-29c expression was associated with abnormal CEA levels (P = 0.030, Table 2). [score:5]
The serum level of miR-429 expression was significantly correlated with that in NSCLC tissues (r = 0.3578, P = 0.0024, Figure 1E), whereas serum levels of miR-29c and miR-93 expression were not associated with those in NSCLC tissues (r = −0.07877, P = 0.5169 and r = 0.1515, P = 0.2105, respectively, Figure 1C and D). [score:5]
We found that miR-29c and miR-93 expression was upregulated in NSCLC tissues compared to the corresponding noncancerous lung tissues. [score:5]
Our data showed that levels of miR-29c and miR-93 expression were upregulated in NSCLC tissues compared to the corresponding noncancerous lung tissues (P = 0.0408 and P = 0.0444, respectively), whereas miR-429 levels were not significantly different between NSCLC and noncancerous lung tissues (P = 0.3903, Figure 1A). [score:5]
Our data showed that levels of miR-29c and miR-93 expression were upregulated in NSCLC tissues compared to the corresponding noncancerous lung tissues. [score:5]
Importantly, we identified miR-29c and miR-429 as dysregulated in circulating serum samples from patients with early stage NSCLC, and the expression of these miRNAs was more sensitive than serum CEA levels in distinguishing NSCLC patients from healthy controls. [score:4]
miRNA array was used to profile differentially expressed miRNAs and Taqman -based quantitative RT-PCR assays were used to analyze levels of miR-29c, miR-93, and miR-429 expression in NSCLC tissue samples, corresponding normal tissue samples, and serum samples from 70 NSCLC patients as well as in serum samples from 48 healthy controls. [score:4]
Pearson correlation test showed that miR-429 expression in serum was significantly associated with that in NSCLC tissues (r = 0.3578, P = 0.0024), whereas serum levels of miR-29c and miR-93 were not associated with those in NSCLC tissues (r = −0.07877, P = 0.5169 and r = 0.1515, P = 0.2105, respectively). [score:3]
However, expression of miR-29c, miR-93, and miR-429 in NSCLC tissues and serum levels of miR-29c and miR-93 were not associated with the overall survival of NSCLC patients. [score:3]
Furthermore, we plotted expression data for miR-29c and miR-429 using ROC curves to identify a cut-off value that could distinguish lung cancer patients from healthy controls. [score:3]
Thus, in this study, we analyzed levels of three miRNAs (miR-29c, miR-93, and miR-429) in non-small cell lung cancer (NSCLC) tissues and compared them to those in serum samples of NSCLC patients and healthy controls, particularly, their expression levels in early stage NSCLC patients. [score:2]
Indeed, Heegaard et al [8] showed that expression of miR-29c was significantly increased in 220 early stage NSCLC patients compared to 220 matched controls. [score:2]
P-values of serum miR-29c, miR-93, and miR-429 were 0.0012, 0.9291, and 0.0001, respectively, using an unpaired sample t-test. [score:1]
Moreover, ROC data showed that the AUCs for miR-29c and miR-429 were 0.723 and 0.727, respectively, and these values were significantly higher than that for CEA (0.534), in stage I NSCLC patients, suggesting these miRNAs could be used for early diagnosis of NSCLC. [score:1]
A, miR-29c; B, miR-429; C, CEA showed ROC curves and an AUC with diagnostic power to distinguish NSCLC patients from healthy controls. [score:1]
Based on our miRNA array (Agilent) and validation data, we selected three miRNAs (miR-29c, miR-93, and miR-429) for further study in NSCLC samples. [score:1]
Our current data indicate that detection of serum miR-29c and miR-429 expression should be further evaluated as a novel non-invasive biomarker for early stage of NSCLC. [score:1]
ROC curve analysis showed that at the optimal cut-off, serum levels of miR-29c had a sensitivity of 65.7% and a specificity of 74.1% for distinguishing NSCLC patients from healthy controls with an area under the curve (AUC) of 0.676 (P = 0.0004, 95% confidence interval [CI]: 0.584–0.759, Figure 2A). [score:1]
The results of the current study suggest that detection of serum miR-29c and miR-429 expression should be further evaluated as a novel, non-invasive biomarker for early stage NSCLC. [score:1]
A number of researchers, including us, have reported the potential clinical application of circulating miRNAs (such as miR-1254, miR-142-3p, miR-24, miR-183, miR-21, miR-221, miR-29c, miR-486, miR-30d, miR-1, miR-499, and miR-210) [7], [8]. [score:1]
P-values for miR-29c, miR-93, and miR-429 were 0.0408, 0.0444, and 0.3903, respectively, using a paired sample t-test. [score:1]
Moreover, we also found that serum levels of miR-29c had a sensitivity of 50.0% and a specificity of 95.8% for distinguishing stage I NSCLC from healthy controls with an AUC of 0.727 (P = 0.0001, 95% CI 0.619–0.818, Figure 2D). [score:1]
D, miR-29c; E, miR-429; F, CEA showed ROC curves and an AUC with diagnostic power to distinguish stage I NSCLC patients from healthy controls. [score:1]
0087780.g002 Figure 2 A, miR-29c; B, miR-429; C, CEA showed ROC curves and an AUC with diagnostic power to distinguish NSCLC patients from healthy controls. [score:1]
[1 to 20 of 28 sentences]
19
[+] score: 85
Fold change, the matching miRNA for targeting, fold value of miRNA, and information about targeting has already been validated or predicted with software mRNA Fold Targeting miRNA miRNA Fold Targeting Status PTX3 -337.5 hsa-miR-29c-3p 21.76 Predicted RPL22 -109.5 hsa-miR-29c-3p 21.76 Validated CABIN1 -8.76 hsa-miR-4492 53.89 Predicted RELA -7.42 hsa-miR-8089 22.13 Predicted SPARCL1 71.88 N/A TMOD1 81.71 N/A The levels of selected mRNAs and miRNAs in fifty-eight patient samples, were checked. [score:9]
In this study, we found that miR-29c-3p is upregulated in meningiomas, whereas its predicted target PTX3 is downregulated. [score:9]
Inhibiting miR-29c-3p has increased the expression level of PTX3 in primary meningioma cells, indicating a potential targeting of PTX3 by miR-29c. [score:7]
Herein, we describe integrated analysis of gene networks that might play an important role in the initiation and progression of meningiomas, with emphasis on the downregulation of tumor suppressor PTX3 via miR-29c. [score:6]
Inhibiting miR-29c upregulated the PTX3 level, induced apoptosis of meningioma cells, and decreased cell viability. [score:6]
Anti-miRNA molecules of miRNAs, miR-29c-3p, miR-4492, and miR-8089, were administered to MEN-117 and MEN-141, and corresponding target mRNA levels were determined after 48 h. a RPL22 as the target of miR-29c-3p. [score:5]
The miR-29 family members miR-29a, miR-29b, and miR-29c have diverse roles in cancer [15] by inhibiting tumorigenesis [16], promoting cancer cell apoptosis [17], and suppressing cell proliferation [18]. [score:5]
The PTX3 gene expression level increased significantly in primary cell lines MEN-117 and MEN-141, suggesting a regulation of the gene by miR-29c-3p in meningiomas (Fig. 3b). [score:4]
In our study, the downregulation of miR-29c decreased cell viability and increased apoptosis. [score:4]
Downregulation of hsa-miR-29c-3p decreased cell viability and induced apoptosis in meningioma Cells. [score:4]
Transfection of anti-hsa-miR-29c-3p increased oncosuppressor PTX3. [score:3]
To elucidate the apoptotic effects of hsa-miR-29c-3p and its target PTX3 on primary meningioma cells, annexin V and 7-AAD staining was performed by using apoptosis detection kit I (BD Pharmingen, San Diego, California) 72 h after transfection of anti-miR-29c-3p. [score:3]
b PTX3 as the target of miR-29c-3p. [score:3]
miR-29c-3p was found to be downregulated when compared with adjacent tissue in meningioma. [score:3]
miR-29c-3p and PTX3 are inversely correlated in tissues and meningioma cells, hinting that PTX3 can be regulated by miR-29c-3p. [score:2]
We evaluated the relationships between miR-29c-3p, miR-4492, PTX3, RPL22, CABIN1, RELA, SPARCL1, and TMOD1 levels and the clinicopathological features of meningioma patients including sex, age, tumor grade, tumor volume, calcification, progesterone receptor status, and p53 and Ki67 levels, as well as the correlation between the level of miRNAs and their targets. [score:1]
meningioma microarray miRNA transcriptome PTX3 miR-29c Meningiomas account for 30% of primary brain tumors and occur at a rate of 5 per 100,000 individuals [1]. [score:1]
In the same study, lower miR-29c was associated with advanced clinical stages of meningioma which is in synchrony with our finding that lower miR-29c is associated with a higher ki67 index [14]. [score:1]
The level of miR-29c-3p in patient samples and healthy controls was consistent with the microarray (Fig. 1). [score:1]
The ability of anti-miRNA molecules to decrease corresponding miRNA levels: (e) The decreased level of miR-29c-3p by anti-miR-29c-3p. [score:1]
Anti-miR mimics were transfected into patient-derived cell lines, and real-time PCR after 48 h revealed that the corresponding anti-miR mimics significantly decreased the level of hsa-miR-29c-3p and hsa-miR-4492-3p (Fig. 2e,f). [score:1]
CABIN1, miR-29c, TMOD1, PTX3, RPL22, SPARCL1 and RELA were correlated with clinicopathological features in patient samples. [score:1]
*Significant changes (p < 0.05) To observe the viability and percentage of apoptotic cells, anti-miR molecules against miR-29c-3p were transfected into two meningioma primary culture cells, MEN-117 and MEN-141. [score:1]
These include miR-145, let-7d, miR-335, miR-98, miR-181a, miR-200a, miR-373*, miR-575, miR-335, miR-96-5p, miR-190a, miR-29c-3p, and miR-219-5p [7, 8, 13, 14]. [score:1]
Markers that can play a role in meningioma pathophysiology and tumor-promoting inflammation have been determined, and the results reveal that the relationship between miR-29c-3p and PTX3 can be one of the driving forces in meningioma pathology. [score:1]
Moreover, PTX3 negatively correlated with miR-29c in our samples. [score:1]
On the other hand, the miR-29 family can induce an epithelial-to-mesenchymal transition acting as drivers of tumor growth and metastasis [19]. [score:1]
[1 to 20 of 27 sentences]
20
[+] score: 78
Our data also revealed that ITGB1 is a novel target of miR-29 s. We therefore hypothesized that hTERT can enhance ITGB1 expression, which occurs, at least in part, by the down regulation of miR-29a expression, to promote the invasion and metastasis of gastric cancer cells. [score:8]
Our results were different from those of Han et al. 36, who reported that miR-29c could directly target ITGB1 expression in the regulation of gastric cancer metastasis. [score:7]
Considering these results, we concluded that miR-29 reduced the expression of ITGB1 via the direct targeting of the 3′UTR of ITGB1. [score:6]
The expression of miR-29 was found to be abnormal in a variety of tumor cells and its expression is closely linked to that of a number of oncogenes, as it is involved in tumor progression 32 33. [score:5]
hTERT may regulate ITGB1 expression via miR-29, which binds to the 3′UTR of ITGB1. [score:4]
These results indicated that miR-29 may play a causal role in the process of hTERT regulation of ITGB1expression and the process of GC metastasis. [score:4]
Bioinformatics analyses revealed that miR-29, miR-124, miR-183 and miR-506 might regulate the expression of ITGB1. [score:4]
The above results indicated that miR-29 family members may play a critical role in the regulation of ITGB1 expression by hTERT. [score:4]
As mentioned above, our results indicated that hTERT may regulate ITGB1 expression via miR-29, but this hypothesis needed confirmation by further experiments. [score:4]
Interestingly, miR-29 was the only miRNA that was found to regulate ITGB1 expression by bioinformatics analyses. [score:4]
However, the correlation between tumor phenotypes and miR-29b or miR-29c was not statistically significant, despite results showed that miR-29b and miR-29c was highly expressed in GC patients (Supplementary Fig. 4 and Supplementary Fig. 5). [score:3]
We also found by western blot that the protein levels of ITGB1 decreased after the introduction of miR-29 family members mimics, which indicates that miR-29 reduced the protein expression level of ITGB1 (Fig. 2d and Supplementary Fig. 3). [score:3]
We then examined the expression of miR-29 and ITGB1 in the tumors of patients with gastric cancer. [score:3]
Our data also demonstrated that ITGB1 is a novel target of miR-29 s. ITGB1, which is an important oncogene, plays a critical role in tumor invasion and metastasis. [score:3]
The results showed that the expression of miR-29 s in GC tissues was significantly lower than that in paracancerous tissues (Fig. 3a and Supplementary Fig. 4). [score:3]
To determine whether miR-29 modulates ITGB1 directly, we cloned the 3′UTR of ITGB1 into luciferase reporters and co -transfected either miR-29 (miR-29a, miR-29b and miR-29c) or a control mimic. [score:2]
MiR-29 can also target a variety of oncogenes, which results in a decrease in the proliferation of tumor cells as well as metastasis 34 35. [score:2]
To investigate whether the loss of miR-29a would suppress the proliferation of GC cells, a proliferation curve generated from an MTT assay showed that miR-29 significantly inhibited the proliferation of human gastric cancer SGC-7901 cells in vitro (Fig. 4e). [score:2]
We also generated a mutant reporter (Luc-ITGB1-mu), in which the predicted miR-29 binding site to ITGB1 was mutated (ITGB1-mu) (Fig. 2b). [score:1]
However, only miR-29a was closely associated with lymph node metastasis, while miR-29b and miR-29c were not significantly associated with any clinical data (Supplementary Fig. 5 and Table 1). [score:1]
The miR-29 family includes miR-29a, miR-29b and miR-29c 31. [score:1]
The three miRNAs within the miR-29 family contain the same seed region AGCACCA. [score:1]
The miR-29 family is composed of three family members (miR-29a, miR-29b and miR-29c), and they all share the same seed region. [score:1]
Then, it was revealed that the luciferase activity was partially relieved after transfection with miR-29 mimics (Fig. 2c), which suggests that miR-29 decreased the luciferase activity of Luc-ITGB1 but did not affect Luc-ITGB1-mu. [score:1]
We investigated the expression levels of miR-29 s in 58 GC tissues and in paracancerous tissues by qRT-PCR. [score:1]
[1 to 20 of 25 sentences]
21
[+] score: 76
Predicted targets of the miR-29 family are enriched with genes associated with cell-adhesion and show significant anti-correlation to the expression of miR-29c which points to a direct involvement of miR-29c in regulating cell-adhesion. [score:7]
Further supporting its direct role in our cohort, we found miR-29c targets as well as cell adhesion genes to be significantly anti-correlated with miR-29c expression (mHG p<2E-11 and mHG p<2E-13, respectively; see Figure S3B and C and Materials and). [score:6]
In our cohort we also found miR-29c to be significantly under-expressed in proliferative samples (Table S5), which may suggest breast tumor suppressive activity mediated by the regulation of the ECM related genes. [score:6]
We used the TargetScan prediction tool [30] to rank all genes according to their miR-29c target prediction scores. [score:5]
We find a significant enrichment of miR-29c targets, as derived from TargetScan V5.1, in the anti-correlated gene ranking (mHG p<3E-11). [score:5]
Analyzing miRNA expression with respect to extracellular matrix component signature of the studied cohort, we found miR-29c to be the most prominently differentially expressed. [score:5]
Target prediction context scores of miR-29c were taken from TargetScan V5.1. [score:5]
We find enrichment of several GO terms in the high scoring genes, with respect to miR-29c targets, using GOrilla web tool [62]. [score:3]
miR-29c, shown in previous sections to be down regulated in basal-like samples as compared to luminal-A samples, was found to be the most differentially expressed miRNA between the two ECM classes (TNoM p<3E-5, lower in ECM1, Table S8). [score:3]
All mRNAs were ranked according to their anti-correlation to miR-29c expression profile. [score:3]
Over -expression of the miR-29 family was shown to revert aberrant methylation patterns in lung cancer [51], and recently it was shown that miR-29 can induce apoptosis in a TP53 dependent manner [52]. [score:3]
Figure S1 Expression profiles of miR-9*, miR-29c and miR-190b in subtypes. [score:3]
miR-29 family members were moderately expressed in subtypes other than luminal-A and basal-like. [score:3]
The top predicted targets of miR-29c were found to be enriched with genes related to the cell-adhesion GO-term (Figure S4). [score:3]
Figure S4 GO enrichment in miR-29c targets. [score:3]
miR-29c shows the highest significance of differential expression between the two classes (TNoM p<4E-5, see Table S8 for full list). [score:3]
Expression profiles (signal intensities) of miR-9*, miR-29c and miR-190b ordered by subtypes. [score:3]
Among the prominently down regulated miRNAs in basal-like tumors were representatives of the miR-29 family (TNoM p<7E-12) along with miR-190b (TNoM p<2E-10) (Figure S1B-C). [score:2]
miR-29c is associated with cell adhesion/extra cellular matrix. [score:1]
The miRNAs selected for this validation were miR-17-5p, miR-18a, miR-18b, miR-19a, miR-29c, miR-34c-5p, miR-142-3p, miR-150 and miR-449a, and the endogenous control used was RNU6B. [score:1]
We further discuss the role of miR-29 in our cohort in later sections. [score:1]
Figure S3 Association of miR-29c with extracellular matrix. [score:1]
The absolute signal intensities of miR-29c are presented in the top bar. [score:1]
[1 to 20 of 23 sentences]
22
[+] score: 75
Regarding the molecular mechanism underlying the oncolytic adenovirus -mediated MCL1 suppression, we demonstrated that OBP-301 upregulated MCL1 -targeted miRNAs, such as miR-15, miR-16 and miR-29, and miR-29 overexpression efficiently suppressed MCL1 expression in human osteosarcoma cells. [score:14]
OBP-301 -mediated microRNA-29 up-regulation suppresses MCL1 expression and enhances chemotherapy -induced apoptosis. [score:8]
OBP-301 -mediated microRNA-29 upregulation suppresses MCL1 expression through E2F1 activation. [score:8]
Regarding the function of miR-29 in tumor development, the miR-29 family is frequently downregulated in human cancers 42 including osteosarcomas 43, suggesting the tumor-suppressive role of the miR-29 family. [score:7]
Moreover, miR-29 negatively regulates the expression of stemness-related markers, such as Oct3/4, Sox2 and Nanog, and subsequently suppresses the proliferation, sphere formation and chemoresistance of human osteosarcoma stem cells 43. [score:6]
The present study demonstrated that a tumor-specific replication-competent oncolytic adenovirus OBP-301 induced miR-29 upregulation via E2F1 activation, which resulted in suppression of anti-apoptotic BCL2 family protein MCL1 in chemotherapy-resistant human osteosarcoma cells. [score:6]
To investigate the underlying mechanism of OBP-301 -mediated MCL1 suppression, we determined whether OBP-301 upregulates MCL1 -targeted miRNAs (miR-15, miR-16, miR-29) via E2F1 activation in human osteosarcoma cells. [score:6]
miR-15, miR-16, and miR-29 suppress MCL1 expression in human malignant tumor cells 22. [score:5]
Moreover, a recent report has suggested that miR-16 and miR-29 are downregulated and miR-15 is associated with chemosensitivity in human osteosarcoma cells 23. [score:4]
How to cite this article: Osaki, S. et al. Ablation of MCL1 expression by virally induced microRNA-29 reverses chemoresistance in human osteosarcomas. [score:3]
Our findings suggest that miR-29 -mediated suppression of anti-apoptotic factor MCL1 was a critical factor for the enhancement of chemosensitivity in human osteosarcoma cells. [score:3]
These results suggest that OBP-301 enhances chemotherapy -induced apoptosis through miR-29 -mediated MCL1 suppression in human osteosarcoma cells. [score:3]
In fact, our data demonstrated that administration of a miR-29 mimic enhanced the chemotherapy -induced apoptosis like MCL1 siRNA. [score:1]
Therefore, OBP-301 -mediated miR-29 activation may have broad therapeutic potential in addition to chemosensitization through MCL1 depletion. [score:1]
[1 to 20 of 14 sentences]
23
[+] score: 69
Moreover, NRF2 activates miRNA-29-coding genes [167, 168], which further attenuate DNMT3B expression causing further feed forward epigenetic upregulation of NRF2 expression (Figure 2). [score:8]
miRNA-29 via targeting DNMT3B and miRNA-148a via targeting DNMT1 may decrease FTO promoter methylation associated with higher FTO expression resulting in decreased m [6]A levels in mRNAs. [score:7]
Obesity in pregnant sheep leads to increased miRNA-29 expression in the liver tissue of offspring lambs, along with decreased markers of insulin signaling, suggesting fetal programming of miRNA-29 expression [322]. [score:5]
Key miRNAs that are abundantly expressed in lactating bovine MECs that promote lactation performance, lipid and protein synthesis include the DNMT -targeting miRNA-148/152- and the miRNA-29 family [116, 117, 122]. [score:5]
miRNA-29 promotes myogenesis via inhibition of Rybp, which acts as a negative regulator of skeletal myogenesis [262]. [score:4]
Zhou L. Wang L. Lu L. Jiang P. Sun H. Wang H. A novel target of microRNA-29, Ring1 and YY1 -binding protein (Rybp), negatively regulates skeletal myogenesis J. Biol. [score:4]
Arnold N. Koppula P. R. Gul R. Luck C. Pulakat L. Regulation of cardiac expression of the diabetic marker microRNA miR-29 PLoS ONE. [score:4]
Kurtz et al. [321] showed that miRNA-29 was upregulated in the livers of DIO mice and in Zucker diabetic fatty (fa/fa) rats. [score:4]
The generation of DNMT -targeting miRNAs (miRNA-152, miRNA-148a, miRNA-29, miRNA-21) is thus a fundamental epigenetic mechanism increasing lactation-specific gene transcription thereby enhancing lactation performance as well as milk yield in domestic animals. [score:3]
The miRNA-29 family is among the most abundantly expressed miRNAs in pancreas and liver and is regarded as a diabetogenic risk marker [318, 319, 320]. [score:3]
By contrast, in the liver both miRNA-29a and miRNA-29c were important negative regulators of insulin signaling via PI3K regulation. [score:3]
In this mo del, miRNA-29 functioned through regulation of the transcription factor FOXA2 (FOXA2 -mediated regulation of PPARGC1A, HMGCS2 and ABHD5). [score:3]
Global or hepatic insufficiency of miRNA-29 potently inhibited obesity and prevented the onset of diet induced insulin resistance [171]. [score:3]
Notably, it has been demonstrated in bovine MECs that the expression of both AKT and SREBP1 underlie epigenetic miRNA-29/DNMT -mediated demethylation of their corresponding promoter regions [122]. [score:3]
Kurinna S. Schäfer M. Ostano P. Karouzakis E. Chiorino G. Bloch W. Bachmann A. Gay S. Garrod D. Lefort K. A novel Nrf2-miR-29-desmocollin-2 axis regulates desmosome function in keratinocytes Nat. [score:2]
These results confirmed strong regulatory functions for the miRNA-29 family in diabesity. [score:2]
Fabbri M. Garzon R. Cimmino A. Liu Z. Zanesi N. Callegari E. Liu S. Alder H. Costinean S. Fernandez-Cymering C. MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B Proc. [score:2]
The miRNA-29 family (miRNA-29a, miRNA-29b and miRNA-29c) has been detected in bovine colostrum and bovine milk [40, 44, 64, 79]. [score:1]
Persistent transfer of milk exosomal miRNA-29 via cow’s milk consumption may thus represent a critical epigenetic factor in the pathogenesis T2DM. [score:1]
In fact, the miRNA-29 family (miRNA29a, miRNA29b, and miRNA29c) has intriguing complementarities to the 3′-UTRs of DNMT3A and DNMT3B, two key de novo methyltransferases involved in DNA methylation [123]. [score:1]
It is thus conceivable that milk-derived exosomal miRNA-148a and miRNA-29 support the epigenetic program of myogenesis. [score:1]
[1 to 20 of 21 sentences]
24
[+] score: 64
Thus, hsa-miR-29 family members down-regulation may represent an appealing possible mechanisms able to determine MYC up-regulation and sustain its expression at mRNA and protein level also in the absence of a translocation. [score:9]
Interestingly, when we compared the miRNA profiling of MYC translocation -positive versus MYC translocation -negative BL cases, we identified four miRNAs differentially expressed, of which hsa-miR-513a-5p and hsa-miR-628-3p were up-regulated and two miR-29 family members (hsa-miR-29a and hsa-miR-29b) were down-regulated in BL cases lacking the MYC translocation. [score:8]
This miRNA family may represent a novel target for tailored therapies as in vitro and mouse studies suggest increasing miR-29 expression by combined inhibition of HDAC3 and EZH2. [score:7]
A significant down-regulation of the miR-29 family members was observed in MYC-translocation negative cases, whereas the remaining two miRNAs were hyper-expressed in the absence of translocation (p < 0.05). [score:6]
Over -expression of the selected genes is in accordance with down-regulation of the miR-29 family observed in MYC-translocation negative cases; (b-c). [score:6]
Interestingly, in MYC translocation -negative cases we found over -expression of DNA-methyl transferase family members, consistent to hypo -expression of the hsa-miR-29 family. [score:5]
Interestingly, in MYC translocation -negative BLs we found over -expression of DNA methyltransferase (DNMT) family members, consistent to hypo -expression of hsa-miR-29 family. [score:5]
In this scenario, over -expression of DNMT family members, due to hypo -expression of hsa-miR-29 family members, may elicit a role in inducing carcinogenesis [46]. [score:5]
Interestingly, miR-29 family members have been related to malignant transformation, and it has been demonstrated that their down-regulation contributes to MYC -induced lymphomagenesis in vivo and in vitro mo dels [42, 43]. [score:4]
MYC-translocation negative cases show a dramatic hyper -expression of the gene; altogether RT-qPCR results confirmed the bioinformatics predictions, which suggest a regulation of these by the miR29 family. [score:4]
The difference in has-miR29 family members expression we detected between MYC translocation -positive and MYC-translocation negative BL samples might be related to the lower MYC protein level among cases lacking the MYC-translocation. [score:3]
Hsa-miR-628-3p and hsa-miR-513a-5p are less referred in the literature, whereas, more is known about the miR-29 family [41]. [score:1]
Interestingly, a link between the miR-29 family by MYC has been recently reported [44], as repression of miR-29 by MYC through a corepressor complex with HDAC3 and EZH2 is observed in aggressive B-cell lymphomas [43]. [score:1]
[1 to 20 of 13 sentences]
25
[+] score: 57
A recent study has shown that miR-29 is involved in the p53 pathway, an important tumor suppressor regulator [41]. [score:4]
The down-regulation of the miR-29 family has been reported in various human cancers including lung cancer [38], prostate cancer [39] and invasive breast cancer [40]. [score:4]
Our analysis for miR-29 targets suggested that CDC42 (combined p value = 0.00053 in Table S4) and other mRNAs are likely to be involved in the potential pathway of CRC development. [score:4]
Our results indicate that down-regulation of miR-29a and miR-29c is associated with the early recurrence of CRC. [score:4]
We found that both miR-29a and miR-29c had significantly lower expression levels in the early recurrence group than non-early recurrence group (both p values were 0.007 after adjusting for sex, age and cancer stage). [score:3]
miR-29a and miR-29c expression levels in our CRC samples of early recurrence and non-early recurrence. [score:3]
Table S3 Top 10 enriched pathways with miR29a or miR29c target genes analyzed by MetaCore pathway analysis system. [score:3]
In this study, we identified miR-29a and miR-29c as important candidates by employing an ingenious method that prioritized candidate microRNAs from publicly available genome-wide gene expression datasets. [score:3]
miR-29a and miR-29c expression level in CRC samples. [score:3]
However, the significance level was lower by using miRanda (p = 0.0173 for miR-29a and p = 0.00197 for miR-29c in p value combination) than MicroCosm Targets (p = 9.14×10 [−9] for miR-29a and p = 1.14×10 [−6] for miR-29c). [score:3]
The above studies offer a biological plausibility to support the role of miR-29 family in suppressing CRC recurrence. [score:3]
MiR-29 activates p53 and induces apoptosis via suppression of CDC42 and p85α [41]. [score:2]
Figure S1 Subjects were dichotomized to have high or low microRNA levels according to the median of 1.39 for miR-29a and 0.58 for miR-29c. [score:1]
Among them, miR-29a and miR-29c were indicated in both stage II and III datasets. [score:1]
miR-29a and miR-29c were also indicated by these two microRNA predictive software to be involved in CRC recurrence, which indicated the robustness of the IMRE method. [score:1]
The similar pattern was also observed for miR-29c (data not shown). [score:1]
Identification of miR-29a and miR-29c as candidate microRNAs for CRC recurrence. [score:1]
We further collected 43 CRC patients of early recurrence and 35 patients of non-early recurrence to validate miR-29a and miR-29c in regard to the prediction of CRC early recurrence. [score:1]
Fisher's combination of p-values showed p = 9.14×10 [−9] for miR-29a and p = 1.14×10 [−6] for miR-29c. [score:1]
The failure of prediction by miR-29c in the Kaplan-Meier analysis may be due to a short follow-up or an inappropriate cutoff due to a small sample size. [score:1]
The random effect mo del showed an effect size of 213.36 (95% CI: 147.38–279.34) for miR-29a and an effect size of 176.91 (95% CI: 111.63–242.18) for miR-29c. [score:1]
In the Kaplan-Meier analysis, we showed that either a high level of miR-29a or miR-29c had a better survival at 12 [th] month, but only miR-29a could significantly predict the early recurrence (Figure S1). [score:1]
Our experimental data were divided into two groups according to the median of each miR-29a and miR-29c data. [score:1]
By applying the IMRE method to the six independent CRC mRNA microarray datasets, we identified four microRNAs (miR-29a, miR-29c, miR-100 and miR-627) in the stage II datasets and three microRNAs (miR-29a, miR-29c and miR-363) in the stage III datasets with a p value ≦ 0.1(Table 2). [score:1]
Meta-analysis for miR-29a and miR-29c. [score:1]
The results of meta-analysis for miR-29a and miR-29c in the six datasets. [score:1]
There was not significant between-dataset heterogeneity for the two microRNAs (p = 0.59 for miR-29a and p = 0.69 for miR-29c). [score:1]
We validated miR-29a and miR-29c as biomarkers for CRC early recurrence. [score:1]
The similar pattern was found for miR-29c. [score:1]
In conclusion, this study showed an efficient strategy by combining the in silico analysis and the empirical experiment to suggest microRNA-29a and microRNA-29c as potential biomarkers to predict early recurrence of CRC. [score:1]
[1 to 20 of 30 sentences]
26
[+] score: 55
miRNAs Expression Mo del Target Effect on cardiac fibrosis Reference miR-21 ↑ MI Cardiac fibroblasts PTEN MAPK ↑ MMP2 expression, matrix remo deling, fibroblast survival, interstitial fibrosis Roy et al., 2009; Thum et al., 2008 miR-29 ↓ I/R, MI TGF-β ↑ MMP2 expression, excessive reparative fibrosis van Rooij et al., 2008; Kriegel et al., 2012; Nicolini et al., 2015; Yang et al., 2015 miR-30-133 ↓ I/R CTGF ↑ Collagen production Duisters et al., 2009; Nicolini et al., 2015 miR-22 ↓ MI TGF-βRI ↑ Collagen deposition Hong et al., 2016 miR-101 ↓ MI c-Fos TGF-β ↑ Collagens, fibronectin, MMP-2, MMP-9 Pan et al., 2012 MI, myocardial infarction; PTEN, phosphatase and tensin homolog; MAPK, mitogen-activated protein kinase; I/R, ischemia/reperfusion; TGF-β, transforming growth factor beta; CTGF, connective tissue growth factor; TGF-βRI, transforming growth factor beta receptor type I. In addition to cardiac disease, the potential of targeting miRNAs in other fibrotic diseases is also of current clinical importance. [score:15]
Particularly, T3 treatment was found to be effective in countering the injury-related downregulation of miR-29c, miR-30c, and miR-133a resulting in the reduction of profibrogenic matrix metalloproteinase (MMP)-2 and CTGF expressions (Nicolini et al., 2015). [score:6]
In other works, the downregulation of miRNAs was also observed in cardiac disease mo dels including reductions in miR-133, miR-590, miR-30, miR155, miR-22, miR-29, and miR101 (van Rooij et al., 2008; Duisters et al., 2009; Shan et al., 2009; Pan et al., 2012; Kishore et al., 2013; Hong et al., 2016). [score:6]
And as observed in cardiac disease, the downregulation of miR-29 is strongly associated with hepatic fibrosis. [score:6]
miR-29c is downregulated in renal interstitial fibrosis in humans and rats and restored by HIF-alpha activation. [score:4]
Notably, miR-29 mimics or overexpression has been shown to control ECM production by HSCs demonstrating therapeutic potential (Kwiecinski et al., 2011). [score:3]
Further, the synthetic overexpression of miR-29 reduced collagen production and fibrosis following MI (van Rooij et al., 2008). [score:3]
In the case of the miR-29 family, miR-29a, miR-29b, and miR-29c were found to be reduced after MI and associated with the gene expression of ECM proteins and TGF-β signaling (van Rooij et al., 2008; Kriegel et al., 2012). [score:3]
Hepatocyte growth factor (HGF) inhibits collagen I and IV synthesis in hepatic stellate cells by miRNA-29 induction. [score:3]
Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis. [score:2]
Multiple works have defined the role of miRNAs in renal fibrosis including the effects of miR-148b and members of the miR-29 and miR-let7 families (Fang et al., 2013; Nagai et al., 2014; Szeto and Li, 2014; Srivastava et al., 2016). [score:1]
The miR-29 family: genomics, cell biology, and relevance to renal and cardiovascular injury. [score:1]
The role of miR-29 in pulmonary fibrosis. [score:1]
And lastly, investigation into the role of miRNAs in pulmonary fibrosis is emerging with potential targetable miRNAs identified including miR-29 (Cushing et al., 2015), miR-155 (Pottier et al., 2009), miR-21 (Zhou et al., 2015b; Liu et al., 2016), miR-26a (Liang et al., 2014), and miR-326 (Das et al., 2014). [score:1]
[1 to 20 of 14 sentences]
27
[+] score: 52
The expression patterns of miR-29 family expression demonstrated that the expression levels were spiked upward immediately after retraction, leveled off 1 hour postretraction (T1), and then gradually increased until the end of study (T4) (Fig 5). [score:7]
Interestingly the expression profiles of miRNA-29 family in this study were similar to the reported activity of osteoclasts as their expression significantly increased after day 35 of canine retraction implicating secretory miRNA-29 family expression in GCF were associated with osteoclast activity during the tooth movement. [score:7]
Franceschetti et al[17] found an increase in expression of all three members of miRNA-29 family during osteoclastogenesis, and repression of osteoclastogenesis process by inhibition of miRNA-29. [score:5]
This study we focused on miR-29 family due to their expression patterns in human periodontal ligament under loading[26] and their direct association with osteoclast function[16, 17]. [score:4]
The expression profile of miRNA-29 family in GCF during tooth movement in human. [score:3]
Increased expression profiles of secretory miRNA-29 family were detected during canine retraction. [score:3]
This study was performed to elucidate the presence of miRNAs with exosomes in human gingival crevicular fluid (GCF), and the expression profile of miRNA-29 during orthodontic tooth movement. [score:3]
In addition, expression of secretory specific miRNAs such as miRNA-29 family seems to be correlated with osteoclast function suggesting the potential of secretory miRNA-29 family during the canine retraction. [score:3]
To study the profiles of secretory miR-29 family expression during maxillary canine retraction to close extraction spaces, seventy orthodontic patients aged 10–17 years old were screened and fifteen orthodontic patients was recruited for the study. [score:3]
We reported that different orientation of forces affected the expression pattern of miRNA-29 in human periodontal ligament cells[26]. [score:3]
Along the course of canine retraction, after normalization with internal miRNA controls (Let-7d, g and i), the change in miRNA-29 family expression patterns from pretreatment (T0) to 6 weeks postretraction (T4) showed statistical significance consistently (P<0.05). [score:3]
Coordinated regulation of extracellular matrix synthesis by the microRNA-29 family in the trabecular meshwork. [score:2]
miR-29 promotes murine osteoclastogenesis by regulating osteoclast commitment and migration. [score:2]
The finding implicated that miRNA-29 promoted osteoclastogenesis. [score:1]
Analyzing all the time points together, no statistical significant difference was found between miRNA-29a, miRNA-29b and miRNA-29c (P>0.05) indicating the similarity in profile changes of the miRNA-29 family. [score:1]
In our laboratory, miR-29 sponge mouse demonstrated delayed tooth movement with reduced numbers of osteoclasts (data not shown). [score:1]
Significant changes were found between T0 and T4 in all of the miRNA-29 family however, the significant changes between T0 and 1 hour postretraction (T1), and T0 and 7-d postretraction (T3) were only observed in miRNA-29b (P<0.05) (Fig 5). [score:1]
[1 to 20 of 17 sentences]
28
[+] score: 51
Moreover, restoring expression of miR-15a/16-1 indirectly affects expression of miR-34 family by modulating p53 expression and downregulation of miR-29 and miR-181b in aggressive CLL contributes to overexpression of Tcl1 [43]. [score:13]
We verified that coexpression of TCL1 with miR-29 and miR-181 decreased its expression and found inverse correlation between miR-29b, miR-181b, and Tcl1 expression in CLL samples [35]. [score:7]
The role of downregulation of miR-29 and miR-181b in aggressive CLLs appears to correlate with Tcl1 overexpression [35]. [score:6]
MiR-15/16 cluster, miR-34b/c, miR-29, miR-181b, miR-17/92, miR-150, and miR-155 family members, the most deregulated microRNAs in CLL, were found to regulate important genes, helping to clarify molecular steps of disease onset/progression. [score:5]
To clarify the role of miR-29 in CLL, we designed a transgenic mouse mo del and mice overexpressing miR-29 developed a disease similar to the indolent form of CLL. [score:5]
MicroRNA-181b and microRNA-29In both indolent and aggressive CLLs, miR-29 is overexpressed when compared to normal B cells while miR-181b is downregulated when compared to normal B cells. [score:4]
In both indolent and aggressive CLLs, miR-29 is overexpressed when compared to normal B cells while miR-181b is downregulated when compared to normal B cells. [score:4]
BCR activation can lead to reduced levels of miR-29c, miR-150, miR-181b, or miR-223 [15], and low expression of these microRNAs was observed in patients with shorter survival and/or time to treatment [16]. [score:3]
Although, when comparing indolent and aggressive CLLs, both mir-29 and mir-181b show higher expression levels in indolent cases [34- 36]. [score:3]
MicroRNA-181b and microRNA-29. [score:1]
[1 to 20 of 10 sentences]
29
[+] score: 51
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
The TCL1 oncogene is a target of the miR-29 family and in CLL patients low miR-29c expression was associated with high TCL1 expression [30]. [score:7]
Lower expression of miR-181b, miR-29c and miR-223 was associated with disease progression in CLL patients and this correlates with unfavorable prognosis, such as shorter progression-free survival and overall survival [23, 30– 33]. [score:5]
Highlighted in red and green are the miRNAs that are found most frequently associated with an unfavorable or favorable outcome, respectively, across different human leukemiasThe miR-29 family, which includes miR-29a, miR-29b and miR-29c, was also significantly down-regulated in a subset of CLL patients and was associated with an unfavorable prognosis. [score:4]
The miR-29 family was significantly down-regulated in a subset of CLL patients and was associated with an unfavorable prognosis [7]. [score:4]
Highlighted in red and green are the miRNAs that are found most frequently associated with an unfavorable or favorable outcome, respectively, across different human leukemias The miR-29 family, which includes miR-29a, miR-29b and miR-29c, was also significantly down-regulated in a subset of CLL patients and was associated with an unfavorable prognosis. [score:4]
The miR-15/16 cluster, miR-34b/c, miR-29, miR-181b, miR-17/92, miR-150, and miR-155 represent the most frequently deregulated miRNAs reported in CLL, and these microRNAs have been associated with disease progression, prognosis, and drug resistance [1] (Table  1). [score:4]
Expression of miR-26a, miR-29c, miR-130b and miR-146a was higher in patients with an Imatinib response than in patients with Imatinib-resistant treatment [47]. [score:3]
In addition, evidence showed that miR-29 targets the oncogene T-cell leukemia 1 gene, TCL1A, which was overexpressed in patients with unmutated immunoglobulin heavy chain variable regions (IgVH) and involved in translocations and inversions characteristic of mature T-cell prolymphocytic leukemia (PLL). [score:3]
Higher miR-29c expression was associated with relapse after patients achieved complete remission. [score:3]
Importantly, low miR-29c expression was associated with better response to azacitidine treatment and remission achievement in elder AML patients who were not suitable for intensive chemotherapy [133]. [score:3]
Reduced miR-29c expression was associated with complete remission after initial treatment (intensive chemotherapy: daunorubicin plus cytarabine or low dose chemotherapy (low dose cytarabine or azacitidine)). [score:3]
miR-29 family members miR-29a, miR-29b, and miR-29c have acted as oncogenes and tumor suppressors in myeloid malignancies [88]. [score:3]
miR-29c expression was higher in AML patients compared with healthy controls and was associated with poor survival [133]. [score:2]
Recent evidence showed elevated expression of the miR-29 family (miR-29a, miR-29b and miR-29c), miR-150 and miR-155 in CLL-derived exosomes compared to healthy donors [162]. [score:2]
A distinct miRNA signature is characterized by an alteration of miR-29, miR-125, miR-142, miR-146 and miR-155 expression, which has been reported to play a role in AML progression and pathogenesis [87]. [score:1]
[1 to 20 of 15 sentences]
30
[+] score: 50
Later Wang et al. confirmed that nuclear factor κB (NF-κB) up-regulated YY-1 resulted in the recruitment of EZH2 and HDAC1 to the miR-29 promoter in myoblasts, leading to the down-regulation of miR-29 and maintaining cells in an undifferentiated state. [score:7]
The miR-29, which targets DNMT3, is down-regulated by HDACs in AML. [score:6]
The regulatory mo dels of miR-29 and other miRNAs suggest that the well-known transcription factor MYC, which is one of the most commonly overexpressed oncogenes in cancer, has some functions in the aspect of epigenetic regulation (Figure 1). [score:5]
Likewise, HDACs can induce miR-29 silencing in acute myeloid leukemia (AML), which in turn increases the expression of its target gene DNMT3 [15, 44]. [score:5]
The inhibition of NF-κB activity by inhibitor of nuclear factor κB α (IκBα) would remarkably decrease the level of YY1, and consequently neither EZH2 nor HDAC1 could be recruited to miR-29 promoter [14]. [score:5]
The miR-29 family, which targets DNA methyltransferase 3 (DNMT3), is the first reported epi-miRNA, and is also the most extensively studied miRNA that is regulated by histone modification [9]. [score:4]
Without MYC, however, the lack of binding of HDAC3 and EZH2 to the miR-29 promoter results in increased miR-29 expression [10]. [score:3]
Therefore, miR-29 is restored and in turn targets YY1 to ensure differentiation. [score:3]
In addition to these effects in solid tumors, miR-29 deregulation by epigenetic mechanisms can also be found in human hematological cancers. [score:2]
Besides the crosstalk between DNA and histone methylation, indirect crosstalk between DNA methylation and histone deacetylation also occur through miRNA mediation, such as miR-1 and miR-29. [score:2]
For instance, MYC can induce epigenetic regulation of miR-29 repression through histone deacetylation and tri-methylation in B-cell lymphomas (BCL), since it can recruit histone deacetylase 3 (HDAC3) and enhancer of zeste homolog 2 (EZH2) to the miR-29 promoter, forming a MYC/HDAC3/EZH2 co-repressor complex. [score:2]
This study demonstrated that NF-κB might be an upstream regulator of the epigenetic status of miR-29 in skeletal myogenesis. [score:2]
Therefore, MYC plays an indispensable role in the epigenetic repression of miR-29 by inducing histone deacetylation and histone tri-methylation. [score:1]
Meanwhile, EZH2 can also repress miR-494 to create a positive feedback loop, which in turn increases MYC abundance and then sustains miR-29 repression in BCL [10]. [score:1]
However, the constitutively activated NF-κB–YY1 in rhabdomyosarcoma (RMS) could induce epigenetic repression of miR-29 and thereby block differentiation. [score:1]
In summary, binding of MYC or NF-κB on the miR-29 promoter seems to be a primary event in miR-29 silencing, and thereby induces the initial step of its chromatin modification. [score:1]
[1 to 20 of 16 sentences]
31
[+] score: 49
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86]Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
miRNA Function (A animal studies, H human studies) References miR-17-92 cluster important in lung development and homeostasis (A)[69, 76, 77] miR-155 important for normal lung airway remo delling (A)[70] alteration of T-cell differentiation (A)[71] miR-26a highly expressed within bronchial and alveolar epithelial cells, important for lung development (H)[75] let-7 highly expressed in normal lung tissue, functions as a tumor suppressor in lung cells (H)[78] miR-29 functions as tumor suppressor in lung cells (H)[79] miR-15, miR-16 function as tumor suppressor genes (H)[80, 81] miR-223 control of granulocyte development and function (A)[82] miR-146a/b central to the negative feedback regulation of IL-1β -induced inflammation (H)[83, 84] miR-200a, miR-223 contribution to the extreme virulence of the r1918 influenza virus (A)[85] miR-17 family, miR-574-5p, miR-214 upregulated at the onset of SARS infection (A, H)[86] Two miRNAs, miR-146a and miR-146b, have been shown to play central role in the negative feedback regulation of IL-1β -induced inflammation; the mechanism is down-regulation of two proteins IRAK1 and TRAF6 involved in Toll/interleukin-1 receptor (TIR) signalling [83, 84]. [score:22]
Other miRNAs found to be involved in the pulmonary homeostasis are members of let-7 family [78], miR-29 [79], miR-15 and miR-16 [80, 81], which function as tumor suppressors in lung cells. [score:3]
Several miRNAs such as miR-155, miR-26a, let-7, miR-29, miR-15/miR-16, miR-223, miR-146a/b and the miR-17-92 cluster have been shown to be involved in homeostasis and in the lung development (Table 4). [score:2]
[1 to 20 of 4 sentences]
32
[+] score: 49
For example, miR-29c is significantly upregulated in A549 cells after IAV infection, resulting in translational inhibition of its target BCL2L2, an anti-apoptotic member of Bcl-2 family. [score:10]
In IAV-infected A549 cells and influenza patients, miR-29 (a, b, and c) are robustly upregulated and involved in the pathway regulating IFN-λ1 expression, leading to increase of IFN-λ1 expression [67, 68]. [score:9]
For example, IAV utilizes host regulator miR-29c to indirectly down-regulate the NF-κB activity via a mechanism different from the canonical post-transcriptional way. [score:6]
In IAV-infected A549 cells, virus -induced up-regulation of miR-29c enhances the abundance of A20 transcripts, subsequently decreases the NF-κB activity, and abrogates the expression of downstream antiviral and proinflammatory cytokines, including TNF-α, IFN-β, IL-1β, IL-6, and IL-8 [69]. [score:6]
Acting as a decoy, miR-29 directly interacts with the RNA binding protein HuR (human antigen R), and prevents HuR from binding to the 3′-UTR of A20, also known as tumor necrosis factor-α -induced protein 3 (TNFAIP3, the negative regulator of NF-κB activity) and recruiting the RNA degradation complex, RNA -induced silencing complex (RISC) [100]. [score:3]
Zhang X. Dong C. Sun X. Li Z. Zhang M. Guan Z. Duan M. Induction of the cellular miR-29c by influenza virus inhibits the innate immune response through protection of A20 mRNA Biochem. [score:3]
Therefore, miR-29c promotes the influenza virus -induced apoptosis in A549 cells to suppress viral replication [67]. [score:3]
It has been revealed that some miRNAs in the serum of influenza patients, including miR-150, miR-29c, miR-145 and miR-22, are associated with severity of the disease caused by pandemic H1N1/2009 [102]. [score:3]
Balkhi M. Y. Iwenofu O. H. Bakkar N. Ladner K. J. Chandler D. S. Houghton P. J. London C. A. Kraybill W. Perrotti D. Croce C. M. miR-29 acts as a decoy in sarcomas to protect the tumor suppressor A20 mRNA from degradation by HuR Sci. [score:3]
Fang J. Hao Q. Liu L. Li Y. Wu J. Huo X. Zhu Y. Epigenetic changes mediated by microRNA miR29 activate cyclooxygenase 2 and lambda-1 interferon production during viral infection J. Virol. [score:1]
For pandemic H1N1/2009 virus-infected patients, miRNAs with significant potential diagnostic value are detected not only in the peripheral blood mononuclear cells (PBMCs) (miR-31, miR-29a and miR-148a) [55], but also in the serum (miR-150, miR-29c, miR-145 and miR-22) [102]. [score:1]
Guan Z. Shi N. Song Y. Zhang X. Zhang M. Duan M. Induction of the cellular microRNA-29c by influenza virus contributes to virus -mediated apoptosis through repression of antiapoptotic factors BCL2L2 Biochem. [score:1]
[1 to 20 of 12 sentences]
33
[+] score: 48
A recent study has revealed that miR-29 family (miR-29a, miR-29b, and miR-29c) target the de novo DNA methyltransferases DNMT3A and DNMT3B and expression levels of miR-29 family were suppressed in lung cancer. [score:7]
In addition, Mott et al. (2007) have demonstrated that MCL1, encoding an antiapoptotic BCL2 family protein, is one of the targets of miR-29 family, and that miR-29 miRNAs regulate apoptosis by targeting MCL1. [score:6]
Interestingly, several miRNAs differentially expressed in neurodegenerative diseases such as, miR-29 family, and miR-34 family are considered to be potential tumor suppressor miRNAs (Table 1). [score:6]
These findings suggest that miR-29 family act as tumor suppressors by targeting DNMT3A, DNMT3B, and MCL1. [score:5]
The reduced expression of the miR-29 family induced overexpression of DNMT3A and DNMT3B, resulting in aberrant DNA methylation in lung cancer (Fabbri et al., 2007a). [score:5]
A recent study has shown that miR-29c also regulates BACE1 protein expression (Zong et al., 2011). [score:4]
mir-29 regulates Mcl-1 protein expression and apoptosis. [score:4]
These findings suggest that miR-29 family regulate BACE1 expression and play important roles in the pathogenesis of AD. [score:4]
miR-29c regulates BACE1 protein expression. [score:4]
MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. [score:2]
miR-9. miR-29 FAMILY. [score:1]
[1 to 20 of 11 sentences]
34
[+] score: 46
All these studies indicate the same molecular mechanism: miRNA-29 regulates multiple target levels of expression with a role in extracellular matrix, and therapeutic inhibition of miR-29 improves the structure and integrity of the vessel wall. [score:8]
Besides acting on the structural components of the extracellular matrix, miRNA-29 also targets anti-apoptotic MCL-1 protein and, paradoxically, MMP-2. In fact, a decrease in MCL-1 protein was found in mice with Marfan, and inhibition of miRNA-29 prevented apoptosis, which may contribute to the therapeutic effects of inhibition of miRNA-29[68]. [score:7]
In human aneurysms, miRNA-29b (but not miRNA-29a and miRNA-29c) showed high expression in thoracic aneurysms in one study whereas, in another study, it was not regulated and showed low expression in abdominal aortic aneurysms (Figure 3). [score:6]
Interestingly, inhibition of miRNA-29 can also be used to increase elastin expression in patients with insufficient haploidentical cells as well as elastin deposition in bioengineering vessels[60]. [score:5]
These extracellular matrix components are also induced after inhibition of miRNA-29 in the vasculature[66]. [score:3]
These studies have reported that inhibition of miRNA-29 reduces the formation of aneurysms in various murine mo dels. [score:3]
Furthermore, increased expression of miRNA-29 induced severe aneurysm expansion in two different murine mo dels[67]. [score:3]
Specifically, inhibition of all miRNA-29 family has been shown to prevent angiotensin II and induce dilatation of the aorta in wild type mice[66]. [score:3]
It has been previously demonstrated that, in the heart, miRNA-29 acts on different targets of the extracellular matrix, such as collagen and elastin. [score:3]
Similar to miRNA-29, other miRNAs have been described to play a role in the pathogenesis of aneurysm. [score:1]
The promotion of miR-29 induces the extracellular matrix degradation and induces the formation of aneurysms (XVI). [score:1]
EDPs, Elastin degradation peptides; PGs, prostaglandins; ROS, reactive oxygen species; TGF-β, transforming growth factor-β; TNF-α, tumor necrosis factor-α; miR-29, microRNA-29[70]. [score:1]
A recent additional report describes the association of altered levels miRNA-29 with aneurysm formation in human thoracic aneurysm zones and, using a bioinformatics approach, miRNA-29 has been proposed to contribute to aneurysm formation[69] (Figure 3)[66, 70]. [score:1]
Indeed, it has recently been shown that miRNA-29 plays a key role in the formation of aneurysms[66]. [score:1]
[1 to 20 of 14 sentences]
35
[+] score: 46
At LT, mmu-miR-29c and -98 are downregulated but upregulation of mmu-miR-125b-5p and -574-5p, and progressive normalization of the levels of mmu-miR-218, -690 and -805 would then be part of the reduction of the inflammatory process at the late stage of the asthma mo del through the modulation of TNFα receptors. [score:7]
MiR-29 has been reported to be involved in various human cancers [54]- [57] and in tumour suppression by targeting the T-cell leukemia/lymphoma 1 (Tcl1) oncogene mRNA [54], by reverting DNA methylation by targeting DNA methyltransferases 3A (Dnmt3a) and 3B (Dnmt3b) mRNA [58] and by regulating p53 pathway through Cdc42 and p85α [59]. [score:7]
Downregulation of mmu-miR-29 members is strongly correlated with (WP458) especially with the extracellular matrix components directly involved in fibrosing processes. [score:5]
By contrast to these six miRNAs, mmu-miR-29c is downregulated at these two time-points. [score:4]
This suggests that downregulation of mmu-miR-29 members coud be one of the causes of the subepithelial fibrosis observed in chronic asthma. [score:4]
Mmu-miR-29c decrease could lead to the upregulation of CTSK (cathepsin K, see Figure 4F) at the intermediate and the late stages of asthma progression. [score:4]
Despite their close sequence similarity, miR-29 members showed different inhibitory patterns. [score:3]
0016509.g004 Figure 4Transient transfection analysis for luciferase reporter expression with mouse Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel A); mouse Mmp-24 3′UTR in the presence and absence of miR-29b and -29c (Panel B); human Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel C); human Mmp-24 3′UTR in the presence of miR-29b and -29c (Panel D); mouse Col6a2 3′UTR in the presence of miR-29c (Panel E); mouse Ctsk 3′UTR in the presence of miR-29c (Panel F); mouse Scube2 3′UTR in the presence of miR-146b (Panel G); mouse Card10 3′UTR in the presence of miR-146b (Panel H). [score:3]
Transient transfection analysis for luciferase reporter expression with mouse Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel A); mouse Mmp-24 3′UTR in the presence and absence of miR-29b and -29c (Panel B); human Mmp-15 3′UTR in the presence of miR-29b and -29c (Panel C); human Mmp-24 3′UTR in the presence of miR-29b and -29c (Panel D); mouse Col6a2 3′UTR in the presence of miR-29c (Panel E); mouse Ctsk 3′UTR in the presence of miR-29c (Panel F); mouse Scube2 3′UTR in the presence of miR-146b (Panel G); mouse Card10 3′UTR in the presence of miR-146b (Panel H). [score:3]
Among these data, 40 out of 42 (95%) gave results and trends similar to those obtained by microarray profiling, except for mmu-miR-29c at ST and LT (Figure 2), although the magnitude of the observed regulation was not always identical (mmu-miR-455 at LT and mmu-miR-450a at IT). [score:2]
As discussed further in the section, mmu-miR-29 appears to be a miRNA family displaying a protective role against fibrosis. [score:1]
Among the 17 others miRNA-mRNA pairs that were evaluated (Figure 4E-H and Figure 5), significant inhibition was observed in 10 experimental conditions (miR-29c and Ctsk; miR-146b and Scube2; miR-483 and Nola2 or Ube2c; miR-672 and Phb2; miR-223 and Il6 or Lpin2 or Arid4b; miR-690 Fst or Ctse). [score:1]
MiR-29 regulates also muscle cell differentiation probably, in part, under a feed-back control of NF-κB-YY1 pathway [61]. [score:1]
MiR-29b mimic reduced efficiently and dose -dependently the luciferase activity from constructs containing the 3′UTRs of mouse Mmp-15 and Mmp-24 while miR-29c had only a limited effect at high concentration on Mmp-24 3′UTR (Figure 4A, B). [score:1]
[1 to 20 of 14 sentences]
36
[+] score: 45
Similar to the effects of ERK5 expression, overexpression of PPARγ in A549 or H157 cells also induced a 28-fold (A549, Fig.  3E) and 54-fold (H157, Fig.  3F) increase in hsa-miR29b expression, but not hsa-miR29a or hsa-miR29c expression, as determined by Q-RT-PCR (Fig.  3E,F). [score:9]
Interestingly, Q-RT-PCR analyses of RNA isolated from ERK5 overexpressing NSCLC cells, revealed a 4-fold (A549) and a 3-fold (H157) increase in hsa-miR29b expression, but not hsa-miR29a or hsa-miR29c expression (Fig.  3A,B). [score:7]
Consistent with our PCR array data, Wnt7a induced the expression of hsa-miR29b, but not hsa-miR29a or hsa-miR29c (Fig.  1B,C). [score:3]
In strong agreement with our observations, recent studies also reveal specific induction of hsa-miR29b expression, but not hsa-miR29a or hsa-miR29c (Kole et al., 2011; Rothschild et al., 2012; Ru et al., 2012). [score:3]
In total, by using several distinct and powerful analyses we establish that activation of a β-catenin-independent pathway by Wnt7a stimulates the expression of hsa-miR29b, but not hsa-miR29a or hsa-miR29c, in NSCLC cells. [score:3]
It was interesting to note that Wnt7a induced the expression of only hsa-miR29b but not hsa-miR29a or hsa-miR29c (supplementary material Table S1). [score:3]
Real-time PCR analyses of the expression of hsa-miR29a, hsa-miR29b and hsa-miR29c in NSCLC cell lines. [score:3]
Surprisingly, in the hsa-miR29 family, Wnt7a induced the expression of only hsa-miR29b, but not hsa-miR29a or hsa-miR29c. [score:3]
On the other hand, probing the same blot with hsa-miR29a and hsa-miR29c specific probes (since there is only one base difference between the mature forms of hsa-miR29a and hsa-miR29c, we probed the blot with both the probes) showed no such increase in hsa-miR29a and hsa-miR29c expression (Fig.  1D). [score:3]
MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. [score:2]
These data suggest that Wnt7a regulates hsa-miR29b, but not hsa-miR29a or hsa-miR29c. [score:2]
To corroborate our PCR array data, we performed q-RT-PCR analyses on RNAs isolated from two NSCLC cell lines (H661 and H157) transiently transfected with either empty vector, Wnt3, or Wnt7a expression vectors and by using primers specific for the hsa-miR29 family members (Fig.  1B,C). [score:2]
The binding site of hsa-miR29b differs from that of hsa-miR29a or hsa-miR29c at the underscored bases. [score:1]
Fig. 1. (A) Multiple alignments of hsa-miR29a, hsa-miR29b and hsa-miR29c. [score:1]
[1 to 20 of 14 sentences]
37
[+] score: 43
Furthermore, overexpression of the miRNA-29 family in 3T3-L1 adipocytes resulted in an impaired insulin-stimulated glucose uptake and intracellular insulin signaling, whereas incubation of adipocytes with high insulin and glucose levels resulted in an upregulation of miRNA-29a and miRNA-29b (He et al., 2007). [score:6]
miRNA-27a-3p and the miRNA-29 family relate to in vivo peripheral insulin sensitivityIn order to determine whether the 6 differentially expressed miRNAs in T2DM patients (relative to obese/overweight controls) also are associated with peripheral insulin sensitivity, we correlated their expression levels to the glucose infusion rate (GIR) during the hyperinsulinemic-euglycemic clamp (Figure 3A). [score:5]
Finally, all members of the miRNA-29 family have previously been reported to be upregulated in several tissues, including skeletal muscle, derived from various rat mo dels of T2DM (He et al., 2007; Karolina et al., 2011). [score:4]
In agreement with these findings, the present study also indicates that all three members of the miRNA-29 family (miRNA-29a-3p, miRNA-29b-3p and miRNA-29c-3p) are upregulated in skeletal muscle tissue of T2DM patients (Figure 1). [score:4]
Subsequent stepwise regression analysis of the relative miRNA expression levels and peripheral insulin sensitivity, supported the notion that these associations of miRNA-27a-3p, miRNA-29a-3p, miRNA-29b-3p and miRNA-29c-3p with peripheral insulin sensitivity were rather direct associations which were not confounded by co-correlations with other variables (i. e., VO2max, PCrR, age, BMI, body fat percentage, FPG, and FPI) that were (by design) different between these 4 phenotypically different groups (Figure 3). [score:4]
Altered miRNA-29 expression in type 2 diabetes influences glucose and lipid metabolism in skeletal muscle. [score:3]
Here, we show that, out of the 25 selected miRNAs, 6 candidate miRNAs (miRNA-133b-3p, miRNA-206, miRNA-27a-3p, miRNA-29a-3p, miRNA-29b-3p, and miRNA-29c-3p) were differently expressed in T2DM patients vs. [score:3]
We demonstrate that miRNA-27a-3p and all three members of the miRNA-29 family were upregulated in skeletal muscle of T2DM patients compared to non-diabetic overweight/obese individuals, and additionally displayed strong negative correlations with peripheral insulin sensitivity across the four metabolically distinct human subject groups. [score:3]
Figure 2Relative expression levels of miR-133b-3p (A), miR-206-5p (B), miR-27a-3p (C), miR-29a-3p (D), miR-29b-3p (E), and miR-29c-3p (F) in type 2 diabetic subjects (T2DM) vs. [score:3]
Previous research also demonstrated increased expression of miRNA-29 family members in whole blood of T2DM patients, as compared to healthy, normoglycemic controls (Karolina et al., 2011; Kong et al., 2011). [score:2]
We identified miRNA-27a-3p and all three members of the miRNA-29 family to be differentially regulated in muscle from patients with T2DM as compared to normoglycemic obese/overweight individuals. [score:1]
1.16 ± 0.08; p = 0.02), and miRNA-29c-3p (1.20 ± 0.06 vs. [score:1]
Interestingly, the miR-29 family members all present a predicted binding site on at least one of the 3′UTR messenger RNAs described above. [score:1]
Mechanistically, the actions of the miRNA-29 family may be mediated via effects on IGF-1 (Smith et al., 2013), AKT2 (Karolina et al., 2011), Caveolin-2 (Cav2) and syntaxin-1, all molecules implicated in insulin stimulated glucose uptake in muscle cells (Oh et al., 2006) or GLUT4 vesicle-membrane interactions, respectively (Dulubova et al., 1999; Macaulay et al., 2002; He et al., 2007). [score:1]
Moreover, we demonstrate that all three miRNA-29 members also significantly and negatively correlated with peripheral insulin sensitivity (Figure 3), supporting recent findings in human (Massart et al., 2017). [score:1]
miRNA-27a-3p and the miRNA-29 family relate to in vivo peripheral insulin sensitivity. [score:1]
[1 to 20 of 16 sentences]
38
[+] score: 42
miR-31-3p, miR-31-5, and miR-29c-3p expression shows up-regulation in full thickness skin samples. [score:6]
B. Relative miR-29c-3p expression in full thickness skin biopsies confirms statistically significant up-regulation in prospectively collected samples (p = 0.043). [score:6]
In fibroblasts, miR-29c showed a trend of induction and was significantly up-regulated in full thickness biopsies, suggesting a possible role in regulating fibroblast functions in the diabetic environment. [score:5]
Furthermore, miR-29b, another member of miR-29 family, has been shown to directly target Type I collagen in human dermal fibroblasts [32]. [score:4]
Nonetheless, we determined the expression of miR-29c-3p in a larger set of cell lines from 8 additional DFS and 8 NFS. [score:3]
MiR-29 family has been found to be up-regulated in different cells and tissues from diabetic patients as well as from diabetic rodent mo dels [23]. [score:3]
Alternatively, although miR-29c was not found regulated in LCM of epidermis its regulation in fibroblast may still require cross talk with keratinocytes or other cell types found in the wound. [score:3]
Taken together, the miR analyses suggest that epidermal miRs show very subtle differences in expression between unwounded diabetic foot and non-diabetic foot skin, while diabetes correlates with induced miR-29c. [score:3]
B. Relative miR-29c expression in a prospective set of samples shows a trend of induction in DFF compared to NFF (Median, n = 8 per group, t-test, p = 0.09). [score:2]
However, the implications of miR-29c up-regulation in diabetic skin require further investigation. [score:2]
We also evaluated expression of miR-29c-3p in the same full thickness foot skin samples from ten diabetic and ten non-diabetic patients. [score:1]
Lack of statistical significance of miR-29c may originate from several reasons. [score:1]
miR-29c-3p was found to be significantly induced in diabetic skin, which correlated with its induction in diabetic foot fibroblasts (Fig 3B). [score:1]
microRNA profiling of diabetic (DFF) and non-diabetic (NFF) foot fibroblasts shows induction of miR-29c. [score:1]
Consistently, miR-29c has been reported to be induced in the liver, skeletal muscle, and fat of diabetic mice and to repress insulin-stimulated glucose uptake in adipocytes [23, 31]. [score:1]
[1 to 20 of 15 sentences]
39
[+] score: 41
The expression of TGF-β was also shown to increase following MI [48], inhibiting the expression of the miR-29 family, which are known to target multiple collagens involved in fibrosis [46]. [score:9]
In the miRNA and TF mediated regulatory network, each of the three miR-29 family members formed miRNA-FFLs with COL4A1 and SP1 (S3 Fig), and previous studies have confirmed that COL4A1 is a target of the miR-29 family and that SP1 could regulate the expression of COL4A1 [61– 64]. [score:7]
Additionally, critical regulators and regulatory modules of the network were identified, and a potential pathway mo del highlighting the co-regulation of miR-21-5p, the miR-29 family and SP1 was proposed, which may provide new clues for deciphering the regulatory mechanisms of MI. [score:5]
In addition, according to this pathway module, the miR-29 family might participate in the process of apoptosis and angiogenesis through indirectly modulating the expression of FASLG and VEGFA. [score:4]
Three (miR-29a-3p, miR-29b-3p and miR-29c-3p) of the 5 MImiRNAs belonged to the miR-29 family, members of which are known to target a cadre of protein-coding mRNAs involved in fibrosis and play crucial roles in cardiac fibrosis [46]. [score:3]
To explore the potential co-regulatory mechanisms between miRNAs and TFs in MI, a pathway mo del demonstrating the co-regulation of miR-21-5p, the miR-29 family (miR-29a-3p, miR-29b-3p and miR-29c-3p) and SP1 in cardiac fibrosis, apoptosis and angiogenesis was proposed (Fig 4). [score:3]
Mo del of co-regulation of miR-21-5p, the miR-29 family and SP1 involving a biological pathway and the regulatory network. [score:3]
Additionally, based on network analysis and a comprehensive literature review, we proposed a pathway mo del demonstrating the potential co-regulation of miR-21-5p, the miR-29 family and SP1 during MI. [score:2]
miR-21-5p, the miR-29 family and SP1 co-regulated the process of cardiac fibrosis, apoptosis and angiogenesis through several cascades. [score:2]
Thus, miR-29 family members, SP1 and multiple collagens were assumed to form FFLs to regulate fibrosis. [score:2]
A potential pathway mo del of miR-21-5p, the miR-29 family and SP1 in cardiac fibrosis, apoptosis and angiogenesis. [score:1]
[1 to 20 of 11 sentences]
40
[+] score: 39
Therefore, We inhibited miR-29c using microRNA inhibitor in YAP -overexpressing cells to detect if miR-29c was required for the effects of YAP on gankyrin. [score:7]
The results showed that inhibiting miR-29c increased the expression of PTEN and reduced the expression of gankyrin and p-AKT (Supplementary Figure 5H). [score:7]
However, the expression of p-AKT and gankyrin are likely regulated by other factors as well because they were reduced but not completely abrogated by inhibiting miR-29c. [score:6]
YAP increases the expression of gankyrin through microRNA-29c (miR-29c) and IGF1 -induced AKT activation. [score:3]
Some of the targets controlled by YAP have been reported to be involved in the activation of PI3K-AKT signaling, such as AXL, CCN2, miR-29c, and IGF-1 [33– 35, 49]. [score:3]
Previous study reported that YAP could activate the kinases AKT by suppressing PTEN via miR-29c [34]. [score:3]
Moreover, CHIP assay further demonstrated that miR-29c was also a direct target of YAP in CCA cells (Supplementary Figure 5I). [score:3]
We further found that YAP increased gankyrin expression through miR-29c- and IGF1 -mediated AKT activation. [score:3]
Our study provided mechanistic evidence that YAP exhibits its oncogenic activity by increasing gankyrin expression via miR-29c and IGF1 -induced AKT activation. [score:3]
Taken together, these results indicated that a positive feedback loop, consisting of YAP, miR-29c, IGF1, AKT, and gankyrin, was involved in the progression of CCA (Figure 6H). [score:1]
[1 to 20 of 10 sentences]
41
[+] score: 38
Targetscan analysis showed that miR-26a and miR-29c had target genes for collagens which involved in pro-fibrotic events and fibrosis. [score:5]
A. Expression of miR-1, miR-26a and miR-29c B. Expression of miR-34b, miR-451 and miR-1246. [score:5]
Among the downregulated miRNAs; miR-1, miR-29c, and miR-34b showed more declined expression in the female subjects, compared to the male counterpart. [score:5]
0064396.g003 Figure 3 A. Expression of miR-1, miR-26a and miR-29c B. Expression of miR-34b, miR-451 and miR-1246. [score:5]
Likewise, miR-29 family directly target at least 16 extracellular matrix genes, providing a strong evidence for anti-fibrotic effects in related organs including heart [27]. [score:4]
Our study reveals that in human subjects with moderate to severe PH are associated with significant downregulation of plasma levels of circulatory miR-1, miR-26a and miR-29c. [score:4]
MiR-1, miR-26a, miR-29c, miR-34b, miR-451 and miR-1246 are downregulated in PH subjects. [score:4]
The expressions of miR-26a, miR-29c, miR-451 and miR-1246 were declined to 0.66±0.12, 0.52±0.14, 0.49±0.16 (p<0.05) and 0.67±0.21-folds (p = ns) respectively, in moderate PH subjects, compared to the control subjects. [score:2]
On the contrary, our data revealed a set of declined miRNAs which includes miR-26a, miR-29c, miR-34b and miR-451and; can be used as biomarker as well. [score:1]
We choose the following miRNAs for validation: MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
We choose the following miRNAs for validation:MiR-21, miR-23a, miR-26a, miR-29, miR-34b, miR-191, miR-451 and miR-1246 were derived from the miRNA array analysis (Figure 2). [score:1]
Alternatively, the significant decrease of miR-1, miR-26a and miR-29c level in PH has potential diagnostic significance. [score:1]
[1 to 20 of 12 sentences]
42
[+] score: 37
The results showed that fucoidan increased the expression of tumor suppressive miRs such as miR-29 family and miR-1224 (Table 1). [score:5]
MiR-29b is the most highly expressed miR-29 family member (miR-29a/b/c) and its aberrant expression is common in the majority of human cancers [36]. [score:5]
Many reports demonstrate that miR-29 family exerts various effects in preventing cancer progression and carcinogenesis, such as apoptosis induction [14], cell cycle regulation, epigenetic modification, and metastasis inhibition [15]. [score:4]
On the other hand, besides the induction of tumor-suppressive miR-29 family, fucoidan also represses the oncogenic miR-17/92 cluster [43], representing its multiple functions in miRs regulation. [score:4]
Considering the marked activation of miR-29 expression by fucoidan in human HCC cells, we investigated the changes of miR-29b downstream target in fucoidan -treated HCC cells to further delineate the underlying molecular events. [score:3]
Decreased expression of miR-29 has been reported in multiple cancers, including HCC [16, 17]. [score:3]
miR-ID Increased Fold-Changes miR-ID Decreased Fold-Changes miR-29b 8.5 miR-17 15.7 miR-29a 7.7 miR-92a 13.6 miR-29c 7.3 miR-18a 12.0 miR-1224 6.6 miR-192 7.2 miR-133b 2.0 miR-127 2.4 miR-200c 1.7 miR-154 1.9 miR-200a 1.4 miR-21 1.7 miR-205 1.3 miR-680 1.3 miR-208a 1.2 miR-377 1.2 miR-669b 1.2 miR-153 1.1 Figure 3Fucoidan increases the expression of miR-29b. [score:3]
miR-ID Increased Fold-Changes miR-ID Decreased Fold-Changes miR-29b 8.5 miR-17 15.7 miR-29a 7.7 miR-92a 13.6 miR-29c 7.3 miR-18a 12.0 miR-1224 6.6 miR-192 7.2 miR-133b 2.0 miR-127 2.4 miR-200c 1.7 miR-154 1.9 miR-200a 1.4 miR-21 1.7 miR-205 1.3 miR-680 1.3 miR-208a 1.2 miR-377 1.2 miR-669b 1.2 miR-153 1.1 Figure 3Fucoidan increases the expression of miR-29b. [score:3]
Regarding the important roles of dysregulated miR-29 family and miR-17/92 cluster reported in many cancers [36, 43], nutraceuticals able to regulate these miRs will be attractive for integration into conventional cancer therapy. [score:3]
The expressions of miR-29b, miR-29a and miR-29c in fucoidan -treated HepG2 cells were increased 8.5-, 7.7- and 7.3-fold, respectively, as compared to the control (Table 1). [score:2]
The miR-29 family consists of miR-29a, miR-29b and miR-29c with shared regulatory capacity. [score:2]
[1 to 20 of 11 sentences]
43
[+] score: 37
Furthermore, as additional evidence for miR-29 activity, a correlation -based sequence motif analysis found that the miR-29 seed sequence complement was the top enriched motif in 3′-UTRs of mRNAs anti-correlated with miR-29a expression (Figure 6B), further suggesting that miR-29 directly regulates expression levels of many target mRNAs in the tumors; this analysis also showed strong enrichment for non-canonical miR-29a seed motifs (i. e. motifs not following the typical pattern of nucleotides 2–7) with a bulge in position 3 of the miR-29a sequence, suggesting that target prediction methods requiring perfect base pairing in the seed region of the miRNA target duplex could miss a substantial fraction of functional miRNA target interactions. [score:15]
While miR-29 expression was not associated with survival (P>0.05, univariate Cox), forced miR-29a expression impacted cell proliferation in OvCar-8 and HEYA8 cell lines (Figure 6D) and had an additional effect on chemotherapeutic agent cisplatin in inhibiting the growth of these lines (Figure 6E). [score:7]
Members of the miR-29 family have been demonstrated to act as tumor suppressors in acute myeloid leukemia and lung cancer, in part by reverting aberrant methylation patterns through its targeting of DNA methyltransferases (DNMT) and methylation-silenced tumor suppressors [28], [29]. [score:7]
The miR-29 family and predicted target genes were among the most strongly anti-correlated miRNA:mRNA pairs; over -expression of miR-29a in vitro repressed several anti-correlated genes (including DNMT3A and DNMT3B) and substantially decreased ovarian cancer cell viability. [score:5]
We focused our attention here on the miR-29 family, given its strong anti-correlation with many cell cycle-related genes (Figure 4B). [score:1]
Figure S11 Methylation subtype 2 is associated with combined low miR-29 and high DNMT3A levels. [score:1]
Top anti-correlated genes of miR-29 in ovarian cancer included DNMT3A and DNMT3B (Figure 6A), suggesting a similar role for miR-29 in high-grade serous ovarian cancer. [score:1]
[1 to 20 of 7 sentences]
44
[+] score: 37
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-186, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Out of the 114 differentially expressed miRNAs, the only 10 upregulated miRNAs in SzS samples were miR-145, miR-574-5p, miR-200c, miR-199a*, miR-143, miR-214, miR-98, miR-518a- 3p, and miR-7. The aberrant expression of MYC in SzS was found to correlate with the set of miRNAs including miR-30, miR-22, miR-26a, miR-29c, miR-30, miR-146a, and miR-150 which were downregulated. [score:11]
Furthermore, downregulation of miR-29 is in line with the ccnd1 overexpression and the consequent CDK4/CDK6 activation, which is the primary event in MCL pathogenesis. [score:6]
Loss of miR-29a and miR-29c also correlates with TCL1A overexpression in MCL, and direct regulation of it has been previously shown [55]. [score:5]
They also showed that miR-29 targets CDK6, expression of which is a known prognostic and pathogenetic factor in MCL. [score:5]
The patients with significantly downregulated miR-29 had a shorter survival compared with those who expressed relatively high levels of miR-29 [54]. [score:5]
miR-29 family (miR-29a, miR-29b, and miR-29c) was among the major downregulated miRs in addition to miR-142-3p/5p, miR-150, and miR-15a/b, and associated with short overall survival [54]. [score:4]
Use of miR-15a and miR-29 mimics in prostate and AML cell lines, respectively, induced apoptosis [5, 81]. [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 36
In addition, the miR-29 family is associated with the up-regulation of the tumor suppressor p53, which is central to many cellular stress responses and for inducing apoptosis [31]. [score:6]
P-values for chosen candidates were as follows: miR-17(1.92E [−09]), miR-18a(2.62E [−09]), miR-29c(4.71E [−09]), miR-106a(1.84E [−08]), miR-135a(8.26E [−09]), miR-135b(1.99E [−08]), miR-221(9.19E [−05]), miR-222(2.04E [−05]) (see Supporting Table S2) Expression profiles of these candidates can be found in Figure 2. Three out of eight miRNAs exhibited decreasing expression during brain development (miR-17, miR-18a (belonging to the same cluster), miR-106a) [24]. [score:6]
The second group, e. g. ; the miR-29 family (containing miR-29a –b –c) and miR-22, miR-24, miR-27b and miR-142-5p showed increasing expression with age progression, with a particularly high expression in the adult tissues. [score:5]
We also analyzed one miRNA which displayed an increase in expression during development (miR-29c). [score:4]
Therefore, it is plausible that miRNAs prominently expressed at this time (for instance miR-24 and the miR-29 family members) might regulate this process. [score:4]
Expression of miR-29c was 22- and 18-fold higher in the adult cortex and cerebellum respectively, than in the corresponding tissues at F50 (Figure 4). [score:3]
A second pattern of expression was detected for miR-29c. [score:3]
Numerous developmental stage or tissue-specific microRNAs including, miR-17, miR-18a, miR-29c, miR-106a, miR-135a and b, miR-221 and miR-222 were found by microarray analysis. [score:2]
Eight different candidate miRNAs: hsa-miR-17, hsa-miR-18a, hsa-miR-29c, hsa-miR-106a, hsa-miR-135a hsa-miR-135b, hsa-miR-221 hsa-miR-222 and two reference miRNAs: hsa-miR-103 and hsa-miR-191 were profiled by. [score:1]
The miR-29 family (miR-29a, miR-29b and miR-29c) has previously been shown to be effective biomarkers of radiation -induced brain responses [29]. [score:1]
The correlation coefficient values (R [2]) for particular miRNAs include: miR-17 (R [2] = 0.84), miR-18a (R [2] = 0.94), miR-29c (R [2] = 0.92), miR-106a (R [2] = 0.81) and miR-135a (R [2] = 0.89) miR-135b (R [2] = 0.95), miR-221 (R [2] = 0.91) and miR-222 (R [2] = 0.88). [score:1]
[1 to 20 of 11 sentences]
46
[+] score: 36
The expression of maternally expressed gene 3 (MEG3), which is down-regulated in HCC, may be regulated by microRNA-29 low expression in tumor (LET) is also down-regulated in HCC and contributes to hypoxia -mediated invasionATB- lncRNA activated by TGF-β is highly expressed in HCC and strongly associated with poor prognosis in HCC patientsTherefore, the discovery of the impact of non-coding RNAs in HCC and CRC has led to useful applications in the clinical management of HCC, future treatment being represented by a cocktail of T-cell modulators and vaccines enriched with the molecular targets of blockers in cancer-signaling pathways [68, 89; 92- 97] In contrast to miRNAs, which were largely studied for their roles in carcinogenesis, lncRNAs are less described. [score:18]
The expression of maternally expressed gene 3 (MEG3), which is down-regulated in HCC, may be regulated by microRNA-29 low expression in tumor (LET) is also down-regulated in HCC and contributes to hypoxia -mediated invasionATB- lncRNA activated by TGF-β is highly expressed in HCC and strongly associated with poor prognosis in HCC patients Therefore, the discovery of the impact of non-coding RNAs in HCC and CRC has led to useful applications in the clinical management of HCC, future treatment being represented by a cocktail of T-cell modulators and vaccines enriched with the molecular targets of blockers in cancer-signaling pathways [68, 89; 92- 97] In contrast to miRNAs, which were largely studied for their roles in carcinogenesis, lncRNAs are less described. [score:18]
[1 to 20 of 2 sentences]
47
[+] score: 34
In this regard, the enforced expression of miR-29 in lung cancer cell lines led to reduced global DNA methylation, induced re -expression of methylation-silenced tumor suppressor genes, such as FHIT and WWOX, and inhibited tumor cell proliferation in vitro and tumor growth in vivo [48]. [score:9]
By promoting the downregulation of the DNA methyltransferases 3A and B (DNMT3A and 3B), miR-29 induces re -expression of methylation-silenced tumor suppressor genes, such as the fragile histidine triad protein (FHIT) and the WW domain containing oxidoreductase (WWOX) [49]. [score:8]
In addition to miR-15a/miR-16-1 and let-7, miR-29 family members (miR-29a, b, c) were shown to function as tumor suppressor miRNAs, their downregulation being associated with the development and progression of several human malignancies, including CLL, lung cancer, invasive breast cancer and hepatocellular carcinoma [36, 37, 43, 48]. [score:7]
Interestingly, Fabbri and colleagues demonstrated that miR-29 can function as a tumor suppressor in lung cancer through interference with the methylation of tumor suppressor genes. [score:5]
Decreased expression of members of the miR-29 family (miR-29a, b, c) was observed in various malignancies that contain aberrant DNA hypermethylation patterns, including lung cancer [48, 127]. [score:3]
Fabbri M. Garzon R. Cimmino A. Liu Z. Zanesi N. Callegari E. Liu S. Alder H. Costinean S. Fernandez-Cymering C. Microrna-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3a and 3b Proc. [score:2]
[1 to 20 of 6 sentences]
48
[+] score: 34
It has been demonstrated that the miR-29 family might function as a tumor suppressor and that expression of these miRNAs inhibits cell proliferation, promotes apoptosis of cancer cells, and suppresses tumorigenicity by targeting multiple oncogenes [38, 39]. [score:11]
In our previous studies on osteosarcoma (OS), a tumor in which the miRNA-29 family members (miR-29a/b/c; miR-29s) are often deregulated [20, 21], we found that ectopic expression of miR-29b-1 was able to suppress the stemness properties of the 3AB-OS cell line [22], a novel CSC line by us produced [23], suggesting that miR-29b-1 could be a novel therapeutic agent against OS. [score:6]
In addition, it has been reported that miR-29b-1/mir-29a promoter sequence is regulated by MYC, contributing to mir-29 downregulation in human malignancies [53]. [score:5]
However, albeit the miR-29 family members share a common seed region sequence (thus predicting that they target overlapping sets of genes), they frequently exhibit differential regulation and different subcellular distribution, suggesting different functional importance [40]. [score:4]
In addition, in human ER+PR+ breast cancer cells, the downregulation of miR-29 members increases mammosphere formation in vitro and tumor initiating capability in vivo [19]. [score:4]
Dysregulation of miR-29 family has been reported in various cancers including breast cancers [15, 16, 34, 41, 42]. [score:2]
This is a particularly important aspect of our research, because it is known that in the big family of miR-29 each member plays often opposing functions. [score:1]
MiR-29 family consists of four closely related members (miR-29a, miR-29b-1, miR-29b-2 and miR-29c). [score:1]
[1 to 20 of 8 sentences]
49
[+] score: 34
Three of the four genes were significantly (p<0.05) down regulated by the over -expression of miR-29 and three genes were significantly (p<0.05) up regulated by the antagomiR -mediated inhibition of miR-29 (Fig. 4B). [score:7]
The x-axis lists the gene symbols for each of four predicted miR-29 target genes and the y-axis depicts the relative quantitative value (RQV; expression determined by RT-qPCR and normalized to Rps9) in response to the miR-29 mimic (blue) or the miR-29 inhibitor (red) relative to mock transfection. [score:7]
We evaluated several predicted gene targets of our top candidate regulatory hub, miR-29, and demonstrated the potential of the 5′-shifted isomiRs miR-375+1 and miR-375-1 to differentially regulate gene expression in MIN6 cells. [score:5]
Though miR-29 has been shown to regulate glucose-stimulated insulin secretion, its target genes in the beta cell are largely unknown. [score:4]
To validate the in silico approach, we selected several predicted targets (Camk1d, Glis3, and Jazf1), and one previously validated target (Slc16a1 [48]), of miR-29 from among the for evaluation in MIN6 cells. [score:3]
MIN6 cells were transiently transfected with (1) 10 nM mmu-miR-29 mimic (Dharmacon); (2) 200 nM mmu-miR-29 hairpin -inhibitor (Dharmacon); (3) 10 nM mmu-miR-375 mimic (Dharmacon); (4) 10 nM custom mmu-miR-375+1 mimic (Dharmacon: 5′-UUGUUCGUUCGGCUCGCGUGA-3′) or (5) 10 nM custom mmu-miR-375-1 mimic (Dharmacon: 5′UUUUGUUCGUUCGGCUCGCGUGA-3′). [score:3]
These findings are consistent with previous reports that miR-29 is involved in the regulation of beta cell function [48], [50], and they serve as a validation of the in silico regulatory hub analysis. [score:3]
Specifically, we transiently transfected MIN6 cells with a miR-29 mimic or inhibitor (antagomiR) and measured the mRNA levels of each of the four genes by real-time quantitative PCR (RT-qPCR). [score:1]
The top two were the 5′-reference miRNAs miR-29 and let-7, both of which have been implicated in beta cell function and glucose homeostasis [47]– [49]. [score:1]
[1 to 20 of 9 sentences]
50
[+] score: 34
The tumor suppressor role of miR-29b2/miR-29c was clearly evidenced by gain-of-function experiments demonstrating that forced over -expression of this miRNA cluster in RMS cells is sufficient to impair the tumorigenic properties both in vitro and in vivo by repressing YY1 expression. [score:7]
Interestingly, the miR-29 family has been shown to directly target DNMT3A and DNMT3B in several types of cancer, thus suggesting a link between their reduced expression and pathological gene hyper-methylation [78, 79]. [score:6]
In line with this report, preliminary results from our laboratory showed that EZH2 downregulation in RMS cells impairs tumorigenesis, thereby allowing the de-repression of several tumor suppressor miRNAs, including the miR-29b2/miR-29c cluster. [score:6]
Under myogenic cues, miR-29b2/miR-29c gene cluster is expressed and directly targeted YY1 reinforcing myogenesis. [score:6]
The miR-29b2/miR-29c-YY1 epigenetic negative feedback circuitry [60] was shown by the authors to be disrupted in RMS cells, in which YY1 and EZH2 over -expression resulted in persistent activation of stemness maintenance program. [score:3]
Wang and colleagues provided the first evidence of an epigenetic deregulation of miRNAs in RMS discovering a regulatory circuitry between miR-29b2/miR-29c and the PcG protein YY1 [60]. [score:3]
This repression involved the recruitment of both HDAC1 and the EZH2 PcG protein, which deacetylated and trimethylated, respectively, the Lys 27 on histone H3 in a highly conserved region 20 kb upstream of the miR-29b2/miR-29c gene locus. [score:1]
Indeed, they identified miR-29b2/miR-29c cluster on chromosome 1 being repressed by YY1 in proliferating myoblasts (Figure 4). [score:1]
In addition to myomiRs, there are non-muscle-specific miRNAs that participate to skeletal muscle differentiation such as miR-181a/miR-181b, miR-27a, miR-27b, miR-26a and miR-29b2/miR-29c. [score:1]
[1 to 20 of 9 sentences]
51
[+] score: 30
In this study, we demonstrated that TPA -induced ERK signaling pathway in HepG2 cells can up-regulate expression of tumor suppressor gene miR-29c and miR-101. [score:8]
Several studies have shown that miR-29c is down-regulated in nasopharyngeal carcinomas, chronic lymphocytic leukemia (CLL), and lung cancer which were correlated with up -regulating target genes in extracellular matrix proteins and DNA methyltransferase (DNMT) 3A and -3B [27- 29]. [score:7]
Expression levels of miR-101, miR-29c and miR-122 were normalized to miR-16 and expressed as fold-change using time 0 as baseline. [score:5]
Two miRNAs, miR-101, and miR-29c, were shown to be significantly down regulated in human hepatoma tissues and induced over 4-fold in HepG2 cells under TPA treatment. [score:2]
Two miRNAs, miR-101, and miR-29c, were found significantly down regulated in human hepatoma tissues and induced over 4-fold in HepG2 cells upon TPA treatment (Fig 2B; Table 2). [score:2]
Whether miR-29c is also involved in regulating HepG2 cell growth still needs more studies in the future. [score:2]
Seed FamilyHCCP-valueHCC(T/N) [a]TPA(T/C) [b] hsa-miR-1011p31.39p24.1 ACAGUAC miR-101 2.30E-04 -2.17 13.36 hsa-miR-29c 1q32.2 AGCACCA miR-29 5.90E-03 -2.31 7.26 a, tumor versus normal fold-change; b, TPA versus DMSO (control) fold change The induction kinetics of both miR-101 and miR-29c in HepG2 cells after TPA treatment were examined. [score:1]
On the other hand, miR-29c only showed slight induction after 12 hrs and reached maximum level of induction at 48 hrs. [score:1]
Since induction kinetics of miR-101 by TPA was much faster than miR-29c suggests that the induction of miR-101 may be the primary response of TPA treatment. [score:1]
Seed FamilyHCCP-valueHCC(T/N) [a]TPA(T/C) [b] hsa-miR-1011p31.39p24.1 ACAGUAC miR-101 2.30E-04 -2.17 13.36 hsa-miR-29c 1q32.2 AGCACCA miR-29 5.90E-03 -2.31 7.26 a, tumor versus normal fold-change; b, TPA versus DMSO (control) fold changeThe induction kinetics of both miR-101 and miR-29c in HepG2 cells after TPA treatment were examined. [score:1]
[1 to 20 of 10 sentences]
52
[+] score: 30
The downregulation of miR-29 and upregulation of its oncogenic targets, Tcl1 (T-cell leukemia/lymphoma 1), Mcl1 (an anti-apoptotic Bcl-2 family member) and DNA methyltransferase (DNMT3), have been implicated in chronic lymphocytic leukemia, cholangio-carcinoma and lung cancer as a means of blocking tumor cell apoptosis and silencing tumor suppressor genes [31,32]. [score:11]
In summary, several previously known downregulated “tumor suppressor miRNAs” in malignant tumors, such as let-7d, miR-451, miR-23a, and miR-29 were found to be upregulated in schwannomas. [score:9]
Another interesting potential tumor suppressor miRNA in cancer, miR-29 was also found to be upregulated in schwannomas. [score:6]
Again upregulation of this miR29 may serve to attenuate the growth of benign schwannomas. [score:4]
[1 to 20 of 4 sentences]
53
[+] score: 30
Kim J. H. Jeon S. Shin B. A. MicroRNA-29 Family Suppresses the Invasion of HT1080 Human Fibrosarcoma Cells by Regulating Matrix Metalloproteinase 2 ExpressionChonnam Med. [score:5]
miR-29c is another miRNA which is downregulated in MPNST, in contrast to benign neurofibroma [70]. [score:4]
The experimental upregulation of miR-29c results in reduced cellular invasion, whilst cell proliferation remains unchanged [70]. [score:4]
Additionally, miR-29 also targets transcription factor E2F7, which is involved in DNA repair and replication, mitosis and cell cycle regulation [78, 80]. [score:4]
Reduced invasion of fibrosarcoma cells can be achieved by experimental overexpression of miR-29 family-members [84]. [score:3]
Consequently, miR-29, miR-1 and miR-206 have potential tumour-suppressive functions; therefore, their mimics may be used in the treatment of rhabdomyosarcoma. [score:3]
Presneau N. Eskandarpour M. Shemais T. Henderson S. Halai D. Tirabosco R. Flanagan A. M. MicroRNA profiling of peripheral nerve sheath tumours identifies miR-29c as a tumour suppressor gene involved in tumour progressionBr. [score:3]
Therefore, therapeutic administration of miR-29c may be a worthwhile strategy to impair the invasive and metastatic potential of MPNST. [score:1]
In clinical practice, the administration of miR-29 could therefore lessen the invasive and metastatic potential of fibrosarcomas. [score:1]
The miR-29 family is not only involved in the pathogenesis of MPNST, but also contributes to the progression and invasion of fibrosarcoma cells [84]. [score:1]
Concurrently, higher miR-29c levels correlate with lower activity of MMP-2 in MPNST cell lines [70]. [score:1]
[1 to 20 of 11 sentences]
54
[+] score: 30
Eight miRNAs (miR-101, miR-107, miR-122, miR-29, miR-365, miR-375, miR-378, and miR-802), whose expression was found to be downregulated in c-Myc and/or AKT/Ras liver tumors, were selected and their tumor suppressor activity was assessed in c-Myc and AKT/Ras mice. [score:8]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
miRNA Oncogene Growth Inhibition miR-101 c-Myc +++ AKT/Ras +++ miR-107 c-Myc + AKT/Ras ++ miR-122 c-Myc ++ AKT/Ras ++ miR-29 c-Myc ++ AKT/Ras + miR-365 c-Myc ++ AKT/Ras ++ miR-375 c-Myc + AKT/Ras +++ miR-378 c-Myc − AKT/Ras − miR-802 c-Myc ++ AKT/Ras − Taken together, the present results indicate that miR-378 does not possess tumor suppressor activity on c-Myc and AKT/Ras induced hepatocarcinogenesis in mice. [score:5]
In summary, the present results indicate that miR-107, miR-122, miR-29, miR-365, and miR-802 possess weak to moderate tumor suppressive properties, as none of them is able to completely prevent oncogene driven liver tumor development in mice. [score:4]
Weak to moderate tumor suppressor potential of miR-107, miR-122, miR-29, miR-365, and miR-802 in c-Myc and AKT/Ras driven liver tumor development. [score:4]
Overexpression of miR-29 slightly delayed AKT/Ras and c-Myc driven liver tumor formation. [score:3]
Among the 8 miRNAs, 4 miRNA (miR-101, miR-29, miR-107 and miR-122) had available human miRNA array data. [score:1]
[1 to 20 of 7 sentences]
55
[+] score: 28
In our study, CASP3 was significantly upregulated by qRT-PCR analysis (Figure 6) and targeted by the downregulated miRNAs: miR-342-3p, miR-29b, miR-29c, miR-29a, let-7g and miR-30b, which can be expected to develop miRNA -based therapeutics for influenza disease. [score:11]
Therefore, down-regulation of miR-29a, miR-29c and let-7g may contribute to the uncontrolled inflammation by allowing up-regulation of pro-inflammation genes. [score:7]
Therefore, the downregulated miR-29 may regulate the T helper 1 (Th1) cell differentiation to secrete more IFN-gamma and mediate elimination of intracellular pathogens, but dysregulated T cell responses may also contribute to pathologic inflammation. [score:6]
E. K. Loveday et al. demonstrated that miR-29a, miR-29c and let-7g were down-regulated in human A549 cells infected with swine-origin influenza pandemic H1N1 [21]. [score:4]
[1 to 20 of 4 sentences]
56
[+] score: 28
Interestingly miR155, through its negative effect on APC (76) and HMG-box transcription factor 1 (77), a strong Wnt pathway suppressor and miR30a by blocking PRDMI (78) could induce β-catenin/TCF -mediated gene expression, and thus regulate the expression of additional miRNAs, like miR21 and miR125b (79) and miR146b, which is positively regulated bya (80) and miR29 (81, 82). [score:9]
Upon interaction of M. tuberculosis with TLR2 and TLR4, NFκB activation leads to increased miR155 levels which, besides its negative effect on autophagy and apoptosis, through the negative modulation of key inhibitors of the Wnt pathway (APC and HMG-box transcription factor 1) leads to β-catenin/TCF -mediated expression of miR2, miR125b, miR146b (a target of thea signaling pathway), and miR29, thus wiping off the pro-inflammatory response. [score:7]
Additionally, miR29 could also further enhance the Wnt signaling pathway by targeting the negative regulators of Wnt signaling, Dikkopf-1, Kremen2, and secreted frizzled-related protein 2 (sFRP2) (81, 82). [score:4]
Additionally, miR29 further enhances Wnt signaling by targeting distinct set of Wnt negative regulators (Dikkopf-1, Kremen2, and sFRP2). [score:4]
miR21 by reducing BCL2 protein levels (83) and miR29 by targeting caspase-7 (84) might prevent apoptosis of infected macrophages. [score:3]
miR-29 modulates Wnt signaling in human osteoblasts through a positive feedback loop. [score:1]
[1 to 20 of 6 sentences]
57
[+] score: 28
According to previous reports, miR-29b suppresses angiogenesis, invasion, and metastasis by inhibiting MMP-2 expression in hepatocellular carcinoma [19]; however, to our knowledge, no study has examined the relationship between miR-29 and BCL2L2 expression and their effect on GBM cell phenotype. [score:9]
Notably, miR-29 family members (miR-29a, -29b, and -29c) indirectly activate the p53 tumor suppressor by targeting p85α (the regulatory subunit of PI3K), resulting in cancer cell apoptosis [22]. [score:7]
Additionally, miR-29 has been reported as tumor suppressor to target oncogenes such as T-cell leukemia/lymphoma 1 (TCL1) [23, 24] and myeloid leukemia cell differentiation protein 1 (MCL1) [20]. [score:5]
Bottom right, BCL2L2 protein expression in U251 cells with Tet-inducible expression of the miR-29 cluster (miR-29a/b) or miR-29b alone. [score:5]
To our knowledge, no study has examined the relationship between miR-29-regulated BCL2L2 and the malignant phenotype of GBM cells. [score:2]
[1 to 20 of 5 sentences]
58
[+] score: 27
Of the seven miRNAs that were simultaneously expressed in both tissues, five miRNAs maintained a relatively similar expression level after normalization: hsa-mir-29c, hsa-mir-21, hsa-mir-451a, hsa-mir-192 and hsa-mir-148a (Table 2). [score:5]
The sequencing results for seven highly expressed miRNAs (hsa-mir-145, hsa-mir-29a, hsa-mir-29c, hsa-mir-21, hsa-mir-451a, hsa-mir-192 and hsa-mir-148a) were validated using singleplex real-time PCR (qRT-PCR) to determine their expression levels in the gastric antrum region of 10 healthy individuals. [score:5]
Hsa-mir-145 is highly expressed in heart, lung, and breast tissues [19], [20], [21], and hsa-mir-29c is highly expressed in the stomach and liver [22], [23]. [score:5]
The expression of hsa-mir-145 and hsa-mir-29c has been studied in other tissues, and both miRNAs are known to be cancer suppressor candidates. [score:5]
The high miRNA expression levels demonstrated by ultra-deep sequencing (in descending order of expression level : hsa-mir-145, hsa-mir-29a, hsa-mir-29c, hsa-mir-21, hsa-mir-451a, hsa-mir-192 and hsa-mir-148a) were validated using TaqMan miRNA assays (Life Technologies). [score:4]
After filtering and aligning using with MirBase, 148 mature miRNAs were identified in the gastric antrum tissue, totaling 3,181 quality reads; 63.5% (2,021) of the reads were concentrated in the eight most highly expressed miRNAs (hsa-mir-145, hsa-mir-29a, hsa-mir-29c, hsa-mir-21, hsa-mir-451a, hsa-mir-192, hsa-mir-191 and hsa-mir-148a). [score:3]
[1 to 20 of 6 sentences]
59
[+] score: 27
Not only does miR-29 regulate cell cycle,it has also been implicated to target HDAC4 and affect epigenetic regulation (Li et al., 2009). [score:5]
Additionally, miR-29 targets E2F7, which is a crucial cell cycle regulator. [score:4]
Also, one of the dowregulated miRNAs, miR-29c was predicted to target various genes including MMP-2 that are responsible for invasion and metastasis. [score:4]
miR-29 levels are significantly low in RMS and re -expression leads to cell cycle arrest and differentiation in RMS cell lines (Weiss et al., 2007). [score:3]
Ectopic expression of miR-29 leads to G1 arrest and cell death. [score:3]
MicroRNA profiling of peripheral nerve sheath tumours identifies miR-29c as a tumour suppressor gene involved in tumour progression. [score:3]
This demonstrated that overexpression of miR-29c reduced invasion in MPNST cell lines, indicating that certain miRNA levels could be manipulated to reduce metastasis in MPNSTs. [score:3]
NF-kappaB-YY1-miR-29 regulatory circuitry in skeletal myogenesis and rhabdomyosarcoma. [score:2]
[1 to 20 of 8 sentences]
60
[+] score: 27
Interestingly, upregulation of several miRNAs (miR-214, miR-26, and miR-29) collaboratively represses PcG complex expression and function in myocytes and thereby promotes muscle-specific gene expression and differentiation (Figure 1). [score:8]
Another downregulated miRNA in dystrophic muscles is miR-29, which positively regulates myogenic differentiation and reduces fibrosis. [score:5]
Like miR-214, miR-29 forms a negative feedback loop with several other critical components of the PcG complex such as Yin Yang 1 (YY1), RING, and Rybp, an YY1 binding protein, by inhibiting their expression [50, 51]. [score:5]
Several recent studies profiling miRNA expression in skeletal muscle of young and old mice have revealed that several miRNAs, including miR-206, miR-698, miR-744-5p, and miR-468, are increased, whereas others, such as miR-29, miR-434, miR-455, miR-382, miR-181a, and miR-221, are reduced in skeletal muscle cells of old animals [82– 84]. [score:3]
Furthermore, miR-29 can also regulate myogenesis more directly by repressing AKT3 in differentiating myocytes [52]. [score:3]
Consistent with its function, overexpression of miR-29 in mdx mice improves muscle regeneration, accompanied by reduced fibrosis [98]. [score:3]
[1 to 20 of 6 sentences]
61
[+] score: 26
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-17, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, mmu-mir-23b, mmu-mir-27b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-127, mmu-mir-128-1, mmu-mir-132, mmu-mir-133a-1, mmu-mir-188, mmu-mir-194-1, mmu-mir-195a, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-122, mmu-mir-30e, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-205, hsa-mir-211, hsa-mir-212, hsa-mir-214, hsa-mir-217, hsa-mir-200b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-128-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-127, hsa-mir-138-1, hsa-mir-188, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-23a, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-27a, mmu-mir-31, mmu-mir-351, hsa-mir-200c, mmu-mir-17, mmu-mir-19a, mmu-mir-100, mmu-mir-200c, mmu-mir-212, mmu-mir-214, mmu-mir-26a-2, mmu-mir-211, mmu-mir-29b-2, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-19b-1, mmu-mir-138-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-379, mmu-mir-379, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-412, mmu-mir-431, hsa-mir-431, hsa-mir-451a, mmu-mir-451a, mmu-mir-467a-1, hsa-mir-412, hsa-mir-485, hsa-mir-487a, hsa-mir-491, hsa-mir-503, hsa-mir-504, mmu-mir-485, hsa-mir-487b, mmu-mir-487b, mmu-mir-503, hsa-mir-556, hsa-mir-584, mmu-mir-665, mmu-mir-669a-1, mmu-mir-674, mmu-mir-690, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-696, mmu-mir-491, mmu-mir-504, hsa-mir-665, mmu-mir-467e, mmu-mir-669k, mmu-mir-669f, hsa-mir-664a, mmu-mir-1896, mmu-mir-1894, mmu-mir-1943, mmu-mir-1983, mmu-mir-1839, mmu-mir-3064, mmu-mir-3072, mmu-mir-467a-2, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-467a-3, mmu-mir-669a-6, mmu-mir-467a-4, mmu-mir-669a-7, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-669a-8, mmu-mir-669a-9, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-669a-10, mmu-mir-467a-9, mmu-mir-669a-11, mmu-mir-467a-10, mmu-mir-669a-12, mmu-mir-3473a, hsa-mir-23c, hsa-mir-4436a, hsa-mir-4454, mmu-mir-3473b, hsa-mir-4681, hsa-mir-3064, hsa-mir-4436b-1, hsa-mir-4790, hsa-mir-4804, hsa-mir-548ap, mmu-mir-3473c, mmu-mir-5110, mmu-mir-3473d, mmu-mir-5128, hsa-mir-4436b-2, mmu-mir-195b, mmu-mir-133c, mmu-mir-30f, mmu-mir-3473e, hsa-mir-6825, hsa-mir-6888, mmu-mir-6967-1, mmu-mir-3473f, mmu-mir-3473g, mmu-mir-6967-2, mmu-mir-3473h
Among the downregulated miRNAs; miR-29 was found to target DNMT1, DNMT3A, DNMT3B and HDAC4),while miR-30 targets DNMT3A, HDAC2, HDAC3, HDAC6 and HDAC10, miR-379 targets DNMT1 and HDAC3 and miR-491 (miR-491 targets DNMT3B and HDAC7. [score:12]
The study revealed downregulation of miR-205, miR-27, miR-31, and miR-29 in the cbs [+/–] retinas, these miRNAs were also reported to be downregulated in vitreous [68] and plasma of AMD patients [69]. [score:7]
The study revealed downregulation of miR-205, miR-27, miR-31, and miR-29 in the cbs [+/–] retinas. [score:4]
Other miRNAs were linked to the hypoxia signaling pathway, for instance, miR-205, miR-214, miR-217, miR-27, miR-29, miR-30 and miR-31. [score:1]
Hcy also induces alteration of miRNAs related to tight junctions signaling such as miR-128, miR-132, miR-133, miR-195, miR-3473, miR-19, miR-200, miR-205, miR-214, miR-217, miR-23, miR-26, miR-29, miR-30, miR-31 AND miR-690. [score:1]
miR-205, miR-27, miR-29 and miR-31 were significantly changed in our cbs [+/–] retina microarray and were also reported to be involved in AMD. [score:1]
[1 to 20 of 6 sentences]
62
[+] score: 26
For instance, the miR-29 family (miR-29a, miR-29b, and miR-29c), which is downregulated in lung cancer, directly targets DNMT3A and DNMT3B (Fabbri et al., 2007; Figure 2). [score:7]
Combined inhibition of HDAC3 and EZH2 induced restoration of miR-29 and suppressed lymphoma cell growth, suggesting the MYC–EZH2–miRNA axis could be a promising target for epigenetic therapy in B cell lymphoma. [score:7]
Ectopic expression of the miR-29 family in lung cancer cells restores expression of methylation-silenced tumor suppressor genes, including fragile histidine triad (FHIT) and WW domain containing oxidoreductase (WWOX). [score:7]
Coordinated silencing of MYC -mediated miR-29 by HDAC3 and EZH2 as a therapeutic target of histone modification in aggressive B-cell lymphomas. [score:3]
MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. [score:2]
[1 to 20 of 5 sentences]
63
[+] score: 25
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2
These findings suggest the antagonistic role of microRNA-29c in regulating DNMT3 expression, and that its potential tumor suppressor activity is lack and correlate with melanoma progression. [score:6]
As a result, they observed that the downregulation of microRNA-29c was associated with hypermethylation status of tumor-related genes and MINT loci, and inversely correlated with DNMT3A and DNMT3B expression in metastatic tumors. [score:6]
Hence, the authors discussed that microRNA-29c expression may potentially provide significant information by differentiating metastatic melanoma in the way to improve adjuvant therapy for advanced disease [27]. [score:5]
Furthermore, expression of microRNA-29c correlated with DNMT3B expression was found significant as prognostic factor predicting overall survival in patients with lymph node metastases. [score:5]
The authors performed a study in which specimens from 15 primary cutaneous melanomas, 16 lymph node metastases, and 31 distant metastases were assessed to determine the significance of microRNA-29 isoform C and DNMT3A and DNMT3B expression in melanoma progression and clinical outcome [27]. [score:3]
[1 to 20 of 5 sentences]
64
[+] score: 24
AMD: Age-related macular degeneration; CNV: Choroidal neovascularization; miR-29: microRNA 29; HUVEC: Human umbilical vein endothelial cell; MMP-2: Matrix metallopeptidase-2; MT1-MMP: Membrane type1 metalloprotease; NFκB: Nuclear factor kappa-like-chain-enhancer of activated B cells; ODN: Oligodeoxynucleotide; RPE: Retinal pigment epithelial cell; RT-qPCR: Reverse transcription quantitative real-time PCR; TIMP: Tissue inhibitors of metalloproteinase; TNFα: Tumor necrosis factor alpha; VEGF: Vascular endothelial growth factor; UTR: untranslated region. [score:5]
Consequently, we tested the possible regulatory effect of TNFα on the miR-29 family and determined stimulation with TNFα (10 ng/mL) resulted in significant down-regulation of all miR-29 members (Figure  4). [score:5]
To gain more information about the regulation of MMP-2 in CNV, we analyzed the circuitry associated with MMP-2 regulation in a CNV mo del and in cell cultures, focusing on NFκB and the microRNA-29 family (miR-29s). [score:3]
It was recently shown that the transcription factor NFκB negatively regulates miR-29 b/c in various cells [18, 23]. [score:2]
C, HEK-293 cells were cultured in 96-well dishes, and each well was transfected with 50 ng pMIR-MMP-2 3’UTR/firefly luciferase, 25 ng pRL-SV40 Renilla luciferase vector, and 5 nM miR-29 mimics or 5 nM NC. [score:1]
HEK-293 cells were transfected in serum-free DMEM into 24-well plates with 50 ng pMIR-MMP-2 3’UTR containing firefly luciferase coding sequence, 25 ng pRL-SV40 Renilla vector (Promega Branch, Beijing, China) and 5 nM miR-29 mimics or negative control mimics (NC). [score:1]
Transfection with individual miR-29 reduced protein levels of MMP-2 to a similar level, but transfection with miR-29 b/c induced a larger decrease in EA hy926 than did transfection with miR-29a (Figure  5A and B). [score:1]
Figure 2 Decreased miR-29 s level in choroidal-RPE tissue of CNV. [score:1]
Further bioinformatic analysis reveals a complementary sequence for all the miR-29 members in the 3’-UTR of MMP-2 (data not shown). [score:1]
Figure 4 TNFα reduced miR-29 s, which was reversed by NFκB decoy. [score:1]
Specifically, the microRNA-29 family (miR-29s) consists of a miR-29a/b1 cluster in one chromosome and a miR-29b2/c cluster in a different chromosome. [score:1]
The ARPE-19 cells were then treated with TNFα (10 ng/mL) for 12 hours and miR-29 s levels were determined by RT-qPCR. [score:1]
We transfected both types of cells with miR-29 mimics or non-specific control miRNA mimics (NC mimic). [score:1]
[1 to 20 of 13 sentences]
65
[+] score: 24
Over -expression of miR-29 in Hela cells resulted in up-regulation of p53 as well as increased p53 -mediated apoptosis. [score:6]
However, over -expression of miR-29 alone, unlike miR-34a, could not lead to apoptosis, but as miR-29 functioning in apoptosis required wild type p53 as apoptosis was not observed when miR-29 was over-expressed in p53 -null nor p53 mutant cells. [score:5]
Data gathered by Park et al. [24] showed that miR-29 down-regulates CDC42 and p85α, which in turn lead to activation of p53. [score:4]
Also, they showed that miR-29 targets CDC42 3’-UTR. [score:3]
miR-29 Family Regulate p53 Activity. [score:2]
Furthermore, miRNAs is implicated in every aspect of cellular outcome of p53 activation: apoptosis (miR-34 and miR-29), cell cycle arrest (miR-192, miR-194, and miR-215), and senescence (miR-34). [score:1]
Paradoxically, miR-29 acted in a fashion different from miR-34 since it is an apoptotic inducer only in the presence of wild type p53 gene. [score:1]
Park et al. [24] showed that p85α has two miR-29 binding sites in it 3’-UTR region. [score:1]
The miR-34 story set the precedence and a number of papers have now been published showing that other miRNAs interfere the p53 pathway, in a p53-independent manner (miR-34), partial p53 -dependent manner (miR-192, miR-194, miR-215, and miR-21) or a p53 -dependent manner (miR-29). [score:1]
[1 to 20 of 9 sentences]
66
[+] score: 24
In contrast to this set of miRNAs, many other “non-muscle specific” miRNAs exert an active role in muscle differentiation through different mechanisms: miR-24, for example, has been shown to be essential for the modulation of transforming growth factor β/bone morphogenetic protein (TGF-β/BMP) pathway, a well-known inhibitor of differentiation, although its specific muscular targets are yet unknown [44]; miR-26a is involved in TGF-β/BMP pathway, where it negatively regulates the transcription factors Smad1 and Smad4, critical components of that signaling; miR26a targets the polycomb complex member Ezh2, involved in chromatin silencing of skeletal muscle genes [45, 46]; miR-27b promotes entry into differentiation program both in vitro and in vivo regenerating muscles by down -regulating Pax3 [47]; miR-29 in general is defined as an enhancer of differentiation. [score:9]
Regeneration-miRNAs were up-regulated (miR-31, miR-34c, miR-206, miR-335, miR-449, and miR-494), while degenerative-miRNAs (miR-1, miR-29c, and miR-135a) were down-regulated in mdx mice and in DMD patients’ muscles. [score:7]
Muscle specific myomiR miR-1 and miR-133 and the ubiquitous miR-29c and miR-30c are down-regulated in mdx mice. [score:4]
miR-1 controls Glucose-6-phosphate dehydrogenase (G6PD), a relevant enzyme involved in the response to oxidative stress while miR-29 controls fibrotic process since it targets the structural component of extracellular matrix, collagen (Col1a1) and elastin (Eln). [score:3]
In particular the activation of both human and murine miR-1 and miR-29 is tightly linked to HDAC2 release from their respective promoters. [score:1]
[1 to 20 of 5 sentences]
67
[+] score: 24
Moreover, the expression level of the miR-18 family (sharing seed with BART5-5p) was up-regulated in NPC, and expression levels of the miR-29 family (sharing seed with BART1-3p) and miR-200 family (sharing seed with BART9-3p) were down-regulated in NPC tissues (Figure 7) [19], [30]. [score:11]
Expression levels of miR-29 family members were also significantly down-regulated in NPC tissues [19], [30], as well as in many other solid tumors. [score:6]
In particular, the miR-200 family (shares seeds with BART9-3p), the miR-29 family (shares seeds with BART1-3p) and miR-18 (shares seeds with BART5-5p) are expressed at high levels in major types of human tissues and cell lines [44] and are highly conserved during evolution [43]. [score:3]
The human miR-29 family has been shown to regulate DNA methylation through DNMT3A and 3B [54] and to regulate cell survival through Mcl-1 and Tcl-1 [55], [56]. [score:3]
In addition, another highly abundant EBV miRNA, BART1-3p, also shared its seed sequence with the miR-29 family, including miR-29a, -29b, and -29c. [score:1]
[1 to 20 of 5 sentences]
68
[+] score: 24
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-210, hsa-mir-215, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-143, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-193a, hsa-mir-194-1, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-302a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-369, hsa-mir-371a, hsa-mir-340, hsa-mir-335, hsa-mir-133b, hsa-mir-146b, hsa-mir-519e, hsa-mir-519c, hsa-mir-519b, hsa-mir-519d, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-499a, hsa-mir-504, hsa-mir-421, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-190b, hsa-mir-301b, hsa-mir-302e, hsa-mir-302f, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-371b, hsa-mir-499b
MicroRNAs miR-15a, miR-16 and miR-29 have been shown to demonstrate lower expression upon increased expression of HDAC1, HDAC2 and HDAC3 transcripts, which are responsible for histone modifications in chronic lymphocytic leukaemia samples [48]. [score:5]
Martinez I. Cazalla D. Almstead L. L. Steitz J. A. DiMaio D. miR-29 and miR-30 regulate B-Myb expression during cellular senescence Proc. [score:4]
The miR-29 gene family directly targets the global DNA methyltransferases DNMT3A and DNMT3B in lung cancer cells [42], as do miR-143, miR-148a and miR-152 in in colorectal cancer, malignant cholangiocytes or hepititis B induced hepatocellular carcinoma cells [43, 44, 45]. [score:4]
Similarly, a number of miRNAs implicated in ageing are regulators of overlapping hallmarks of ageing; for example miR-34a has been implicated in mitochondrial dysfunction [76] and telomere attrition [34], miR-29 family members have been demonstrated to regulate DNA methylation genes [42] and to be linked with stem cell exhaustion [88]. [score:3]
Other studies have also implicated other miRNAs such as miR-29 in cellular senescence in HeLa cells and in ageing muscle by virtue of their effect on the expression of c-Myb mRNAs [85, 86]. [score:3]
Loss of stemness has been associated with differential expression of several miRNAs, notably miR-371, miR-369-5p, miR-29c, miR-499 and let-7 in mesenchymal stem cells [88]. [score:3]
Fabbri M. Garzon R. Cimmino A. Liu Z. Zanesi N. Callegari E. Liu S. Alder H. Costinean S. Fernandez-Cymering C. MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B Proc. [score:2]
[1 to 20 of 7 sentences]
69
[+] score: 23
A different study conversely showed upregulation of miR-34a and members of the miR-29 family [29], and high expression of miR-331 in CLL patients, suspected but not validated to target suppressor of cytokine signalling 1 (SOCS1) [29, 30]. [score:10]
Illustrating that differential miRNA expression might be dependent on AML subtypes, miR-29 has conversely shown downregulation in MLL-rearranged AML patients [31]. [score:6]
It has been suggested that miR-29 may play a role in tumourigenesis by inhibiting apoptotic genes such as MCL1, and luciferase vector assays have validated the direct binding of miR-29b to the 3′UTR of MCL1 [57]. [score:3]
miR-10a, miR-10b, and members of the miR-29 family were shown to be overexpressed in mutated NPM1 AML patients [52]. [score:3]
Additionally, levels of miR-29c and miR-17-5p were also reduced. [score:1]
[1 to 20 of 5 sentences]
70
[+] score: 23
During MC3T3 osteogenic differentiation, miR-29b-3p, miR-29c-3p and miR-204 expression was upregulated, both at day 3 and at day 7 of differentiation, while miR-146b-5p and miR-20a-5p were upregulated only at day 7 of differentiation, which is in agreement with microarray results (Figure 2A; Supplementary Figure 1). [score:9]
Results obtained show that miR-29b-3p, miR-29c-3p and miR-20a-5p were upregulated upon osteogenic differentiation, while miR-143-3p, miR-195-5p and miR-497-5p were downregulated (Figure 2B). [score:7]
This is the first report demonstrating miR-29b and miR-29c upregulation during osteogenic differentiation in human primary MSC. [score:4]
Furthermore, validation of our miRNA-microarray results by RT-qPCR confirmed miR-29b and miR-29c as positive regulators of osteoblast differentiation in the mouse cell line, which is in agreement with previous reports and further strengthen the quality/relevance the array data [25, 26]. [score:2]
miR-146b-5p, miR-29b-3p, miR-29c-3p, miR-20a-5p, miR-143-3p, miR-195-5p and miR-497-5p expression levels were measured by quantitative real-time PCR. [score:1]
[1 to 20 of 5 sentences]
71
[+] score: 22
Among the miRNAs regulated by myocardial infarction, there are members of the miR-29 family, which have been reported to be down-regulated in the heart, in the region adjacent to the infarct; these miRNA target mRNAs encoding proteins that are involved in fibrosis, so that down-regulation of miR-29 would enhance the fibrotic response; consequently, down-regulation of miR-29 with modified antisense oligonucleotides, referred to as anti-miRs could induce the expression of collagens, whereas over -expression of miR-29 in fibroblasts would reduce collagen expression, which could constitute a potential therapeutic way to regulate cardiac fibrosis [90]. [score:20]
Van Rooij E. Sutherland L. B. Thatcher J. E. DiMaio J. M. Naseem R. H. Marshall W. S. Hill J. A. Olson E. N. Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis Proc. [score:2]
[1 to 20 of 2 sentences]
72
[+] score: 22
TGF-β -associated pathways are important regulators of miR-29 expression, leading to triggering of the fibrotic response by decreasing miR-29 levels in cardiac fibroblasts, hepatic stellate cells, and dermal fibroblasts, and leading to a substantial increase in the aforementioned ECM target genes [78, 81, 82]. [score:6]
We found that miR-29b was the only member of the miR-29 family to be significantly down-regulated at three different time points during murine AAA development and progression [82]. [score:5]
Based on these observations, miR-29 seems to be a crucial regulator of aortic aneurysm disease through modulating genes and pathways which are responsible for ECM composition and dynamics. [score:4]
They discovered that expression of the miR-29 family was increased in the aging mouse aorta [61]. [score:3]
Other fibrosis-related responses and diseases, such as liver [79] and kidney fibrosis [80], systemic sclerosis [81], as well as cardiac fibrosis in response to myocardial ischemia [78], have all been linked to repressed levels of miR-29. [score:3]
The miR-29 family of miRs contains three members (miR-29a, miR-29b, and miR-29c) that are encoded by two separate loci, giving rise to bi-cistronic precursor miRs (miR-29a/b1 and miR-29b2/c). [score:1]
[1 to 20 of 6 sentences]
73
[+] score: 22
The fact that Mtb upregulates miR-29 expression during the course of the infection suggests that it also modulates IFNγ production to tilt the immune response in its favor (Ma et al., 2011). [score:6]
The microRNA miR-29 controls innate and adaptive immune responses to intracellular bacterial infection by targeting interferon-γ. [score:3]
miR-29 miRNAs activate p53 by targeting p85 alpha and CDC42. [score:3]
Indeed, miR-29 inhibits the production of IFNγ, a crucial cytokine for the microbiocidal response against intracellular pathogens. [score:3]
Of special interest is the miR29 family, since its members are known to play a major role in human diseases (Wang et al., 2008; Park et al., 2009; Xiong et al., 2010). [score:3]
NF-kappaB-YY1-miR-29 regulatory circuitry in skeletal myogenesis and rhabdomyosarcoma. [score:2]
Therefore, the case of miR-29 best illustrates the potential of using microRNA modulation as microbial strategy to circumvent the immune system (Eulalio et al., 2012b), and it validates the exclusive list of miRNAs obtained in this study. [score:1]
Effects of microRNA-29 on apoptosis, tumorigenicity, and prognosis of hepatocellular carcinoma. [score:1]
[1 to 20 of 8 sentences]
74
[+] score: 22
Seven miRNAs (downregulated: miR-29c, miR-93, miR-101 and miR-130a; upregulated: miR-9, miR-182 and miR-221) were identified as differentially expressed (≥2-fold) in both A172-TR and U251-TR cell lines (Figure 1A). [score:9]
Upregulated miRNAs (miR-9, miR-182 and miR-221) were shown in red, downregulated miRNAs (miR-29c, miR-93, miR-101 and miR-130a) were shown in green. [score:7]
Among them, three miRNAs (miR-29c, miR-93 and miR-101) were downregulated and two (miR-9 and miR-182) were upregulated in the TMZ-refractory samples as compared with that in the primary tumor samples (p<0.05, Figure 1D). [score:6]
[1 to 20 of 3 sentences]
75
[+] score: 22
More recently, the downregulation of let-7d [39], upregulation of miR-21 [40], and the downregulation of miR-29 [41] were shown to contribute to the enhanced fibrosis observed in IPF. [score:10]
For example, differences in miR-21, miR-29, miR-30, and miR-133 expression have been examined in cardiac fibrosis [31]– [33]. [score:3]
Also concordant with this previous study, we detected an increase in COL1A2 (a miR-29b and miR-29c target) in IPF patients. [score:3]
Third, Cushing et al [41] used a bleomycin -induced fibrotic mouse mo del and found that the expression of miR-29 family miRNA was reduced in fibrotic lungs, which corresponded with an increase in collagens and ECM-related genes like laminins and integrins. [score:3]
J Exp Med 41 Cushing L Kuang PP Qian J Shao F Wu J 2010 MIR-29 is a Major Regulator of Genes Associated with Pulmonary Fibrosis. [score:2]
COL1A2 has been previously described in IPF [45], and this gene was significantly increased in both forms of IPF, perhaps due to the decreased miR-29b and miR-29c in these biopsies. [score:1]
[1 to 20 of 6 sentences]
76
[+] score: 21
Another recent study has shown that progesterone decreased miR-29 expression in breast cancer cells lines expressing PR and ER (T47D and BT474), resulting in the upregulation of Krüppel-like factor 4 (KLF4), a transcription factor required for the dedifferentiation into pluripotent stem cell phenotype and for the maintenance of CSCs; as a consequence, the authors observed an expansion of CK5 [+]/CD44 [+] tumor-initiating cells [46]. [score:8]
miR-29c is downregulated in inflammatory breast cancer [44] and its expression is associated with good prognosis [45]. [score:6]
Several microRNAs were strongly down- (miR-22-3p, miR-29c-3p) or upregulated (miR-328, miR-98-5p) by progesterone and might contribute to the observed hormonal effects. [score:4]
Compared to control cells, both miR-22 and miR-29c were downregulated not only after progesterone treatment, but also after irradiation in ADLH [−] and ALDH [+] cells. [score:3]
[1 to 20 of 4 sentences]
77
[+] score: 21
In our results, we did not find any correlation between miR-29c expression and the level of IFN- γ. Furthermore, upregulation of the miR-148 family (miR-148a, miR-148b, and miR-152) was observed in DCs stimulated by LPS. [score:6]
Moreover, miR-29 suppressed IFN- γ production by directly targeting IFN- γ mRNA. [score:6]
They found downregulation of miR-29 in activated natural killers, CD4+ T cells, and CD8+ T cells producing IFN- γ [45]. [score:4]
We did not find any correlation between IFN- γ production and expression of miR-29c. [score:3]
Ma et al. described the mechanism of IFN- γ regulation by miR-29. [score:2]
[1 to 20 of 5 sentences]
78
[+] score: 21
Other miRNAs from this paper: hsa-mir-22, hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2
We found that all members of the miR-29 family were expressed in human tendon biopsies and explanted tenocytes (Fig. 4a) with miR-29a showing the most altered expression in early tendinopathy biopsies. [score:5]
Furthermore, luciferase activity was fully restored when the seed regions of both miR-29 MREs in sST2 were mutated, demonstrating that sST2 is a direct target of miR-29a (Fig. 5a). [score:4]
Importantly, only miR-29 family members showed a good probability in targeting both collagens and sST2, thus suggesting a feasible regulatory role in IL-33 effector functions. [score:4]
However, miR-22, 183 and 25 showed much less favourable probability in targeting sST2 (total context score value 27) than miR-29 family. [score:3]
Computational algorithms predict that miR-29 may also target sST2 (ref. [score:3]
Co-transfection of sST2-luciferase reporter plasmid with miR-29 mimics in HEK 293 cells resulted in significant reduction in luciferase activity relative to scrambled control (Supplementary Fig. 6h). [score:1]
Transfection efficiency (80%) was assessed by flow cytometry using the labelled Dy547 mimic (Supplementary Fig. 7g) and confirmed by qPCR of control-scrambled mimic and the respective miR29 family mimic. [score:1]
[1 to 20 of 7 sentences]
79
[+] score: 21
Of microRNAs differentially expressed in IPF, the miR-29 family is probably the most extensively studied both mechanistically and as a therapeutic target, because of its known inhibitory effects on extracellular matrix proteins, and growth factors such CTGF and IGF1 (106). [score:7]
Other microRNAs regulating or regulated by TGFB1 were found to be changed in IPF lungs include miR-30, miR-199, miR-29, miR-26, miR-155, miR-326, and others (105). [score:3]
miR-29 family microRNAs are decreased in IPF lungs (114), they regulate numerous genes related to fibrosis (115) and seem to regulate profibrotic signals from the extracellular matrix to fibroblasts (116). [score:3]
miR-29 family members are decreased in cardiac, renal and liver fibrosis, keloid, fibrotic Crohn’s disease, and other fibrotic conditions (107– 113). [score:3]
Notably, over 20 microRNAs including members of the miR-30, let-7, miR-29 families were decreased in IPF and lung cancer, commonly increased microRNAs included miR-155, miR-21, miR-205, and miR-31 (101). [score:1]
While most of these studies focused on the role of miR-29 in fibroblasts, two recent studies suggested that miR-29 could be important in prevention of pulmonary fibrosis (119) or bronchopulmonary dysplasia (120) through beneficial effects on alveolar repair. [score:1]
Regardless of the cell specificity of the effect, miR-29 supplementation seems a viable option as an antifibrotic therapy. [score:1]
miR-29, the Ultimate Antifibromir. [score:1]
Both gene delivery of miR-29 via a transposon method (117) or using a miR-29b mimic (118) augmented resolution of bleomycin -induced pulmonary fibrosis. [score:1]
[1 to 20 of 9 sentences]
80
[+] score: 21
Shu Y. Bao R. Jiang L. Wang Z. Wang X. Zhang F. Liang H. Li H. Ye Y. Xiang S. MicroRNA-29c-5p suppresses gallbladder carcinoma progression by directly targeting CPEB4 and inhibiting the MAPK pathwayCell Death Differ. [score:7]
The target prediction result showed that the expression of PEG3 can be regulated by miR-29c-5p. [score:6]
Based on target prediction result, it has been found that ITGA2 is the target of miR-29c-5p. [score:5]
A recent report by Yi-Jun Shu et al. (2017) suggested that miR-29c-5p has a tumor-suppressive nature that may act as potential biomarker for prognostic purpose of gallbladder cancer [63]. [score:3]
[1 to 20 of 4 sentences]
81
[+] score: 20
In myeloid leukemogenesis, overexpressed c-Myc inhibits miR-29 family expression, resulting in increased Akt2 and CCND2 protein expression in AML [20, 22- 24]. [score:9]
The miR29 family members miR29a, - 29b and -29c function as tumor suppressors in AML, regulating cell proliferation and apoptosis by the inhibiting AKT2 and CCND2, and show therapeutic potential for AML [22]. [score:6]
Akt2 was also identified to be a target of the three miR-29 members that was significantly increased in the AML blasts. [score:3]
More recently, Gong et al. [22] reported that all the miR-29 family members, miR-29a, -29b and -29c, were reduced in PBMNCs and bone marrow CD34+ cells from AML patients. [score:1]
Reintroducing each miR-29 member into AML BM blasts was able to partially correct abnormal cell proliferation and apoptosis repression and myeloid differentiation arrest. [score:1]
[1 to 20 of 5 sentences]
82
[+] score: 20
miR-21 was shown to suppress PTEN, a key modulator in DN [67]; miR-192 was shown to suppress ZEB2, which is responsible for controlling TGF-β -induced extracellular matrix proteins accumulating during DN [67], while miR-29c was shown to inhibit SPRY1, which involves albuminuria and kidney mesangial matrix accumulation in diabetic mice mo dels [68]. [score:7]
For example, although miR-29 is mentioned above in regard to its role in regulating β-cell proliferation, it has also been shown in multiple reports to negatively regulate insulin secretion by directly targeting Stx-1a, a t-SNARE protein involved in insulin exocytosis [31], and Mct1, which may affect insulin secretion [32]. [score:6]
Gomes P. R. Graciano M. F. Pantaleão L. C. Rennó A. L. Rodrigues S. C. Velloso L. A. Latorraca M. Q. Carpinelli A. R. Anhê G. F. Bordin S. Long-term disruption of maternal glucose homeostasis induced by prenatal glucocorticoid treatment correlates with miR-29 upregulation Am. [score:4]
Long J. Wang Y. Wang W. Chang B. H. Danesh F. R. MicroRNA-29c is a signature microRNA under high glucose conditions that targets Sprouty homolog 1, and its in vivo knockdown prevents progression of diabetic nephropathy J. Biol. [score:3]
[1 to 20 of 4 sentences]
83
[+] score: 20
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2
Pathway analysis indicated that a number of these genes are positively regulated by the transcription factor SP1, which is a validated target of miR-29b [23], suggesting that inhibition of SP1 by miR-29 may be an important factor in the overall effects on gene expression mediated by miR-29b. [score:8]
Members of the miR-29 family, including miR-29b, have been demonstrated to activate p53 by targeting p85α and CDC42 [31]. [score:3]
MiR-29 is a positive regulator of osteoblast differentiation and controls the expression of collagens in differentiated osteoblasts [14]. [score:3]
Strategies to increase miR-29 expression in TM cells may be beneficial to limit ECM deposition, prevent cell loss, and maintain normal levels of aqueous humor outflow facility. [score:3]
Thus, miR-29 would be predicted to contribute to the regulation of ECM dynamics in the TM. [score:2]
Thus, the pro-apoptotic effects reported for miR-29 may be dependent on the cell type or the specific stress conditions affecting the cells. [score:1]
[1 to 20 of 6 sentences]
84
[+] score: 20
Using 15 down-regulated miRNAs (let-7 g, miR-101, miR-133a, miR-150, miR-15a, miR-16, miR-29b, miR-29c, miR-30a, miR-30b, miR-30c, miR-30d, miR-30e, miR-34b and miR-342), known to be associated with cancer, we found 16.5% and 11.0% of our PLS-predicted miRNA-targets, on average, were also predicted as targets for the corresponding miRNAs by TargetScan5.1 and miRanda, respectively (Table 2). [score:10]
By restricting our attention to only the 15 cancer -associated miRNAs in the top four mRNA networks, we found that all 15 miRNAs were involved in network 1, all but miR-16 were in network 2, and all but miR-29c were in network 3 and 4, as shown in the fourth column of Table 4. We also checked which miRNAs associated with the mRNA targets predicted by PLS regression method were linked to the cancer-related function. [score:3]
By restricting our attention to only the 15 cancer -associated miRNAs in the top four mRNA networks, we found that all 15 miRNAs were involved in network 1, all but miR-16 were in network 2, and all but miR-29c were in network 3 and 4, as shown in the fourth column of Table 4. We also checked which miRNAs associated with the mRNA targets predicted by PLS regression method were linked to the cancer-related function. [score:3]
We found that all 15 miRNAs were involved in cancer and tumorigenesis, 12 of them (all except miR-101, miR-15a and miR-29c) were in carcinoma, malignant tumor and primary tumor and 8 of them (all except let-7 g, miR-101, miR-150, miR-15a, miR-16, miR-29c and miR-342) were in angiogenesis as were shown in the last column of Table 5. Furthermore, we examined which associated miRNAs among the 15 cancer-related miRNAs were involved in the canonical pathways associated with cancer. [score:1]
C. A sub-network depicting miRNA:mRNA interactions predicted from other cancer -associated miRNAs: let-7 g, miR-101, miR-133a, miR-15a, miR-16, miR-29b and miR-29c. [score:1]
Networks were also developed for the seven miRNAs (let-7 g, miR-101, miR-133a, miR-15a, miR-16, miR-29b and miR-29c) closely related to cancer and their associated mRNAs (Figure 2C). [score:1]
We found that all 15 miRNAs were involved in cancer and tumorigenesis, 12 of them (all except miR-101, miR-15a and miR-29c) were in carcinoma, malignant tumor and primary tumor and 8 of them (all except let-7 g, miR-101, miR-150, miR-15a, miR-16, miR-29c and miR-342) were in angiogenesis as were shown in the last column of Table 5. Furthermore, we examined which associated miRNAs among the 15 cancer-related miRNAs were involved in the canonical pathways associated with cancer. [score:1]
[1 to 20 of 7 sentences]
85
[+] score: 19
Mature miRNA expression could be classified into two groups: i) cardia-tissues: miRNAs rarely expressed in other tissues but expressed in gastric cardia, including miR-148a, miR-192, miR-200a and miR-200b; ii) quasi-ubiquitous: miRNAs expressed in many tissues and conditions, including miR-29c, miR-21, miR-24, miR-29b, miR-29a, miR-451, miR-31, miR-145, miR-26a, miR-19b and let-7b. [score:9]
Six miRNAs showed a low variable pattern of expression (miR-29b, miR-29c, miR-19b, miR-31, miR-148a, miR-451) and could be considered part of the expression pattern of the healthy gastric tissue. [score:4]
Could observe miRNAs with high interindividual variation, for exempla miR-21, and another with low interindividual variation, e. g. expression pattern slightly variable (miR-29b, miR-29c, miR-19b, miR-31, miR-148a, miR-451). [score:3]
The high expression levels of miRNAs identified by ultra-deep sequencing (in descending order: miR-29c, miR-21, miR-148a, miR-29a, miR-24, miR-29b, miR-192, miR-451, miR-145, miR-31, miR-200a, miR-19b, miR-200b, let-7b and miR-26a) were validated with the TaqMan miRNA assays (Life Technologies). [score:2]
hsa-miR-29c ANKRD52 ; UBN2 ; TNRC6B ; EPS15 ; NFAT5 ; BACH2 ; BRWD1 ; NUFIP2 ; PTEN ; CDK6 ; PTPRD ; DDX6 ; IGF1 ; KIAA2018 ; KIAA0355 ; CNOT6 ; GMFB ; SH3PXD2A ; KLF4 ; SLC16A2. [score:1]
[1 to 20 of 5 sentences]
86
[+] score: 19
Lastly, the miR-29 family may also promote neuroprotection via the direct suppression of disease-linked pathways (Figure 1). [score:6]
Overall, functional studies focusing on miR-29 align well with its inverse association with neurodegenerative disease and point to a conserved role for this miRNA family in neuroprotection. [score:3]
Several studies employing mouse mo dels and human cell lines have examined the involvement of miR-29 in neurodegenerative diseases. [score:3]
The notion that these patterns may represent disease-promoting mechanisms rather than just correlational markers stems from the observation that perturbing miR-29 function is associated with compromised neuronal survival. [score:3]
Brain-specific knockdown of miR-29 results in neuronal cell death and ataxia in mice. [score:2]
Consistent with a role in neuroprotection, diminished levels of miR-29 family members have been reported in both patients or mouse mo dels of AD, HD, and various subtypes of SCA (Lee et al., 2011; Wang et al., 2011b). [score:1]
One family of miRNAs that has emerged as putatively protective is the miR-29 family (Figure 1). [score:1]
[1 to 20 of 7 sentences]
87
[+] score: 19
The mir-29 family is highly expressed in normal tissues and is downregulated in many types of human cancers including lung cancer (Yanaihara et al., 2006; Xu et al., 2009). [score:6]
MicroRNA miR-29 modulates expression of immunoinhibitory molecule B7-H3: potential implications for immune based therapy of human solid tumors. [score:5]
Recently, the mir-29 family was shown to directly target DNMT3A and DNMT3B, two enzymes involved in de novo DNA methylation (Fabbri et al., 2007). [score:4]
MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3A and 3B. [score:2]
The mir-29 family is comprised of three miRNAs (mir-29a, mir-29b, and mir-29c) that are derived from two transcripts (mir-29b-1/29a on chromosome 7 and mir-29b-2/29c on chromosome 1). [score:1]
The mir-29 family is the prototype of such miRNAs (Fabbri et al., 2007). [score:1]
[1 to 20 of 6 sentences]
88
[+] score: 19
Furthermore, these 34 target-mRNAs were regulated by hsa-mir-29a, hsa-mir-29b, hsa-mir-29c, hsa-mir-452 and hsa-mir-1266, and were all related to neuronal development, neurodegenerative diseases and aging-related disorders. [score:7]
Moreover, mir-29a, mir-29b and mir-29c were significantly up-regulated, which suggested that they are most likely to play important roles in the developmental and physiological processes during brain development [49]. [score:6]
The gene NAV3 was synergistically regulated by hsa-mir-29a, hsa-mir-29b, hsa-mir-29c and hsa-mir-452. [score:2]
The gene ARFGEF2 was synergistically regulated by hsa-mir-29a, hsa-mir-29b and hsa-mir-29c. [score:2]
Hsa-mir-29a, hsa-mir-29b and hsa-mir-29c are members of the miR-29 family. [score:1]
For example, miRNA clique 103 (Figure  7) consisted of six miRNAs: hsa-mir-29a, hsa-mir-29b, hsa-mir-1255a, hsa-mir-1266, hsa-mir-452 and hsa-mir-29c. [score:1]
[1 to 20 of 6 sentences]
89
[+] score: 19
Interestingly it was shown that hsa-mir-29c directly targets DNA-methyl transferase 3A (DNMT3A) and 3B (DNMT3B) in lung cancer tissue [51]. [score:4]
We have demonstrated for the first time that miRNAs (hsa-mir-371, hsa-mir-369-5P, hsa-mir-29c, hsa-mir-499 and hsa-let-7f) are up-regulated upon replicative senescence. [score:4]
Furthermore, differential miRNA expression was validated by QRT-PCR for hsa-mir-29c, hsa-mir-369-5p and hsa-let-7f in the three MSC preparations that were used for microarray analysis as well as in three additional samples (B). [score:3]
Differential expression of three miRNAs (hsa-mir-369-5P, hsa-mir-29c and let-7f) was validated by using quantitative RT-PCR in all three donor samples as well as in three independent donor samples (figure 6). [score:3]
SAM analysis identified a group of five significantly up-regulated miRNAs, (FDR<1): hsa-mir-371, hsa-mir-369-5P, hsa-mir-29c, hsa-mir-499 and hsa-mir-217 (signal intensity of hsa-mir-217 was very low and thus not considered for subsequent analysis). [score:3]
Expression of hsa-mir-29c, hsa-mir-369-5p and hsa-let-7f was further analyzed using miRNA TaqMan assays according to the manufacture's instructions (Applied Biosystems, Foster City, USA). [score:2]
[1 to 20 of 6 sentences]
90
[+] score: 19
This is substantiated by differential expression of several miRNAs according to ZAP-70 status, including both the 3p and 5p variants of miR-29c, which is recurrently found down-regulated in ZAP-70 positive patients, miR-146b-5p, as in the recent study by Negrini et al [25], and miR-210-3p. [score:6]
Moreover, comparison between ZAP-70 positive (n = 11) and negative (n = 5) patients by the Student t test (p<0.05) using the mean values of all the available samples from each patient, revealed a set of 6 miRNAs significantly underexpressed in ZAP-70 positive patients, with differences higher than 2-fold for miR-146b-5p, miR-210-3p, and miR-29c-5p, and higher than 1.5-fold for the ones with the highest levels of expression, miR-29c-3p and miR-30b-5p (Table 2). [score:5]
In CLL, several miRNAs have been recurrently found overexpressed compared to normal B cells (NBC), such as miR-155 [14– 19], miR-150 [14, 16, 19], miR-101 [14, 18, 19], miR-21 [14, 18], miR-29a [18, 19], or miR-29c [16, 19], or underexpressed, such as miR-181a, miR-181b [15, 18, 19], and miR-223 [15, 16, 19]. [score:4]
In ZAP-70 negative patients miR-29a, miR-29b, miR-29c and miR-223 often show higher expression levels [15, 16, 19, 32, 33]. [score:3]
Both lists share similarities, including the same top 10 miRNAs: miR-150-5p, miR-142-3p, miR-29a-3p, miR-21-5p, miR-16-5p, let-7g-5p, miR-29b-3p, let-7f-5p, miR-29c-3p, and let-7a-5p. [score:1]
[1 to 20 of 5 sentences]
91
[+] score: 19
These results suggest that the downregulation of the miR-29c tumor suppressor plays a critical role in the progression of gastric cancer. [score:6]
Celecoxib activation of miR-29c induces suppression of the oncogene Mcl-1, a target of miR-29c and apoptosis in gastric cancer cells. [score:5]
miRNA microarray analysis revealed that miR-29c is significantly downregulated in gastric cancer tissues relative to non-tumor gastric mucosa [29]. [score:4]
As such, selective COX-2 inhibitors may be a clinical option for the treatment of gastric cancer via restoration of miR-29c. [score:3]
miR-29c is significantly activated by celecoxib in gastric cancer cells (AGS) [29]. [score:1]
[1 to 20 of 5 sentences]
92
[+] score: 18
There are reports showing that TGF-β signaling significantly downregulates miR-29 in clinical conditions like cardiac fibrosis [21, 22]. [score:4]
Interestingly, miR-29 was found to be downregulated (fold change– 8.8) in our arthritis group. [score:4]
The enhanced level of TGF-β in the arthritis environment could be a reason for the downregulation of miR-29 in our arthritis group. [score:4]
Similarly, miR-29, miR-218, miR-340 and miR206 were reported to regulate MMP2 and MMP9 and these effects were also profound in cancer cells [18]. [score:2]
Collagen type 1 was reported to be regulated by miR-133a, miR-29b and miR-29c in cancer cells [19]. [score:2]
Recent reports have shown that miR-29 is a significant mediator for the regulation of collagen type 1 and type 3, and IL-33 in supraspinatus tendon [20]. [score:2]
[1 to 20 of 6 sentences]
93
[+] score: 18
For example, the median log2 expression level change of the top 150 TargetScan conserved targets was 0.096 (6.9%) for mir-29 knockdown in fetal lung fibroblasts [89], 0.131 (9.5%) for mir-145 transfection of MB-231 breast cancer cells [90], 0.173 (12.7%) for mir-30 overexpression in melanoma cell lines [91], and 0.465 (38.0%) for mir-7 overexpression in A549 cancer cells [92]. [score:12]
Overexpression of mir-29 isoforms in mouse adipocytes resulted in an insulin resistant phenotype [59]. [score:3]
In a recent study, carried out in mouse islets, isoforms of mir-29 were found to contribute to the beta-cell-specific silencing of MCT1 (SLC16A1) expression required for appropriate insulin secretion [61]. [score:3]
[1 to 20 of 3 sentences]
94
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Systemic administration inhibe cancer cell proliferation and induced apoptosis in HCCChang et al., 2008; Ji et al., 2009a; Braconi et al., 2011; Kerr et al., 2011; Szabo et al., 2012 miR-27a Promote cell growth and inhibit apoptosisHuang et al., 2008, 2009 miR-29c Apoptosis inhibitionLi et al., 2008; Xiong et al., 2010; Wang et al., 2011 miR-34a Stimulation of HCC proliferation. [score:7]
miR-29c targets TNFAIP3, inhibits cell proliferation and induces apoptosis in hepatitis B virus-related hepatocellular carcinoma. [score:5]
In HCC has been reported up -expression of miR-21, miR-221, miR-22, miR-15, miR-517a, and down -expression of miR-122, miR-29 family, miR-26a, miR-124, let-7 family members, and miR-199a/b-3p (Szabo et al., 2012). [score:5]
Effects of microRNA-29 on apoptosis, tumorigenicity, and prognosis of hepatocellular carcinoma. [score:1]
[1 to 20 of 4 sentences]
95
[+] score: 18
The miR-29 family is downregulated in lung cancer and DNMT3a and3b are up-regulated, this can be reversed by miR-29 over -expression. [score:9]
Fabbri et al. were the first to identify that the miR-29 family directly targets the DNA methyltransferases DNMT3a and DNMT3b [249]. [score:4]
Fabbri M. Garzon R. Cimmino A. Liu Z. Zanesi N. Callegari E. Liu S. Alder H. Costinean S. Fernandez-Cymering C. MicroRNA-29 family reverts aberrant methylation in lung cancer by targeting DNA methyltransferases 3a and 3b Proc. [score:2]
Rostas J. W. 3rd Pruitt H. C. Metge B. J. Mitra A. Bailey S. K. Bae S. Singh K. P. Devine D. J. Dyess D. L. Richards W. O. MicroRNA-29 negatively regulates EMT regulator N-myc interactor in breast cancer Mol. [score:2]
Jiang H. Zhang G. Wu J. H. Jiang C. P. Diverse roles of miR-29 in cancer (review) Oncol. [score:1]
[1 to 20 of 5 sentences]
96
[+] score: 18
There are also reports linking non-coding RNAs with neurological disorders such as Parkinson's disease (miR-133b) [17], Huntington's disease (miR-132, miR-9) [18], [19], Alzheimer's disease (miR-29 and miR-107) [20], [21], and Tourette's syndrome (miR-189) [22]. [score:7]
Several studies examine the expression of miRNAs during neurodevelopment as well as in the adult CNS and reveal that certain miRNAs are found preferentially expressed in neurons, e. g., miR-124 and miR-128 [10], whereas others, e. g., miR-23, miR-26 and miR-29, seem restricted to astrocytes [11]. [score:6]
We also detected expression of a number of miRNAs associated with neurological disorders, such as miR-29 and miR-107 associated with Alzheimer's disease [20], [21]. [score:5]
[1 to 20 of 3 sentences]
97
[+] score: 18
Even though downregulation of miR-29 family members were observed [180, 220], the authors contended that any suppressive effect by the miRNA is attenuated by the secondary structure of the viral LTR target sequence. [score:8]
In experiments targeted towards deciphering the mechanistic details underlying the IL-21 -mediated inhibition of HIV-1 replication, the authors showed that IL-21 promotes miR-29 biogenesis in a STAT3 -dependent fashion and reverses the HIV -induced downregulation of miR-29. [score:8]
A recent report by Adoro et al. [239] provides an alternative conceptual framework to decode the anti-HIV activity of miR-29. [score:1]
Adoro S. Cubillos-Ruiz J. R. Chen X. Deruaz M. Vrbanac V. D. Song M. Park S. Murooka T. T. Dudek T. E. Luster A. D. IL-21 induces antiviral microRNA-29 in CD4 T cells to limit HIV-1 infectionNat. [score:1]
[1 to 20 of 4 sentences]
98
[+] score: 18
Furthermore, down-regulation of miR-29 with anti-miRs in vitro and in vivo induced the expression of collagens [16]. [score:6]
Also, it has been shown that miR-29 family is down-regulated in the region of the heart adjacent to the infarct. [score:4]
The miR-29 family targets mRNAs that encode extracellular matrix-related proteins like collagens, fibrillins, and elastin, proteins involved in fibrosis [16]. [score:3]
These studies indicate that miRNAs, miRNA-208, miRNA-23a, miRNA-24, miRNA-125, miRNA-21, miRNA-129, miRNA-195, miRNA-199, and miRNA-212 are frequently increased in response to cardiac hypertrophy, whereas, miRNA-29, miRNA-1, miRNA-30, miRNA-133, and miRNA-150 expression are often found to be decreased. [score:3]
Van Rooij E. Sutherland L. B. Thatcher J. E. DiMaio J. M. Naseem R. H. Marshall W. S. Hill J. A. Olson E. N. Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis Proc. [score:2]
[1 to 20 of 5 sentences]
99
[+] score: 18
Intriguingly, many of the miR-29 downstream target genes, such as FBN1, COL1A1, COL1A2, ELN and COL3A1, are up-regulated after myocardial infarction, suggesting that miR-29 controls the physiological levels of many matrix proteins in such a manner that down-regulation of miR-29 is associated with an excessive accumulation of matrix protein and cardiac fibrosis. [score:9]
In another study, the miR-29 family, which is predominantly expressed in cardiac fibroblasts [34], was found to be significantly down-regulated in the fibrotic border zone of infracted hearts. [score:6]
Van Rooij E. Sutherland L. B. Thatcher J. E. DiMaio J. M. Naseem R. H. Marshall W. S. Hill J. A. Olson E. N. Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis Proc. [score:2]
Though the function of miR-29 in cardiac fibrosis was established using gain- and loss-of function studies in vitro and in vivo, genetic evidence is still lacking to support the conclusion. [score:1]
[1 to 20 of 4 sentences]
100
[+] score: 17
A more recent study demonstrated that many of the Wnt pathway components (e. g., dishevelled segment polarity protein 3 (DVL3) and frizzled class receptor 5 (FZD5)) are directly targeted by miRNA-29 family members, of which the regulation of expression in cartilage seems to be important during the course of OA development. [score:8]
The miRNA-29 family, of which expression is regulated throughout the development/progression of OA, also dampens NF-kB -mediated signalling [86]. [score:5]
In fact, the miRNA-29 family is suppressed by transcription factor SRY-box 9 (SOX9), whereas, in turn, the miRNA-29 family dampens Wnt- and Smad -mediated signalling [86]. [score:3]
Le L. T. Swingler T. E. Crowe N. Vincent T. L. Barter M. J. Donell S. T. Delany A. M. Dalmay T. Young D. A. Clark I. M. The microRNA-29 family in cartilage homeostasis and osteoarthritis J. Mol. [score:1]
[1 to 20 of 4 sentences]