sort by

430 publications mentioning mmu-let-7e (showing top 100)

Open access articles that are associated with the species Mus musculus and mention the gene name let-7e. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 395
LIN28A and LIN28B inhibit biogenesis of all let-7 miRNAs with the possible exception of let-7a-3 (Triboulet et al., 2015), implicating the coordinate downregulation of this tumor suppressor microRNA family in disease. [score:10]
Overexpression of TTP in PA1 ovarian cancer cells successfully suppressed cell growth via let-7b-meidated inhibition of CDC34, which is a downstream target gene of the let-7 family (Kim et al., 2012). [score:9]
It was hypothesized that the drug might induce these anti-CSCs functions through AMP-activated protein kinase (AMPK) -mediated up-regulation of let-7 miRNAs leading to suppression of LIN28A/LIN28B expression. [score:8]
As a result, let-7 is downregulated, leading to enhanced expression of notable let-7 targets such as RAS, MYC, and HMGA2 as well as changes in cellular metabolism. [score:8]
Specifically, decreased expression of the tumor suppressor let-7 microRNAs and increased expression of oncogenic miR-21 are most frequently associated with poor prognosis as determined by analysis of 46 studies on 20 different types of human cancers. [score:7]
To conclude, novel therapeutics which can effectively reduce LIN28AB expression/activity or increase mature let-7 levels have significant potential to improve therapeutic outcomes in LIN28AB -expressing cancer in general and specifically, in metastatic and drug-resistant disease. [score:7]
There is a growing body of evidence demonstrating that overexpression of LIN28 and/or down-regulation of let-7 contributes to metastasis and tumor resistance to chemotherapy and radiation therapy (Table 3). [score:6]
Inhibition of Lin28 promotes Let-7 expression leading to inhibition of HMGA2 which is a driver of tumor metastasis. [score:6]
In the PTCL mo del, LIN28B led to upregulation of IL-6, a let-7 microRNA target (Beachy et al., 2012), and is consistent with earlier work from the Struhl lab that linked molecular inflammation and cancer through a positive feedback loop involving NF-κB, LIN28B, let-7, and IL-6 (Iliopoulos et al., 2009). [score:6]
As LIN28AB expression is limited predominantly to tumor cells and conditional mouse knockout of either Lin28a or Lin28b at 6 weeks of age yields no overt phenotypes, it is anticipated that therapeutics targeting the LIN28/let-7 pathway will have minimal side effects in patients. [score:6]
In worms to mammals, Lin28 blocks let-7 expression, while let-7 itself binds to the 3′ UTR of Lin28 mRNA to regulate negatively Lin28 expression, thereby establishing a double negative feedback loop. [score:6]
Future research endeavors will reveal not only a more precise role of LIN28 in human disease but also bring to the forefront an exciting frontier in cancer therapeutics as the LIN28/let-7 pathway is exploited for the development of a novel class of LIN28 and/or TUTase inhibitors. [score:6]
Ectopic over -expression of tristetraprolin in human cancer cells promotes biogenesis of let-7 by down-regulation of Lin28. [score:6]
From 2010, the Lin28AB/let-7 axis was directly implicated in regulation of glucose metabolism in mammals using transgenic overexpression and conditional knockout mice. [score:6]
Since LIN28A -mediated inhibition of let-7 requires ZCCHC11 (Hagan et al., 2009; Heo et al., 2009; Piskounova et al., 2011), small molecules that inhibit functions of this TUTase may also produce therapeutic benefits in cancer patients. [score:5]
Direct association of c-MYC with LIN28B promoter led to transcriptional transactivation of the protein and LIN28B expression was necessary and sufficient for MYC -mediated Let-7 suppression. [score:5]
Besides let-7 miRNAs, LIN28AB also functions in post-transcriptional gene regulation by directly binding to specific mRNAs leading to altered translational efficiency. [score:5]
Overexpression of Lin28a resulted in an increase in Thr-Gly-SAM metabolites while overexpression of let-7 resulted in a concomitant decrease of these metabolites. [score:5]
Considering the oncogenic role of LIN28AB, it is evident that inhibition of the LIN28AB/let-7 pathway is an attractive molecular target for cancer chemotherapy. [score:5]
LIN28A and LIN28B exert their biological functions through repressing the biogenesis of the tumor suppressor let-7 microRNA family as well as modifying the translation efficiency of mRNAs that it binds. [score:5]
LIN28A recruits the TUTase ZCCHC11 to pre-let-7 where ZCCHC11 adds a short polyU tail to pre-let-7. Pre-let-7 is no longer a DICER substrate and is targeted for degradation by DIS3L2, thereby blocking let-7 maturation into its functional tumor suppressor form. [score:5]
Raf kinase inhibitory protein suppresses a metastasis signalling cascade involving LIN28 and let-7. EMBO J. 28, 347– 358. [score:5]
Since let-7 is wi dely and abundantly expressed in most cells, it would seem less likely to have off-target effects in comparison to miR-34 replacement therapy. [score:5]
In neuroblastoma cells, LIN28B blocks neuronal differentiation and upregulates MYCN post-transcriptionally by blocking the let-7 microRNAs. [score:4]
This compound upregulated the levels of the let-7 family members in the human choriocarcinoma cell line, JAR as well as PA-1 cells. [score:4]
let-7 microRNAs induce tamoxifen sensitivity by downregulation of estrogen receptor alpha signaling in breast cancer. [score:4]
It was reported that LIN28A significantly induced EMT via down-regulation of let-7 microRNAs including let-7a. [score:4]
In mice with inducible let-7 overexpression, similar effects were found as those observed in Lin28a conditional knockout (Zhu et al., 2011). [score:4]
Overexpression of LIN28A/LIN28B that results in dysregulation of let-7 microRNAs are essential pathological events in tumorigenesis and progression of many human cancers. [score:4]
As differentiation progresses, LIN28AB expression is lost, resulting in production of mature let-7 microRNAs that themselves negatively regulate LIN28AB. [score:4]
Down-regulation of LIN28B reduced self-renewal ability and increased let-7 level in these prostate cancer cells. [score:4]
Specifically, knockdown of Zcchc6 did not change mature let-7 levels on its own; however, knockdown of both Zcchc11 and Zcchc6 led to an increase in let-7 levels in comparison to single Zcchc11 knockdown. [score:4]
Ultimately, two highly conserved RNA -binding proteins, LIN28A and LIN28B, were shown to inhibit biogenesis of mammalian let-7 miRNAs through direct binding to either pre-let-7 and/or pri-let-7 (Heo et al., 2008, 2009; Newman et al., 2008; Rybak et al., 2008; Viswanathan et al., 2008; Hagan et al., 2009; Piskounova et al., 2011). [score:4]
Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. [score:4]
LIN28A and LIN28B block biogenesis of the tumor suppressor let-7 microRNA family. [score:3]
Lin28A and Lin28B inhibit let-7 microRNA biogenesis by distinct mechanisms. [score:3]
LIN28B induces neuroblastoma and enhances MYCN levels via let-7 suppression. [score:3]
Whole body overexpression of both Lin28a and let-7 resulted in no overt metabolic defects due to the antagonistic actions of these factors. [score:3]
In addition, LIN28AB expression and let-7 loss has been associated with resistance to numerous cancer therapies (Table 3). [score:3]
First, there are 12 members of the let-7 microRNA family located on eight chromosomes, where most cells express a handful of let-7 family members. [score:3]
More importantly, treatment with let-7 not only inhibited tumor growth, but markedly reduced metastasis to the lung and liver of tumor-bearing mice (Yu F. et al., 2007). [score:3]
Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cells. [score:3]
For example, overexpression of either LIN28A or LIN28B in liver cancer cells promotes the Warburg effect as manifested by elevated glucose uptake, lactate production and oxygen consumption rate, which were reversed upon exposure to let-7 mimetics (Ma et al., 2014). [score:3]
Whereas, LIN28A/LIN28B depresses C-MYC by repressing let-7 miRNAs, C-MYC post-transcriptionally activates expression of LIN28A and LIN28B. [score:3]
Lin-28 and let-7 were first discovered and studied in the nematode Caenorhabditis elegans as heterochronic genes that regulate developmental timing (Moss et al., 1997; Reinhart et al., 2000; Slack et al., 2000). [score:3]
A study conducted by Viswanathan and colleagues using primary human tumors and human cancer cell lines showed that about 15% of human cancers displayed high LIN28A/LIN28B and low let-7 expression pattern. [score:3]
HMGA1 and HMGA2 expression and comparative analyses of HMGA2, Lin28 and let-7 miRNAs in oral squamous cell carcinoma. [score:3]
This study showed that let-7 suppression was necessary but not sufficient to improve tissue repair. [score:3]
Lin-28 and the microRNA let-7 were initially discovered in C. elegans as heterochronic genes that regulate developmental timing. [score:3]
Increased glucose uptake is attributed to Lin28ab -mediated repression of let-7 and consequent suppression of the Insulin-PI3K-mTOR pathway. [score:3]
The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. [score:3]
Increased let-7 expression reduced body size and led to hyperglycemia and glucose intolerance. [score:3]
The Wnt-beta-catenin pathway represses let-7 microRNA expression through transactivation of Lin28 to augment breast cancer stem cell expansion. [score:3]
Under pathological conditions, loss of let-7 expression triggers derepression of these oncogenes leading to tumorigenesis or facilitating tumor growth and/or metastasis. [score:3]
The LIN28AB/let-7 pathway as a molecular target for novel anticancer therapeutics. [score:3]
Of the candidate inhibitors that survived biochemical scrutiny under reducing conditions, aurothioglucose hydrate was further validated to block pre-let-7 uridylation in vivo. [score:3]
With regards to suppression of let-7, there are four distinct modes of action that have been hypothesized where multiple mechanisms may be responsible or have differential significance based on cell type. [score:3]
In addition, a truncated stem loop short RNA duplex which has a similar structure to let-7 miRNAs might also help increase let-7 level by acting as a competitive binding inhibitor for LIN28AB. [score:3]
It is also a feasible to increase let-7 level by interfering with binding of LIN28A/LIN28B to pre-let-7. LIN28AB inhibits let-7 maturation by first interacting with the terminal loop of let-7 precursors. [score:3]
Altogether, these studies demonstrate the LIN28AB expression and let-7 loss almost invariably correlates with poor prognosis. [score:3]
As tumor suppressors, let-7 miRNAs repress several oncogenes including K-RAS, C-MYC, HMGA2 and cell cycle factors (Cyclin D1, D2; Roush and Slack, 2008). [score:3]
Whereas chemotherapy selectively promotes survival of breast tumor-initiating cells (BT-ICs), enforced expression of let-7 in drug-resistant BT-ICs markedly impaired self-renewal ability of the cells. [score:3]
Furthermore, in JAR cells, exposure to Compound 1 resulted in a reduction of the let-7 targets c-Myc, HMGA2 and Ras. [score:3]
The RNA binding protein IMP2 preserves glioblastoma stem cells by preventing let-7 target gene silencing. [score:3]
Loss of mature let-7 microRNAs causes overexpression of numerous oncogenes and bioenergetic genes. [score:3]
Mammalian DIS3L2 exoribonuclease targets the uridylated precursors of let-7 miRNAs. [score:3]
Lin28 -mediated control of let-7 microRNA expression by alternative TUTases Zcchc11 (TUT4) and Zcchc6 (TUT7). [score:3]
LIN28AB expression is high in undifferentiated cells where these proteins block biogenesis of the let-7 microRNA family. [score:3]
Coexpression of 7S21L with LIN28AB in NIH/3T3 cells successfully nullified the ability of LIN28AB to transform cells suggesting let-7 loop mutants might be effective in treating cancers caused by increased level of LIN28AB (Viswanathan et al., 2009). [score:3]
This result was recapitulated by restoring let-7 expression using a microRNA mimic, implicating let-7 dependent functions of LIN28AB in tumor regression. [score:3]
Subsequent activation of let-7 targets such as HMGA2, CCND2, IGF1R, and IGF2BP2 was also validated. [score:3]
Thus, chemical or small molecular compounds specifically targeting LIN28/let-7 axis might be more potent in eradicating CSCs than conventional chemotherapeutics. [score:3]
In another study, LIN28A/let-7 axis was found to be involved in the resistance of human lung and pancreatic cancer cells with a K-RAS mutation (Oh et al., 2010). [score:2]
In mouse ESCs, the Lin28a/let-7 axis regulates the Thr-Gly-SAM pathway (Shyh-Chang et al., 2013a). [score:2]
The Lin28/let-7 axis regulates glucose metabolism. [score:2]
Let-7 miRNAs directly repress a pantheon of well-known oncogenes such as RAS, MYC, HMGA2, BLIMP1, among others (Figures 4, 5; Zhou et al., 2013). [score:2]
Let-7 levels were negatively correlated with LIN28AB expression as expected in these samples. [score:2]
Lightfoot et al. developed a biophysical high throughput screening assay to detect small molecule inhibitors of the LIN28A-pre-let-7 interaction (Lightfoot et al., 2016). [score:2]
The lin-41 RBCC gene acts in the C. elegans heterochronic pathway between the let-7 regulatory RNA and the LIN-29 transcription factor. [score:2]
In contrast to this result, loss of ZCCHC11 via siRNA on its own was sufficient to cause regression of established LIN28A -positive tumor xenografts to a similar level as LIN28A knockdown, raising doubts on TUTase redundancy in let-7 repression in LIN28A -positive human cancer cells (Piskounova et al., 2011). [score:2]
Lin28/let-7 axis regulates aerobic glycolysis and cancer progression via PDK1. [score:2]
LIN28AB through let-7 dependent and independent mechanisms promote multiple processes that promote cancer development and progression. [score:2]
For example, knockdown of ZCCHC11 by siRNA or shRNA increased the level of mature let-7 microRNAs in both mouse embryonic stem cells and human LIN28A -positive cancer cells. [score:2]
LIN28A and/or LIN28B are implicated in key biological functions such as development, glucose metabolism, and pluripotency via let-7 dependent and independent mechanisms (Zhu et al., 2011; Mayr and Heinemann, 2013; Zhang et al., 2016). [score:2]
Double -negative feedback loop between reprogramming factor LIN28 and microRNA let-7 regulates aldehyde dehydrogenase 1 -positive cancer stem cells. [score:2]
The underlying mechanism of RKIP -mediated suppression of metastasis involves a MAPK/Myc/Lin28/Let-7/HMGA2 signaling pathway. [score:2]
let-7 regulates self renewal and tumorigenicity of breast cancer cells. [score:2]
has a method for let-7 restoration using a chemically modified let-7 microRNA duplex in preclinical development. [score:2]
In another study, LIN28B was found to link molecularly inflammation and cancer via a positive feedback loop involving NF-κB activation and derepression of the let-7 regulated gene IL-6 (Iliopoulos et al., 2009). [score:2]
The third mo del is that LIN28B directs polyuridylation of pre-let-7 via an unidentified TUTase, blocking Dicer cleavage and leading to degradation of polyuridylated pre-let-7 (Heo et al., 2008). [score:2]
Figure 5 Mo del for LIN28A/ZCCHC11 regulation of let-7 microRNA biogenesis, promoting cellular proliferation and modifying bioenergetics. [score:2]
Mechanism of Dis3l2 substrate recognition in the Lin28-let-7 pathway. [score:1]
A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway. [score:1]
Lin-28B transactivation is necessary for Myc -mediated let-7 repression and proliferation. [score:1]
Results from another study showed that LIN28B promotes oncogenesis and tumor progression in head and neck cancer cells by repressing let-7 miRNAs (Alajez et al., 2012). [score:1]
Several recent reports have discovered roles for the LIN28AB/let-7 pathway in metabolism. [score:1]
Table 1 lists multiple studies that have evaluated the diagnostic and prognostic value of LIN28A, LIN28B, and/or let-7 expression in cancer. [score:1]
The LIN28B/let-7 axis is a novel therapeutic pathway in multiple myeloma. [score:1]
To date, no other reports have been published that have independently tested TUTase redundancy in LIN28A -mediated let-7 repression. [score:1]
Secondly, primary let-7 transcripts are still being actively transcribed in many cancers as well as in embryonic stem cells; however, mature let-7 is not being produced as expected. [score:1]
In support of this assertion, LIN28AB via a let-7 dependent mechanism promotes metastasis and resistance to several frontline cancer treatments including ionizing radiation and multiple chemotherapies such as taxanes and platinum -based drugs. [score:1]
Lin28 mediates the terminal uridylation of let-7 precursor MicroRNA. [score:1]
The let-7 family of microRNAs. [score:1]
Figure 2 Alignment of human pre-let-7 sequences (partial) with a focus on the terminal loop. [score:1]
The CSD and Zinc finger domains are separated by a flexible region that permits binding to distinct pre-let-7 loops where the GNGAY and GGAG motifs vary in their spacing. [score:1]
The coordinate repression of the let-7 microRNA family is striking for two reasons. [score:1]
This result was phenocopied by application of a let-7 mimic. [score:1]
Lin28/let-7/Bcl-xL pathway: the underlying mechanism of drug resistance in Hep3B cells. [score:1]
Since the subcellular localization of LIN28B is controversial, the precise mechanisms of LIN28B -mediated let-7 repression and whether or not LIN28B utilizes a TUTase for let-7 repression remains unclear. [score:1]
Molecular basis for interaction of let-7 microRNAs with Lin28. [score:1]
For tissue repair, both let-7 dependent and independent activities of Lin28a are required. [score:1]
A feedback loop comprising lin-28 and let-7 controls pre-let-7 maturation during neural stem-cell commitment. [score:1]
Repression of let-7 miRNAs is important in establishing the pluripotent state. [score:1]
The first mo del suggested that LIN28B binds pri-let-7 in the nucleus, blocking Microprocessor cleavage (Newman et al., 2008; Viswanathan et al., 2008). [score:1]
When taken together, the consensus is that cytoplasmic Lin28A first binds to the conserved terminal loop of pre-let-7 and recruits the TUTase Zcchc11 (also known as TUT4) to polyuridylate pre-let-7, thereby blocking Dicer cleavage (Figure 5; Hagan et al., 2009; Heo et al., 2009; Thornton et al., 2012). [score:1]
Of note, loss of Dis3L2 does not elevate mature let-7 levels, since polyuridylated pre-let-7 is a very poor Dicer substrate. [score:1]
A recent study suggested that the TUTase Zcchc6 (also known as TUT7) may be partially redundant with Zcchc11 in Lin28A -mediated let-7 repression (Thornton et al., 2012). [score:1]
Black boxes and asterisks denote perfectly conserved bases while blue boxes represent bases where 10/12 are identical across all let-7 family members. [score:1]
The let-7 microRNA reduces tumor growth in mouse mo dels of lung cancer. [score:1]
In addition to the LIN28AB/let-7 axis, LIN28AB might also induce oncogenesis through other signaling pathways. [score:1]
Activation of the Lin28/let-7 axis by loss of ESE3/EHF promotes a tumorigenic and stem-like phenotype in prostate cancer. [score:1]
It is conceivable that correcting aberrant LIN28AB/let-7 signaling pathway will help overcome shortcomings of current anticancer treatments. [score:1]
Future studies are still needed to define the precise mechanism(s) that are responsible for LIN28B -mediated let-7 repression. [score:1]
Crystallography and biochemical studies demonstrate that the CSD and Zinc finger domains bind GNGAY and GGAG motifs in the pre-let-7 terminal loop, respectively (Nam et al., 2011; Figure 2). [score:1]
Let-7 independent functions of LIN28AB in post-transcriptional gene regulation. [score:1]
Moreover, LIN28AB via a let-7 dependent mechanism confers resistance to ionizing radiation and several chemotherapies. [score:1]
Further work revealed that LIN28B represses let-7 by a distinct mechanism that does not rely on ZCCHC11. [score:1]
The bases shown in red font are part of the let-7-5p/let-7-3p microRNA duplex following cytoplasmic Dicer cleavage. [score:1]
Four high throughput screens have been reported whose objective is the identification of pharmacologically active small molecules that disrupt LIN28AB -mediated let-7 repression. [score:1]
Figure 3 The LIN28AB/let-7 axis has significant biological functions. [score:1]
Lin-28 interaction with the Let-7 precursor loop mediates regulated microRNA processing. [score:1]
Thus, any small molecules such as aptamers which can effectively block the binding of LIN28AB to immature let-7 will increase let-7 levels. [score:1]
High throughput biochemical screens recently demonstrated that small molecules exist that can modulate the LIN28/let-7 pathway. [score:1]
They identified a compound N-methyl-N[3-(3-methyl[1,2,4]triazolo[4,3-b]pyridazin-6-yl)phenyl]acetamide that phenocopied LIN28B siRNA in the restoration of let-7 levels in the Huh7 liver cancer cell line. [score:1]
Moreover, synthetic let-7 mimic elicited remarkable anticancer effects on mice human lung cancer xenografts. [score:1]
Metformin may antagonize Lin28 and/or Lin28B activity, thereby boosting let-7 levels and antagonizing cancer progression. [score:1]
It was found that, similar to its interaction with precursor let-7 miRNA transcripts, LIN28A binds to a consensus GGAGA motif enriched within coding exons and 3′-UTR of mRNAs. [score:1]
This omission is notable as subsequent work from the Gregory lab showed that LIN28B promotes pre-let-7 in vitro uridylation by ZCCHC6 (Thornton et al., 2012). [score:1]
This knowledge will inform the precise mechanism(s) by which LIN28B blocks let-7 biogenesis. [score:1]
In the study, a double -negative feedback loop between LIN28A and let-7 mechanism. [score:1]
Figure 4 The LIN28AB/let-7 axis has significant impact on cancer hallmarks. [score:1]
Of note, CLiP-Seq of DIS3L2 -associated RNAs identified polyuridylated pre-let-7 in the LIN28B -positive HEK-293T cell line (Ustianenko et al., 2016). [score:1]
During differentiation, the levels of Lin28AB are markedly reduced with a concomitant increase in let-7 microRNAs (Mayr and Heinemann, 2013; Figure 3). [score:1]
A second mo del is that LIN28B likely binds pre-let-7 in the cytoplasm, blocking Dicer cleavage (Rybak et al., 2008). [score:1]
Given the observation that global let-7 microRNA biogenesis was blocked in multiple cellular contexts, several research teams interrogated the responsible mechanism (Heo et al., 2008, 2009; Newman et al., 2008; Rybak et al., 2008; Viswanathan et al., 2008; Hagan et al., 2009; Piskounova et al., 2011). [score:1]
Polyuridylated pre-let-7 is degraded by the exonuclease Dis3L2, a gene implicated in Perlman Syndrome gene (Chang et al., 2013; Ustianenko et al., 2013; Faehnle et al., 2014). [score:1]
POSTN+ LIN28AHayashi et al., 2013 Ovarian cancer Oct4+ LIN28APeng et al., 2010 Ovarian cancer ALDH1+ LIN28AYang et al., 2010 Ovarian cancer CD44+, CD24+, Epcam+, Ecadherin- LIN28AMeirelles et al., 2012 Pancreatic cancer ABCG2+, Nestin+ LIN28AHamada et al., 2012 Prostate cancer Sox2+, Nanog+, Oct4+ LIN28BKong et al., 2010 Prostate cancer ESE3/EHF LIN28A/BAlbino et al., 2016 Table 3 LIN28 and let-7 in resistance to anticancer therapies. [score:1]
Binding to both RNA sites is required for high affinity pre-let-7 binding. [score:1]
[1 to 20 of 148 sentences]
2
[+] score: 334
Consistent with this idea of a negative feedback loop, shRNA -mediated suppression of endogenous MYC was found to up-regulate let-7 (Wang et al., 2011), whereas let-7 expression was shown to suppress MYC expression in a Burkitt lymphoma cell line (Sampson et al., 2007). [score:12]
Moreover, up-regulation of RAS was found to require down-regulation of let-7 in lung cancer and non-small cell lung cancer (NSCLC) (Takamizawa et al., 2004; Johnson et al., 2005; Kumar et al., 2008), and let-7g was shown to block tumorigenesis by suppressing RAS in NSCLC (Kumar et al., 2008). [score:9]
The inverse relationship between the expression levels of let-7 and HMGA2 was further supported by recent studies demonstrating that ectopic let-7 expression can inhibit cell growth and mammosphere formation by down -regulating RAS and HMGA2 in mouse breast cancers (Sempere et al., 2007; Yu et al., 2007). [score:8]
In an unfavorable environment, ligand-unbound DAF-12 suppresses let-7 expression with its co-repressor, DIN-1. When environmental conditions favor developmental progression, however, ligand-bound DAF-12 activates the transcription of let-7. This feedback loop may regulate cellular fate and developmental arrest (Bethke et al., 2009; Hammell et al., 2009). [score:8]
In addition to the role of let-7 in modulating the RAS oncogene, multiple let-7 members were found to be down-regulated in human cancers and cancer stem cells, strengthening the notion that let-7 may also function as a tumor suppressor (Takamizawa et al., 2004; Shell et al., 2007; Yu et al., 2007; Dahiya et al., 2008; O’Hara et al., 2009). [score:6]
It thus seems that let-7 should be expressed at specific stages of terminal differentiation, but down-regulated in stem cells being maintained in their undifferentiated state. [score:6]
During differentiation, increased expression of let-7 down-regulates HMGA2 by interacting with its 3′ UTR (Yu et al., 2007; Boyerinas et al., 2008; Nishino et al., 2008). [score:6]
let-7 was shown to regulate the expression of high-mobility group AT-hook 2 (HMGA2), which is an early embryonic oncofetal gene that is overexpressed in stem cells and contributes to their self-renewal (Yu et al., 2007; Nishino et al., 2008). [score:6]
As a result, the majority of let-7 mutants die due to bursting of the vulva, earning this mutation its name: lethal-7. The expression pattern of let-7 is consistent with its mutant phenotype, as its expression is first detected at the L3 stage and peaks at the L4 stage (Reinhart et al., 2000; Esquela-Kerscher et al., 2005). [score:6]
Purified LIN28A inhibits pri-let-7 processing in vitro and its ectopic expression selectively blocks pri-let-7 processing in vivo (Newman et al., 2008; Viswanathan et al., 2008). [score:5]
The observation that let-7 expression gradually increases during development suggests that let-7 biogenesis may be tightly regulated by additional factors (Pasquinelli et al., 2000; Sempere et al., 2002; Thomson et al., 2006; Liu et al., 2007). [score:5]
Moreover, the SET7/9 -mediated post-translational modification (methylation) appears to act as a switch that changes the action mode of LIN28A in the inhibition of let-7 biogenesis. [score:5]
Thus, although it is not yet clear whether LIN28A directly inhibits Drosha activity, it appears to negatively regulate let-7 biogenesis in the nucleus as well as in the cytoplasm. [score:5]
Transcriptional regulation of let-7 C. elegans harbors a feedback circuit between let-7 and the nuclear hormone receptor, DAF-12, in that DAF-12 is a target of let-7, but also regulates the transcription of let-7 in a ligand -dependent manner. [score:5]
Even though let-7 is ubiquitously expressed in adult mammalian tissues (Sempere et al., 2004), expression of individual let-7 family members is also context -dependent. [score:5]
This context -dependent expression of let-7 family members would be tightly related with the expression of LIN28A/B as well as transcription factors (Thornton and Gregory, 2012). [score:5]
As let-7 is induced during development and represses the expression of pluripotency factors, its biogenesis must be precisely regulated. [score:5]
In the presence of LIN28A/B, TUTases instead inhibit pre-let-7 processing by oligo-uridylation via LIN28A/B -mediated targeting. [score:5]
Together, these lines of evidence strongly suggest that the let-7 family members act as crucial tumor suppressors that inhibit diverse oncogenes. [score:5]
As let-7 expression gradually increases during development, and this miRNA plays important roles in many biological processes, it could be expected that the biogenesis of let-7 should be tightly regulated (Pasquinelli et al., 2000; Sempere et al., 2002; Thomson et al., 2006; Liu et al., 2007). [score:5]
Indeed, DIS3, other catalytic subunit of cytoplasmic exosome, also indirectly regulates the expression of let-7 through degradation of LIN28B mRNAs in several mammalian cancer cell lines (Segalla et al., 2015). [score:5]
With respect to the function of let-7 as tumor suppressor, the targets of C. elegans let-7 were initially predicted using computational analysis, and the 3′ UTR of let-60 [also known as an ortholog of the RAS (human Rat sarcoma) oncogene] was identified as having the highest identified sequence complementarity to let-7 (Johnson et al., 2005). [score:5]
Although the expressions of LIN28A and LIN28B are mutually exclusive and these proteins play somewhat different inhibitory roles in let-7 biogenesis, recent results suggest that they might share the consensus of their molecular mechanism. [score:5]
Thus, one of the mechanisms of maintaining undifferentiated state in stem cells is upregulation of HMGA2 by maintaining the low level of let-7 miRNA. [score:4]
The involvement of let-7 miRNA in stem cell regulation also provided a clue as to how let-7 may function as a tumor suppressor. [score:4]
Indeed, recent studies have shown that let-7 family members generally promote differentiation during development and function as tumor suppressors in various cancers (Reinhart et al., 2000; Takamizawa et al., 2004; Grosshans et al., 2005; Johnson et al., 2005; Yu et al., 2007; Caygill and Johnston, 2008; Kumar et al., 2008). [score:4]
In summary, two major biological roles have been elucidated for the let-7 miRNA: as an essential regulator of terminal differentiation, and as a fundamental tumor suppressor. [score:4]
This conservation suggests that let-7 may act as a regulator of gene expression across diverse animal species (Pasquinelli et al., 2000; Hertel et al., 2012). [score:4]
LIN28B appears to directly bind to pri-let-7 in the nucleus and sequester it to the nucleolus, which lacks Drosha, thereby suppressing let-7 maturation via a TUTase-independent pathway. [score:4]
Cluster1-a (let-7a-2, miR-100, miR-125b-1) and Cluster1-b (let-7c, miR-99a, miR-125b-2) are involved in HSPC (hematopoietic stem and progenitor cell) homeostasis such as self-renewal, proliferation, quiescence, and differentiation by blocking TGFβ pathway and amplifying Wnt signaling (Emmrich et al., 2014), whereas LIN28B represses let-7 to inhibit erythroid development and maintain stemness (Copley et al., 2013; Lee et al., 2013b). [score:4]
Interestingly, a similar feedback loop has also been demonstrated in mammals: MYC is a target of let-7, but it can also repress the transcription of let-7 during MYC -mediated tumorigenesis by directly binding to the promoter and upstream region of the let-7a-1/let-7f-1/let-7d cluster (Chang et al., 2008; Wang et al., 2011). [score:4]
C. elegans harbors a feedback circuit between let-7 and the nuclear hormone receptor, DAF-12, in that DAF-12 is a target of let-7, but also regulates the transcription of let-7 in a ligand -dependent manner. [score:4]
In mammals, let-7 expression is high during embryogenesis and brain development (Thomson et al., 2004; Schulman et al., 2005; Thomson et al., 2006; Wulczyn et al., 2007) and remains high in adult tissues (Sempere et al., 2004; Thomson et al., 2004). [score:4]
For instance, miR-48, miR-84, and miR-241 regulate the second larval (L2) to third larval (L3) transition, while let-7 regulates the fourth larval (L4) to adult transition (Fig.   1) (Reinhart et al., 2000; Abbott et al., 2005). [score:3]
Several other lines of evidence strongly suggest that let-7 functions as tumor suppressor in general. [score:3]
Consistent with this mutant phenotype, let-7 expression in D. melanogaster gradually increases during the third larval instar stage and peaks in the pupa (Pasquinelli et al., 2000; Bashirullah et al., 2003). [score:3]
Ultimately, detailed mechanistic studies for let-7 biogenesis and its regulation involved in the developmental timing, cell division and differentiation in animals should be elucidated. [score:3]
Thus, the let-7 miRNAs of C. elegans and D. melanogaster both act as essential regulators for proper development at the larva-to-adult transition. [score:3]
During the life cycle of C. elegans, miR-48, miR-84, and miR-241 regulate the L2-to-L3 transition, whereas let-7 regulates the L4-to-adult transition Let-7 miRNAs are found in various animal species, including the human. [score:3]
LIN28B has also been shown to inhibit let-7 biogenesis (Fig.   4), but the similar functions of LIN28A and LIN28B are achieved through very different action mechanisms (Piskounova et al., 2011). [score:3]
In addition, a subset of let-7 family member would be expressed in specific tissues, cell lines, and cancers (Boyerinas et al., 2010; Chiu et al., 2014). [score:3]
In C. elegans, let-7 controls the crucial developmental timing of the last larval transition (L4-to-adult) via regulation of transcription factors (daf-12, pha-4, die1, and lss4) in different tissues (Fig.   1) (Reinhart et al., 2000; Grosshans et al., 2005). [score:3]
The let-7 mutant is lethal in the nematode (Reinhart et al., 2000), and decreased let-7 expression or genomic deletion has been detected in several human cancer types (Takamizawa et al., 2004; Dahiya et al., 2008; O’Hara et al., 2009). [score:3]
This conserved feature of the let-7 miRNAs suggests that their targets and functions may be similar across diverse animal species. [score:3]
However, the exact role of let-7 family members in mammalian development has not yet been fully elucidated (Lancman et al., 2005; Schulman et al., 2005; Wulczyn et al., 2007), in large part because it is technically difficult to knock out multiple let-7 family members in the same individual. [score:3]
These studies collectively support the notion that let-7 is a key regulator of proper developmental timing in C. elegans. [score:3]
LIN28A and LIN28B inhibit the biogenesis of let-7 via both TUTase -dependent and -independent pathways. [score:3]
In addition, precocious expression of let-7 at the L2 stage yielded an early adult-like phenotype at the L4 stage (Hayes and Ruvkun, 2006). [score:3]
According to miRBase, Caenorhabditis elegans (nematode), Drosophila melanogaster (fly), Xenopus tropicalis (frog ), Danio rerio (zebra fish), Gallus gallus (chicken), Canis familiaris (dog), Mus musculus (mouse) and Homo sapiens (human) all express a version of let-7 (let-7a) that possesses the exact consensus sequence of ‘UGAGGUAGUAGGUUGUAUAGUU’ (Fig.   2A). [score:3]
When LIN28A is overexpressed in HEK293T cells, the 3′-terminal oligo-uridylation of pre- let-7 yields a uridine tail of ~14 nt (Heo et al., 2008). [score:3]
Further studies examining the molecular mechanisms of let-7 biogenesis and its regulation by nuclear/nucleolar and cytoplasmic factors should provide new insights into the biological roles of the let-7 family members. [score:2]
The detailed relationship between LIN28B and TUTases needs to be further understood LIN28A/B negatively regulates let-7 biogenesisAs noted above, LIN28A is required for the oligo-uridylation of pre-let-7 by TUTases (Heo et al., 2008; Hagan et al., 2009; Heo et al., 2009; Piskounova et al., 2011; Thornton et al., 2012). [score:2]
Figure 4 Regulation of let-7 biogenesis by LIN28A/B. [score:2]
Thus, it appears that LIN28A may regulate pri-let-7 processing in a TUTase-independent fashion in the nucleus as well as a TUTase -dependent pathway in the cytoplasm. [score:2]
In addition, pri-let-7 processing is rescued by knockdown of LIN28A in mouse embryonal carcinoma (Viswanathan et al., 2008). [score:2]
In contrast, seam cells harboring the let-7 mutation fail to finish the L4-to-adult transition and instead exhibit extra cell division without proper formation of the adult alae (Reinhart et al., 2000). [score:2]
Oligo-uridylation by TUTases is a marker for pre-let-7 degradationIt has been reported that let-7 is also post-transcriptionally regulated by additional factors. [score:2]
Dysregulation of let-7 family members leads to abnormal physiological processes. [score:2]
It has been reported that let-7 is also post-transcriptionally regulated by additional factors. [score:2]
For example, let-7 family members have been shown to repress cell cycle regulators (e. g., cyclin A, cyclin D1, cyclin D3, and CDK4) and block cell cycle progression and anchorage-independent growth in cancer cells (Johnson et al., 2007; Schultz et al., 2008). [score:2]
LIN28A/B negatively regulates let-7 biogenesis. [score:2]
REGULATION OF let-7 BIOGENESIS. [score:2]
In addition, we discuss recent progress in better understanding the regulatory mechanisms that act upon let-7. The discovery of let-7 in C. elegansExperiments using forward genetics originally identified let-7 (lethal-7) as a heterochronic gene in C. elegans (Reinhart et al., 2000). [score:2]
Despite let-7 is one of the first discovered miRNAs, the details on transcriptional regulation of let-7 family, especially individual members of let-7 family, are not clearly understood. [score:2]
Interestingly, MYC can also negatively regulate let-7 family members such as let-7a, - 7d, and - 7g by binding to their promoters, thus, forming a negative-feedback loop (Chang et al., 2008; Wang et al., 2011). [score:2]
Based on this, it seems reasonable to speculate that other transcription factors may also participate in the transcriptional regulation of let-7 family members. [score:2]
LIN28A/B proteins also regulate let-7 biogenesis via TUTase-independent pathways. [score:2]
Moreover, let-7 is known to regulate hematopoietic stem cell fate along with miR-99a/100, miR-125b-1/2, and LIN28B (Copley et al., 2013; Lee et al., 2013b; Emmrich et al., 2014). [score:2]
To date, several transcriptional and post-transcriptional mechanisms have been proposed as regulators of let-7 biogenesis. [score:2]
Transcriptional regulation of let-7. Oligo-uridylation by TUTases is a marker for pre-let-7 degradation. [score:2]
In chicken and mice, let-7 is involved in limb development (Mansfield et al., 2004; Lancman et al., 2005; Schulman et al., 2005). [score:2]
Pre-let-7 is mono-uridylated at the 3′ end by LIN28A and TUTases prior to Dicer -mediated processing. [score:1]
The group II pri- let-7 precursors have a bulged adenosine (pri-let-7d) or uridine (all other members of the group) next to the processing site (Heo et al., 2012). [score:1]
As discussed above, TUTase is essential for the processing of the group II pre-let-7 miRNAs, which have a unique 3′ overhang (Fig.   3) (Heo et al., 2012). [score:1]
Notably, each let-7 family member is often present in multiple copies across the genomes of higher animals (Table  1). [score:1]
Comparison of let-7 family members in D. melanogaster and higher animals has revealed that such sequences tend to show similar genomic positions, suggesting that they form well-preserved clusters (Lagos-Quintana et al., 2001; Bashirullah et al., 2003; Sempere et al., 2003). [score:1]
This oligo-uridylated pre-let-7 resists Dicer cleavage and is instead susceptible to degradation. [score:1]
It was recently shown that LIN28A can prevent the biogenesis of let-7 independent of TUT4/7 in hESCs, in a manner similar to that seen for LIN28B (Fig.   4) (Kim et al., 2014). [score:1]
X-ray crystallography has shown that the three RNA binding domains of DIS3L2 form an open funnel that facilitates uridine-specific interactions with the first 12 uridines of the pre- let-7 tail. [score:1]
In the human, let-7g and let-7i are located individually on chromosomes 3 and 12, respectively, while the other let-7 family members are distributed among four clusters (clusters 1 to 4) (Table  2). [score:1]
In the human, for example, 12 distinct loci encode nine mature let-7 miRNAs (Fig.   2B and Table  2). [score:1]
For one, whereas the nematode and the fly have only one let-7 miRNA, higher animals (e. g., fishes and mammals) have diverse let-7 family members including let-7a, - 7b, - 7c, - 7d, - 7e, - 7f, - 7g, - 7h, - 7i, - 7j, - 7k (see below for a discussion of this nomenclature) and miR-98 (Table  1) (Lagos-Quintana et al., 2001; Lau et al., 2001; Chen et al., 2005; Landgraf et al., 2007). [score:1]
Genomic location and four clusters of these precursors are describedIn animal genomes, the let-7 family members can be encoded individually or as clusters with other family members and/or unrelated miRNAs. [score:1]
Biological roles of let-7 family membersThe high degree of conservation among let-7 miRNAs across different animal species suggests that they may play important (and potentially similar) roles in the biological processes of various organisms (Pasquinelli et al., 2000; Hertel et al., 2012). [score:1]
Moreover, HuR, RNA -binding protein, binds and represses MYC mRNA by recruiting the let-7/RISC complex to 3′ UTR region of MYC (Ma et al., 1996; Kim et al., 2009). [score:1]
The nematode and fruit fly have a single isoform, whereas higher animals have multiple let-7 isoforms. [score:1]
In addition, while the mature let-7 miRNA is not detected, pri-let-7 exists in some cell types including mESCs (Suh et al., 2004; Thomson et al., 2006; Wulczyn et al., 2007). [score:1]
LIN28A is mainly localized in the cytoplasm, but it can enter the nucleus and shows affinity for both pri- and pre-let-7 (Heo et al., 2008; Newman et al., 2008; Rybak et al., 2008; Viswanathan et al., 2008). [score:1]
The machinery responsible for degrading oligo-uridylated pre-let-7 was recently identified as the catalytic subunit of the cytoplasmic exosome, DIS3L2 (Chang et al., 2013; Malecki et al., 2013; Ustianenko et al., 2013). [score:1]
The detailed relationship between LIN28B and TUTases needs to be further understood As noted above, LIN28A is required for the oligo-uridylation of pre-let-7 by TUTases (Heo et al., 2008; Hagan et al., 2009; Heo et al., 2009; Piskounova et al., 2011; Thornton et al., 2012). [score:1]
Figure 2 Sequence comparison of let-7 family members across diverse animal species. [score:1]
Although let-7 maturation generally follows the canonical miRNA biogenesis pathway, some family members require an additional step. [score:1]
The terminal loop of pre- let-7 has three independent binding sites for LIN28A, which can be multiply assembled in a stepwise fashion (Desjardins et al., 2014). [score:1]
LIN28B blocks the biogenesis of the let-7 miRNA via TUTase-independent pathways. [score:1]
During the life cycle of C. elegans, miR-48, miR-84, and miR-241 regulate the L2-to-L3 transition, whereas let-7 regulates the L4-to-adult transition Characteristics of the let-7 family Let-7 miRNAs are found in various animal species, including the human. [score:1]
Experiments using forward genetics originally identified let-7 (lethal-7) as a heterochronic gene in C. elegans (Reinhart et al., 2000). [score:1]
In this review, we provide an overview of the features and biological roles of the let-7 family members in higher eukaryotes. [score:1]
For instance, we do not yet know what happens to pri-let-7 following its sequestration into the nucleolus by methylated LIN28A or LIN28B. [score:1]
These lines of evidence suggest that LIN28A might participate in multiple steps of let-7 biogenesis, including both Dicer- and Drosha -mediated processing. [score:1]
Mammals have two paralogs of LIN28, LIN28A (also known as LIN28) and LIN28B, which can bind to both pri- and pre-let-7 to block the activities of Drosha and Dicer (Fig.   4) (Heo et al., 2008; Newman et al., 2008; Rybak et al., 2008; Viswanathan et al., 2008). [score:1]
org, bottom panel) Although the let-7 sequence is well conserved from the nematode to the human, several differences distinguish the closely related let-7 family members of various animal species (Roush and Slack, 2008). [score:1]
This multimerization of LIN28A is likely to be required for the efficient blockade of Dicer -dependent pre-let-7 processing. [score:1]
GENERAL FEATURES OF THE let-7 FAMILY. [score:1]
LIN28A helps TUTases to oligo-uridylate pre-let-7. Methylated LIN28A binds to pri-let-7 in the nucleus and sequesters it into the nucleolus to prevent Drosha -mediated processing. [score:1]
Let-7 (lethal-7) was one of the first miRNAs to be discovered. [score:1]
In this context, the level of pre-let-7 appears to influence the subcellular localization of LIN28B (Suzuki et al., 2015). [score:1]
org, bottom panel)Although the let-7 sequence is well conserved from the nematode to the human, several differences distinguish the closely related let-7 family members of various animal species (Roush and Slack, 2008). [score:1]
Three members of the let-7 family (pre- let-7a-2, -7c, and -7 e) carry the typical two-nucleotide 3′ overhang in their precursors (group I pre-miRNAs), while the rest possess one-nucleotide 3′ overhang (group II pre-miRNAs) (Heo et al., 2012). [score:1]
Indeed, studies have shown that LIN28A/B blocks let-7 biogenesis in several different ways to maintain self-renewal and pluripotency in stem cells (Heo et al., 2008; Newman et al., 2008; Rybak et al., 2008; Viswanathan et al., 2008; Heo et al., 2009; Piskounova et al., 2011; Kim et al., 2014). [score:1]
Genomic location and four clusters of these precursors are described In animal genomes, the let-7 family members can be encoded individually or as clusters with other family members and/or unrelated miRNAs. [score:1]
Subsequently, let-7 was shown to interact with let-60 and RAS in C. elegans and human cancers, respectively (Johnson et al., 2005). [score:1]
The let-7 miRNA is evolutionarily conserved across various animal species, including flies and mammals, but it is not found in plants (Pasquinelli et al., 2000; Hertel et al., 2012). [score:1]
The high degree of conservation among let-7 miRNAs across different animal species suggests that they may play important (and potentially similar) roles in the biological processes of various organisms (Pasquinelli et al., 2000; Hertel et al., 2012). [score:1]
Higher animals have generally similar sets of let-7 family members, although slight differences may be observed (for example, let-7h exists in the zebrafish but not in the human). [score:1]
TUT4 and TUT7 were recently shown to oligo-uridylate pre-let-7 in embryonic stem cells and cancer cells (Hagan et al., 2009; Heo et al., 2009; Thornton et al., 2012). [score:1]
The discovery of let-7 in C. elegans. [score:1]
let-7 has also been shown to function as a heterochronic gene in D. melanogaster (Caygill and Johnston, 2008; Sokol et al., 2008), wherein let-7 mutants show abnormal (delayed) cell cycle exit in the wing (Caygill and Johnston, 2008) and an irregular maturation of neuromuscular junctions in the adult abdominal muscles that results in immaturity of the neuromusculature and defects in adult fertility, motility, and flight (Sokol et al., 2008). [score:1]
LIN28A reportedly competes with Dicer for pre-let-7 and blocks processing of the precursor (Rybak et al., 2008); in the absence of LIN28A, pre-let-7 is mono-uridylated by TUT2/4/7 and further processed by Dicer to generate the mature let-7 (Heo et al., 2012). [score:1]
miRNA processing miRNA biogenesis let-7 family TUTase LIN28A/B MicroRNAs (miRNAs) are short (~22-nucleotide-long) non-coding RNAs found in diverse eukaryotes from plants to animals. [score:1]
The details of the relationship between DIS3L2-related cytoplasmic exosomes and let-7 biogenesis are also unknown. [score:1]
In the human, for instance, the let-7 family is composed of nine mature let-7 miRNAs encoded by 12 different genomic loci, some of which are clustered together (Ruby et al., 2006; Roush and Slack, 2008). [score:1]
Through its RNA -binding activity, LIN28A associates with the bulging GGAG motif in the terminal loop of pre-let-7 and recruits TUT4/7 (Nam et al., 2011). [score:1]
Most of let-7 sequences include the ‘seed sequence’. [score:1]
Biological roles of let-7 family members. [score:1]
Interestingly, the TUTases play a second role in the degradation of pre- let-7 through their terminal uridylation activity (Fig.   4) (Heo et al., 2008; Hagan et al., 2009; Heo et al., 2009; Thornton et al., 2012). [score:1]
This substantial total includes 401 let-7 sequences from various organisms. [score:1]
Consensus sequences of the mature human let-7 family members, as assessed by MEME (http://meme-suite. [score:1]
To distinguish between the various isoforms, a letter and/or number are placed after the term ‘ let-7’. [score:1]
In this review, we briefly summarize the current state of knowledge regarding the let-7 miRNA family and its biological functions, focusing on let-7 biogenesis in higher animals. [score:1]
In addition, TUTase has been shown to be involved in degrading the let-7 precursor (pre-let-7) to block the generation of mature let-7 in the cytoplasm (Hagan et al., 2009; Heo et al., 2009; Thornton et al., 2012). [score:1]
Moreover, these multiple let-7 family members are likely to have functionally redundant roles. [score:1]
In general, the let-7 miRNA is generated through the canonical miRNA biogenesis pathway, which involves Drosha- and Dicer -dependent processing and is supported by TUTases. [score:1]
In addition, recruitment of HuR and let-7 to the transcript of MYC is interdependent (Kim et al., 2009; Gunzburg et al., 2015). [score:1]
At present, the detailed molecular mechanisms underlying let-7 miRNA biogenesis are not fully understood. [score:1]
Although let-7 family is generated through canonical miRNA biogenesis pathway, it would be helpful to understand the let-7 biogenesis when comparing with the non-canonical miRNA biogenesis. [score:1]
[1 to 20 of 135 sentences]
3
[+] score: 249
Let-7 Down-Regulation and HMGA2 Up-Regulation Are Associated with a Stem Cell Signature in Intestinal Cancers in Humans and Lin28b [Lo]/ Let7 [IEC- KO] MiceTo extrapolate relevance to human CRC from these mouse mo dels, we examined expression data from human samples from The Cancer Genome Atlas (TCGA) [35] by querying for expression of Let-7 target mRNAs, with a focus on targets that exhibited significant up-regulation in either Vil-Lin28b [Med] or Lin28b [Lo]/ Let7 [IEC- KO] mouse mo dels (namely, ARID3A, PLAGL2, HMGA1, HMGA2, MYCN, IGF2BP1, IGF2BP2, and E2F5). [score:17]
To extrapolate relevance to human CRC from these mouse mo dels, we examined expression data from human samples from The Cancer Genome Atlas (TCGA) [35] by querying for expression of Let-7 target mRNAs, with a focus on targets that exhibited significant up-regulation in either Vil-Lin28b [Med] or Lin28b [Lo]/ Let7 [IEC- KO] mouse mo dels (namely, ARID3A, PLAGL2, HMGA1, HMGA2, MYCN, IGF2BP1, IGF2BP2, and E2F5). [score:11]
The critical nature of maintaining sufficient levels of mature Let-7 miRNAs is reflected in the large number of studies that have found LIN28A or LIN28B up-regulated in human cancers, with expression often associated with an aggressive disease phenotype and/or predictive of poor outcomes [12– 15]. [score:8]
K) Comparison of stem cell marker expression and Let-7 target mRNA expression levels in WT jejunum, Lin28b [Lo] /Let7 [IEC- KO] jejunum, and Lin28b [Lo] /Let7 [IEC- KO] tumors by linear regression yielded Pearson correlation coefficients, with Arid3a, Hmga1, and Hmga2 correlating very highly with expression of stem cell markers. [score:8]
For example, Let-7 regulates insulin-PI3K-mTOR signaling in muscle by inhibiting expression of INSR, IGF1R, and IRS2 [21], yet can also inhibit mTORC1 without affecting insulin-PI3K signaling [22], whereas we have observed no effects on insulin-PI3K-mTOR signaling following depletion of Let-7 miRNAs in the small intestine [18]. [score:8]
Expression analysis was performed by Q-RT-PCR, normalized to Hprt and Actb, with n = 3 mice for each genotype at 12 weeks of age with error bars representing +/–the S. E. M. D) Identification of conserved Let-7 target genes in ten of eleven Let-7 target genes based upon TargetScan. [score:8]
For examination of Let-7 miRNA expression and expression relative to candidate target genes we examined a cohort of 199 CRC patients from the TCGA Pan-Cancer analysis project visualized using the starbase miRNA CLIP-seq portal (http://starbase. [score:7]
Expression of all Let-7 targets also correlated significantly between Lin28b [Lo]/ Let7 [IEC- KO] and Vil-Lin28b [Med] intestine crypts, with Hmga2, Igf2bp2, Hif3a, Arid3a, and E2f5 being the most highly induced targets in both mo dels (Fig 2C). [score:6]
Let-7 Down-Regulation and HMGA2 Up-Regulation Are Associated with a Stem Cell Signature in Intestinal Cancers in Humans and Lin28b [Lo]/ Let7 [IEC- KO] Mice. [score:6]
Analysis of Let-7 target mRNAs revealed two basic patterns of expression, with one group displaying expression highest in intact tumors or tumoroids/enteroids (Fig 4F). [score:6]
Many studies have focused on RAS and MYC as cancer-relevant Let-7 targets, although recent high-throughput sequencing (mRNA-seq, miRNA-seq, and CLIP-seq) and meta-analyses indicate that these mRNA targets are not frequently regulated by Let-7, especially in the context of cancer [5, 6, 20, 23]. [score:6]
Identification of Let-7 targets up-regulated specifically in transformed cells from intestinal adenocarcinomas. [score:5]
Concurrent deletion of the MirLet7c-2/Mirlet7b bi-cistronic cluster is necessary as Lin28b is unable to effectively target and inhibit processing of these specific Let-7 miRNAs [18]. [score:5]
Onco-fetal Let-7 targets such as HMGA2 and IGF2BP1-3 appear to be more frequently up-regulated in multiple contexts, across multiple tissues, and in association with somatic stem cell potential [4, 5, 20, 24– 29]. [score:5]
Dissecting the interaction and possible cooperation of Let-7 target mRNAs is critical for designing strategies to ameliorate the loss of Let-7 in human cancers via combinatorial targeted therapies against multiple oncogenes. [score:4]
A) Expression of Let-7 target mRNA levels in small intestine crypts isolated from wild-type (WT) and Vil-Lin28b [Med] mice. [score:4]
1005408.g002 Fig 2A) Expression of Let-7 target mRNA levels in small intestine crypts isolated from wild-type (WT) and Vil-Lin28b [Med] mice. [score:4]
B) Expression of Let-7 target mRNA levels in small intestine (jejunum) crypts isolated from wild-type (WT), Vil-Lin28b [Lo], Let7 [IEC- KO], Lin28b [Lo] /Let7 [+/-], and Lin28b [Lo] /Let7 [IEC- KO] mice. [score:4]
Co -expression of Let-7 Targets HMGA2, ARID3A, IGF2BP2, PLAGL2, HMGA1, HIF3A, E2F5, NR6A1, MYCN, and DDX19A with stem cell markers (LGR5, EPHB2, ASCL2, MSI1, z-score threshold +/– = 1) in two human colon cancer datasets from TCGA (http://www. [score:4]
However, the differences between Let-7 target mRNAs in each of these mo dels can be quite disparate; e. g. KRAS has a larger effect on tumorigenesis than does HMGA2 in a non-small cell lung cancer mo del [49], whereas HMGA2 appears to have a much larger role in other cancer mo dels [28, 50– 53], likely as a modifier of chromatin structure and gene expression [54– 57]. [score:4]
edu) comparing expression of Let-7 target mRNAs in normal tissue (N. T. ) vs. [score:4]
While Let-7a and Let-7b depletion and increased expression of stem cell markers may appear to be a general feature of colon cancer, our discovery of a relationship between expression of Let-7 and stem cell markers suggests a functional connection. [score:4]
To gain insight into the association of several Let-7 targets with tumorigenesis in vivo, we examined Hmga1, Hmga2, Arid3a, and Hif3a protein expression by immunostaining adenomas and adenocarcinomas, as well as adjacent normal tissue, from Lin28b [Lo] /Let7 [IEC- KO] mice. [score:4]
S2 TableCo -expression of Let-7 Targets HMGA2, ARID3A, IGF2BP2, PLAGL2, HMGA1, HIF3A, E2F5, NR6A1, MYCN, and DDX19A with stem cell markers (LGR5, EPHB2, ASCL2, MSI1, z-score threshold +/– = 1) in two human colon cancer datasets from TCGA (http://www. [score:4]
Since Let-7a and Let-7b appear to be the most highly expressed Let-7 miRNAs in normal colonic epithelium, and are significantly depleted in CRC specimens [20, 30] (S1A, S1B and S1C Fig), we examined these miRNAs in a subset of colon cancer specimens. [score:3]
Let-7 miRNAs and Let-7 Target anti-correlation in CRC TCGA datasets. [score:3]
In the mouse intestine we have achieved comprehensive depletion of all Let-7 miRNAs in this large multi-genic family through use of an inhibitory protein, called LIN28B, that specifically represses Let-7, and genetic inactivation of another gene cluster called MirLet7c-2/Mirlet7b. [score:3]
We have achieved comprehensive depletion of all Let-7 miRNAs in the intestinal epithelium and demonstrated the critical nature of their cumulative tumor-suppressive properties. [score:3]
A) Schematic of the intestine-specific deletion of the Mirlet7c-2/Mirlet7b floxed locus via Villin-Cre and expression of Lin28b with a Villin-Lin28b-ires-tdTomato transgene, which repress all 8 of the Let-7 clusters. [score:3]
To assay exogenous expression of Let-7 targets in enteroids, we used a lentivirus vector for transduction of wild-type mouse small intestine enteroids (Fig 6D–6G). [score:3]
Inverse relationships for Let-7 and target mRNAs could be discerned by plotting miRNA-seq data against mRNA-seq data for Let-7c vs. [score:3]
1005408.g001 Fig 1A) Schematic of the intestine-specific deletion of the Mirlet7c-2/Mirlet7b floxed locus via Villin-Cre and expression of Lin28b with a Villin-Lin28b-ires-tdTomato transgene, which repress all 8 of the Let-7 clusters. [score:3]
Nascent tumorigenesis beginning with aberrant crypt foci and/or microadenomas may occur spontaneously in our mouse mo del of Let-7 depletion, likely due to sporadic deregulation of Wnt signaling or potential spontaneous loss of other tumor suppressive mechanisms. [score:3]
We focused on Hmga2, rather than Hmga1, as it is consistently up-regulated in non-malignant intestinal tissue from Vil-Lin28b [Med] and Lin28b [Lo]/ Let7 [IEC- KO] and thus appears highly dependent on Let-7 [18]. [score:3]
Vil-Lin28b [Med] mice express higher levels of Lin28b, have partially depleted Let-7 miRNAs and develop adenocarcinomas of the small intestine as do Lin28b [Lo] /Let7 [IEC- KO] mice but do not exhibit a phenotype as severe as Lin28b [Lo] /Let7 [IEC- KO] mice (18). [score:3]
Let-7 miRNAs comprise one of the largest and most highly expressed families of miRNAs, possessing potent anti-carcinogenic properties in a variety of tissues [3]. [score:3]
To circumvent this obstacle and elucidate the mechanistic roles of Let-7 miRNAs in intestinal tumorigenesis in a genetic mouse mo del we have combined a Vil-Lin28b [Low] (Lin28b [Lo]) transgene with intestinal deletion of the MirLet7c-2/Mirlet7b bi-cistronic cluster (Let-7 [IEC- KO]) to achieve robust repression of all Let-7 miRNAs expressed in the intestinal epithelium. [score:3]
In addition to our findings for HMGA2, IGF2BP1, and IGF2BP2, there is experimental evidence that HMGA1, E2F5, and ARID3A are also direct targets of Let-7 [6, 31, 32]. [score:3]
These compound Lin28b [Lo]/ Let7 [IEC- KO] mice, exhibit depletion of all Let-7 miRNAs specifically in intestinal epithelial cells (IEC) achieved through deletion of the MirLet7c-2/MirLet7b locus and repression of all other Let-7 miRNAs through inhibition by Lin28b [18] (and Fig 1A). [score:3]
D-I) Scatter plots of Let-7 miRNA expression vs. [score:3]
As documented in developmental programs in C. elegans and in human cancers, Let-7 miRNAs repress a stem cell phenotype and tumor-initiating phenotype [3], an association we observe here as well. [score:2]
Comprehensive depletion of all Let-7 miRNAs leads to the development of intestinal adenocarcinomas. [score:2]
All targets contained conserved Let-7 sites in the 3’UTR or coding sequence, except for Trim6, for which only the mouse mRNA possesses Let-7 sites (Fig 2D). [score:2]
To examine a possible relationship between Let-7 target mRNAs and stem cell markers, we evaluated co -expression in mouse samples (from Fig 5I) and found that Hmga1 and Hmga2 had very high correlation with all of the markers we examined (Fig 5K). [score:2]
Perhaps consistent with its association with a stem cell phenotype, HMGA2 is also frequently co-expressed with the stem cell markers MSI1 and LGR5 in human CRC, and notably, more frequently than any of the other Let-7 targets evaluated here in this study (Fig 5L and S2 Table). [score:2]
Comprehensive Depletion of Let-7 miRNAs Leads to the Development of Intestinal Adenocarcinomas in Mice. [score:2]
Let-7 biogenesis is tightly regulated, revealed by the discovery of several proteins that regulate processing by DGCR8/DROSHA in the nucleus, and by DICER1 cleavage in the cytoplasm. [score:2]
We next pursued 3-D culture and manipulation of intestinal organoids (enteroids) to explore the relationship between Let-7 targets and a stem cell phenotype. [score:2]
However, Let-7 action appears dependent on the particular mRNA targets affected, although Let-7 represses de-differentiation in multiple contexts. [score:2]
We also observed significant elevation of mRNAs for these Let-7 targets in crypts from small intestine epithelia from Lin28b [Lo]/ Let7 [IEC- KO] (Fig 2B). [score:2]
Lin28b [Lo] /Let7 [IEC- KO] mice reveals similar expression changes in each mo del of Let-7 depletion, with significant correlation (Pearson correlation shown). [score:2]
Examination of Let-7 targets in these tumors and in tumoroid cultures suggest that HMGA2 is likely playing a major role in driving carcinogenesis following Let-7 depletion, a novel in vivo finding. [score:2]
This activity is likely mediated via Let-7 repression of a multitude of onco-fetal mRNAs and other pro-proliferative and/or pro-metastatic targets, such as HMGA2, IGF2BP1, IGF2BP2, and NR6A1 [4– 6]. [score:2]
We have previously shown that crypt hyperplasia and Hmga2 expression is dependent on Let-7 depletion in crypts from Vil-Lin28b [Med] mice [18]. [score:2]
While HMGA2 is playing a key role, it is likely that the effects of Let-7 on an intestinal stem cell phenotype and epithelial tumorigenesis are dependent on the collective and/or cooperative role of multiple Let-7 targets. [score:2]
To generate compound mutant animals we used a low -expressing transgenic line (Lin28b [Lo] ), in which we could not detect measureable changes in either protein or mRNA levels of Let-7-independent Lin28b targets [18]. [score:2]
We next examined Let-7 targets that might mediate programs of tumorigenesis in Lin28b [Lo]/ Let7 [IEC- KO] mice in the context of tumors and cellular transformation. [score:2]
Identification of Relevant Let-7 Target mRNAs in the Intestinal Epithelium and Tumors. [score:2]
These effects appear to be due to Let-7, although LIN28B can bind mRNAs and modulate protein levels of targets in the intestinal epithelium [18]. [score:2]
Let-7 targets were examined in small intestine crypts from Vil-Lin28b and Lin28b [Lo]/ Let7 [IEC- KO] mice. [score:2]
C) Comparison of Let-7 target mRNA changes in small intestine crypts from Vil-Lin28b [Med] mice vs. [score:2]
Quantification of Let-7 target mRNA levels in intestinal epithelium crypts. [score:2]
Let-7 miRNA genes are shown as black hairpins while non-let-7 miRNA genes are depicted as gray hairpins. [score:1]
Levels of HMGA1, HMGA2, PLAGL2, IGF2BP2, E2F5, and ARID3A transcripts were also inversely proportional to levels of Let-7 miRNA by examination of a cohort of 199 CRC patients from the TCGA Pan-Cancer analysis project [20] (Fig 5B–5E and S1D–S1I Fig). [score:1]
LIN28B appears to act by sequestering primary-Let-7 (pri-Let-7) miRNAs within the nucleolus to prohibit processing by DGCR8 and DROSHA [9]. [score:1]
LIN28A works in concert with TRIM25 and TUT4 to mediate terminal uridylation and subsequent degradation of immature precursor-Let-7 (pre-Let-7) miRNA molecules [9– 11]. [score:1]
Quantification by Taqman RT-PCR confirmed that Let-7 miRNAs are severely repressed in tumoroid/enteroids and transformed tumoroid cysts (Fig 4D). [score:1]
The exploration of Let-7-dependence through genetic manipulation in mouse mo dels is currently untenable due to the large number of miRNA clusters, with 12 Let-7 genes located at 8 separate clusters on 7 different chromosomes. [score:1]
Supporting this hypothesis is the documentation that LIN28 proteins and Let-7 miRNAs do indeed affect proliferation, migration, and invasion in cell culture mo dels and xenografts of various malignancies [16, 17, 46– 49]. [score:1]
Most notable are LIN28A and LIN28B, which are RNA -binding proteins that directly bind to and block the processing of Let-7 mRNAs [7, 8]. [score:1]
D) Let-7 miRNAs are repressed consistently in tumoroid/enteroids (TE) and tumoroid cysts (TC). [score:1]
Let-7 miRNAs were quantified using Taqman Q-RT-PCR kits (Life Technologies), according to the manufacturers instructions and normalized to U6 and SNO135 small RNA levels. [score:1]
Large gene families, such as the Let-7 family, are difficult to silence or mutate because of the large amount of redundancy that exists between similar copies of the same gene; the mutation of one will often be masked or compensated by the continued function of others. [score:1]
[1 to 20 of 73 sentences]
4
[+] score: 198
Further, p53-miRs, such as miR-181c, 30b and 92 [Table S2], are predicted to target lin-28B [56], [69], [70], indicating that p53, by suppressing the expression of lin-28B, it could increase the processing of the tumor suppressor miRNA, let-7. Interestingly, increased expression of let-7 has been shown to increase the expression of Ago-2 [71]. [score:13]
This data suggests that p53/TA-p73/p63, by suppressing the TUTase4 expression through its target miRs, it could increase the processing of the tumor suppressor let-7. This data further strengthens the notion that p53/TA-p73/p63, by increasing let-7 expression, it could reduce stem cell proliferation/renewal/maintenance [Figure 3]. [score:11]
It has recently been shown that let-7 suppresses the expression of Dicer, which, in turn, suppresses the expression of let-7, indicating a double negative feedback loop [35], [36]. [score:9]
Interestingly, let-7 has recently been shown to suppress the expression of HMGA2, suggesting that p53/TA-p73/p63, by increasing the expression of let-7, it could increase the expression of INK4a/ARF (TAp73/p63-let-7-HMGA2-INK4a/ARF) [Figure 3]. [score:9]
This data suggests that TA-p73, by increasing the expression of the tumor suppressor let-7, it could indirectly regulate the expression of Dicer. [score:9]
Together, these data suggest that p53/TA-p73/p63, by negatively regulating the expression of lin-28/TUT4ase through its target miRs, it could increase the processing of the tumor suppressor-miRNAs, let-7, miR-200c, miR-143, and miR-107 [Figure 3]. [score:8]
As discussed, p53/TA-p73/p63, by increasing the expression of let-7, it could suppress the expression of the stem cell reprogramming factor lin-28 [37], [38], [40]. [score:7]
Together, these data suggest that both p53/TA-p63/p73 and ΔN-p63 could regulate the processing of tumor suppressor let-7 through their transcriptional targets in a cell context dependent manner [Figure 3]. [score:6]
This data suggests that p53/TA-p73/p63, by negatively regulating c-Myc/lin-28 through its transcriptional target miR-145, it could increase the expression of let-7 [73]. [score:6]
Interestingly, both Drosha and DGCR8 appear to be targeted by p53-miR, miR-27, while both Dicer and TARBP2 appear to be targeted by p53-miRs, such as let-7, miR-103/107, and miR-15/16/195, suggesting a co-ordinated regulation of miRNA processing mediated by the p53-miRs. [score:6]
This finding suggests that TA-p73/p63/p53, by suppressing the expression of lin-28 through let-7, it could regulate the miRNA-processing efficiency. [score:6]
Together, these data suggest that p53, by inducing miR-183 and let-7, it could promote the destabilization/degradation of oncogenic mRNAs (βTrCP1, c-myc, MDR-1, IGF2BP1, ZEB1, TCF-4, NFKB1) and thereby suppress the expression of metastatic factors [79] [Figure 4]. [score:5]
Remarkably, let-7 has recently been shown to suppress the expression of IGF2BP1, suggesting that it could destabilize βTrCP1, c-myc, and MDR-1 mRNAs. [score:5]
In addition, both let-7 and lin-28 (an RNA binding protein) have been shown to inhibit each other's expression [37], [38]. [score:5]
Estradiol, an inducer of p53 expression, has been shown to increase the expression of eight members of the let-7 family. [score:5]
Evidently, let-7 has recently been shown to increase the expression of its target mRNAs under stressful conditions [57]. [score:5]
This data suggests a) a feedback loop between p53 and let-7; and b) the ability of let-7c and -7a to inhibit p53 expression may be relieved in response to DNA damage [57]. [score:5]
This data suggests that p53/TA-p73/p63 could increase the expression of Ago-2 through its target gene let-7, and thereby it could increase the processing efficiency of miRNAs [Figure 3]. [score:5]
Among the p53-miRs that target the components of the miRNA processing complexes, miR-15/16/195, miR-103, miR-107, let-7, miR-124, miR-181, miR-148a/b, miR-30a/c, miR-27, miR-17, and miR-20 appear to target more than five components of the miRNA-processing pathway [Table 4, Table S3], suggesting the conserved nature of p53-miRs. [score:5]
Interestingly, let-7, by suppressing mLin41 expression, it could enhance the Ago-2 -dependent silencing efficiency of miRNAs. [score:5]
Together, p53/TA-p73, by increasing the processing of the tumor suppressor let-7, it could inhibit the stem cell proliferation/renewal/maintenance. [score:5]
Increased expression of lin-28 will suppress the processing of let-7 pre-miRNA. [score:5]
Together, p53/TA-p73/p63, by increasing the expression of miR-145, let-7, and miR-200, it could decrease the expression of metastasis promoting factors, and stem cell factors. [score:5]
p53, TA-p73/p63, and ΔNp63 regulate the processing of the tumor suppressor miRNAs, let-7, miR-200, miR-143, and miR-107. [score:4]
Remarkably, the let-7 family promoters contain p53-REs [40], indicating that they could be indeed be direct transcriptional targets of p53/p73/p63. [score:4]
Together, these data suggest that both p53 and p53-miRs, by controlling the expression of both ILF-3 and ILF-2, they could regulate the processing of let-7/miR-21 pri-miRNAs. [score:4]
It interacts with let-7 precursor loop, and thereby inhibits its processing in embryonic stem cells [58]. [score:3]
By interacting with let-7/miR-21 pri-miRNAs, they inhibit the processing of let-7/miR-21 pri-miRNAs into pre- miRNAs. [score:3]
Thus, p73, by increasing the expression of Ago-1/2, it could increase the processing of miRNAs, such as let-7 (HMGA2; lin-28; EGFR; Kras; c-myc; Bcl-xL), miR-134 (Nanog; LRH1; Oct-4; Collagenase-3; Stromelysin), miR-130b (ERK2; Fosl1; TGFβR1; ERα; Tcf-4; Collagenase-3; Ago4; Dicer; p63), miR-214 (EZH2; CTNNB1), miR-449a (CDK6; SirT1; HDAC1; E2F-1), miR-503 (CCND1; Fosl1), miR-181d (ERK2; TGFβR1; Tcl-1; ERα; AID; Bcl-2) and miR-379 (lin-28) [Figure 2] [31], [32]. [score:3]
Evidently, let-7a (2.1 fold), let-7c (2.7 fold), and let-7e (2.1 fold) are induced in response to p53 expression [56]. [score:3]
Thus, this data suggests that let-7 may increase the translation of p53 mRNA under genotoxic conditions. [score:3]
2009.4112.1> 77 Rybak A Fuchs H Hadian K Smirnova L Wulczyn EA 2009 The let-7 target gene mouse lin-41 is a stem cell specific E3 ubiquitin ligase for the miRNA pathway protein Ago2. [score:3]
The TUTase4 uridylates let-7 precursor, and thereby inhibits its processing [Figure 3]. [score:3]
It has been shown to unwind the stem loop structures of the tumor suppressor miRNA, let-7 [80]. [score:3]
The stem cell renewal factor, lin-28, has been shown to suppress the processing of pre-let-7 at the Microprocessor step [37]. [score:3]
Further, Let-7 has recently been shown to reduce the expression of stem cell reprogramming factors, such as Klf-4, Oct-4, Sox-2, and c-Myc [59], [61]. [score:2]
However, the enzyme that uridylates let-7 precursor remains obscure. [score:1]
The uridylated let-7 fails to be processed by the Dicer complex and therefore undergoes degradation in the cytoplasm. [score:1]
They do not appear to bind to any of the known miRNA processing components, but they interact with pri-miRNAs of let-7 and miR-21. [score:1]
The C-terminal NHL domain of TRIM-32 forms complex with Ago1, and thereby promotes the efficiency of processing of a number of miRNAs [Figure 2], including let-7, miR-134, miR-130, miR-214, 449, 379, 181, and miR-503 [31]. [score:1]
Let-7 miRNA is highly conserved from lower organisms to humans. [score:1]
It has also been shown to mediate uridylation of let-7 at its 3′ end in the cytoplasm [59]. [score:1]
Remarkably, Heo et al., [60] have recently showed that lin-28 recognizes a sequence motif—GGAG—present in let-7, and recruits TUTase-4 [TUT4, uridyl transferase]. [score:1]
[1 to 20 of 43 sentences]
5
[+] score: 195
Since let-7 is expressed at lower levels in HCC cells than normal liver cells and can affect either the stability or translation of the target mRNA [40], it is feasible to decrease the Ad's liver tropism via introducing let-7 target sites to regulate E1A expression. [score:12]
Consistent with its role of tumor suppressor, let-7 is found deregulated in various forms of cancers and the decreased expression of let-7 is functionally linked to tumor cell biology, paralleled with the upregulated expression of proto-oncogenes, reflecting poor patient prognosis at least in lung cancers [21]. [score:11]
By contrast, the RLuc/FLuc value was 86.0% and 87.8% in psiCHECK2-let7MT transfected L-02 and Hep3B cells, respectively (Fig. 2), confirming that the inhibitory effect was indeed mediated by the endogenous let-7. These results demonstrated that eight copies of let-7 target sites could effectively regulate the expression of the upstream gene according to the cellular endogenous expression status of the let-7 gene. [score:10]
The upregulation of LIN28B [43], [44], a suppressor of let-7 expression, may be one of possible causes. [score:8]
n = 3. To assess the ability of let-7 in suppressing foreign genes, a let-7-sensitive (psiCHECK2-let7T) (containing eight copies of imperfectly complementary let-7 target sites) and a let-7-insensitive (psiCHECK2-let7MT) (containing eight copies of “seed”-mutated let-7 target sites) luciferase reporter vector was generated and measured the effect of let-7 target sites (let7T) in high (L-02) versus low (Hep3B) let-7-containing cell lines. [score:7]
Having identified the capacity of let-7 target sites in the regulation of the upstream gene, a let-7-regulated fiber chimeric adenovirus, SG7011 [let7T], was constructed by incorporating the same fragment containing eight copies of let-7 target sites immediately after the stop codon of E1a gene and substituting the Ad5 fiber protein with the Ad11 knob domain (Fig. 3A). [score:7]
These results indicated that introduction of let-7 target sites downstream of E1A could successfully decrease the hepatotoxicity of wild-type adenovirus without attenuation of its ability to kill HCC cells with lower level of let-7. Thus, the engineered adenovirus fine-tuned by let-7 presented here may serve as a potential anticancer agent or a therapeutic vehicle for harboring antitumor genes, broadly applied in the treatment against cancer with the downregulated cellular let-7, including HCC. [score:6]
Western blotting was used to test the ability of let-7 target sites in regulating adenoviral E1A expression in HCC cells and normal liver cells. [score:6]
Let-7 Target Sites Effectively Regulate the Upstream Gene According to Endogenous Let-7. The regulation effect of let-7 target sites on upstream gene, analyzed by dual-luciferase assay system. [score:6]
The capacity of let-7 target sites to regulate E1A expression of the recombinant adenovirus, SG7011 [let7T]. [score:6]
0021307.g003 Figure 3The capacity of let-7 target sites to regulate E1A expression of the recombinant adenovirus, SG7011 [let7T]. [score:6]
These results indicated that the introduced let-7 target sites could effectively control adenoviral replication according to the expression of cellular endogenous let-7. 10.1371/journal. [score:5]
These results indicated that the introduced let-7 target sites could effectively control adenoviral replication according to the expression of cellular endogenous let-7. 10.1371/journal. [score:5]
And then, DNA fragment containing eight copies of let-7 target sites or seed-mutated let-7 target sites mentioned above was inserted into pXC-miR between BstBI and SalI site to generate pXC-let7T and pXC-let7MT, respectively. [score:5]
The results showed that within normal liver cell lines that have high cellular let-7, the E1A protein was dramatically suppressed in the SG7011 [let7T]-infected cells, but remained highly expressed in the SG7011 [let7MT]- and WAd5-infected cells. [score:5]
Eight copies of imperfectly complementary let-7 target sites (AACTATACAACGTCTACCTCA) [45] or “seed”-mutated let-7 target sites (AACTATACAACGTCTTGGAGT) with 2–6 oligonucleotides intervals were synthesized (TAKARA, DaLian, China)and cloned downstream of the Renilla luciferase gene of psiCHECK™-2 (Promega, Madison, WI), a plasmid containing both Renilla luciferase (RLuc) and firefly luciferase (FLuc) reporter gene, to generate reporter plasmids sensitive to let-7 (i. e. psiCHECK2-let7T), and control plasmid insensitive to let-7 (i. e. psiCHECK2-let7MT). [score:5]
The capacity of let-7 target sites in regulation of virus replication. [score:4]
Other members of let-7 family (i. e. let-7b, let7c, let-7d, let-7e, let-7f, and let-7g) were also downregulated at some extent in these HCC cell lines. [score:4]
Recently, it have been reported that members of let-7 family are downregulated in hepatocellular carcinoma [17]– [20]. [score:4]
In line with the finding that let-7 is downregulated in a considerable proportion of primary tissues (36.4%) and HCC cells, we have demonstrated the possibility of using let-7 to fine-tune the replication specificity of a chimeric Ad5/11 fiber adenovius, thereby reducing Ad's hepatotoxicity while maintaining its therapeutic replication within HCC cells. [score:4]
Here we reported that let-7 was downregulated (>2 folds) in a proportion of primary HCC tissues (12/33, 36.4%), most which were collected from patients had a history of HBV infection and suffered cirrhosis (Table 1). [score:4]
Downregulation of Let-7 in Primary HCC Tissues and HCC Cell lines. [score:3]
At the same time, the fragment containing eight copies of “seed”-mutated let-7 target sites were individually inserted into the same site to generate a control fiber chimeric adenovirus, SG7011 [let7MT]. [score:3]
Eight copies of let-7 target sites were inserted into the 3′UTR of E1A gene and the Ad5 fiber was replaced by Ad5/11 chimeric fiber. [score:3]
These results indicated that total expression of let-7 family was decreased in a considerable proportion of primary HCC tissues and HCC cell lines. [score:3]
Replicative Control of Recombinant Adenovirus by let-7 Target Sites. [score:3]
In this study, we detected the expression of let-7 family in a set of primary HCC tissue and HCC cell lines. [score:3]
In HCC cell lines that have low cellular let-7, however, the E1A protein expressed similarly among the SG7011 [let7T]-, SG7011 [let7MT]- and WAd5-infected cells (Fig. 3B). [score:3]
Previous studies have validated that in vitro or in vivo let-7 restorations can inhibit tumor growth [22]. [score:3]
Subsequent work has shown that let-7 is highly conserved across species and found abundantly and ubiquitously expressed in mammalian cells [7]. [score:3]
Let-7 Target Sites Reduce Hepatic Toxicity of Recombinant Adenovirus while Remain its Oncolytic Effects on HCC Cells in vitro. [score:2]
Let-7 Target Sites Reduce Hepatic Toxicity of Recombinant Adenovirus while Remain its Oncolytic Effects on HCC Cells in vitro Since the engineered adenovirus SG7011 [let7T] was replicated preferentially in tumor cells where the let-7 is downregualted, its cytotoxic effects in normal liver and HCC cells were quantified by 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. [score:2]
Cellular Let-7 Controls the Expression of E1A in the Let-7-engineered Adenovirus. [score:2]
Introduction of Let-7 Target Sites does not Attenuate Oncolytic Effects of Recombinant Adenovirus on HCC Cells in vivo. [score:2]
In normal stem cells, let-7 can negatively regulate “stemness” by repressing self-renewal and promoting differentiation [21]. [score:2]
Moreover, ten HCC tissues (10/33, 30.3%) even had deregulated let-7 which was more than 5 folds lower relative to their corresponding normal liver tissues. [score:2]
These results indicated that the negative regulation of cellular let-7 on E1A may through mRNA destruction. [score:2]
Viral replication was detected to evaluate the capacity of let-7 target sites in regulating the adenoviral replication in HCC cells and normal liver cells. [score:2]
It has been well documented that members of let-7 family play important roles in both normal development and tumorigenesis [41]. [score:2]
This result was consistent with the finding from recent work via deep-sequencing, showing that the abundance of several members of let-7 family were among the top 10 most abundantly expressed miRNAs in normal livers and the abundance of let-7 remarkably decreased (>10 folds) in a considerable proportion of HCC tissues as compared with matched normal liver tissues. [score:2]
More interestingly, it has been demonstrated that let-7 is markedly reduced in breast tumor initiator cells, regulating their self-renewal and tumorigenicity [42]. [score:2]
The let-7 miRNA is one of the first known microRNAs, originally discovered in the nematode Caenorhabditis elegans, where it regulates cell proliferation and differentiation [6]. [score:2]
Conversely, increasing evidence has revealed that let-7 is deregulated in various cancer cells, such as colorectal cancer [8], lung cancer [9], colon cancer [10], ovarian cancer [11], breast cancer [12], gastric cancer [13], malignant melanoma [14], Burkitt lymphoma [15], and acute lymphoblastic leukemia [16]. [score:2]
Correlation between relative let-7 expression and clinicopathologic parameters was evaluated by using Pearson's chi-square test. [score:1]
Furthermore, since the constitute of HCC tissue is highly heterogeneous, it is unclear if the lower levels of let-7 in HCC tissue vs. [score:1]
n = 3. of Let-7 Target Sites does not Attenuate Oncolytic Effects of Recombinant Adenovirus on HCC Cells in vivo The antitumor efficacy of SG7011 [let7T] as a monotherapy was evaluated in two kinds of s. c. xenograft HCC tumor mo del (i. e. Hep3B and SMMC-7721). [score:1]
In Hep3B xenografts mo del, a tumor mo del with low level of let-7, significant antitumor efficacy was observed. [score:1]
However, like other miRNA replacement or antagonizing therapies, it remains a challenge to effectively deliver the let-7 into cancer cells in vivo [23]. [score:1]
These results suggested that the test virus SG7011 [let7T] could efficiently lyse tumor cells with lower level of let-7, leaving normal liver cells with higher level of let-7 spared. [score:1]
The expression of let-7 family was measured by miScript SYBR Green PCR Kit (Qiagen, Valencia, CA) according to the manufacturers' protocol and normalized to U6 levels. [score:1]
Expression of let-7a, a member of let-7 family, in 33 primary HCC tissues was measured by SYBR Green. [score:1]
Since let-7 has been documented to mediate mRNA deadenylation via binding on its imperfectly complementary target sites [40], we next measured the amount of E1A mRNA in SG7011 [let7T]-, SG7011 [let7MT]- and WAd5-infected cells by quantitative RT-PCR. [score:1]
As shown above, both mRNA and protein of the E1A was tightly regulated according to cellular let-7. Consequently, the replication of the engineered virus was decreased more than 300-fold compared to the control virus in normal liver cells, whereas the proliferation rate between the engineered virus and the control virus was similar in HCC cells. [score:1]
To date, however, the underlying mechanism for the repression of let-7 in HCC remains unknown. [score:1]
Conversely, in the SMMC-7721 xenografts mo dels, a tumor mo del containing let-7 at a level corresponding to normal hepatocytes, almost no antitumor effect was displayed in the SG7011 [let7T] treatment. [score:1]
[1 to 20 of 55 sentences]
6
[+] score: 186
In fact, the protein expression levels of LIN28B were upregulated by the existence of HBV preS2 transcript, which were antagonized by the forced expression of let-7 g. Although let-7 g is one of the twelve let-7 family members 30, because LIN28B blocks the maturation of all let-7 family members 34 35, the increased LIN28B expression may lead to repression of all miRNAs in the let-7 family, leading to a concomitant increase of let-7 targets. [score:12]
In addition, when HBV products expressed from the cellular genome were suppressed by adding tetracycline after culturing the cells without tetracycline, HBV preS2 protein, although its expression was lower to begin with due to let-7 g overexpression, was decreased more rapidly in let-7 g -overexpressing Hep38.7 cells than in control Hep38.7 cells. [score:11]
These results support the in vitro results that HBV transcripts may suppress let-7 function and, in those cases, let-7 target protein expression is upregulated. [score:10]
The inhibitory effects on cccDNA production by let-7 g may be due to the decreased large S protein, direct effects of let-7 on cccDNA production, or indirect effects via let-7 g function on expression level changes of its target host genes. [score:9]
As expected, the protein expression levels of HMGA2, LIN28B, and c-myc, which are let-7 g targets, were increased in Large S–S -expressing cells (Fig. 2d). [score:7]
Expression of Large S–S (pCDH-Large S–S) reversed such suppression by inhibiting let-7 g function (left), but not in case of miR103 (right). [score:7]
Forced stable expression of let-7 g in Large S–S -expressing Huh7 cells canceled the effects of Large S–S expression. [score:7]
As shown in Fig. 4c, the cccDNA levels were lower in let-7 g -overexpressing cells than in control Hep38.7-tet cells in cultures without tetracycline (Fig. 4c), suggesting that let-7 g has, albeit slightly, suppressive effects on the HBV cccDNA levels. [score:5]
The details of the effects on cccDNA by let-7 g expression or targeting the corresponding sequences need to be further determined. [score:5]
In these cells, let-7 g -overexpressing Hep38.7 cells expressed lower levels of HBV preS2 protein after long-term culture without tetracycline (Fig. 4a). [score:5]
Additionally, to introduce mutations into the seed region putatively targeted by let-7, another mutagenesis was performed to introduce mutations (ACACUCCA to TCTCUCCA) into pCDH-large S–S, constructing pCDH-large S-SM. [score:5]
When examining the effects of forced expression of miRNAs, 0.4 μg Let-7 g or miR103 precursor -expressing plasmids (pCDH-let-7 g or pCDH-miR103) were transfected simultaneously. [score:5]
However, when using let-7 g reporter and precursor constructs, simultaneous expression of the Large S–S construct significantly suppressed the let-7 g function, and luciferase values were recovered (Fig. 2b). [score:5]
Additionally, to examine the expression levels of LIN28B, a let-7 target gene, in liver tissues derived from patients with HBV infection, immunohistochemistry was performed using HCC and the surrounding tissues from HBV-infected and -uninfected cases. [score:5]
These effects were not observed when expressing the Large S-SM construct, which has mutations in the complementary regions of the let-7 g seed sequences, suggesting that the effects were let-7 g-specific. [score:4]
To establish large S mRNA -expressing transgenic mice with and without mutations in the let-7 g-specific seed sequences, a DNA fragment of 2,535 bp, containing the CMV promoter region, the coding region of the large S mRNA, and a transcriptional terminator, was excised from the pcDNA3.1-Large S–S or pCDNA3.1-Large S-SM plasmids and subcloned into the EcoRI sites of pCDH-large S–S and pCDH-large S-SM by the In-Fusion method, as described above, by digestion with NruI and DraIII. [score:4]
Let-7 g overexpression suppressed preS2 protein levels. [score:4]
The values of the sample without let-7 g overexpression were set as 1. Data represent the means ± s. d. of three independent experiments. [score:3]
The suppression of miRNA function by the Large S–S construct was not observed when using the miR103 reporter or precursor constructs (Fig. 2b), again suggesting specificity to let-7 g function. [score:3]
Figure 4b, suggesting that cellular let-7 g has suppressive effects on HBV protein levels. [score:3]
Based on the results in this study, supplementation of let-7 g into infected hepatocytes may be beneficial to both the prevention of tumorigenesis and the inhibition of viral envelop protein production. [score:3]
While the role of Large S protein in cccDNA amplification is still controversial 27 28, we examined the levels of cccDNA by Southern blotting with and without let-7 g overexpression in Hep38.7-tet cells. [score:3]
The firefly luciferase -based reporter carrying let-7 g- and miR103-responsive elements in its 3′ untranslated region, to examine corresponding miRNA function (pGL4-let-7 g and pGL4-miR103), and the internal control renilla luciferase -based plasmids (pGL4-TK) have been described previously 47. [score:3]
However, the let-7 g levels in RISC were reduced by ~50% when using the cells stably expressing the let-7 g precursor construct and Large S–S. [score:3]
Therefore, suppression of intrinsic function of even only let-7 g by preS2 transcript may be one of the causative factors for long-term hepatocarcinogenesis during chronic HBV infection. [score:3]
Let-7 g and miR103 precursor -expressing plasmids were constructed previously 48 49. [score:3]
Simultaneously, on the part of the effects of miRNA to the virus, let-7 g overexpression decreases the HBV preS2 protein levels and possibly HBV cccDNA levels. [score:3]
HBV preS2 mRNA inhibits let-7 g function. [score:3]
Let-7 is a well-regarded tumor-suppressive miRNA 30. [score:3]
Two bases corresponding to the let-7 g seed sequences in the Large S transcript -expressing construct were mutated (Large S-SM). [score:3]
In this study, we describe that sequences in HBV preS2 region can be targeted by cellular let-7 g, resulting in the impaired function of this miRNA through the decreased intrinsic recruitment of the miRNA into Ago2-related complexes. [score:3]
These sequences are targeted by let-7 g, with complementarity at positions 1–13 from the miRNA 5′-end, including the seed region, and 83% complementarity of the entire miRNA sequence (Fig. 1a). [score:3]
These effects were not observed when using the cells stably expressing the let-7 g precursor construct and Large S-SM, suggesting that the Large S transcripts sequestered let-7 g from RISC through their interactions and reduced let-7 g intrinsic function. [score:3]
Potential let-7 g -targeting sequences, shown in red, are from nucleotides 99 to 120, and the nucleotides differing from the sequences used in this study are shown in black. [score:3]
From this point, let-7 g indeed inhibited preS2 protein levels in the HBV product-inducible system both stably and after shutting off the transcription of the viral products. [score:3]
In summary, we have shown that HBV preS2 transcript can be targeted by host cellular let-7 g, which may mutually anatagonize the intrinsic let-7 g function and HBV replication. [score:3]
HBV preS2 mRNA can be targeted by let-7.. [score:3]
HBV preS2 mRNA interacts with cellular microRNA let-7 g. HBV large S mRNA suppress let-7 g function. [score:3]
Let-7 g decreases HBV preS2 protein expression. [score:2]
To visualize the results more easily by enhancing the basal effects, let-7 g precursor -expressing cells were used for this assay. [score:2]
In addition, a construct with mutations in the preS2 sequences that disrupts the complementarity to the seed sequences of let-7 g was generated from the Large S–S construct (named as “Large S-SM”) (Fig. 1e). [score:2]
How to cite this article: Takata, A. et al. Mutual antagonism between hepatitis B viral mRNA and host microRNA let-7. Sci. [score:1]
Although the precipitated Ago2 protein levels were almost unchanged, let-7 g levels in RISC were approximately 20-fold higher than those in the control cells stably transfected with a control vector (Fig. 2e). [score:1]
It may be important to determine which genes are indeed affected by the impaired host miRNA by the existence of HBV transcripts during the steps of chronic hepatitis and to determine the most appropriate timing for the supplementation of let-7 g into hepatocytes, to overcome the pathogenesis induced by the existence of HBV transcripts in hepatocytes. [score:1]
We identified that the sequences in the HBV preS2 RNA can sequester let-7 g, which, in turn, impairs the intrinsic let-7 g function. [score:1]
Data are shown after normalizing the let-7 g levels to miR103 levels in the Ago2 -associated complexes. [score:1]
Through these in silico selections, the highest probabilities were attributed to the HBV preS2 sequences and let-7 g. Representative HBV genotypes A, B, C, and D were selected by referring to a previous study 10, and their sequences were extracted from the HBV sequence database, Hepatitis Virus Database (http://s2as02. [score:1]
Positions of the let-7 g seed sequences are also indicated. [score:1]
[1 to 20 of 48 sentences]
7
[+] score: 167
To express Krox20 and to start myelination, SCs need to shift their balance of negative to positive regulators of myelination 4. We hypothesized that let-7 isoforms might promote this shift by downregulating negative regulators of myelination. [score:8]
These combined results concord with our in vivo observations, and suggest that let-7 isoforms positively affect Krox20 expression by downregulating Notch1 expression. [score:8]
We conclude that let-7 isoforms promote Krox20 expression at least partly via targeting the Notch1 3′-UTR and suppression of Notch signalling in SCs (Fig. 5n). [score:7]
Nrg1 -induced Krox20 expression was decreased both in Lin28B and let-7 TuD -transfected cells (Fig. 3k) suggesting that Lin28B -dependent let-7 expression can affect Nrg1 -induced Krox20 expression. [score:7]
In addition, analysis of developmental expression of Hmga2, a well-described let-7 target, revealed a prominent decline upon let-7 induction in SN (Fig. 1e). [score:6]
Our studies revealed that targeting and downregulation of Notch signalling by let-7 contributes to the onset of myelination, based on the fact that Notch1 is known to prevent the timely onset of myelination by opposing Krox20 activation. [score:6]
The decline in Lin28B levels and concomitant induction of let-7 accumulation are in agreement with findings in other cellular systems showing that let-7 miRNAs are associated with more differentiated states, while Lin28 supports the maintenance of undifferentiated states 3. Lin28B is itself a target of let-7 and this may partially explain the reduction of Lin28B expression during early SC development. [score:6]
Supplementary Data 1. Let-7 miRNAs are highly expressed during myelination and inversely correlated to Lin28B expression. [score:5]
Through targeting and reducing Notch signalling, let-7 miRNAs inhibit a central pathway opposing myelination. [score:5]
We transfected primary SCs with Lin28B or with let-7 targeting tough decoy expression vectors (let-7 TuD) prior to a 1 h Nrg1-stimulation 18 19. [score:5]
Notch1 suppression by let-7 promotes myelination through Krox20 expression. [score:5]
Given the defects observed in response to sustained Lin28B overexpression, we asked if loss of let-7 miRNAs is the principal reason for the impaired myelination onset by targeting let-7 activity in myelinating ex vivo dorsal root ganglion cultures (DRG explants) using antagomirs 13. [score:5]
Furthermore, LY411575 treatment prevented the decrease of Krox20 expression in primary SCs expressing let-7-TuD (Fig. 5d). [score:5]
Our data indicate that these mechanisms involve the loss of let-7 isoforms and the consequent ectopic expression of their targets. [score:5]
A MetaCore pathway analysis of transcripts that were upregulated in both mutants and carrying predicted let-7 sites in their 3′-UTRs, identified Notch signalling as the most-affected pathway. [score:4]
Next, as a broad readout of let-7 function, we analysed differential expression of predicted let-7 targets in postnatal day (PN) 1 SN of mice lacking Dicer in SCs (Dicer KO) compared with control mice, using RNA sequencing. [score:4]
Likewise, functions of the Lin28/let-7 regulatory axis during remyelination, after injury 31 or in demyelinating diseases, also merit further investigations, particularly in the prospect of exploring novel therapeutic approaches for demyelinating diseases. [score:4]
Given the involvement of Notch signalling in many other aspects of metazoan development and disease, these findings warrant further studies of the relationship between Notch signalling and the antagonizing role of let-7 in other systems. [score:4]
We conclude that sustained Lin28B expression leads to impaired onset of PNS myelination, pointing to a crucial regulatory role of the Lin28B/let-7 pathway in this process. [score:4]
Myelination and appropriate Krox20 expression require let-7. The Notch pathway is hyperactive in Lin28 tg and Dicer KO. [score:3]
Expression analysis confirmed that let-7 isoforms are strongly reduced in SN of these mice (Fig. 2d). [score:3]
In vivo, we sought to rescue the myelination deficits in Lin28 tg using the validated let-7S21L chimera that bypasses Lin28 binding and thus allows let-7 maturation despite Lin28 expression 14. [score:3]
For expression of let-7-TuD, the let-7f-TuD-forward and let-7f-TuD-reverse DNA oligonucleotides (Supplementary Table 1) were annealed and cloned into pSicoR-Δ3'-loxP (modified version of pSicoR with deleted 3'-loxP site). [score:3]
Taken together, our data demonstrate that the let-7 family is functionally enriched during PNS myelination and suggest that the decline of Lin28B expression before myelination might be causal in this context. [score:3]
Since Lin28B repression is necessary to enable let-7 biogenesis, we propose a mo del in which Lin28B repression and concomitant let-7 induction drives myelination through inhibition of the Notch pathway. [score:3]
To address if this regulation occurs directly through let-7 binding, we searched for predicted let-7 seed matches in the Notch1 3′-UTR. [score:3]
We found globally increased levels of let-7 targets in Dicer KO (Fig. 1d). [score:3]
Consequently, predicted let-7 targets were globally increased in Lin28 tg (Fig. 2e; Supplementary Fig. 1c,e), comparable to the observations in Dicer KO (Fig. 1d). [score:3]
To test if Lin28B repression and subsequently increased let-7 biogenesis is functionally required for PNS myelination, we employed conditionally inducible transgenic Lin28B mice 11 and crossed them with Dhh-Cre mice 12 to obtain animals with sustained SC-specific expression of Lin28B (Lin28 tg). [score:3]
To examine if Notch1 levels are dependent on let-7, we analysed Notch1 expression in differentiated cells of the SC precursor line SpL201, 48 h after transfection with Lin28 or treatment with anti-let-7 antagomirs. [score:3]
We found that several members of the let-7 family are particularly strongly expressed in SCs during myelination (Fig. 1a,b; Supplementary Fig. 1a,b). [score:3]
Lin28B -dependent let-7 miRNAs are necessary for myelination and appropriate Krox20 expression. [score:3]
let-7 promotes Krox20 and myelination via Notch1 suppression. [score:3]
Since Krox20 was strongly reduced in Lin28 tg and Dicer KO, we investigated the role of Lin28B and let-7 in the regulation of neuregulin 1 (Nrg1) -dependent Krox20 expression. [score:2]
These results identify let-7 as a critical regulator of the Notch pathway during myelination. [score:2]
Furthermore, we have shown that let-7 miRNAs are necessary for myelination in DRG explants and that myelination deficits in Lin28 tg can be improved by Lin28-resistant let-7. Nevertheless, we do not exclude a contribution of let-7-independent functions of Lin28B in its role as a negative regulator of myelination. [score:2]
First, we identified let-7 isoforms as a major class of regulatory miRNAs that promote PNS myelination. [score:2]
To biochemically validate these seed matches as bona fide let-7 target sites, the Notch1 3′-UTR was cloned into a luciferase reporter construct and luciferase activity was assayed in the presence or absence of let-7 mimics after transfection of primary SCs. [score:2]
Taken together, these results indicate that Lin28B-regulated let-7 isoforms are required for myelination. [score:2]
Analysis at earlier developmental time points revealed that let-7 isoforms are induced prior to myelination onset, and that their levels are inversely correlated to those of Lin28B (Fig. 1c). [score:2]
Our expression analysis revealed, however, several miRNA species besides let-7 isoforms that are abundant at different stages and thus provides a valuable resource for future studies aimed at the investigation of additional physiological miRNA functions in myelin biology. [score:1]
Strongly diminished myelination was found in such anti-let-7 -treated cultures (Fig. 3a–g) and similarly observed with DRG explants derived from Lin28 tg cultured under myelination-competent conditions (Supplementary Fig. 4a–i). [score:1]
In our studies, we have discovered a physiologically critical function of the Lin28/let-7 pathway during terminal cell differentiation. [score:1]
Supplementary Figures 1–5 and Supplementary Table 1 Predicted interactions of let-7 with the Notch1 3'-UTR using RNAhybrid. [score:1]
How to cite this article: Gökbuget, D. et al. The Lin28/let-7 axis is critical for myelination in the peripheral nervous system. [score:1]
let-7 and Lin28B levels are anticorrelated upon myelination. [score:1]
In ESCs, Lin28 is part of the Sox2-Nanog-Oct4-Tcf3 network, which maintains ESCs in their pluripotent state while priming them for rapid let-7 -mediated differentiation 25. [score:1]
Furthermore, Lin28B opposes signals promoting myelination by negatively affecting let-7 -mediated Notch pathway repression. [score:1]
[1 to 20 of 48 sentences]
8
[+] score: 166
Our data showed that up-regulation of Let-7 in thymic B progenitors normally suppresses B-1a fetal type B cell production by suppression of Arid3a expression, specifically by suppressing proliferation of B progenitors and promoting the differentiation from pre-B II cells to IgM [+] immature B cells in the Foxn1 [lacz] mutant thymus. [score:11]
We also showed that Lin28 is down regulated with normal timing after day 14 in both controls and Z/Z mutants, but that Let-7 was not properly up-regulated at this time in the Z/Z mutants (Fig 2B), indicating that Let-7 up-regulation is controlled by additional mechanisms other than down-regulation of Lin28. [score:10]
Specifically, we provide evidence that Let-7 up-regulation in the thymic B progenitors normally limits the generation of thymic B cells through the inhibition of Arid3a, and that this up-regulation requires FOXN1 -dependent signals from the thymic epithelium. [score:8]
Taken together, our data show that the thymic microenvironment, especially MHCII [hi] mTECs, provides necessary signals to up-regulate Let-7 in the fetal type B progenitors in the neonatal thymus, thus controlling the development of thymic B progenitors specifically in the perinatal period, via down-regulation of Arid3a. [score:7]
The signals required for up-regulation of Let-7 in hematopoietic progenitors were reduced in Foxn1 [lacZ] mutant TECsDown regulation of Lin28b is necessary for Let-7g up-regulation in adult HSCs [22, 23]. [score:7]
Indeed, our data show that the same signals from mTECs, VD3, RA, and IL15, were required for Let-7 up-regulation and Arid3a down-regulation in thymic B progenitors as well. [score:6]
Impaired up-regulation of Let-7 in thymic B progenitors was due to the deficient microenvironment in the Foxn1 [lacZ] mutant thymusTo test whether replacing these microenvironment-derived signals is sufficient to up-regulate Let-7, we sorted the major thymic B progenitor population (CD19 [+]B220 [+]CD24 [+]CD43 [+/lo]IgM [-]) from Foxn1 [lacZ] mutant thymus, and then co-cultured with Cyp27b1, Aldh1a2 and IL15 individually or in combination in vitro. [score:6]
After adult-type HSCs seed the thymus, TECs down-regulate the signals that promote Let-7 expression, resulting in their decline in intrathymic B progenitors. [score:5]
These results indicate that by controlling up-regulation of Let-7, the thymic microenvironment plays an important role not only specifically for B lineage fate, development, and differentiation but also more broadly for regulating the neonatal to the adult transition of lymphoid progenitors in the thymus. [score:5]
In this study, we show that signals from TECs in the thymic microenvironment regulate the Lin28/Let-7 axis, thus suppressing Arid3a expression within hematopoietic-derived cells to control B cell differentiation. [score:5]
To test whether the failure to up-regulate Let-7 in TSPs in the Foxn1 [lacz] mutant thymus would be sufficient to cause these thymic B cell phenotypes, we generated HSC-specific Lin28a overexpression by crossing the iLin28a transgenic mice [19] with Vav-iCre [20]. [score:5]
Overexpression of Lin28a in HSCs by this approach has been shown to prevent up-regulation of Let-7 and block the transition from fetal to adult HSC, reprogramming adult HSCs to a persistent fetal HSC phenotype [5, 10]. [score:5]
0193188.g006 Fig 6The effects of Let-7 up-regulation signals on the development of thymic B progenitors. [score:4]
The effects of Let-7 up-regulation signals on the development of thymic B progenitors. [score:4]
Consistent with these data, Arid3a expression (which is normally suppressed by Let-7) was increased, peaking at day 28 in Z/Z B progenitors at 3.4-fold higher than in controls (Fig 1F). [score:4]
Ectopic expression of Lin28b in adult BM or Let-7 in FL precursors is sufficient to switch these precursors to a reversed developmental pathway in B cell development [5, 11]. [score:4]
Thus, we hypothesize that the thymic microenvironment might also regulate Let-7 expression in thymic B cells to control their development, in particular during the B cell precursor switch from fetal to adult type in the thymus during the neonatal to young adult transition. [score:4]
This decline in Let-7 expression also coincides with declines in all three TEC-derived factors that promote their expression (Fig 4G–4I), which likely explains this decline. [score:4]
These results indicate that reduction of Let-7 in HSCs is sufficient to cause a higher potential for thymic B production, consistent with our conclusion that failure to up-regulate Let-7 and the subsequent increase of Arid3a are critical factors causing thymic progenitor B cell development in the Foxn1 [lacz] mutant thymus. [score:4]
0193188.g004 Fig 4The signals required for up-regulation of Let-7 in hematopoietic progenitors were reduced from TECs in Foxn1 [lacZ] mutant. [score:3]
The signals required for up-regulation of Let-7 in hematopoietic progenitors were reduced in Foxn1 [lacZ] mutant TECs. [score:3]
Thus, the deficiency of these signals prevented up-regulation of Let-7, and consequently increased the level of Arid3a in thymic B progenitors in the Foxn1 [lacz] thymus. [score:3]
These results indicated that the VD3 signaling pathway was the critical factor for up-regulation of Let-7 in thymic B cells and that IL15 and RA had a synergistic effect with VD3. [score:3]
Impaired up-regulation of Let-7 in thymic B progenitors was due to the deficient microenvironment in the Foxn1 [lacZ] mutant thymus. [score:3]
Given the broad regulatory effects of Lin28/Let-7, and the role of thymic B cells in central tolerance, our findings have potential implications for improving the transplantation of umbilical cord blood cells or adult BM cells, autoimmune disease, and for understanding the contributions of microenvironmental signals in cancer formation due to the disorder of Lin28/Let-7 axis [40]. [score:3]
The signals required for up-regulation of Let-7 in hematopoietic progenitors were reduced from TECs in Foxn1 [lacZ] mutant. [score:3]
To test whether replacing these microenvironment-derived signals is sufficient to up-regulate Let-7, we sorted the major thymic B progenitor population (CD19 [+]B220 [+]CD24 [+]CD43 [+/lo]IgM [-]) from Foxn1 [lacZ] mutant thymus, and then co-cultured with Cyp27b1, Aldh1a2 and IL15 individually or in combination in vitro. [score:3]
Up-regulation of Let-7 in thymic NKT cells has been shown to require IL15, 1α,25-dihydroxy vitamin D3 (VD3) and all-trans retinoic acid (RA) signals provided by mTECs [14]. [score:3]
As Let-7 levels do not go all the way down to their neonatal baseline, it is possible that the low level of Let-7 that remains is sufficient to repress Arid3a expression. [score:2]
We transferred T, B deleted BM cells from 9-week-old iLin28a;Vav-iCre mice (well after the age when B cell potential has declined) into lethally irradiated 8-week-old Foxn1 [lacz] mutant and control mice to see if enforced suppression of Let-7 would be sufficient to maintain a high B potential in TSPs in the thymus. [score:2]
Consistent with this reduction in Let-7, Arid3a expression was significantly increased in both BM and thymic B progenitors (Fig 3D). [score:2]
These data showed that the differentiation of NKT cells from immature (S1+S2) to mature stage was blocked in Foxn1 [lacz] mutant thymus, consistent with previous reports [14, 32] that down regulation of the Let-7 regulatory signals in TECs caused a dramatic decrease in NKT thymocytes by blocking terminal maturation of NKT in the thymus. [score:2]
Specific overexpression of Lin28a in HSCs caused a reduction of Let-7 and promoted thymic B cells production. [score:2]
Suppression of Let-7 activity in HSCs promoted the production of thymic B cells in the Z/Z mutant thymus. [score:2]
Since all of these signaling pathways can also affect B cell differentiation [24– 31], we considered that these signaling pathways might also regulate Let-7 expression in thymic B progenitors. [score:2]
To test if the Lin28b/Let-7 system and Arid3a expression were changed in these thymic B progenitors in Foxn1 [lacZ] mutants, we sorted the major thymic progenitor B populations (CD19 [+]B220 [+] CD24 [+/hi] CD43 [+/lo]IgM [-]) from both +/Z and Z/Z thymus (Fig 1B) and measured these genes’ expression over this time period by Q-PCR. [score:2]
0193188.g003 Fig 3Specific overexpression of Lin28a in HSCs caused a reduction of Let-7 and promoted thymic B cells production. [score:2]
Conversely, Let-7 is highly expressed in adult BM but is very low in FL precursors [5, 10]. [score:2]
Thus, Arid3a is a key transcription factor regulated by the Lin28b-Let-7 system that controls the B cell developmental switch between fetal and adult-type [11]. [score:2]
However, this high level of Let-7 is not required to suppress thymic B cell production from adult-type BM derived TSPs. [score:2]
Interestingly, we noticed that expression of Let-7 dropped quickly after day 28 (Fig 1D and 1E), consistent with dynamic reduction of NKT and thymic B cells at this time period (Fig 5C and 5D), and with the known timing of HSCs switching from fetal to adult type, which is completed by postnatal 4 weeks [3– 5]. [score:2]
The question remains, why is Arid3a down regulated at this time, when Let-7 levels are also declining? [score:1]
In addition, Let-7 in hematopoietic cells regulates the differentiation of NKT cells in the thymus. [score:1]
Recent work demonstrated that Let-7 in hematopoietic cells regulates the terminal differentiation of NKT cells in the thymus, and is critically mediated by signals derived from the thymic microenvironment [14]. [score:1]
In addition, the repressive effect of a relative high level of Let-7 seems only essential for the thymocyte development during neonatal to young adult when the TSPs posses a high B lineage potential. [score:1]
The Lin28b/Let-7 microRNA (miRNA) system plays a critical role in the distinct differentiation potential of fetal and adult derived HSCs in both mice and humans [5, 10]. [score:1]
[1 to 20 of 46 sentences]
9
[+] score: 154
Downregulated expressions of both GSK3β [P] and β-catenin were detected in differentiated EBs and the expressions were recovered when LNA-antiLet-7e (DIF-Let-7e) was added. [score:7]
As presented in Fig. 1D, miRNA let-7e expression in treated EBs was dramatically upregulated on day 8 relative to non treated EBs. [score:6]
A close relationship between PKCβ protein expression and miRNA let-7e has been detected in our work, thus miRNA let-7e is an upstream regulator of the PKCβ protein expression. [score:6]
The expression levels of the miRNA let-7 family members were significantly upregulated; [>1.5] fold difference for the eight members (let-7e,let-7i,let-7a,let-7d,let-7g,let-7c,let-7b,let-7f) in treated EBs with respect the non treated EBs (Fig. 1C, Table 1). [score:6]
In addition miRNA let-7e is an upstream regulator of PKCβ since Western blot analysis of PKCβ, revealed a decrease in the expression in differentiated EBs and an increase when miRNA let-7e was silenced (Fig. 2C) indicating the inhibitory influence of miRNA let-7e on PKCβ levels. [score:6]
miRNA let-7e Overexpression is Involved in EBs Expression of Early Nephrogenic Markers. [score:5]
C) PKCβ levels evaluated by Western blot analysis show a downregulated expression in differentiated EBs (DIF) and a recovery of the expression in silenced EBs (DIF-Let-7e). [score:5]
Our results show an increased expression of GSK3β serine phosphorylation and β-catenin, concomitant with a decrease in the expression of differentiation markers when let-7e is silenced. [score:5]
Inhibition of PKCβ in the differentiated EBs (DIF-Let-7e+PKCβi) provokes a downregulation again. [score:5]
Embryoid bodies (EBs) cultured with a combination of ATRA and activin A express markers of intermediate mesoderm and metanephric mesenchyme and overexpresses the miRNA let-7e. [score:5]
Here we show that let-7e is involved in the expression of early nephrogenic markers in mESCs, since let-7e miRNA silencing reduced the expression of Pax2, WT-1 and Wnt4, thus indicating the role of let-7e in differentiation. [score:5]
miRNA let-7e silencing (DIF-Let-7e) and BIO (DIF+BIO) provokes a downregulation of the genes Pax2, Wnt4 and WT1. [score:4]
Inhibition of PKCβ (DIF-Let-7e+PKCβi) provokes a recovery in the expression of these genes. [score:4]
The most upregulated miRNA with a [>9] fold difference was the miRNA let-7e. [score:4]
DIF and normalized to U6 snRNA; B) RT-PCR of WT1, Pax2 and Wnt4 show that miRNA let-7e silencing provokes a downregulation of these genes. [score:4]
Addition of a PKCβ inhibitor to the miRNA let-7e silenced group reversed the increase in GSK3β [P] and β-catenin, thus indicating the direct relationship between PKCβ, GSK3β [P] and β-catenin levels. [score:4]
In addition, since PKCβ is an inductor of GSK3β phosphorylation (GSK3β [P)], we hypothesized that miRNA let-7e could inhibit the formation of PKCβ protein that in turn decreases serine phosphorylation and the negative regulation of GSK3β activity, destabilizing β-catenin during the differentiation process in mESCs. [score:4]
0060937.g004 Figure 4 Inhibition of PKCβ (DIF-Let-7e+PKCβi) provokes a recovery in the expression of these genes. [score:4]
Groups: differentiated EBs+control antimiR (DIF), Non treated EBs (CONTROL), differentiated EBs+LNA-antiLet-7e (DIF-Let-7e), differentiated EBs+LNA-antiLet-7e and PKCβ inhibitor (Gö 6983) (DIF-Let-7e+PKCβi). [score:3]
To confirm the results of the microRNA microarray, we examined expression levels of let-7e miRNA in treated and non treated EBs by northern blot analysis and additionally by real-time PCR. [score:3]
Conversely, miRNA let-7e silencing induces an increase in the expression of GSK3β [P] and β-catenin, indicating the relation between miRNA let-7e and Wnt pathway (Fig. 3). [score:3]
miRNA let-7e Inhibitory Effect on PKCβ Prevents Phosphorylation of GSK3β and β-catenin Formation. [score:3]
miRNA let-7e silencing decreased the expression of these differentiation markers. [score:3]
org database as one potential target gene of the miRNA let-7e reinforce our findings. [score:3]
Among the miRNAs overexpressed, we found let-7e, let-7i, let-7a, let-7d, let-7g, let-7c, let-7b and let-7f. [score:3]
Therefore indicates that let-7e acts in differentiation as an inhibitor of β-catenin through the reduction of the inactive form of GSK3β. [score:3]
Efficient silencing of miRNA let-7e was observed since expression levels of miRNA let-7e decreased significantly after silencing (Fig. 2A). [score:3]
Groups: differentiated EBs+control antimiR (DIF), Non treated EBs (CONTROL), differentiated EBs+LNA-antiLet-7e (DIF-Let-7e), differentiated EBs+LNA-antiLet-7e and PKCβ inhibitor (Gö 6983) (DIF-Let-7e+PKCβi), differentiated EBs+BIO (DIF+BIO). [score:3]
Some of these miRNAs, as is the case of the miRNA let-7 family, regulate cell proliferation and differentiation during development in different species [20]. [score:3]
When miRNA let-7e was silenced, mRNA expression of the differentiation markers WT1, Pax2, Wnt4 were significantly decreased on day 10 (Fig. 2B), thus indicating the role of miRNA let-7e in EBs differentiation. [score:3]
Addition of a PKCβ inhibitor to the miRNA let-7e silenced group reversed the decrease in differentiation markers provoked previously by let-7e silencing (Fig. 4). [score:3]
miRNA let-7e silencing reduces the expression of the differentiation markers WT1, Pax2, Wnt4 and increases the protein levels of PKCβ. [score:3]
In summary, our results indicate that miRNA let-7e is critically involved in the expression of early nephrogenic markers during EBs differentiation and the concomitant reduction of β-catenin production. [score:3]
The inhibitory effect of miRNA let-7e on GSK3β serine phosphorylation through PKCβ could explain these effects. [score:3]
ATRA and Activin A Treatment Differentiates EBs and Promote the Expression of Early Nephrogenic Markers and miRNA let-7e. [score:3]
We hypothesized that miRNA let-7e was determinant in stem cell differentiation and expression of early nephrogenic markers. [score:3]
Specifically, let-7e was detected in the adult kidney [21] and recent studies have started to investigate its role in renal cancer [a state of cell dedifferentiation], outlining that let-7e is downregulated and associated with metastasis and poor prognosis [22]. [score:2]
miRNA let-7 family was observed to regulate proliferation and differentiation of neural stem cells [23]. [score:2]
D) probed for the mature miRNA let-7e in EBs cultured for 8 days with ATRA and activin A (DIF) or without factors (CONTROL) confirmed the result of the microarray. [score:1]
Groups: Non treated EBs (CONTROL), differentiated EBs+control antimiR (DIF), differentiated EBs and miRNA let-7e silenced (DIF-Let-7e). [score:1]
C) miRNAs microarray in EBs cultured for 8 days with ATRA and activin A (DIF EBs) shows a positive fold difference >1.5 for all the family members of let-7 miRNAs tested (black columns), and in particular a (>9) fold difference for the miRNA let-7e (*) versus EBs cultured for 8 days without factors (CONTROL EBs). [score:1]
A) RT-PCR of the mature miRNA let-7e confirms that miRNA let-7e is silenced after the administration of antiLet-7e. [score:1]
Here we present our findings concerning the involvement of miRNA let-7e in stem cell differentiation via the modulation of GSK3β phosphorylation and β-catenin production. [score:1]
This work could well indicate that one potential interfering factor favoring the correct balance between Wnt signaling and β-catenin production is the miRNA let-7e. [score:1]
- Same as group II but let-7e silenced with LNA-antiLet-7e. [score:1]
[1 to 20 of 45 sentences]
10
[+] score: 150
Other miRNAs from this paper: mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-27b, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-181a-2, mmu-mir-182, mmu-mir-199a-1, mmu-mir-122, mmu-mir-143, mmu-mir-298, mmu-let-7d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-27a, mmu-mir-31, mmu-mir-98, mmu-mir-181a-1, mmu-mir-199a-2, mmu-mir-181b-1, mmu-mir-379, mmu-mir-181b-2, mmu-mir-449a, mmu-mir-451a, mmu-mir-466a, mmu-mir-486a, mmu-mir-671, mmu-mir-669a-1, mmu-mir-669b, mmu-mir-669a-2, mmu-mir-669a-3, mmu-mir-669c, mmu-mir-491, mmu-mir-700, mmu-mir-500, mmu-mir-18b, mmu-mir-466b-1, mmu-mir-466b-2, mmu-mir-466b-3, mmu-mir-466c-1, mmu-mir-466e, mmu-mir-466f-1, mmu-mir-466f-2, mmu-mir-466f-3, mmu-mir-466g, mmu-mir-466h, mmu-mir-466d, mmu-mir-466l, mmu-mir-669k, mmu-mir-669g, mmu-mir-669d, mmu-mir-466i, mmu-mir-669j, mmu-mir-669f, mmu-mir-669i, mmu-mir-669h, mmu-mir-466f-4, mmu-mir-466k, mmu-mir-466j, mmu-mir-669e, mmu-mir-669l, mmu-mir-669m-1, mmu-mir-669m-2, mmu-mir-669o, mmu-mir-669n, mmu-mir-466m, mmu-mir-669d-2, mmu-mir-466o, mmu-mir-669a-4, mmu-mir-669a-5, mmu-mir-466c-2, mmu-mir-669a-6, mmu-mir-466b-4, mmu-mir-669a-7, mmu-mir-466b-5, mmu-mir-669p-1, mmu-mir-669a-8, mmu-mir-466b-6, mmu-mir-669a-9, mmu-mir-466b-7, mmu-mir-669p-2, mmu-mir-669a-10, mmu-mir-669a-11, mmu-mir-669a-12, mmu-mir-466p, mmu-mir-466n, mmu-mir-486b, mmu-mir-466b-8, mmu-mir-466q, mmu-mir-145b, mmu-let-7j, mmu-mir-451b, mmu-let-7k, mmu-mir-126b, mmu-mir-466c-3
These data demonstrated that TCDD -mediated downregulation of mmu-let-7e expression may contribute towards upregulated expression of FasL and thus mmu-let-7e may regulate the expression of FasL. [score:14]
Mmu-let-7e sense target sequence:5′- AAAC TA GCGGCCGC TAGT AACTATACAACCTCCTACCTCA T-3′ Mmu-let-7e antisense target sequence:5′- CTAGA TGAGGTAGGAGGTTGTATAGTT ACTA GCGGCCGC TA GTTT-3 Mmu-let-7e scramble sense target sequence:5′- AAAC TA GCGGCCGC TAGT AACTATACAACCTCCGGTATCA T-3′ Mmu-let-7e scramble antisense target sequence:5′- CTAGA TGATACCGGAGGTTGTATAGTT ACTA GCGGCCGC TA GTTT-3′ pairs containing Pmel and Xba1 restriction sites (forward and reverse) of mouse FasL UTR region specific to mouse mmu-let-7e were generated by IDT DNA (IDT Inc). [score:9]
To understand TCDD-regulated expression of mmu-let-7e and its role in regulation of FasL expression, FasL UTR region containing normal mmu-let-7e complementary region or scramble FasL UTR region were cloned into pmiRGLO luciferase expression vector and the clones were designated as pmirGLO-FasL and pmirGLO-FasL-S respectively (as described in). [score:9]
Mmu-let-7e sense target sequence: 5′- AAAC TA GCGGCCGC TAGT AACTATACAACCTCCTACCTCA T-3′ Mmu-let-7e antisense target sequence: 5′- CTAGA TGAGGTAGGAGGTTGTATAGTT ACTA GCGGCCGC TA GTTT-3 Mmu-let-7e scramble sense target sequence: 5′- AAAC TA GCGGCCGC TAGT AACTATACAACCTCCGGTATCA T-3′ Mmu-let-7e scramble antisense target sequence: 5′- CTAGA TGATACCGGAGGTTGTATAGTT ACTA GCGGCCGC TA GTTT-3′ pairs containing Pmel and Xba1 restriction sites (forward and reverse) of mouse FasL UTR region specific to mouse mmu-let-7e were generated by IDT DNA (IDT Inc). [score:9]
In contrast, there was significant downregulation in the expression of luciferase in EL4 cells transfected with pmiR_GLO-FasL and mmu-let-7e following TCDD treatment (Fig 7B), whereas, in EL4-cells transfected with pmiR-GLO-FasL and anti-mmu-let-7e, there was significant increase in FasL expression in the presence of TCDD (Fig 7B). [score:8]
The details of some of miRs and 3′UTR of their target gene (mRNA targets) are described in Table 2. To understand the role of mmu-let-7e in regulation of FasL expression, EL4 cells (5×10 [6]) were transfected using Lipofectamine RNAMAX transfection kit from Invitrogen and following Reverse Transfection protocol of the company (Invitrogen). [score:8]
The data obtained from miR analysis and highly complementary sequence property of miR-23a and mmu-let-7e demonstrated that TCDD may regulate Fas/FasL expression via downregulating miRs (miR-23a and mmu-let-7e). [score:7]
TCDD -induced Downregulation of mmu-let-7e Affects FasL Expression. [score:6]
In this context, we analyzed miRs (miR-23a and mmu-let-7e) that were downregulated and are associated with Fas and FasL expression respectively. [score:6]
Similarly, there were at least 14 miRs (miR-31, -34a, -181c, -671, -700, -669, -500, -491, -466, -466c, -449a, -134a, mmu-let-7b, mmu-let-7c, and mmu-let-7e) that were downregulated (>1.5 fold) by TCDD in fetal thymi and these miRs have also been shown directly/indirectly to be associated with various types of cancer development. [score:6]
Upon transfection of EL4 cells with mmu-let-7e and treatment with TCDD, there was significant downregulation of FasL expression when compared to non -transfected EL-4 cells treated with TCDD (Fig 6B). [score:5]
EL4 cells not transfected (NONE) but treated with TCDD showed significantly downregulated expression of mmu-let-7e, when compared to vehicle -treated EL4 cells (Fig 6A). [score:5]
The expression of mmu-let-7e was determined in vehicle- or TCDD -treated cells by performing Real-Time PCR and expression of FasL was determined by performing Real-Time PCR and Western blotting. [score:5]
However, there was significantly higher expression of mmu-let-7e in EL4 cells that were transfected with mmu-let-7e and treated with vehicle or TCDD, while transfection with anti-mmu-let-7e led to down regulation of mmu-let-7e (Fig 6A). [score:4]
We also observed significant downregulation of several mmu-let-7 (mmu-let-7b, let-7c, and let-7e) miRs that possess highly complementary sequence with FasL 3′UTR (Table 2). [score:4]
Expression of luciferase in EL4 cells in the absence or presence of FasL UTR containing mmu-let-7e binding site post-vehicle or TCDD treatment. [score:3]
We also performed Western blotting to determine FasL expression at the protein level in EL4 cells not transfected or transfected with mmu-let-7e or anti-mmu-let-7e and treated with vehicle or TCDD. [score:3]
0045054.g006 Figure 6 A, EL4 cells, not transfected or transfected with mature mmu-let-7e and exposed to vehicle or TCDD, were analyzed for the expression of FasL by performing Real-Time PCR. [score:3]
EL4 cells were also transfected independently with Pre-miR miRNA precursors of mmu-let-7e (MI0000561; PM12855) and anti-miR miRNA inhibitors (scramble mmu-let-7e) (MI0000561; AM12855) and negative controls for both from Applied Biosystems (Applied Biosystems) or in combination with pmirGLO-FasL or pmirGLO-FasL-S plasmids. [score:3]
In panel B, FasL expression was determined by performing Real-Time PCR on cDNAs generated from EL4 cells not transfected or transfected with mmu-let-7e or anti-mmu-let-7e or negative control (-Ve) for mmu-let-7e and exposed to vehicle or TCDD. [score:3]
org and/or TargetScanMouse 5.1databases, highly complementary sequence of miR-23a with 3′-UTR region of Fas and highly complementary sequence of mmu-let-7e with FasL gene was observed (Table 2). [score:3]
Expression of FasL in EL4 cells in the presence or absence of mmu-let-7e and post-vehicle or TCDD treatment. [score:3]
Transfection with Mature mmu-let-7e and Determination of FasL Expression in the Absence or Presence of TCDD. [score:3]
Analysis of mmu-let-7e and FasL Expression. [score:3]
A, EL4 cells, not transfected or transfected with mature mmu-let-7e and exposed to vehicle or TCDD, were analyzed for the expression of FasL by performing Real-Time PCR. [score:3]
Panel C, FasL expression at the protein level in EL4 cells not transfected or transfected with mature mmu-let-7e or anti-mmu-let-7e and treated with vehicle or TCDD. [score:3]
To further understand the role of mmu-let-7e in FasL expression, we performed a series of in vitro assays. [score:2]
In contrast, EL4 cells transfected with anti-mmu-let7e and treated with TCDD showed marked upreglulation in the expression of FasL when compared to EL4 cells transfected with mmu-let-7e and treated with TCDD (Fig 6B). [score:2]
Upon analysis of highly complementary sequence of miR-23a and mmu-let-7e using microRNA. [score:1]
To this end, EL4 T cells, not transfected or 48 hrs post-transfection with mature mmu-let-7e or anti-mmu-let-7e, were cultured in the absence or presence of TCDD for 24 hrs. [score:1]
Both nucleotides of normal and scramble mmu-let-7e-specific FasL UTR regions contain Pmel and Xba1 restriction sites. [score:1]
Generation of Reporter Constructs Containing Mouse mmu-let-7e-specific Mouse FasL UTR Region. [score:1]
Mouse FasL-specific UTR region complementary to let-7e was cloned into pmirGLO vector and these were designated as pmirGLO-FasL or pmirGLO-FasL scramble (pmiRGLO-FasL S). [score:1]
In brief, total RNA from EL4 cells not transfected or transfected with mmu-let-7e or anti-let-7e and treated with vehicle or TCDD were isolated using RNeasy mini kit and following the protocol of the company (Qiagen, Valencia, CA). [score:1]
EL4 cells not transfetcted or transfected with pmirGLO-FasL or pmirGLO-FasL-S plasmids or transfected with mature mmu-let-7e or anti-mmu-let-7e were treated with vehicle or TCDD (100 nM/ml) for 24 hrs. [score:1]
Both oligonucleotides (2 µl of each oligonucleotide) of normal or scramble mouse FasL UTR (specific to mmu-let-7e) regions were annealed in the presence of oligo annealing buffer (46 µl) at 90°C for 3 minutes and 37°C for 15 minutes. [score:1]
[1 to 20 of 36 sentences]
11
[+] score: 150
Thus, we conclude that phenformin mediates its effects on GSC stemness via the upregulation of let-7 expression and downregulation of H19 that further increases let-7 bioavailability and ability to inhibit HMGA2 expression. [score:13]
Collectively, these results suggest that phenformin regulates both the expression and bioavailability of let-7 by upregulating its expression and downregulating H19 that acts as let-7 sponge. [score:12]
Using specific antagomiRs we demonstrated that inhibition of miR-124 and let-7 expression decreased some of the inhibitory effect of phenformin on GSC self-renewal, whereas inhibition of miR-137 expression did not have a significant effect (Figure 2B). [score:11]
In addition to the upregulation of let-7 expression, we found that phenformin also increased the bioavailability of let-7 by inhibiting the expression of H19 that acts as a let-7 sponge [43]. [score:10]
Moreover, we found that the effect of phenformin on GSCs was mediated by the downregulation of HMGA2 via the targeting of this gene by let-7. HMGA2 acts as an oncogene in a large number of tumors and has been reported to be a direct target of let-7 [48]. [score:9]
Treatment of GSCs with phenformin or overexpression of let-7 induced a significant downregulation of HMGA2 mRNA levels and phenformin treatment of these cells did not result in additional decrease in HMGA2 expression (Figure 2E). [score:8]
Transfection of the cells with a let-7 antagomiR increased the expression of HMGA2 in the cells and abrogated the inhibitory effect of phenformin on the expression of HMGA2 (Figure 2F). [score:7]
We further demonstrated that transduction of GSCs with a lentivirus vector expressing HMGA2 which lacks 3′-UTR (a let-7 “resistant” HMGA2), decreased the inhibitory effect of phenformin on cell renewal of the GSCs (Figure 2G), suggesting that the targeting of HMGA2 by let-7 mediated at least some of phenformin effects. [score:7]
Inhibition of miR-124 and let-7 expression using specific antagomiRs abrogated the inhibitory effect of phenformin on GSC self-renewal in 10 days. [score:7]
Using, we demonstrated that the expression of HMGA2 was increased in the mesenchymal GBM compared to the G-CIMP subtype that exhibits a better prognosis (Figure 2C), whereas the expression of let-7 exhibited an opposite pattern of expression (Figure 2D). [score:6]
We found that phenformin induced the upregulation of miR-124, miR-137 and let-7 in the GSCs and that let-7 and miR-124 played a role in the inhibitory effect of phenformin on the self-renewal of these cells. [score:6]
Phenformin regulates the expression of non-coding RNAs and inhibits the self-renewal of GSCs via the H19/let-7/HMGA2 pathway. [score:6]
Since phenformin inhibited both the stemness and mesenchymal markers of GSCs, we further examined the effect of phenformin on HMGA2 expression and the role of let-7 in its effect. [score:5]
Our data demonstrate that silencing of H19 decreased the stemness of GSCs and enhanced the ability of let-7 to inhibit HMGA2 expression. [score:5]
Let-7 acts as a tumor suppressor miRNA and has been reported to modulate CSC self-renewal and mesenchymal transformation by targeting HMGA2 [42]. [score:5]
Using qPCR analysis, we found that the expression of miR-124, 137 and let-7 was significantly increased following phenformin treatment (Figure 2A), whereas metformin induced a significant increase only of let-7 and miR-137 expression (Supplementary Figure S2). [score:5]
Figure 2(A) The expression of miR-124, miR-137 and let-7 was analyzed in phenformin -treated GSCs by qPCR following 3 days of phenformin treatment. [score:3]
Recently, HMGA2 has been also reported to mediate the inhibitory effect of let-7 on cancer stem cells in anaplastic astrocytoma [49, 50]. [score:3]
Expression values were assessed for each gene of interest (HMGA2, let-7) and averaged across consistent probes. [score:3]
In addition to the let-7 pathway, we also found that silencing of miR-124 abrogated some of phenformin effects on the expression of differentiation, stemness and mesenchymal markers (Figure 3H, 3I). [score:3]
Lentivirus vectors expressing let-7, let-7 antagomiR tagged to GFP (System Biosciences, Mountain View, CA) or HMGA2 lacking the 3′-UTR were packaged and used to infect glioma cells according to the manufacturer's protocol and as previously described [54, 65]. [score:3]
In addition, silencing of H19 decreased also the expression of HMGA2 (Figure 3E, 3F) and increased the inhibitory effect of let-7 on the HMGA2 as measured using the HMGA2 3′-UTR tagged to luciferase (Figure 3G). [score:3]
Several miRNAs, such as miR-33a, miR-26a, miR-193, miR-221/222 and let-7, are regulated by metformin in breast, pancreatic, and lung cancer cells [25– 29]. [score:2]
Phenformin regulates the H19/let-7/HMGA2 pathway in GSCs. [score:2]
The effects of let-7 on additional pathways that regulate GSC function and survival and the role of miR-124 in phenformin effects are currently being studied. [score:2]
Another pathway that affects the activity of let-7 is its bioavailablity and sequestration by binding to H19 [43, 44]. [score:1]
These results are summarized in a diagram that depicts the effects of phenformin on the stemness of GSCs via the H19/let-7/HMGA2 [45] and the miR-124 pathway (Figure 3J). [score:1]
The cells then were transfected with let-7 or let-7 and H19 siRNA. [score:1]
Indeed, recent studies demonstrated that H19 acts as an oncogenic long non-coding RNA (lncRNA) [51, 52] that contains binding sites for let-7 miRNA family and modulate let-7 bioavailability [43, 53]. [score:1]
[1 to 20 of 29 sentences]
12
[+] score: 133
These EMT-type cells also showed decreased expression of miR-200 or let-7, and reversal of EMT by forcing expression of miR-200 significantly inhibited clonogenic and prostasphere-forming ability, which was consistent with the inhibition of Notch1 and Lin28B expression. [score:11]
Loss of miR-200b and miR-200c lead to increased ZEB1, Notch1 and Lin28B expression, resulting in decreased expression of let-7. Downregulation of let-7 leads to the up-regulation of Sox2, Nanog and Oct4, which together with Notch1 and Lin28B contribute to stem cell signatures. [score:11]
Our results presented above showed that the miR-200b and miR-200c inhibited lin28B expression (Fig. 4C), which is known to bind to primary let-7 and pre-let-7 RNA and inhibits the accumulation of mature let-7 miRNA [19]. [score:7]
These results were consistent with the data from showing that the re -expression of let-7 significantly inhibited Sox2 and Nanog expression in PC3 PDGF-D cells by transfection of pre-let-7a, pre-let-7b or co-transfection of pre-let-7a, pre-let-7b or pre-let-7d with Lin28B siRNA. [score:7]
In order to prove our hypothesis, PC3 PDGF-D cells were transfected with let-7, and we found that let-7a and let-7b could reduce the sphere-forming capacity concomitant with decreased expression of Sox2 and Nanog, These results were consistent with the data showing that let-7 significantly inhibited Oct4, Nanog and Sox2 expression in mouse embryonic stem cells [42]. [score:7]
Let-7 family of miRNAs has been shown to act as a tumor suppressor through targeting Ras, high mobility group A2 (HMGA2) and c-myc, and decreased let-7 expression has been linked with increased tumorigenicity and poor patient prognosis. [score:7]
Knock-down of Lin28B by siRNA strongly increased mature let-7 expressions (Fig. 6B); suggesting lin28B regulated mature let-7 expression in PC3 PDGF-D cells. [score:7]
We have shown that let-7 family regulated self-renewal and inhibited Sox2, Nanog, Oct4 and Lin28B expression in PC3 PDGF-D cells with EMT phenotype. [score:6]
Moreover, knock-down of Lin28B markedly increased let-7 expression, suggesting that miR-200 and let-7 could act as a target for the prevention of tumor recurrence and metastasis in PCa. [score:6]
Lin28B inhibited production of let-7, regulating self-renewal by controlling the expression of Sox2, Nanog and Oct4. [score:6]
Down-regulation of Lin28B increased let-7 expression, which was consistent with repressed self-renewal capability. [score:6]
Lin28B inhibited accumulation of mature let-7, which resulted in the increased expression of Sox2, Nanog and Oct4 (Fig. 8D), leading to increased self-renewal and tumor growth. [score:5]
Re -expression of selected let-7 family such as let-7a, let-7b, let-7d or combination of let-7a, let-7b and let-7d markedly inhibited prostasphere-forming capability (Fig. 6C and 6D) and simultaneously reduced the size of prostaspheres (Fig. 6C, S4A and S4B). [score:5]
Thus, we hypothesized that let-7 could regulate self-renewal by regulating Nanog, Oct4, Sox2 and Lin28B expression in PC3 PDGF-D cells. [score:5]
Moreover, miR-200 and let-7 played a critical role in linking EMT phenotype with stem cell signatures by regulating the expression of Lin28B and Notch1. [score:4]
Transfection of Lin28B siRNA enhanced let-7 expression, suggesting increased Lin28B was responsible for the loss of let-7 in PC3 PDGF-D cells. [score:3]
Since Lin28B inhibits accumulation of mature let-7 by binding to pre-let-7 RNA and thereby blocking the processing of pre-let-7 RNA, PC3 PDGF-D cells with high level of Lin28B were co -transfected with pre-let-7 and Lin28B siRNA. [score:3]
The let-7 was known to promote differentiation of embryonic cells, reduced expression of let-7 was associated with increased self-renewal ability in breast cancer cells [18]. [score:3]
In this study, we found that PCa cells with EMT phenotype displayed stem-like cell features characterized by increased expression of Sox2, Nanog, Oct4, Lin28B and/or Notch1, consistent with enhanced clonogenic and sphere (prostasphere)-forming ability and tumorigenecity in mice, which was associated with decreased expression of miR-200 and/or let-7 family. [score:3]
Two evolutionary conserved families, miR-200 and let-7 have been shown to regulate the differentiation processes during the development. [score:3]
Figure S4 Let-7 regulated the self-renewal of PC3 PDGF-D. (A) Transfection of pre-let-7 or combination of pre-let-7 and Lin28B siRNA reduced the size of prostaspheres. [score:2]
It is well known that let-7 family plays a critical role in regulating self-renewal in embryonic stem cells and breast cancer stem-like cells [18], [37]. [score:2]
Recent studies have also documented that lin28B could block the accumulation of mature let-7 [19], which in turn regulates “stemness” by inhibiting self-renewal, the cellular characteristics of cancer stem-like cells associated with tumor recurrence. [score:2]
Lin28B -mediated repression of let-7 was partially responsible for regulating self-renewal in PC3 PDGF-D cells. [score:2]
Let-7a, let-7b, let-7d and combination of Let-7a, let-7b, let-7d as well as co-transfection with let-7 and Lin28B siRNA decreased the number of prostaspheres. [score:1]
More importantly, Let-7 family members regulate the self-renewal of breast cancer cells [18], which is associated with stem cell phenotype. [score:1]
The results from our miRNA microarray data showed that all the members of let-7 family were significantly reduced in PC3 PDGF-D cells (Table S3). [score:1]
Table S3 The levels of miR-200 and let-7 family in PC3 Neo and PC3 PDGF-D cells. [score:1]
Single cell suspensions of PC3 Neo, PC3 PDGF-D, ARCaP [E], ARCaP [M] and PC3 PDGF-D cells transfected with Sox2, Nanog, Oct4, Lin28B or control siRNA as well as miR-200 and let-7, were plated on ultra low adherent wells of 6-well plate (Corning, Lowell, MA) at 1000 or 2000 cells/well in DMEM/F12 (Invitrogen) supplemented with B27 and N2 (Invitrogen). [score:1]
Cells were transfected with 100 nmol/L of Sox2, Nanog, Oct4, Lin28B siRNA or control siRNA (Santa Cruz) as well as 20 nmol/L of miR-200 or let-7 (Ambion, Austin, TX) using DharmaFECT3 siRNA transfection reagent (DHARMACON, Lafayette, CO). [score:1]
It has been shown to selectively block the processing of pri-let-7 miRNAs in embryonic cells, resulting in decreased mature let-7 [19]. [score:1]
In the present study, we found that Lin28B was significantly increased and let-7 family was strongly repressed in PC3 PDGF-D cells. [score:1]
0012445.g006 Figure 6 (A) The levels for let-7 family in PC3 Neo and PC3 PDGF-D cells were determined by using real time RT-PCR. [score:1]
We found that prostasphere numbers from cells co -transfected with pre-let-7 and Lin28B siRNA were less than that of transfection with pre-let-7 alone (Fig. 6D); however, except for let-7d, there was no difference in prostasphere size between pre-let-7 alone and co-transfection with pre-let-7 and Lin28B siRNA (Fig. 6C, S4A and S4B). [score:1]
[1 to 20 of 34 sentences]
13
[+] score: 131
De Vito et al. [12] demonstrated that let-7 is a direct EWS-FLI-1 target resulting in reduced let-7a expression which is implicated in ESFT development through HMGA2 regulation. [score:8]
Interestingly, Aryee et al. have shown that EWS-FLI-1 is upregulated by HIF-1α and De Vito et al. have shown that EWS-FLI-1 is a direct target of let-7 [11] [12]. [score:7]
Based on the results of both studies we hypothesize the possible existence of a feedback loop in which EWS-FLI-1 binds let-7 resulting in downregulation of let-7, which in turn upregulates EWS-FLI-1 (Figure 10). [score:7]
let-7 regulates the expression of RAS, p-ERK, HIF-1α and EWS-FLI-1. let-7 regulates the expression of RAS, p-ERK, HIF-1α and EWS-FLI-1. Salirasib treatment in-vitro. [score:7]
let-7 regulates the expression of RAS, p-ERK, HIF-1α and EWS-FLI-1Synthetically, we overexpressed and silenced the levels of let-7a and let-7b in ES cells following transfection with mimics or inhibitors and measured the levels of RAS, p-ERK, HIF-1α and EWS-FLI-1 proteins (Figure 6). [score:6]
Our results are consistent with a recent study providing evidence that let-7 is downregulated and functions as a tumor suppressor gene in ES [20]. [score:6]
Figure 6 let-7 regulates the expression of RAS, p-ERK, HIF-1α and EWS-FLI-1Western blot analysis of pan-RAS, p-ERK, HIF-1α and EWS-FLI-1 proteins (A1, B1 and C1, respectively) following transfection of let-7 mimics and inhibitors. [score:6]
Downregulation of let-7 results in the activation of the RAS signaling pathway leading to the activation of HIF-1α and this leads to an increase in EWS-FLI-1. Salirasib treatment or transfection with let-7 mimic inhibits RAS signaling pathway, HIF-1α and EWS-FLI-1. Primary tumor samples were obtained from 67 ES patients who were admitted to the Rina Zaizov Pediatric Hematology Oncology Department at the Schneider Children's Medical Center of Israel. [score:6]
In 33 tumor samples, the expression results of both let-7 and p-ERK protein were available and a significant inverse correlation was identified between let-7a and p-ERK expression levels (p = 0.037). [score:5]
Figure 10Downregulation of let-7 results in the activation of the RAS signaling pathway leading to the activation of HIF-1α and this leads to an increase in EWS-FLI-1. Salirasib treatment or transfection with let-7 mimic inhibits RAS signaling pathway, HIF-1α and EWS-FLI-1. Next we evaluated the clinical use of Salirasib in ES. [score:4]
We suggest that the expression of EWS-FLI-1 and p-ERK proteins are regulated by let-7. This is of extreme importance for a possible therapeutic use of let-7 in ES, since the EWS-FLI-1 protein is known to be a pivotal oncogenic event in ES. [score:4]
One of the most studied miRNA is let-7. The human let-7 family consists of 13 genes, is highly conserved and has been found to be downregulated in several malignancies such as lung cancer, colon, breast, and acute lymphoblastic leukemia [6]. [score:4]
We showed that let-7 is downregulated in ES and is significantly associated with poor outcome and an increase in relapse rates. [score:4]
We detected the downregulation of all of the let-7 members in all ES tumors analyzed. [score:4]
These results suggest that let-7 regulates EWS-FLI-1 and HIF-1α, in addition to RAS and its downstream target. [score:4]
In summary, our results support the hypothesis that let-7 is a tumor suppressor that regulates the RAS signaling pathway, also in ES. [score:4]
We found the let-7 family to be downregulated in ES, leading to the activation of the RAS pathway and HIF-1α. [score:4]
Studies have shown that let-7 directly binds the RAS oncogene, resulting in negative regulation of RAS protein [7, 24- 26]. [score:3]
Distribution of progression free survival (PFS) based on let-7 expression and p-ERK protein levels were estimated by Kaplan-Meier analysis (using log rank). [score:3]
Correlations between let-7 expression and p-ERK protein levels were performed using 2-tailed t-test. [score:3]
let-7 expression levels are predictive of outcome. [score:3]
This is supported by De Vito et al. 's findings [12] demonstrating the repression of the entire let-7 tumor suppressor family in ES cell lines. [score:3]
Western blot analysis of pan-RAS, p-ERK, HIF-1α and EWS-FLI-1 proteins (A1, B1 and C1, respectively) following transfection of let-7 mimics and inhibitors. [score:3]
One of the validated targets of let-7 is the RAS oncogene [7]. [score:3]
let-7 expression levels are predictive of outcomeWe evaluated the expression levels of let-7a and let-7b by RQ-PCR in 57 primary ES tumors. [score:3]
Expression levels of let-7 and p-ERK protein levels were assessed for potential association with clinical parameters, including patients’ age, primary site and metastases at diagnosis. [score:3]
High or low let-7 expression levels were defined above or below the first quartile of each miR. [score:3]
We hereby describe that let-7 expression inversely correlated with the levels of RAS, p-ERK, HIF-1α and EWS-FLI-1 proteins. [score:3]
Moreover, let-7 negatively regulates HIF-1α and EWS-FLI-1 proteins. [score:2]
We were interested in located on the chromosomes most frequently translocated in ES tumors, chromosomes 11q and 22q that result in the chimeric transcript EWS-FLI-1. Of the located at the site of interest, 3 are members of the known let-7 family. [score:1]
Interestingly, their miRNA based therapy using synthetic let-7 supports our findings suggesting that increased levels of let-7 result in a reduction of HIF-1α and EWS-FLI-1, contributing to the reduction of tumor growth in-vivo. [score:1]
We decided to focus on let-7 family for further analysis. [score:1]
let-7/RAS/HIF-1α /EWS-FLI-1 circuit in ES. [score:1]
Interestingly, 3 out of the identified belong to the let-7 family: let-7a-2 (chromosome 11), let-7a and let-7b (chromosome 22). [score:1]
Additional confirmation of the involvement of the let-7 family in ES came from the miRNA microarray analysis we performed on 30 primary tumors using the miRXplore microarrays (Miltenyi Biotec, Bergisch Gladbach, Germany). [score:1]
[1 to 20 of 35 sentences]
14
[+] score: 130
SNAI1 Expression Is Temporally Associated with Let-7 DownregulationNext, we explored the potential mechanism by which SNAI1 enhances reprogramming, noting the references that link EMT with downregulation of the let-7 family of tumor suppressor miRs (Chang et al., 2011; Kong et al., 2010; Li et al., 2009; Yang et al., 2012). [score:11]
As shown here, SNAI1 binds several let-7 promoters, and SNAI1 expression is associated temporally with downregulation of let-7 miRs early in reprogramming, consistent with prior evidence that EMT factors suppress let-7 expression in cancer (Yang et al., 2012). [score:10]
Expression of let-7 miRs can promote differentiation of pluripotent stem cells, and a let-7 inhibitor promotes dedifferentiation; thus, let-7 downregulation is likely essential to reprogramming (Melton et al., 2010). [score:8]
Knockdown of SNAIL reduces and overexpression enhances reprogramming • SNAIL-YFP -positive fractions reprogram at higher efficiency • Let-7 decreases early in reprogramming, and expression of SNAIL reduces let-7 • SNAIL binds to the promoters of let-7 family members during reprogramming somatic cells to induced pluripotent stem cells (iPSCs) holds great promise for disease mo deling and therapeutic applications. [score:8]
We also noted a trend toward higher expression of several let-7 members in FVB than in B6×129 strain prior to reprogramming, correlating high expression with augmentation of reprogramming efficiency upon SNAI1 overexpression (Figure S4F). [score:7]
The downregulation of let-7 transcription by SNAI1 may be associated with upregulation of LIN28 by pluripotency factors, thereby potently reversing the differentiated state. [score:7]
While let-7 is downregulated in the first week of reprogramming, its expression appears to recover thereafter before again diminishing to near zero in the iPSC state (Figures 4E, 4F, and S4D). [score:6]
Next, we explored the potential mechanism by which SNAI1 enhances reprogramming, noting the references that link EMT with downregulation of the let-7 family of tumor suppressor miRs (Chang et al., 2011; Kong et al., 2010; Li et al., 2009; Yang et al., 2012). [score:6]
LIN28, a regulator of miR biogenesis and an alternative reprogramming factor (Viswanathan et al., 2008; Yu et al., 2007), inhibits the processing and maturation of let-7 and is in turn a let-7 target (Rybak et al., 2008). [score:6]
SNAI1 Expression Is Temporally Associated with Let-7 Downregulation. [score:5]
Let-7 inhibition stimulates OSK reprogramming efficiency (without c-MYC) to the same extent as does c-MYC, and forced let-7 expression decreases reprogramming efficiency (Worringer et al., 2014). [score:5]
We further demonstrated that SNAI1 binds the let-7 promoter, which may play a role in reduced expression of let-7 microRNAs, enforced expression of which, early in the reprogramming process, compromises efficiency. [score:5]
Mature let-7 family miRs, regulators of developmental timing (Ambros, 2011), are absent in pluripotent cells and are expressed at high levels in differentiated cell populations (Viswanathan et al., 2008). [score:5]
Let-7 inhibits expression of pluripotency factors (including LIN28, c-MYC, and SALL4) (Melton et al., 2010) and cell cycle regulators critical for the ES cell phenotype (such as CDK6, CDC25A, and cyclin D) (reviewed in (Mallanna and Rizzino, 2010). [score:5]
Using inducible Snail ER, we observed downregulation of let-7 after 7 days of TMX treatment in mouse fibroblasts (Figures 4A and S4A). [score:4]
Moreover, overexpressing SNAI1 in a poorly reprogramming strain augments both reprogramming efficiency and SNAI1 binding to the let-7 promoter, suggesting SNAI1 regulation of let-7 may be the basis for enhanced reprogramming efficiency. [score:4]
These data suggest downregulation of the let-7 miRs as a possible mechanism by which SNAI1 influences reprogramming (diagrammed in Figures 4H, S4G, and S4H). [score:4]
To understand the role of let-7 in reprogramming, we expressed let-7 in MEFs from a strain of mice carrying a dox-inducible transgene at various stages of reprogramming (Zhu et al., 2011). [score:3]
KD of SNAI1 resulted in increased let-7 expression (Figure 4B). [score:3]
We found that let-7 overexpression compromised efficiency when done during the first, but not the second, 7 days of reprogramming (Figure 4G). [score:3]
Upon TMX treatment of SNAI1-ER expressing fibroblasts (without reprogramming), SNAI1 binding to let-7 members similarly increases (Figure 4D). [score:3]
A role for let-7 in reprogramming has been established since its inhibition increases reprogramming efficiency (Melton et al., 2010). [score:3]
We propose that suppression of let-7 miRs is a mechanism whereby SNAI1 might be acting to confer these stem cell properties. [score:3]
Chromatin immunoprecipitation (ChIP) confirmed that SNAI1 binds the promoters of several let-7 family members during early stages of reprogramming in B6×129 fibroblasts (Figure 4C) and in FVB overexpressing SNAI1-ER more so than without induction (Figure S4B). [score:3]
Moreover, a connection between EMT factors and the transcriptional regulation of let-7 has been reported (Chang et al., 2011; Kong et al., 2010; Li et al., 2009). [score:2]
We evaluated expression of let-7 during OSKM -induced reprogramming and found let-7a, let-7e, let-7g, and let-7i decreased in both fibroblasts and keratinocytes in the early phase (Figures 4E, 4F, S4C (parallel fibroblast data for Figure S1A), and S4D). [score:1]
[1 to 20 of 26 sentences]
15
[+] score: 129
In accordance with the mo del of Blimp1 regulation, we show that the downregulation of Lin28 and upregulation of let-7 are associated with a downregulation of Blimp1 in PGCs from exposed animals. [score:11]
In absence of LIN28, let-7 miRNAs are overexpressed in PGCs and bind to the 3′UTR of the Blimp1 mRNA, which blocks its translation and inhibits PGC development [2]. [score:8]
Together, these results suggest that a coordinated deregulation of Lin28 and TUTases participate in the upregulation of let-7. Altogether, these results indicate that in the mouse, the exposure to VCZ, even at low dosage, disturbs the expression of several miRNAs and the balance of the Lin28/let-7/Blimp1 pathway during the specification of PGCs, which provides a possible molecular explanation for the perturbation caused in germ cell precursors (Fig 5). [score:7]
Altogether, our data show that the transgenerational upregulation of let-7 and miR-23b in PGCs of VCZ exposed animals was associated with the downregulation of the key PGC factors Lin28 and Blimp1 along three generations. [score:7]
Together, these results suggest that a coordinated deregulation of Lin28 and TUTases participate in the upregulation of let-7. Altogether, these results indicate that in the mouse, the exposure to VCZ, even at low dosage, disturbs the expression of several miRNAs and the balance of the Lin28/let-7/Blimp1 pathway during the specification of PGCs, which provides a possible molecular explanation for the perturbation caused in germ cell precursors (Fig 5). [score:7]
This leads us to propose that the deregulation of the Lin28/let-7 pathway and partial reduction of Blimp1 is one molecular pathway that directly contributes to inhibit PGC development in embryos exposed to VCZ (Fig 5). [score:6]
In mammals, two Lin28 paralogs are expressed (Lin28a and Lin28b), which are functionally equivalent but with different expression patterns, cellular localization and different mechanism of let-7 repression [28]. [score:5]
let-7 and mir-23b also regulate Lin28, which encode a stem cell-expressed RNA binding protein required for PGC development. [score:5]
Deregulated miRNAs (let-7, miR-21, miR-23b) and their targets genes (Lin28a/ Lin28b and Blimp1) are involved in PGC specification and development. [score:5]
We quantified the expression levels of let-7 miRNA and target mRNAs in samples from all three generations. [score:5]
BLIMP1 is responsible for the specification of PGCs in the posterior epiblast and is regulated by the expression of let-7, which is in turn regulated by LIN28 [23, 38]. [score:5]
In this sense, the upregulation of let-7 miRNAs could be a cellular response to protect from the damage induced by environmental factors. [score:4]
The increased levels of let-7 in PGCs correlate with a downregulation of the Lin28 paralogs. [score:4]
This work demonstrates that the fetal exposure of mice to VCZ induces trans-generational changes in miRNAs and target gene expression profiles of the Lin28/let-7/Blimp1 pathway in PGCs, even at a dosage under those considered as NOAEL “No Observed Adverse Effect Level” (established at 1.2 mg/kg/day) (http://www. [score:4]
Our results showed that exposure to VCZ increased significantly the expression of the precursor and some mature forms of let-7 in F1 to F3 (p≤0.001) (Fig 3A and 3B). [score:3]
In turn, LIN28 establishes a feedback loop by binding to let-7 pre-miRNAs and pri-miRNAs and inhibiting their processing into mature miRNAs [25– 27]. [score:3]
0124296.g005 Fig 5Schematic mo del for the deregulation of PGC development by the Lin28/ let-7/ Blimp1 pathway in the PGCs from mice exposed to VCZ. [score:3]
We provide evidence that this transgenerational phenotype is not associated with major changes in gametic DNA methylation but is associated with long lasting deregulations of several miRNAs in male PGCs, in particular the Lin28/ let-7/ Blimp1 pathway that plays important roles in PGC specification and development. [score:3]
At the same time, VCZ also induces the overexpression of TUTase4 (Zcchc11) and TUTase7 (Zcchc6) that, in absence of LIN28, facilitate the processing of pre-let-7 into let-7 [32] explaining the accumulation of mature let-7 in exposed animals. [score:3]
In addition to let-7, Lin28 is also a predicted target of miR-23b. [score:3]
As mentioned before, let-7 family members and Lin28 are critical regulators of cell proliferation and are considered as tumor suppressors [25, 41, 42]. [score:3]
For example, Bisphenol A (BPA) induces the overexpression of three members of let-7 miRNA family in human placental cells [40]. [score:3]
Schematic mo del for the deregulation of PGC development by the Lin28/ let-7/ Blimp1 pathway in the PGCs from mice exposed to VCZ. [score:3]
Interestingly, previous studies showed that let-7 is overexpressed after exposure to other EDs. [score:3]
Besides the Lin28/let-7/Blimp1, other pathways certainly also contribute to the defects in PGC development and apoptosis caused by the exposure to VCZ. [score:2]
Our results demonstrate for the first time that VCZ induces a deregulation of the Lin28/let-7/Blimp1 pathway in embryos. [score:2]
Development of PGCs also requires the RNA -binding factor LIN28 that binds to specific microRNA (miRNA) precursor: the let-7 pri-miRNA preventing the processing into mature forms of let-7 miRNAs. [score:2]
In addition to Lin28, let-7 and miR-23b are also potential regulators of Blimp1. [score:2]
This includes members of the let-7 family and miR-23b, which can regulate Blimp1, a key in the PGC differentiation [22– 24]. [score:2]
As was described in Lin28 knockdown mice [39], the reduction of LIN28 by VCZ is associated with an accumulation of precursor and mature forms of let-7 in germ cells. [score:2]
Therefore, the balance among Blimp1, Lin28 and let-7 needs to be tightly controlled for the proper specification of PGCs in the mouse embryo. [score:1]
To investigate whether the deregulation of the Lin28/ let-7 pathway detected in PGCs was associated to the deregulation of TUTases, we performed analysis of TUTase4 and TUTase7. [score:1]
Finally, terminal uridylyl transferases (TUTases) interact with LIN28 to induce poly-uridylation of let-7 precursors at their 3’ end, which interferes with let-7 maturation and facilitates the miRNA precursor degradation by the recruitment of exonucleases [31]. [score:1]
TUTase4 (Zcchc11) and TUTase7 (Zcchc6) also promote the mono-uridylation of pre-let-7 in absence of LIN28, which facilitates DICER processing and increases the levels of mature let-7 [32]. [score:1]
[1 to 20 of 34 sentences]
16
[+] score: 115
Intriguingly, LIN28 also suppresses the production of let-7. H19 is downregulated by its target miRNA let-7 in non-diabetic muscle, [42] myotubes [43] and breast cancer cells. [score:8]
These data suggest that H19 is reciprocally inhibited by its target let-7, and that this negative feedback loop can be disrupted by LIN28 through its ability to repress let-7 expression. [score:7]
Notably, although the expression levels of let-7a and let-7b were unaltered when H19 was overexpressed in MDA-MB-231 cells (Figure 4f), the protein levels of DICER and RAS targeted by let-7 were increased (Figure 4g). [score:7]
To identify the potential downstream targets of H19 and let-7 involved in BCSC maintenance, we first examined the expression levels of a panel of core pluripotency factors upon H19 overexpression in breast cancer cells. [score:7]
In consequence, LIN28 can also indirectly promote H19 expression through suppressing the miRNA level of let-7 (Figure 6). [score:6]
In consequence, an accumulation of LIN28 can indirectly elevate H19 expression through inhibiting let-7. Thus, we identify a novel negative-feedback mechanism between H19 and let-7, as well as a double -positive feedback loop between H19 and LIN28 mediated through let-7 in breast cancer. [score:6]
LIN28 promotes H19 expression by suppressing let-7 production. [score:5]
As let-7 miRNA is a key tumor suppressor that targets numerous oncogenes such as c-Myc and RAS, 47, 48 this double ‘beat' for let-7 releases its oncogenic factors and underlines BCSC maintenance. [score:5]
H19 overexpression in breast cancer breaks the homeostatic balance between let-7 and LIN28, leading to the inhibition of let-7 and subsequent elevation of LIN28. [score:5]
As let-7 is suppressed by both H19 and LIN28 in breast cancer cells, we analyzed let-7 expression in three paired breast cancer patient samples. [score:5]
As LIN28 was a validated target of let-7, we examined whether LIN28 was regulated by the H19/let-7 axis in breast cancer cells. [score:4]
Here we describe a mechanism in which H19 functions as a ceRNA to sponge let-7 family of microRNAs and promotes the expression of core pluripotency factor LIN28 (Figures 4 and 5). [score:3]
In agreement with the fact that LIN28 is a post-transcriptional repressor of let-7, the let-7a and let-7b miRNA levels were markedly decreased by overexpression of LIN28 (Figure 6e; Supplementary Figure 7E). [score:3]
[42] In our study, H19 localized in the cytoplasm is associated with AGO2 and acts to sponge let-7 to inhibit its bioactivity in breast cancer cells. [score:3]
As cancer stem cells tend to cause metastasis in breast tumor, we further examined the expression of H19, LIN28 and let-7 in metastatic and non-metastic mammary tumors from twenty tumor tissues stratified on clinical progression. [score:3]
We further generated H19 -overexpressing plasmids with either wild-type (WT) or mutated (Mut) let-7 -binding sites. [score:3]
Together, these results suggest that H19 acts as a ceRNA to inhibit let-7 function, leading to de-repression of LIN28 that is crucial for the maintenance of BCSCs. [score:3]
In addition, both the levels of LIN28 mRNA (Supplementary Figure 6A) and protein (Supplementary Figure 6B) decreased in the presence of mlet-7 and increased in the presence of let-7 inhibitors (ilet-7). [score:3]
Importantly, both quality and quantity of let-7 are dual -suppressed in double -negative feedback loop. [score:3]
H19 elevates LIN28 expression through a let-7 -dependent mechanism. [score:3]
In conclusion, our study establishes that H19/let-7/LIN28 form a double -negative feedback circuitry to regulate BCSC maintenance (Figure 6j). [score:2]
In addition, let-7 displays a lower expression in breast tumor tissues compared with adjacent tissues. [score:2]
Furthermore, H19 functions as a novel upstream regulator of the core pluripotency factor LIN28 and protects LIN28 from let-7 -mediated degradation. [score:2]
H19 functions as a ceRNA to constitute a dual-feedback regulatory circuitry with let-7 and LIN28. [score:2]
[40] Recent findings revealed that cytoplasmic H19 functions as an endogenous sponge for the let-7 family of microRNAs to regulate cancer metastasis [41] and muscle metabolism. [score:2]
In present study, we demonstrate that H19-let-7-LIN28 exhibit a double -negative feedback loop in regulation of BCSC maintenance. [score:2]
Taken together, these findings evidently suggest that H19 acts as a miRNA sponge to restrict the biological function of let-7 in breast cancer cells. [score:1]
[43] psiCHECK2- H19 and psiCHECK2- H19D with or without two copies of predicted that let-7 -binding sites were established as described by Kallen et al, [43] psiCHECK2-let7 4 × was built as described by Iwasaki et al. [50] To make psiCHECK2- LIN28, the bioinformatics tool Miranda (http://www. [score:1]
[46] Here we reveal that lncRNA-H19, functioning as a ceRNA, links the network of miRNA let-7 and core transcription factor LIN28. [score:1]
The effect of H19/let-7 axis in the regulation of LIN28 expression was further investigated by rescue assay shown in Figure 5e. [score:1]
By contrary, psiCHECK2- H19D, with let-7 -binding sites deletion, no longer responded to mlet-7 (Figure 4d). [score:1]
Intriguingly, H19 is also repressed by let-7 in a negative-feedback mechanism. [score:1]
H19 functions as a molecular sponge for let-7 miRNA in breast cancer cells. [score:1]
org) was used to search for let-7 -binding sites in the full-length transcripts of LIN28 and predicted let-7 -binding sites within LIN28 3′-UTR fragments were obtained by RT-PCR and were inserted into the luciferase reporter vector psiCHECK2 (Promega, Madison, WI, USA) between Xho1 and Not1 sites. [score:1]
The psiCHECK2-let-7 4 × reporter was co -transfected with increasing amounts of WT H19 or Mut H19 (sponge) into MDA-MB-231 cells. [score:1]
The results showed that the relative let-7 reporter luciferase activity was increased in response to WT H19 in a dose -dependent manner but remained unchanged with the Mut H19 plasmids (Figure 4e). [score:1]
Furthermore, let-7 mimics (mlet-7) substantially repressed the luciferase activities of the psiCHECK2-let-7 4 × and psiCHECK2- H19 (P<0.001) reporters, which harbors four and two copies of let-7 -binding sites, respectively. [score:1]
[1 to 20 of 37 sentences]
17
[+] score: 93
Among the potential pathways predicted from miRNAs differentially expressed between dormant and activated blastocysts, the Wnt pathway may be relevant to the observed action of let-7. Two miRNAs target gene prediction softwares, TargetScan and PicTar show that Kremen1 and Wnt1 are target genes of let-7. Wnt1 is predominantly expressed in the inner cell mass of mouse blastocyst [69], while Kremen1 is detected primarily in the trophectoderm of dormant blastocysts and is translocated into the nuclei of trophodermal cells in activated blastocysts [47]. [score:11]
The evidence include (a) Let-7a bound to the 3′UTR region of the integrin-β3; (b) forced -expression of let-7a reduced the expression of integrin-β3; and (c) forced -expression of integrin-β3 partially rescued the suppressive effect of let-7 on blastocyst implantation, attachment and outgrowth. [score:9]
Down-regulation of let-7 in the activated blastocysts would enable up-regulation of let-7-response genes, many of which are oncogenes or cell cycle checkpoint genes, leading to cell cycle progression, DNA synthesis and cell division. [score:7]
In view of the high level of let-7 in dormant embryos, we postulated that up-regulation of let-7 suppress blastocyst implantation. [score:6]
The expression of let-7 is dynamically regulated during oogenesis and early embryonic development [7]. [score:5]
Apart from the possible compensatory function of integrins, the inability of forced -expression of integrin-β3 in completely nullifying the inhibitory action of let-7 precursor on blastocyst outgrowth could be due to the involvement of other pathway(s) mediating the action of of let-7 on embryo implantation. [score:5]
The high level of let-7 during dormancy relative to the normal blastocyst and the down-regulation of let-7 in the activated blastocysts suggest that a low level of let-7 is beneficial for implantation. [score:4]
Similar to the report in mouse [9], a continuous decrease of expression levels of let-7 family members was found during preimplantation development of human embryos (Fig. 1d ). [score:4]
Here, we studied the let-7 function by forced expression of precursor of let-7 in embryos using electroporation as described for studying the roles of specific genes in mouse preimplantation embryo development [27], [28]. [score:4]
The knowledge gained may be applied to humans as a continuous down-regulation of let-7 is also observed in the human preimplantation embryos. [score:4]
Several of the let-7 members are upregulated in the delayed implantating mouse uterus after activation [70] and in the implantation site relative to inter-implantation site [71]. [score:4]
The present study showed that the expression level of let-7 family in human blastocysts is also low, consistent with a similar role of the miRNA in preimplantation embryo development. [score:4]
Precursor of let-7 inhibits embryo implantation in vivo. [score:3]
Expression of let-7 family members (in Ct values) in dormant and activated blastocysts. [score:3]
Whether let-7 modulates the expression of integrin-β3 in the uterine luminal epithelium remains to be determined. [score:3]
0037039.g003 Figure 3Precursor of let-7 inhibits embryo implantation in vivo. [score:3]
Both the luminal epithelium and the stroma of endometrium express let-7 members with unknown function [71], [72]. [score:3]
Let-7 family is wi dely demonstrated as a tumor suppressor. [score:2]
The results showed that let-7 is involved in the regulation of blastocyst activation. [score:2]
Other than integrin-β3, let-7 is known to regulate RAS [66], HMGA2 [67] and Dicer [68]. [score:2]
Nine members of the let-7 family were analyzed in the profiling experiment. [score:1]
The let-7 family consists of 11 members, which are conserved in invertebrates and vertebrates, including humans [48], [49]. [score:1]
Several members of the let-7 family (let-7a, -7d, -7e, -7f, -7g) were also found in the list. [score:1]
Let-7 controls cellular proliferation by negatively regulating RAS and cell cycle-related genes such as cyclin D2, CDK6 and CDC25A [53]. [score:1]
To determine whether a low level of let-7 also occurred in human blastocysts, donated human embryos cryopreserved at the 2–4-cell stage were thawed and cultured to blastocysts. [score:1]
[1 to 20 of 25 sentences]
18
[+] score: 93
and exhibit increased expression in p53 wild-type radiation sensitive tissues which is similar to the let-7 expression pattern, but do not exhibit increased expression in radiation insensitive tissues, or tissues from p53 knock-out mice (other transcription factors mediate minimal expression of Puma in the absence of p53). [score:10]
This is in part explained by the fact that let-7 family members have been shown to target expression of proteins involved in cell proliferation such as Ras [7] and cell cycle regulation such as Cdc25A and cyclin D1 [8], [9], which contribute to its tumor suppressor phenotype. [score:8]
Furthermore, after irradiation let-7a and let-7b expression decreased in ATM [+/+] fibroblasts but not ATM -deficient fibroblasts (Fig. 2B and C) suggesting that ATM -dependent p53 activation is necessary for radiation -induced changes in let-7 expression. [score:5]
Similar to the response of let-7 expression, both and showed a much greater change in expression in radiation-sensitive tissues compared to radiation- resistant tissues (Fig. 5A and B, respectively) which may suggest that let-7a and let-7b regulation by p53 may be associated with the p53 mechanisms that induce apoptosis. [score:5]
Deletion or mutation of let-7 family expression is highly associated with the development of cancer [5], while the presence of increased let-7b decreases lung tumor growth in mice [6] and sensitizes lung cancer cells to radiation [2]. [score:5]
ATM [+/+] and ATM [−/−] fibroblasts were also collected after irradiation and expression of let-7a (B) and let-7b (C) decreased in the ATM [+/+]cells but not in ATM [−/−] cells suggesting that ATM -dependent p53 activation is necessary for radiation -induced changes in let-7 expression. [score:5]
These results suggest that p53 plays an important role in stress -induced miRNA expression changes and is required for the observed decrease in let-7 expression signaled by DNA damage. [score:5]
Expression of let-7 remained either unchanged or increased in all tissue types collected from p53 knock-out mice. [score:4]
Basal let-7 expression is greater in radiation sensitive tissues, especially lung. [score:3]
However, the mechanism underlying the decrease in let-7 expression after irradiation has not yet been elucidated, and a greater understanding may allow for manipulation of these pathways for therapeutic intervention. [score:3]
To further study this interaction between p53 and let-7 expression, an in silico analysis was performed which identified a possible p53 binding site approximately 450 bp upstream of the let-7a3/let-7b gene. [score:3]
let-7a and let-7b account for about 60% of overall let-7 expression in HCT116 cells [18] and about 70% in AG01522 cells [3]. [score:3]
A recent study has shown that p53 can interact directly with the miRNA processing enzyme Drosha [23], and it is therefore possible that this may also play a role in the p53 -mediated repression of the let-7 family, in addition to transcriptional regulation. [score:3]
p-value determined by Student's t. let-7a and let-7b account for about 60% of overall let-7 expression in HCT116 cells [18] and about 70% in AG01522 cells [3]. [score:3]
Studies have shown that over -expression of let-7 increases sensitivity of cells to radiation [2] and cisplatin [24]. [score:3]
Reduced expression of the let-7 miRNA family has been shown to be activated in response to irradiation [2], [3]. [score:3]
Our results confirm a radiation -induced decrease in let-7 expression in both HCT116 p53 [+/+] colon cancer cells and ATM [+/+] fibroblasts. [score:3]
In contrast, radiation resistant tissues from the wild-type mice did not exhibit a decrease in let-7 expression (Fig. 4E and F). [score:3]
Therefore it is logical to suggest that higher expression of let-7 may contribute to radiation sensitivity. [score:3]
This differential response in let-7 expression closely mimics the difference we observed between HCT116 p53 [+/+] and p53 [−/−] cells suggesting a similar mechanism might be responsible. [score:3]
We hypothesized that, since p53 is activated by both oxidative stress and DNA damage, p53 could be involved in the mechanism underlying the observed let-7 expression changes. [score:3]
The in vivo response of let-7 to DNA damage was determined by treatment of C57BL/6J wild-type and p53 knock-out mice with 2.0 Gy total body irradiation (TBI). [score:2]
These genotoxic stressors similarly resulted in a decrease of both let-7 species that was observed only in the p53 [+/+] cells. [score:1]
These observations taken together display significant potential of let-7 mimics as adjuvant cancer therapeutics. [score:1]
In addition to sensitizing to cytotoxic agents, it has been previously observed that let-7 can significantly slow tumor growth in vivo [6] and suppress stem cell characteristics in tumors [25]. [score:1]
Several previous studies have shown that the let-7 family of miRNA is repressed following exposure to radiation in multiple cell lines [2], [3], [19], [20], [21]. [score:1]
Furthermore only let-7a and let-7b have been reported to decrease at both high and low doses of radiation, thus we chose to focus on those two members of the let-7 family. [score:1]
[1 to 20 of 27 sentences]
19
[+] score: 89
We found that Gal-3 negatively regulates expression of the miRNA let-7, which itself down-regulates K-Ras expression [3] (Figure 5). [score:9]
In normal cells, let-7 miRNAs act as tumor-suppressor genes that downregulate Ras expression [2]. [score:8]
A variant allele in the K-Ras 3-untranslated region, which arises in the let-7 miRNA complementary site (K-Ras-LCS6) and leads to increased K-Ras expression in lung cancer [36], was shown to significantly reduce survival time in squamous cell carcinoma of the head and neck, suggesting that this variant may alter the phenotype or therapeutic response of the disease [37]. [score:7]
However, the dual control over K-Ras expression and activity that we describe here indicates that let-7, even without oncogenic mutation, can regulate Ras activity and that this might be a general phenomenon related to the interactions between tumor suppressor genes (e. g. let-7) and proto-oncogenes (e. g. K-Ras) or oncogenes (e. g. K-Ras G12V or G12D). [score:7]
The results indicate that Gal-3 negatively regulates let-7 expression, which in turn leads to increased expression of K-Ras. [score:6]
In the latter case, as in many human tumors, Gal-3 acts as a negative regulator of let-7 expression, leading to an increase in K-Ras expression levels associated with increased stability and activity of K-Ras. [score:6]
Binding of let-7 to the K-Ras 3′-untranslated region in the let-7 miRNA complementary site (K-Ras-LCS6) results in a decrease in the transcription and/or degradation of K-Ras mRNA [36], with consequent reduction in K-Ras expression. [score:5]
Ras genes and oncogenes are regulated by members of the let-7 miRNA family by virtue of the possession by these genes of let-7 complementary sites in their 3′-untranslated regions (UTRs) [3]. [score:4]
Control of K-Ras expression by the let-7 family of miRNAs has been well documented. [score:3]
Low levels of let-7 expression in human tumors correlate with high levels of K-Ras [36]– [38]. [score:3]
Here we examined the possibility that Galectin-3 (Gal-3) interacts with active K-Ras [10], [11] and may modulate let-7 expression. [score:3]
To determine whether this negative regulation might be associated with the positive regulation of K-Ras by Gal-3, we first examined a possible correlation in the Gal-3 [-/-] cells between the levels of K-Ras transcripts and let-7 transcripts, particularly let-7a and let-7c (the abundant miRNAs of the let7 family). [score:3]
Reduction of let-7 has been reported in several human cancers including melanoma, colon and lung [4]– [6] and their expression has been shown to attenuate cancer cell proliferation and tumorigenicity [7], [8]. [score:3]
Yet another study described a SNP in a let-7 miRNA in the complementary site in the KRAS 3′-untranslated region that reduces the binding of let-7 and correlates with increased risk of NSCLC [9]. [score:3]
In another study, genetic modulation of the let-7 miRNA binding to the KRAS 3′-untranslated region was found to correlate with survival of metastatic colorectal cancer patients who underwent salvage cetuximab-irinotecan therapy [38]. [score:3]
Loss of nuclear Gal-3 expression is associated with tumor progression [20], just as loss of let-7 leads to progression of many human tumors [23]. [score:3]
The significance of this control mechanism has been highlighted in a number of studies that report a correlation between let-7 expression and cancer. [score:3]
Ras transcription is negatively regulated by the let-7 miRNA family of small RNAs [3]. [score:2]
This dual mode of regulation of K-Ras by Gal-3/let-7 suggests a new signaling pathway (see scheme in Figure 6). [score:2]
The above results suggest that Gal-3 regulates the transcriptional level of let-7, and show for the first time that Gal-3 mediates K-Ras transcription through let-7c. [score:2]
Our results showing that Gal-3, through its negative regulation over let-7, is highly carcinogenic are consistent with that study. [score:2]
Recently a single-nucleotide polymorphism (SNP) was detected in a let-7 miRNA complementary site in the KRAS 3′UTR in non-small cell lung carcinoma (NSCLC) and was found to be correlated with increased risk for NSCLC [9]. [score:1]
These findings led us to postulate that loss of Gal-3 might be related to the increase in let-7 and decrease in K-Ras stability. [score:1]
[1 to 20 of 23 sentences]
20
[+] score: 85
Western blot analysis of TF-1a cells that transfected with let-7a and let-7b mimics further confirmed that IGF2BP1 could be downregulated by let-7a and let-7b, in addition to simultaneously reduced LIN28B expression as there is a feedback regulatory loop between LIN28B and let-7 miRNAs (Fig.   5d) [8]. [score:7]
Studies in stem cell, growth and metabolic disorders, and cancers uncover LIN28/LIN28B as a central regulator of cellular metabolism through let-7 -dependent or let-7-independent manner, where LIN28/LIN28B directly binds mRNA of glycolysis and mitochondrial OxPhos enzymes and enhances their translation [37– 40]. [score:5]
The high expression of LIN28B-pDsRed might result in further repression of let-7, thus inhibiting let-7 function might explain the increase of endogenous LIN28B protein. [score:5]
Bioinformatics predictions from DIANAmT, miRDB, miRwalk, PICTAR5, and Targetscan databases revealed IGF2BP1 as a potential target for the let-7 family miRNAs (Table  1). [score:5]
As let-7 miRNA family concurrently regulates several pivotal oncogenic pathways, there is of great interest in re -expression of let-7 miRNAs as a therapeutic option for cancer. [score:4]
LIN28B is a stem cell reprogramming factor, downregulating let-7 microRNAs (miRNAs), where this occurs primarily at a post-transcriptional level [8]. [score:4]
In sum, these results uncover a novel mechanism of an important regulatory signaling, LIN28B/let-7/IGF2BP1, in leukemogenesis and provide a rationale to target this pathway as effective therapeutic strategy. [score:4]
However, the repression of let-7 miRNAs in cancer stem cells (CSCs) may be due to overexpression of LIN28B [13, 14]. [score:3]
The Pearson r values and p values were determined with GraphPad Prism software We and others reported previously that overexpression of LIN28B contributes to tumor aggressiveness and metastasis through let-7 -dependent mechanisms [16, 18]. [score:3]
Overexpression of LIN28B has been associated with advance human malignancies [16], including leukemias [17, 18], and there are increasing evidences of its role in formation of CSCs and LSCs through either let-7 dependent or independent mechanisms [14, 15, 19]. [score:3]
Strategies using viral vector, to overexpress let-7 miRNAs or by introducing artificial double-stranded miRNA (mimic of let-7 miRNAs), hold great promising for novel anti-AML therapy. [score:3]
IGF2BP1 was confirmed to be a novel downstream target of LIN28B via let-7 miRNA in AML. [score:3]
Numerous human malignancies such as ovarian cancer, lung cancer, hepatocellular carcinoma, and melanoma have been shown to have repression of multiple members of the let-7 family of miRNAs, thus promoting oncogenesis by depressing targets such as c-Myc, Ras, and HMGA2 [10, 34]. [score:3]
The repression of members of let-7 miRNAs could well elicit the de-repression of several oncogenes such as K-Ras, c-Myc, and HMGA2 [30– 32], in turn, promoting disease progression. [score:3]
IGF2BP1 is a novel target gene of let-7 miRNAs. [score:3]
Thus, targeting LIN28B or let-7 may be an effective therapeutic option for AML patients. [score:3]
Cells with high level of LIN28B are regarded to have low expression of let-7 miRNA and vice versa. [score:3]
The Pearson r values and p values were determined with GraphPad Prism software We and others reported previously that overexpression of LIN28B contributes to tumor aggressiveness and metastasis through let-7 -dependent mechanisms [16, 18]. [score:3]
In agreement with the results from HEL cells, silencing of IGF2BP1 or supplying let-7 miRNA mimics significantly suppressed the growth rates of TF-1a cells (Additional file 5: Figure S3). [score:3]
The reciprocal regulations between LIN28B and let-7 have been confirmed in many studies [16, 25, 26]. [score:2]
The most well-studied molecular mechanism of LIN28B in oncogenesis is its ability in regulating let-7 miRNA biogenesis through a TUTase-independent mechanism by sequestering pri-let-7 miRNAs in the nucleoli [29]. [score:2]
IGF2BP1 is a downstream effector of LIN28B through let-7 miRNA. [score:1]
Cells were allowed to grow in MyeloAim medium complex containing 10 nM of let-7 miRNA mimic, 400 μl of serum free medium, and 40 μl of MyeloidAim reagent at 37 °C overnight before replacing the medium complex with complete growth medium and continued to culture for another 48 h. Plasmids pEGFP and LIN28B-pEGFP were transfected into TF-1 cells by Neon transfection (electroporation). [score:1]
Increased let-7 miRNAs promote stem cell differentiation [9]. [score:1]
To examine the functional importance of IGF2BP1 in LIN28B -mediated leukemogenesis, we used HEL AML cell line with endogenous LIN28B to study loss-of-function phenotype by way of depletion of IGF2BP1 or addition of let-7 mimics. [score:1]
MyeloAim In Vitro Transduction reagent (BIOO Scientific, TX, USA) was used to transfect let-7 miRNA mimics to TF-1a cells. [score:1]
In summary, our findings demonstrate a pivotal role of LIN28B/let-7/IGF2BP1 in progression of AML and indicate the essential changes in metabolic pathways by LIN28B. [score:1]
We next applied similar approaches to examine the effects of silencing IGF2BP1 or additional let-7 miRNA mimics in a different cell line, TF-1a cell line. [score:1]
Let-7 miRNA family consists of 13 members located in genomic locations, which are often mutated in human cancers [10– 12]. [score:1]
In this study, IGF2BP1 has been increased by LIN28B through repression of let-7 miRNA. [score:1]
Fig. 5Characterization of IGF2BP1 as downstream target of LIN28B via let-7 microRNA. [score:1]
In fact, loss-of-IGPF2BP1 or additional let-7 mimics led to about a 1.8-fold or 1.5-fold reduction in proliferation, respectively (Fig.   5f, p < 0.01 or p < 0.05, respectively). [score:1]
[1 to 20 of 32 sentences]
21
[+] score: 72
Moreover, despite the ability of EWS-FLI-1 to directly induce expression of c-Myc, a known regulator of let-7 expression, recent evidence suggests that let-7a may also constitute a direct EWS-FLI-1 target gene [27], further supporting possible involvement of let-7a in ESFT development. [score:11]
Taken together, our observations have identified a miRNA expression signature that characterizes ESFT and that participates in ESFT pathogenesis, including the miRNA tumor suppressor family let-7. We have also shown that EWS-FLI-1 directly binds to the let-7a promoter, repressing its transcriptional activity, and that reduced let-7a expression is implicated in ESFT development through HMGA2 regulation. [score:8]
Expression of the let-7 family is also known to be tightly regulated at the post-transcriptional level by LIN28, a direct let-7 target gene [28], [29], [30]. [score:7]
We show the let-7 family member let-7a to be a direct EWS-FLI-1 target gene, whose in vivo repression promotes ESFT cell tumorigenicity via induction of its target gene HMGA2. [score:6]
To determine whether lin28 may also participate in the regulation of let-7 expression in ESFT, we compared the expression levels of LIN28A and LIN28B in MSC, ESFT cell lines and primary tumors. [score:5]
The observed changes in miRNA expression are consistent with reports that members of the let-7 family are repressed in a broad range of tumors [14], that miRNA-31 is repressed in disseminating and metastatic malignancies [22], [23] and that overexpression of the cluster 17–92 is involved in the tumorigenic phenotype of haematologic malignancies as well as that of a variety of solid tumors [13]. [score:5]
Although all mice developed tumors, even moderate let-7a overexpression resulted in a marked decrease in tumor volume irrespective of their cell line derivation (Figure 3C), consistent with findings in other tumor types, where let-7 expression was reported to delay tumor growth [19]. [score:5]
Similar to our discovery that repression of miRNA-145 is directly involved in the emergence of ESFT CSC [8], the observed repression of let-7a may enhance expression of LIN28B, triggering a double negative feed-back loop that reinforces let-7 repression in ESFT and facilitates CSC generation and maintenance. [score:4]
The two ESFT cell lines revealed a similar miRNA expression profile, characterized by repression of the entire let-7 family, miRNA-100, miRNA-125b and miRNA-31, and over -expression of the miRNA 17–92 cluster and its paralogs miRNA-106a and miRNA-106b (Figure 1A). [score:3]
Although low expression of all the let-7 family members was observed in primary ESFT cells and ESFT cell lines compared to MSCs (Figure 1A), we focused our attention on let-7a because its repression has been shown to be directly implicated in the pathogenesis of several cancer types as well as in maintenance of breast cancer CSC [15], [26]. [score:3]
B) Left: Real-Time PCR analysis of let-7 family expression in MSC, A673, TC252, STA-ET-8.2, SK-ES-1 cells and primary ESFT. [score:3]
Our observations indicate that ESFT display concomitant induction of the oncogenic miRNA 17–92 cluster [13] and repression of the entire let-7 tumor suppressor family [14], [15]. [score:3]
LIN28 has recently been shown to be directly involved in the generation and maintenance of ovarian aldehyde dehydrogenase (ALDH) -positive CSC through its ability to block let-7 maturation [40]. [score:2]
Together with increasing evidence of a pivotal role of let-7 in normal and cancer stem cell differentiation, this observation further supports the notion that the double negative feedback loop between LIN28 and let-7 may regulate the behavior of CSC in vivo. [score:2]
Members of the let-7 family play a major role in cell differentiation and are considered to act as tumor suppressors by silencing numerous genes that encode oncogenic proteins including HMGA2, insulin-like growth factor 2 -binding protein 1 (IGF2BP1), RAS and c- MYC [24], [25]. [score:2]
Among induced miRNAs, we found the oncogenic miRNA 17–92 cluster and its paralogs miRNA106a/b, whereas repressed miRNAs included miRNA 100, 125b as well as the entire let-7 family. [score:1]
Among the let-7 miRNA family we focused on let-7a because of its reported functional role in diverse cancer types. [score:1]
Lin28 is strongly implicated in the induction and control of pluripotency and binds to the terminal loops of let-7 precursors, thereby blocking their processing to mature forms [30]. [score:1]
[1 to 20 of 18 sentences]
22
[+] score: 69
Several other studies have shown radiation -induced downregulation of let-7 family members in cells and tissues, and this downregulation was associated with the altered expression of the DNA damage mediator protein p53 [77, 78]. [score:9]
Many tumors exhibit profound downregulation of let-7 [69], and the overexpression of let-7 strongly suppresses tumor cell growth. [score:8]
Overall, upregulation of the let-7 family may viewed as a positive and protective event in the context of cancer and brain metastasis, whereby it acts as a tumor-suppressor and blocks proliferation. [score:6]
The let-7 family is also involved in glioma, where the upregulation of let-7b inhibited proliferation, migration and invasion in glioma cell lines. [score:6]
In the brain, let-7 levels have been shown to increase after cerebral ischemia/reperfusion injury [72, 73], whereas let-7 suppression inhibited apoptosis and inflammatory responses and caused an overall neuroprotective effect upon cerebral ischemia/reperfusion injury [73]. [score:5]
The let-7 family is one of the well-known tumor-suppressor miRNA families [65, 66] that target RAS [67, 68], a cellular oncogene. [score:5]
In a rat mo del of a middle cerebral artery occlusion and subsequent reperfusion injury, let-7 family members were upregulated at the 48-hour reperfusion time point [72, 74]. [score:4]
In the future, more studies are needed to dissect the cellular, tissue-specific, and behavioral repercussions of let-7 upregulation in tumor brain and chemo brain. [score:4]
In C. elegancs, several neurons have shown increased levels of let-7 as they age, whereby let-7 upregulation contributed to the decline of aging neurons’ regeneration potential [75]. [score:4]
Since the different let-7 family members have similar or even identical seed sequences, they likely have overlapping sets of target mRNAs. [score:3]
DCP treatment caused upregulation of the let-7 family miRNAs - let-7a, 7b, 7g, 7i - in the PFC tissues of TBNC mice, as compared to intact controls. [score:3]
Let-7 microRNAs was downregulated in radiation-exposed neural granule cell progenitors, as well as in medulloblastoma [76]. [score:3]
On the other hand, the let-7 family includes many potent senescence-inhibiting and anti-age miRNAs [105]. [score:3]
Moreover, miRNAs of the let-7 family were up-regulated in the PFC tissues of PR+BC untreated and crizotinib -treated animals as compared to intact controls. [score:3]
The let-7 family is involved in neural development and neuronal differentiation [24, 71]. [score:2]
In lung cancer, low let-7 levels are correlated with poor survival [70]. [score:1]
[1 to 20 of 16 sentences]
23
[+] score: 59
It was found that the tumor suppressive let-7 miRNA could be up-regulated by [188]Re-liposome and involved in mediating the therapeutic efficacy of this radiopharmaceutical. [score:6]
Although we showed that let-7 could be induced by [188]Re-liposome, little is known whether the expression of p53, PTEN and RB will be directly activated by this radioactive compound to suppress tumor growth. [score:6]
Thus, the current data provide the evidence that administration of [188]Re-liposome on HNSCC would increase the let-7 microRNA expression that leads to suppression of tumorigenesis. [score:5]
Therefore, [188]Re-liposome may specific suppress TWIST-1 signaling pathway but not BMI-1 pathways to regulate let-7 biogenesis. [score:4]
Knockdown of let-7i compromises [188]Re-liposome suppressed HNSCC tumor growth in vivoTo further investigate whether let-7 family is essential for the efficacy of [188]Re-liposome in vivo, we used LNA™ to suppress let-7i in FaDu-3R cells and then implanted into nude mice for treatment of [188]Re-liposome in the tumor bearing mice. [score:4]
Surprisingly, let-7 showed high z-score with apparent up-regulation, and this is the only microRNA family found by IPA, even the z-score was filtered at 2.0 (data not shown). [score:4]
Because here we only used the let-7i LNA™, it is not excluded that concomitantly knockdown of other let-7 members would further suppress the therapeutic efficacy of [188]Re-liposome. [score:4]
For z-score over 3, we found that [188]Re-liposome altered gene expression could be stimulated by several upstream regulators, including TP53, PTEN (phosphatase and tensin homolog), RB1 (retinoblastoma 1), RBL1(retinoblastoma-like 1) and let-7 (Figure 5A). [score:4]
Therefore, these data suggest that let-7 family is involved in [188]Re-liposome suppressed HNSCC growth in vivo. [score:3]
Currently, it is unclear whether [188]Re-liposome could induce let-7 or other tumor suppressive microRNA for therapeutic effects or not. [score:3]
To the best of our knowledge, this is the first report showing that [188]Re-liposome can induce let-7 expression in HNSCC tumors. [score:3]
The main let-7 family regulated genes were also listed by the heatmap from GSEA (Supplementary Figure 6). [score:2]
Let-7 family has been shown to participate in the control of cellular pluripotency, proliferation and differentiation and has been defined as a tumor suppressor gene [17, 18]. [score:2]
How [188]Re-liposome can distinguish these signaling pathways to induce let-7 expression is of interest to further investigate. [score:1]
According to the gene expressive ranking calculated by GSEA, the let-7 family was identified the most enriched gene set using c3. [score:1]
To further investigate whether let-7 family is essential for the efficacy of [188]Re-liposome in vivo, we used LNA™ to suppress let-7i in FaDu-3R cells and then implanted into nude mice for treatment of [188]Re-liposome in the tumor bearing mice. [score:1]
There are 13 different members in human let-7 family [16]. [score:1]
Furthermore, [188]Re-liposome induced let-7 family members, including let-7b, let-7e and let7i, were confirmed using qPCR (Figure 5C). [score:1]
Interestingly, let-7 was the only gene belonging to microRNA family and performing the highest log ratio. [score:1]
The family of let-7 is one of the first two discovered microRNAs in C. elegans. [score:1]
Interestingly, the let-7 family was the only microRNA involved in the therapeutic efficacy of [188]Re-liposome. [score:1]
The let-7 microRNA family was mostly enriched. [score:1]
[1 to 20 of 22 sentences]
24
[+] score: 55
The EGFP -based reporter was sensitive to miRNA pathway repression by AGO2 knock-down, plant virus-derived suppressors of RNA silencing P19 and P21, and miRCURY LNA inhibitors targeting let-7 (Figures S2B–D). [score:8]
Apart from these candidates for general miRNA inhibitors, other compounds of interest included let-7-specific inhibitors (3 compounds) and compounds associated specifically with bulged reporters (12 compounds), which could specifically disrupt formation of the full miRISC effector complex. [score:5]
To test the reporter derepression, we employed LNA miRNA family inhibitors targeting let-7 and miR-30 families. [score:5]
Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. [score:4]
Inhibition of translational initiation by Let-7 MicroRNA in human cells. [score:4]
Indeed, both, let-7 and miR-30 reporters showed good repression relative to non -targeted controls upon transient transfection into HeLa or 3T3 cells (Figure 1C). [score:3]
In contrast, the above-mentioned 6-hydroxy-DL-DOPA showed some inhibitory dose-response effect only on the 4xB let-7 reporter in 3T3 cells. [score:3]
Subsequently, for let-7 3x perfect reporters, we chose HeLa and 3T3 clones that showed low raw basal reporter activity, which was strongly stimulated upon transfection of the LNA let-7 inhibitor (Figure 1D). [score:3]
Here, we present the development and use of high-throughput cell -based firefly luciferase reporter systems for monitoring the activity of endogenous let-7 or miR-30 miRNAs. [score:2]
In our hands, it showed mild inhibitory potential in two of the four dose-response reporter assays in 3T3 cells (1xP miR-30 & 4xB let-7). [score:2]
Let-7 is of particular interest because of its tumor suppressor properties and negative impact on pluripotency, which is counteracted in embryonic stem cells and during the establishment of induced pluripotent stem cells (reviewed in Svoboda and Flemr, 2010; Lee et al., 2016). [score:2]
Biogenesis and regulation of the let-7 miRNAs and their functional implications. [score:2]
The luciferase reporter plasmids PGK-FL-let-7-3xP-BGHpA, PGK-FL-let-7-4xB-BGHpA, and PGK-FL-miR-30-4xB-BGHpA used to produce reporter cell lines for HTS were built stepwise on the HindIII-AflII pEGFP-N2 (Clontech) backbone fragment using PCR-amplified fragments carrying appropriate restriction sites at their termini. [score:1]
For let-7 and miR-30 bulged reporters, we produced and tested stable HeLa cells but without specific clonal selection (Figure 1E). [score:1]
Accordingly, we tested varying in promoters and types and numbers of let-7 binding sites (Podolska, 2015); a system with the CAG promoter (Niwa et al., 1991) and three perfect let-7 binding sites was further studied in HEK293 and HeLa cells (Figure S2A). [score:1]
Next, let-7 1xP forward (1xlet-7P_Fwd) and let-7 1xP reverse (1xlet-7P_Rev) oligonucleotides representing a perfect let-7a binding site were annealed and subcloned into a BglII site of the pCX-EGFP plasmid (Okabe et al., 1997), yielding pCX-EGFP-1xlet-7_1xP; the proper orientation of the let-7a binding site was determined by sequencing. [score:1]
To develop reporters for miRNA activity for HTS, we opted for well-established “perfect” and “bulged” binding sites for let-7 and miR-30 miRNAs in previously developed reporters (Pillai et al., 2005; Ma et al., 2010; Figure 1A). [score:1]
Accordingly, we designed firefly luciferase reporters with multiple miRNA binding sites: either three let-7 perfect binding sites or four let-7 or miR-30 bulged sites. [score:1]
EGFP -based reporter plasmids carrying let-7 2xP, let-7 3xP, and let-7 4xB binding sites were cloned using a similar strategy. [score:1]
Let-7 and miR-30 miRNAs were chosen as good candidates for setting up reporters as they are abundant in somatic cells and their biogenesis and activities have been well studied (Pasquinelli et al., 2000; Hutvágner and Zamore, 2002; Zeng et al., 2002, 2005; Zeng and Cullen, 2003, 2004; Pillai et al., 2005). [score:1]
Using a library of 12,816 compounds at 1 μM concentration, we performed HTS experiments in HeLa cells with reporters carrying miR-30 bulged and let-7 bulged and perfect binding sites, as well as an HTS experiment in 3T3 cells with a reporter carrying let-7 perfect binding sites. [score:1]
All three reporters depicted in Figure 1B were stably integrated in HeLa cells; the PGK-FF-let-7-3xP reporter was also stably integrated into 3T3 cells. [score:1]
Finally, the miRNA binding sites were inserted into the plasmid using in vitro synthesized oligonucleotides carrying miRNA binding sites for let-7 or miR-30 miRNA, which were annealed and cloned into a BamHI site downstream of the luciferase CDS; the plasmids were validated by sequencing. [score:1]
Of the 163 compounds, 69 and 104 showed at least 2-fold increase of the let-7 mutated reporter in HeLa cells and miR-30 mutated reporter in 3T3 cells, respectively. [score:1]
[1 to 20 of 24 sentences]
25
[+] score: 55
Ablation of CCNB1 in male germ cells might promote their differentiation by downregulating the expression of Lin28a and upregulating the expression of let-7 miRNAs. [score:11]
Collectively, these results indicate that ablation of CCNB1 might promote the undifferentiated germ cells’ differentiation by downregulating the expression of Lin28a and upregulating the expression of let-7 miRNAs. [score:11]
We also showed that ablation of CCNB1 in undifferentiated spermatogonia might promote their differentiation by downregulating the expression of Lin28a and upregulating the expression of let-7 miRNAs. [score:11]
We also found that ablation of CCNB1 in spermatogonia may promote their differentiation by downregulating Lin28a and upregulating let-7 miRNAs. [score:7]
42, 43, 44 Because the mRNAs of Lin28a are themselves let-7 targets, this LIN28A/let-7 axis creates a double -negative feedback loop whereby either let-7 or LIN28A is expressed at high levels, generating a differentiated or an embryonic cell fate, respectively. [score:5]
These results indicate that high level of c-Kit expression in Stra8-c KO mice testes is probably due to the change of LIN28A/let-7 axis, with low level of Lin28a and high level of let-7 promoting the differentiation of spermatogonia. [score:3]
LIN28A specifically regulates the maturation of let-7 miRNAs. [score:2]
[50] Previous studies showed that LIN28A/let-7 axis regulates proliferation and differentiation of PGCs and spermatogonial progenitor cyclic expansion. [score:2]
In addition, we also found that the mature miRNA level of let-7 family were notably increased in adult Stra8-c KO mice testis. [score:1]
42, 43, 44 We then investigated the expression of let-7 miRNAs in the adult Stra8-c KO mouse testes and found that let-7 miRNAs were remarkably increased. [score:1]
34, 35, 37 LIN28A mainly represses the maturation of let-7 miRNAs, whereas the maturation of other miRNAs is largely unaffected by LIN28A. [score:1]
[1 to 20 of 11 sentences]
26
[+] score: 53
We propose that Shh -dependent induction of Ascl1a and Lin28a contributes to Müller glia dedifferentiation through let-7 microRNA -mediated translational downregulation of shha, shhb, smo, ptch1, and zic2b from respective mRNAs. [score:6]
Shh Signaling/ lin28a/ let-7 Regulatory Loop Is Essential for MGPC InductionWe then explored whether the RNA -binding protein and pluripotency-inducing factor Lin28a, a necessary and well-known target of Ascl1a during retina regeneration, is regulated directly through Shh signaling (Ramachandran et al., 2010a). [score:6]
These findings suggest that lin28a -mediated suppression of let-7 is required for the translational regulation of Shh signaling components in MGPCs as a part of positive feedback loop mediated through the Ascl1a- lin28a axis. [score:6]
As zic2b mRNA shows a translational regulation through let-7 microRNA, one could speculate that the role of Zic2b protein is restricted to Ascl1a- or Lin28a -expressing MGPCs. [score:6]
We report on stringent translational regulation of sonic hedgehog, smoothened, and patched1 by let-7 microRNA, which is regulated by Lin28a, in Müller glia (MG)-derived progenitor cells (MGPCs). [score:5]
This let-7 downregulation in MGPCs is opposite to the IF pattern of Shh (Figures 3H and 3I), which suggested possible regulation of shha mRNA by let-7 microRNA. [score:5]
• Shh signaling is essential for MG dedifferentiation during retina regeneration •Shh signaling components are regulated by let-7 microRNA in the zebrafish retina • A regulatory feedback loop between Mmp9 and Shh signaling is active in the retina •Shh signaling induced a gene-regulatory network involving mmp9, ascl1a, zic2b, and foxn4 zebrafish retina regeneration Shh Ascl1a Mmp9 Zic2b Foxn4 let-7 Lin28 In contrast to mammals, zebrafish retina possesses remarkable regenerative capacity after an acute injury, leading to functional restoration of vision (Sherpa et al., 2008). [score:4]
Furthermore, let-7 microRNA, which is downregulated by Lin28a (Ramachandran et al., 2010a), was abundant in the uninjured inner nuclear layer (INL) in BrdU [+] MGPCs at 4 dpi (Figure 3H). [score:4]
We anticipate a much wider role for the Shha-Mmp9-Ascl1a-Lin28a- let-7 regulatory loop during retinal regeneration. [score:2]
Shh Signaling/ lin28a/ let-7 Regulatory Loop Is Essential for MGPC Induction. [score:2]
Figure 3Lin28a- let-7 Axis Regulates Shh Signaling Component Genes in the Injured Retina(A) FISH and IF microscopy images of a 0.5-μm-thick optical section of retina showed co-localization of lin28a with ptch1 in BrdU [+] MGPCs at 4 dpi. [score:2]
These results suggest that zic2b is an essential regeneration -associated gene in zebrafish retina that is regulated through the mmp9-shha-ascl1a-lin28a-let-7 pathway. [score:2]
This speculation is mainly because of the presence of bona fide let-7 microRNA -binding sites in the zic2b coding region (Figure S5F). [score:1]
In silico analysis predicted several let-7 microRNA -binding sites present in shha, shhb, smo, and ptch1 genes (Table S4). [score:1]
These include the interplay of Shh/Notch signaling components, transcription factors (namely, Ascl1a, Zic2b, Foxn4, and Insm1a), the matrix metalloproteinase Mmp9, the RNA -binding protein Lin28a, and microRNA let-7. Complete retina regeneration in zebrafish has provided valuable clues as to why their mammalian counterparts often fail (Goldman, 2014, Wan and Goldman, 2016). [score:1]
[1 to 20 of 15 sentences]
27
[+] score: 46
Increased tumorigenicity and invasion with increased LIN28A expression can be explained mechanistically by down-regulation of let-7 microRNAs and up-regulation of let-7 targets such as HMGA2, a chromatin modifying gene that is associated with numerous cancers [11, 12]. [score:11]
The let-7 regulated, pro-invasion factor HMGA2 is also downregulated, but the neural stem cell factor SOX2 is not affected by suppression of LIN28A knockdown. [score:8]
The corresponding decrease in expression of let-7b and let-7g after LIN28A expression suggests that increased LIN28A suppresses let-7 microRNAs and de-represses HMGA2, which is then able to activate a program of increased pro-invasion genes, such as SNAI1. [score:7]
The primary known targets of LIN28A and the related protein LIN28B are the let-7 family of tumor suppressing microRNAs. [score:5]
HMGA2, a known let-7 target, was upregulated in GBM14-LIN28A (Figure 4F, G) compared to GBM14-GFP. [score:5]
By increasing the expression of multiple oncogenes simultaneously through repression of the let-7 microRNAs, LIN28A can activate oncogenic programs that enhance glioblastoma aggressiveness. [score:3]
Over-activation of LIN28A or LIN28B is one mechanism by which cancer cells can eliminate let-7 microRNAs and allow for increased expression of pro-oncogenic signals [5]. [score:3]
To investigate the potential mechanisms of LIN28A -induced tumorigenicity, we detected the expression levels of let-7 microRNA and known let-7 targets in JHH-GBM14-LIN28A and JHH-GBM14-GFP. [score:3]
Human tall stature is associated with polymorphisms in HMGA2 [43], suggesting a link between LIN28A, let-7 microRNAs, and HMGA2 and generalized growth. [score:1]
[1 to 20 of 9 sentences]
28
[+] score: 43
Second, overexpressing let-7 family members in JMML patients may target RAS directly and induce profound antileukemic effects as it has been shown for other RAS -dependent malignancies [29– 31]. [score:6]
LIN28b is known to inhibit let-7 family members [26] and may explain at least in part the down-regulation observed of let-7 in JMML. [score:6]
Overexpression of let-7 in cancer cell lines, primary cancer samples and animal mo dels of RAS induced cancers represses the expression of the K-Ras and N-Ras proteins resulting in profound antitumoral effects [29– 31]. [score:5]
A second study reported that high levels of expression of the gene LIN28b correlated with higher hemoglobin F (HbF), low expression of let-7 miRs family members and with poor clinical outcome in JMML patients [21]. [score:5]
Among the miRs downregulated in all JMML cases, but, in particular, in KRAS and NRAS mutated cases (Table 2 and Supplemental Table 1), there are several let-7 family members. [score:4]
In addition, as described previously, let-7 family members directly recognize and bind to the 3′UTR of KRAS and NRAS blocking RAS translation [27– 28]. [score:4]
Among the downregulated miRs in JMML patients, we found several let-7 family members. [score:4]
Remarkably, both NRAS and KRAS have let-7-complementary sites in their 3′UTRs and have been validated as let-7 targets in several malignancies [27, 28]. [score:3]
These results are consistent with the recently published manuscript from Helsmoortel et al [21], where several let-7 family members were found at reduced levels in LIN28B overexpressing JMML cases. [score:3]
Thus, it is possible that the loss of let-7 family members expression further contributes to unleash RAS signaling in JMML. [score:3]
[1 to 20 of 10 sentences]
29
[+] score: 43
Consistent with this, mutation to let-7 -binding site disrupts the translational repression conducted by let-7 overexpression (Figure 5e and Supplementary Figure 7C). [score:6]
In addition, as DICER is a known target of let-7, [43] both DICER and HIF-1α protein levels (Figure 5f and Supplementary Figure 7D) were decreased in the presence of mlet-7 and increased in the presence of let-7 inhibitors, but the mRNA levels had no significant changes (Supplementary Figure 7E). [score:5]
We are the first to demonstrate that the let-7 miRNA targets 3′-UTR of HIF1A mRNA to decrease HIF-1α protein expression. [score:5]
Consistently, let-7 released by siH19 decreased DICER and HIF-1α expression, which could be rescued by let-7 inhibitors in MDA-MB-231 cells (Figure 5h) and MCF-7 cells (Supplementary Figure 7G). [score:5]
Here, we describe a mechanism in which the hypoxia -induced H19 functions as a competitive endogenous RNA to sponge miRNAs, such as let-7, thereby relieving the expression of HIF-1α and, ultimately leading to the increase in PDK1 expression (Figures 4 and 5). [score:5]
Thus, the hypoxia -induced H19 functions as a competitive endogenous RNA to sponge let-7, leading to the upregulation of HIF-1α, which promotes PDK1 transcription. [score:4]
However, luciferase assays showed let-7 binds to imperfectly complementary sequences in the mRNA resulting in predominant translational repression. [score:2]
These results reveal that PDK1 is regulated through the H19/let-7/HIF-1α axis. [score:2]
Our data collectively led us to conclude that the glycolysis gatekeeper PDK1 regulated by the H19/let-7/HIF-1α pathway is required for BCSC self-renewal reprogramming in hypoxia, which could be blocked by aspirin (Figure 6j). [score:2]
In summary, our findings demonstrate that PDK1 functions downstream of the H19-let-7-HIF-1α-signaling cascade as a metabolic switch to regulate glycolysis, which in turn contributes to BCSC maintenance under hypoxic conditions. [score:2]
Mechanistically, we showed that PDK1 is elevated through the H19/let-7/HIF-1α signaling axis. [score:1]
As H19 is a sponge of let-7, [42] the HIF1A 3′UTR full-length sequence (FL) including the putative miRNA (let-7) response element (MRE) were cloned into the psiCHECK2 vector, and the MRE was mutated in psiCHECK2-Mut vector (Figure 5d and Supplementary Figure 7B), respectively. [score:1]
Then, psiCHECK2-HIF1A-FL, MRE, Mut and psiCHECK2-let-7 4 × (harboring four let-7 -binding sites; used as a positive control) were transfected into MDA-MB-231 and MCF-7 cells together with mlet-7 (let-7 mimics) in parallel with negative controls. [score:1]
Moreover, when we co -transfected psi-HIF1A-MRE (sensor) with increasing amounts of wide-type H19 (WT, sponge of let-7) into MDA-MB-231 and MCF-7 cells, the relative luciferase activity was promoted in response to WT H19, but not by H19 with mutated let-7 binding site (Mut H19) in a dose -dependent manner (Figure 5g and Supplementary Figure 7F). [score:1]
Notably, HIF-1α mRNA level did not change after let-7 binding. [score:1]
[1 to 20 of 15 sentences]
30
[+] score: 42
We found a significant up-regulation of oncogenic miRNAs and a significant down-regulation of tumor-suppressing miRNAs, which included let-7, miR-17-92, miR-10b, miR-15, miR-16, miR-26, and miR-181. [score:9]
For example, overexpression of miRNA let-7 significantly inhibited A549 lung cancer cell growth in vitro (Takamizawa et al. 2004), suggesting a potential novel approach for clinical cancer gene therapy by controlling the expression of a single miRNA (Zhang and Farwell 2008). [score:7]
In contrast, the expressions of some miRNAs were significantly inhibited by RDX exposure; the miRNAs with at least 4-fold inhibition were miR-574-5p, miR-466f-3p, and let-7e. [score:7]
Seven miRNAs (let-7e, miR-98, miR-361, miR-26b, miR-125a-5p, let-7i, and let-7f) were significantly up-regulated in the brain but down-regulated in the liver after RDX exposure. [score:7]
Of the miRNAs selected for comparison, two miRNAs (miR-206 and let-7e) were up-regulated whereas two miRNAs (miR-200c and miR-27a) were down-regulated based on the results of microarray analysis. [score:7]
Although a number of the RDX-responsive miRNAs (let-7, miR-34, miR-146, and miR-222) found in this study have been reported previously to have aberrant expressions in response to different chemical exposures in human cell lines, most of the RDX-responsive miRNAs reported in this study have not been shown to respond to chemical treatment previously (Blower et al. 2008; Marsit et al. 2006; Moffat et al. 2007; Pogribny et al. 2007; Rossi et al. 2007; Saito et al. 2006; Sun et al. 2008). [score:3]
In this study, we found that many cancer-related miRNAs, such as let-7, miR-17-92, miR-10b, 125b, miR-146, miR-15, miR-200, and miR-16, were significantly affected by RDX exposure (Table 4). [score:1]
To validate the microarray data, we assayed expression levels of four miRNAs (miR-206, miR-200c, miR-27a, and let-7e) by qRT-PCR and compared the results from the microarray and qRT-PCR. [score:1]
[1 to 20 of 8 sentences]
31
[+] score: 40
Expression and Function of the let-7 Microrna during Stem Cell Specification and Development of the CNS. [score:4]
Human TRIM71 and its nematode homologue are targets of let-7 MicroRNA and its zebrafish orthologue is essential for development. [score:4]
The let-7/LIN-41 pathway regulates reprogramming to human induced pluripotent stem cells by controlling expression of prodifferentiation genes. [score:4]
LIN41, also known as TRIM71, is a member of the Trim-NHL protein family, and was first described in the nematode Caenorhabditis elegans (C. elegans) as target of the differentiation -associated microRNA (miRNA) let-7 and therefore part of a heterochronic gene network that controls larval development (Slack et al., 2000; Pasquinelli, 2012; Ecsedi and Grosshans, 2013). [score:4]
Reciprocal expression of lin-41 and the microRNAs let-7 and mir-125 during mouse embryogenesis. [score:3]
In particular, LIN41 was found to cooperate with the pluripotency factor LIN28 to suppress activity of the pro-differentiation miRNA let-7 (Rybak et al., 2009). [score:3]
In C. elegans, similar regulatory interactions between LIN41, the Argonaute protein ALG-1 and let-7 have been shown to mediate changes in the regenerative capacity of neuronal axons that take place during development of the nervous system (Zou et al., 2013). [score:3]
The let-7 microRNA target gene, Mlin41/Trim71 is required for mouse embryonic survival and neural tube closure. [score:3]
The let-7 target gene mouse lin-41 is a stem cell specific E3 ubiquitin ligase for the miRNA pathway protein Ago2. [score:3]
SVZ-derived neural stem cells, cultured as either neurospheres or in monolayer, express the let-7 miRNA and almost undetectable levels of Lin41 mRNA (Rybak et al., 2009, F. Rehfeld, personal communication). [score:3]
The lin-41 RBCC gene acts in the C-elegans heterochronic pathway between the let-7 regulatory RNA and the LIN-29 transcription factor. [score:2]
As in the embryo, LIN41 expression displayed a reciprocal relationship to the let-7 miRNA in these adult stem cell niches (Rybak et al., 2009), and has therefore been considered a gene associated with proliferation and undifferentiated cell types. [score:2]
The Lin41 gene is conserved throughout bilateral animals in terms of both amino acid (a. a. ) sequence and the presence of binding sites for the miRNAs let-7 and lin-4/miR-125 in the 3′ UTR of the messenger RNA (mRNA). [score:1]
The C. elegans microRNA let-7 binds to imperfect let-7 complementary sites from the lin-41 3′UTR. [score:1]
[1 to 20 of 14 sentences]
32
[+] score: 39
However, radiation exposure to various cell lines showed inconsistencies such as upregulation and downregulation of let-7 miRNAs expressions [48]. [score:9]
Pathway analyses indicate Ras protein and three ras genes (Kras, Hras and Nras) is the target of upregulated let-7e. [score:6]
One of the Ras genes, Kras was reported as a well-established target of let-7 and also demonstrated to be a part of the MAPK signaling pathway [51] Upregulated let-7 in response to CI may damage the kidney blood cells that involved in proliferation and differentiation when exposed to radiation [48]. [score:6]
Lower level of let-7 expression increased the expression of Ras protein in pathogenesis of human lung cancer [50]. [score:5]
Only miRNA let-7e is upregulated among the filtered 6 miRNAs. [score:4]
Significantly altered expression of let-7 family has been shown in response to radiation by several miRNA profiling studies [48]. [score:3]
NF-kB has been shown to directly activate let-7e during osteoclast differentiation [55]. [score:2]
Let-7e targets RAS, HRAS, KRAS, and NRAS that are common for NF-κB, HIF-1 and EPO singling. [score:2]
Increased let-7 in mouse hematopoietic stem cells showed marked reduction in their self-renewal activity [49]. [score:1]
The association between let-7e and Ras protein and all three Ras genes in CI indicates that it may play a significant role in NF-κB-HIF-1-EPO cascade. [score:1]
[1 to 20 of 10 sentences]
33
[+] score: 39
We find that miR-294 and let-7 are able to induce co -expression of their target genes, while having opposing effects on the co -expression of cell cycle phase genes and cellular heterogeneity in ESCs (Supplementary Fig. 14). [score:7]
Specifically, miR-294 induced a loss of gene co -expression very similar to WT ESCs, whereas let-7 induced a gain in gene co -expression similar to that of the K562 cells. [score:5]
In contrast, the let-7c targets were not, which is also expected, as let-7 family members are not expressed in ESCs. [score:5]
Therefore, it is plausible that the let-7 effect on co -expression of cell cycle phase genes could be an indirect result of its impact on differentiation. [score:4]
Using both pair-wise and set-wise correlation measures, we found that both let-7 and miR-294 led to significant increases in co -expression among their respective targets across individual cells. [score:3]
Interestingly, let-7 is highly expressed in K562 cells 27. [score:3]
Therefore, the effect of let-7 on cell cycle gene phasing is likely to be due to be a more direct effect on the cell cycle pathways, although the mechanism remains to be revealed. [score:2]
Let-7 normally increases as ESCs differentiate down somatic lineages and the introduction of let-7 in Dgcr8 [−/−] ESCs grown in LIF alone induces differentiation of ESCs. [score:1]
In contrast, let-7 increased transcriptional heterogeneity. [score:1]
Principal component analysis (PCA) of the resulting matrix of samples and genes showed separation into three groups across PC1 consisting of let-7, Dgcr8 [−/−] and WT/miR-294 -transfected cells (Fig. 1c). [score:1]
We found that the introduction of miR-294 and let-7 induced distinct outcomes on the correlation of the cell cycle phase genes used in the previous study. [score:1]
Using identical conditions, cells were transfected with a representative let-7 family member let-7c and a representative ESCC family member miR-294. [score:1]
This finding is consistent with previous work showing that under 2i+LIF conditions, let-7 may actually reduce differentiation 14. [score:1]
However, in the studies presented here, the cells are grown in LIF+2i conditions and we show that let-7 does not induce differentiation under these conditions. [score:1]
Let-7 similarly constitutes a high fraction of the miRNA population in downstream differentiated somatic lineages 18. [score:1]
Here we show very different effects of the two miRNAs, miR-294 and let-7. The introduction of miR-294 into the Dgcr8 [−/−] induces a highly transcriptionally homogenous population, essentially the same as described for WT ESCs grown in similar culture conditions 14. [score:1]
Interestingly, previous work had shown that the ESCC and let-7 miRNAs have opposing effects on the fraction of ESCs in the G1 phase. [score:1]
[1 to 20 of 17 sentences]
34
[+] score: 39
Alterations in phosphorylation of the putative LRRK2 substrates, translation initiation factor 4E binding protein 1 and moesin, do not appear to be involved in altered differentiation, rather there is indirect evidence that a regulatory signaling network comprising retinoic acid receptors, let-7 miRNA and downstream target genes/mRNAs may be affected in LRRK2 -deficient stem cells in culture. [score:7]
LRRK2 protein suppressed the inhibitory effects of let-7 miRNA by promoting the interaction of phosphorylated 4E-BP1 with Argonaute. [score:5]
Thus, there is indirect evidence that lower protein levels of LRRK2 and 4E-BP1 in LRRK2+/− ES cells may alleviate suppression of let-7 miRNA function thereby accelerating retinoic acid -induced differentiation (Figure 8). [score:4]
Administration of retinoic acid causes a repression of Lin28 mRNA and an upregulation of let-7 miRNA and a concomitant switch from self-renewal to differentiation [38]. [score:4]
Very recently, LRRK2 has been shown to antagonize let-7 miRNA -mediated translational repression in mature Drosophila neurons leading to neurodegeneration [35]. [score:3]
In the self-renewing state, the RNA -binding protein Lin28 inhibits processing and maturation of let-7 miRNA. [score:3]
Lower protein levels of LRRK2 and 4E-BP1 in LRRK2+/− ES cells may alleviate suppression of let-7 miRNA function by LRRK2. [score:3]
In embryonic stem cells, let-7 miRNA acts as a key pro-differentiation factor by blocking mRNA translation of pluripotency factors, like Lin28, Sall4, and Hmga2 [36], [37]. [score:3]
In our study, repression of Lin28 and of several let-7 target mRNAs (4E-BP1, Sall4, Hmga2) was more pronounced in LRRK2 -deficient ES cells after retinoic acid treatment. [score:3]
0020820.g008 Figure 8Lin28 protein and let-7 miRNA are key regulators of pluripotency and differentiation, respectively. [score:2]
Lin28 protein and let-7 miRNA are key regulators of pluripotency and differentiation, respectively. [score:2]
[1 to 20 of 11 sentences]
35
[+] score: 37
It has also been shown that Lin28b -dependent regulation of let-7 controls the self-renewal potential of fetal and adult HSCs by modulating its target Hmga2 [54]. [score:4]
Let-7 miRNAs have been implicated in the lineage commitment to natural killer T (NKT) cells and fetal B lymphocytes by targeting key transcription factors PLZF [52] and Arid3a [53], respectively. [score:3]
The 3′-untranslated region (UTR) of the Alox5 mRNA contains a predicted let-7 binding sequence (Fig.   7a). [score:3]
Fig. 7Alox5 is a novel target of the let-7 family of miRNAs. [score:3]
Transfection of let-7e mimic but not miR-125 or miR-142 mimic into RAW 264.7 cells mediated the reduction of Alox5 mRNA (Fig.   7d), indicating that Alox5 is a novel target of the let-7 family of miRNAs. [score:3]
When let-7e was transfected, however, the number of total colonies increased 2.5-fold compared to control, demonstrating that the restoration of let-7e and downregulation of Alox5 is sufficient to rescue the functional maturation of Drosha -depleted HSPCs. [score:3]
Our study of conditional Drosha knockout mice uncovers a role for let-7 miRNAs in developmental hematopoiesis, within a newly discovered stage that occurs after the emergence of HSPC clusters but prior to their mobilization to the FL. [score:3]
Pobezinsky LA Let-7 microRNAs target the lineage-specific transcription factor PLZF to regulate terminal NKT cell differentiation and effector functionNat. [score:3]
b Schematic diagram of the Alox5-reporter construct (pISO-AL5) in which let-7 binding sequence in the Alox5 3′UTR (hatched box) was cloned at the 3′ end of the firefly luciferase gene upstream of SV40 poly(A). [score:1]
Thirty-four nucleotide sequence partially complementary to let-7 miRNA found in the 3′UTR of Alox5 mRNA (5′-CAATAAAAAAGCTGGTCTACTACCTCCTCCAACG-3′) was cloned at SacI and NheI site of the firefly luciferase miRNA sensor pISO (Addgene, plasmid #12178) [66] (pISO-AL5). [score:1]
Copley MR The Lin28b-let-7-Hmga2 axis determines the higher self-renewal potential of fetal haematopoietic stem cellsNat. [score:1]
When Alox5 3′-UTR was inserted into the luciferase reporter construct pISO-AL5 (Fig.   7b), the luciferase activity was significantly reduced upon transfection of let-7e mimic but not control mimic (miR-142) (Fig.   7c). [score:1]
For transfection of let-7e mimic or control mimic (miR-142-5p), 18 n M miRNA mimics were transfected into cultured E10.5 AGM with Lipofectamine RNAiMAX (Thermo Fisher Scientific) following manufacturer’s instructions. [score:1]
a Sequence comparison of the let-7 family members and the sequence partially complementary to the seed sequence of let-7 (shaded) found in the 3′-UTR of Alox5 mRNAs. [score:1]
For let-7e, n = Ctr: 23 embryos, c KO: 6 embryos. [score:1]
The let-7 family of miRNAs, which shares a common seed sequence (Fig.   7a), was abundant in Ctr AGMs, and reduced more than 50% in c KO AGMs (Supplementary Table  4). [score:1]
pISO, pISO-AL5 (100 ng each), and renilla luciferase plasmid (1 ng) were transfected with 6 pmol let-7e or control (miR-142-5p) mimic (mirVana® miRNA mimic, Thermo Fisher Scientific) into one well of a 24-well plate of HEK293 cells. [score:1]
c pISO-AL5 or empty pISO vector was cotransfected into HEK293 cells with 10 n M let-7e or miR-142 (control) mimic or vehicle alone (bottom). [score:1]
Therefore, we hypothesized that restoration of let-7 might be sufficient to rescue hematopoietic defects in c KO. [score:1]
n = 6. d Macrophage RAW 264.7 cells were transfected with 18 n M miR-142 (control), let-7e, or miR-125b mimic, followed by qRT-PCR analysis of Alox5 mRNAs (bottom). [score:1]
[1 to 20 of 20 sentences]
36
[+] score: 37
The proximal let-7-5p target sequence is close to a conserved miR-448 target sequence and the central let-7-5p target sequence close to a conserved miR-143 target sequence (Fig.  3a–b) [29, 30]. [score:9]
Figure 3. Conserved microRNA target sequences of stratum 1. (a– c) let-7 target sequences; (d) tandem target sequences for miR-182. [score:7]
In addition to the polyadenylation site, this region contains a miR-7-3p target site that has been lost from the Pelodiscus sequence (Fig.  2b), a conserved let-7-3p target site (Fig.  2c) and a conserved miR-186 target site (Fig.  2d). [score:7]
The 4.8-kb gigaloop is a putative structure formed by pairing of VCR and a complementary sequence (cVCR) Figure 2. Conserved sequences of stratum 1 (shared by Homo and Callorhinchus IGF1R 3'-UTRs): (a) the 3' end of the long IGF1R transcript; (b) a miR-7-3p target site that has been lost from the Pelodiscus sequence; (c) let-7-3p target site; (d) miR-186 target site; (e) The VCR with predicted binding sites for miR-376c, miR-675 (derived from the imprinted H19 RNA) and miR-16. [score:7]
The 3'-UTR of human IGF1R possesses three target sequences for let-7-5p microRNAs [28]. [score:3]
Postranscriptional regulation of IGF1R by let-7, miR-7 and miR-182 are plausible candidates for such ancient functions because these microRNA families are themselves ancient, conserved between protostomes and deuterostomes [32–34]. [score:2]
The let-7 family of microRNAs. [score:1]
We found that some ancient microRNAs, such as let-7 and mir-182, have predicted binding sites that are conserved between cartilaginous fish and mammals. [score:1]
[1 to 20 of 8 sentences]
37
[+] score: 36
Other miRNAs from this paper: cel-let-7, cel-mir-1, cel-mir-35, cel-mir-52, cel-mir-58a, dme-mir-1, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, dme-bantam, mmu-let-7d, dme-let-7, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-1a-2, cel-lsy-6, dre-mir-430a-1, dre-mir-430b-1, dre-mir-430c-1, dre-let-7a-1, dre-let-7a-2, dre-let-7a-3, dre-let-7a-4, dre-let-7a-5, dre-let-7a-6, dre-let-7b, dre-let-7c-1, dre-let-7c-2, dre-let-7d-1, dre-let-7d-2, dre-let-7e, dre-let-7f, dre-let-7g-1, dre-let-7g-2, dre-let-7h, dre-let-7i, dre-mir-1-2, dre-mir-1-1, dre-mir-16a, dre-mir-16b, dre-mir-16c, dre-mir-430c-2, dre-mir-430c-3, dre-mir-430c-4, dre-mir-430c-5, dre-mir-430c-6, dre-mir-430c-7, dre-mir-430c-8, dre-mir-430c-9, dre-mir-430c-10, dre-mir-430c-11, dre-mir-430c-12, dre-mir-430c-13, dre-mir-430c-14, dre-mir-430c-15, dre-mir-430c-16, dre-mir-430c-17, dre-mir-430c-18, dre-mir-430a-2, dre-mir-430a-3, dre-mir-430a-4, dre-mir-430a-5, dre-mir-430a-6, dre-mir-430a-7, dre-mir-430a-8, dre-mir-430a-9, dre-mir-430a-10, dre-mir-430a-11, dre-mir-430a-12, dre-mir-430a-13, dre-mir-430a-14, dre-mir-430a-15, dre-mir-430a-16, dre-mir-430a-17, dre-mir-430a-18, dre-mir-430i-1, dre-mir-430i-2, dre-mir-430i-3, dre-mir-430b-2, dre-mir-430b-3, dre-mir-430b-4, dre-mir-430b-6, dre-mir-430b-7, dre-mir-430b-8, dre-mir-430b-9, dre-mir-430b-10, dre-mir-430b-11, dre-mir-430b-12, dre-mir-430b-13, dre-mir-430b-14, dre-mir-430b-15, dre-mir-430b-16, dre-mir-430b-17, dre-mir-430b-18, dre-mir-430b-5, dre-mir-430b-19, dre-mir-430b-20, dre-let-7j, mmu-mir-1b, cel-mir-58b, mmu-let-7j, mmu-let-7k, cel-mir-58c
pab-1 and pab-2 genetically cooperate with miRNAs let-7 was previously implicated in the translation repression of its targets during the larval developmental stages of C. elegans (32). [score:6]
let-7 was previously implicated in the translation repression of its targets during the larval developmental stages of C. elegans (32). [score:6]
Ecsedi M. Rausch M. Grosshans H. The let-7 microRNA directs vulval development through a single target Dev. [score:5]
Bursting was recently attributed to the mis-regulation of a single target, lin-41, as mutating a single let-7 binding site in lin-41 3′UTR recapitulates the phenotype (36). [score:4]
let-7(n2853) animals (L1) were fed with bacterially-expressed dsRNA against the indicated gene, or L4 animals injected with dsRNA (B) and F1 animals were scored for bursting vulva phenotype at the permissive temperature (16°C). [score:3]
Nolde M. J. Saka N. Reinert K. L. Slack F. J. The Caenorhabditis elegans pumilio homolog, puf-9, is required for the 3′ UTR -mediated repression of the let-7 microRNA target gene, hbl-1 Dev. [score:3]
These results demonstrate that pab-1 and pab-2 are required for the full function of let-7 in larval development. [score:2]
To examine the role of PAB-1 and PAB-2 and other proteins identified in our proteomic survey in miRNA -mediated translation repression, we tested their genetic interaction with let-7. As previously noted, complete genetic depletion of pab-1 and pab-2 leads to sterility, due to germline proliferation defects and pleiotropic effects (33, 34); we thus employed a sensitized genetic assay based on the temperature-sensitive let-7(n2853) hypomorphic allele. [score:2]
Figure 2. pab-1 and pab-2 genetically cooperate with let-7 and lsy-6 miRNAs. [score:1]
All strains were grown at 22°C except let-7(n2853), which was maintained at 16°C. [score:1]
Akay A. Craig A. Lehrbach N. Larance M. Pourkarimi E. Wright J. E. Lamond A. Miska E. Gartner A. RNA -binding protein GLD-1/quaking genetically interacts with the mir-35 and the let-7 miRNA pathways in Caenorhabditis elegans Open Biol. [score:1]
Worm strains used: N2 Bristol (WT), pab-2 (ok1851), let-7 (n2853), MH2636 (otIs114(Plim-6::GFP, rol-6(d)), lsy-6(ot150)), FD01(pab-2(ok1851), otIs114(Plim-6::GFP, rol-6(d)), lsy-6(ot150)), FD02(pab-2(ok1851), otIs114(Plim-6::GFP, rol-6(d))). [score:1]
Accordingly, deadenylation of a 6×-let-7 reporter reached half-completion at ∼3 h in mouse ascites and was fully impaired by PABP depletion (5), whereas a 8x-let-7 reporter was deadenylated much faster in Drosophila lysates (T [1/2] <30 min), and did not require PABP (20). [score:1]
[1 to 20 of 13 sentences]
38
[+] score: 35
Importantly, it has been demonstrated that self-renewal and neuronal differentiation of neural precursors is controlled by Sox-2 that regulates the expression of LIN28, a suppressor of let-7 miRNA biogenesis [36]. [score:6]
Notably, although irradiation significantly decreases the expression level of all members of the let-7 family regardless of genotype, this effect is particularly marked in Ptch1 mutant cells suggesting cooperation of radiation insult with Shh deregulation en route to stem cell deregulation and tumorigenesis. [score:5]
The let-7 family has gained notoriety owing to its regulation of stem cell differentiation, essential role in normal development, as well as its tumor suppressor function [31]. [score:5]
These evidences explain the significant decreased expression of let-7 family we found in unirradiated Ptch1 -deficient GCPs and suggest an involvement of these miRNAs in spontaneous MB development in Ptch1 [+/−] mice. [score:4]
The correlation between let-7 family and the immediate cellular response to irradiation was described by Weidhaas and colleagues in normal and cancer cell lines [37]; they found down-regulation of most members of the let-7 family within 2h after irradiation in both cancerous and normal lung epithelium cells. [score:4]
First, we analyzed the expression of 3 members of the let-7 family, i. e. let-7a, let-7b and let-7c, involved in DNA damage response. [score:3]
Comparison of these results with miRNAs listed in Table 1, shows that 4 miRNAs, such as members of let-7 family, miR-99a, miR-34c and miR-144 were in common, while only miR-144 is in common with miRNAs listed in Table 2, indicating its potential role in MB development after irradiation. [score:2]
In unirradiated condition, we found a statistically significant decreased expression of all let-7 family members in Ptch1 [+/−] compared with WT GCPs. [score:2]
An important aspect highlighted by our analysis was the significant dowregulation of three different members of the let-7 family observed in unirradiated Ptch1 mutant compared with WT cells. [score:1]
It represses premature expansion of progenitors and production of post-mitotic neurons functioning opposite to let-7, as its loss leads to acceleration, rather than delay in differentiation [40]. [score:1]
Regarding CNS, Wulczyn and colleagues [32] presented evidence for both transcriptional and post-transcriptional control mechanisms in the induction of let-7 family members during neural differentiation. [score:1]
Bonferroni post-hoc tests confirmed for all let-7 miRNAs a statistically significant difference among the two genotypes at both doses (P < 0.001). [score:1]
[1 to 20 of 12 sentences]
39
[+] score: 35
Compared with KHSRP-WT, re -expression of KHSRP-K87R into stable cell line DU145-shKHSRP, a subset of miRNAs such as let-7 family were upregulated (Fig. 4d- e; Additional file  10: Table S4) and consequently the tumor-suppressive capabilities were enhanced (Fig. 3a-e). [score:7]
Indeed, 151 miRNAs including let-7 family were down-regulated due to KHSRP knockdown (Fig. 4c; Additional file 9: Table S3). [score:5]
Among these miRNAs, the let-7 family, which are important tumor suppressor miRNAs [46, 47], are the most classic examples of KHSRP positively regulating miRNA biogenesis [7, 10]. [score:4]
Consequently, SUMO1 modification of KHSRP impairs the processing step of pre-miRNAs from pri-miRNAs which especially harbor short G-rich stretches in their terminal loops (TL), resulting in the downregulation of a subset of TL-G-Rich miRNAs such as let-7 family and consequential tumorigenesis. [score:4]
As expectedly, 51 miRNAs including let-7i, let-7g, let-7e and miR-98 were up-regulated by the mutant KHSRP-K87R compared with by KHSRP-WT (Fig. 4c- d; Additional file  10: Table S4). [score:3]
As a result of the above orchestrating, the pre-miRNA processing from pri-miRNA harboring short G-rich stretches in the terminal loop was impaired, thus leading to the decrease of a subset of mature miRNAs, especially like tumor suppressive miRNAs let-7 family. [score:3]
Furthermore, we observed that the dysregulation of TL-G-Rich miRNAs such as the members of let-7 family mediated by KHSRP SUMOylation was linked to tumorigenesis and cancer progression. [score:2]
KHSRP contains four KH domains that bind to the single-stranded nucleic acids, and specifically to short G-rich stretches in the terminal loop (TL-G-rich) of primary/precursor miRNAs, which favors the maturation of a subset of miRNAs including let-7 family [7– 10]. [score:1]
In particular, of 151 KHSRP -dependent miRNAs, there were 51 miRNAs (including let-7 family let-7i, let-7e, let-7g and miR-98 etc. ) [score:1]
All of pri-let-7e, pri-let-7g, pri-let-7i, pri-miR-98 and pri-miR-182 harbored G-rich stretches in their terminal loops, as like pri-let-7a-1 and pri-let-7a-3. b KHSRPΔN fusing with SUMO1 decreases its interaction with pri-let-7a-1 and the mature let-7a production. [score:1]
The third KH domain (KH3) of KHSRP recognizes short G-rich sequences in the pre-let-7 terminal loop and dominates the interaction [10], but it is not clear whether SUMOylation of the protein influences the formation of the KH3-pri-miRNA complex. [score:1]
For instances, as like pri-let-7a-1 [9, 10], the secondary structures of pri-miRNAs including pri-let-7a-3, pri-let-7g, pri-let-7i, pri-let-7e, pri-miR-98 and pri-miR-182 contained G-rich stretches (Fig.   6a). [score:1]
Moreover, by using the RNAstructure software, we analyzed the secondary structures to show short G-rich stretches in the terminal loop of these pri-miRNAs (Additional file  10: Table S4), for instances, pri-let-7a-1, pri-let-7a-3, pri-let-7e, pri-let-7g, pri-let-7i, miR-98 and pri-miR-182 (Fig. 6a). [score:1]
Consistently, let-7 family and other miRNAs as KHSRP -dependent miRNAs whose precursor terminal loops harbor short G-rich stretches [7, 8], were included in the above set of miRNAs. [score:1]
[1 to 20 of 14 sentences]
40
[+] score: 33
Live pathogens down-regulate the expression of let-7 family miRNAs, and let-7 miRNAs act on toll-like receptors (e. g. TLR4) that directly mediate macrophage responses [54– 56]. [score:7]
Enrichment of bma-let-7 and the high fractional presence of other parasite miRNAs sharing perfect or high homology to host miRNAs, leads us to speculate about a potential ELV -mediated mechanism by which parasite RNAs can be used to efficiently direct aspects of gene expression in host cells. [score:4]
Targets of endogenous let-7 family miRNAs in vertebrates include oncogenes, as well as genes involved in proliferation, apoptosis, and innate immunity [51– 53]. [score:3]
Let-7 is intricately involved in macrophage polarization and responses to pathogen challenge [31, 33, 54], and the altering of host let-7 expression therefore represents a potentially advantageous point of intervention for an invading parasite. [score:3]
Bma-let-7 only appears in the highly expressed subset, and a number of miRNAs with perfect mature sequence identity to host homologs are highlighted (outer blue circle). [score:3]
Our observation that B. malayi secrete let-7 and other potential modulators of host gene expression identifies a mechanism by which this host immune response might be manipulated. [score:3]
Clearly, there is an important association between macrophage response to pathogens and let-7 expression. [score:3]
Supporting this hypothesis, let-7 and other miRNAs with host conservation have been identified in immunomodulatory H. polygyrus adult stage exosomes [26]. [score:1]
bma-let-7 is shown as an example of a Brugia ELV miRNA that exhibits both seed site and full length sequence conservation extending to other parasitic and free-living nematodes, as well as to mammalian host species. [score:1]
The let-7 family of microRNAs. [score:1]
Common markers include let-7, lin-4, miR-34, miR-71, miR-92, and miR-100c (Fig 7A and 7B). [score:1]
Alignments are shown for bma-let-7, bma-miR-9 and bma-miR-993. [score:1]
Bma-let-7, bma-miR-1, bma-miR-9, bma-miR-92, and bma-miR-100b (white asterisks) share 100% identity with a host miRNA, while bma-miR-34 shows high identity with a host miRNA (21/23 nucleotides). [score:1]
Bma-let-7, along with four other B. malayi mature miRNAs found in ELVs (bma-miR-1, bma-miR-9, bma-miR-92, and bma-miR-100b), share perfect sequence identity with host (Homo sapiens) mature miRNAs, as shown in Fig 5B. [score:1]
[1 to 20 of 14 sentences]
41
[+] score: 33
The tumor-suppressor let-7 miRNA family has been shown to be universally down-regulated in CSCs, because of abundant expression of the regulatory gene Lin28. [score:9]
Low let-7 levels resulted in up-regulation of oncogenes including MYCN, AURKB and Lin28 itself, the latter through a direct feedback mechanism. [score:5]
It has been shown that let-7 family of miRNAs plays an important role in cell differentiation, development and tumor suppression [31]. [score:4]
Lin28 is a developmentally regulated RNA binding protein which regulates the biogenesis of let-7 micro -RNA family [32, 33]. [score:4]
Let-7 is required for normal gene expression in the context of embryonic development and oncogenesis. [score:3]
Overexpression of LIN28 correlates with poor outcome [43, 44], therefore drugs that impact the Lin28/Let-7 pathway could be beneficial in treating cancer patients. [score:2]
Let-7 may inhibit Kras, whereas Lin28 protein could control the PI3k/AKT pathway [41]. [score:2]
Lin28/Let-7 pathway regulates several biological processes, such as differentiation of stem cell, invasion and metastasis, aerobic glycolysis, and tumorigenesis [34, 38– 40, 42– 44]. [score:1]
We have demonstrated that the Lin28/Let-7/Kras axis is regulated by NVP-LDE-225 and NVP-BEZ-235 in pancreatic CSCs. [score:1]
The Lin28/Let-7 pathway affects many cellular processes including the regulation of CSCs, differentiation and glycolytic metabolism [34, 38– 41]. [score:1]
Let-7 and Lin28 regulate several biological processes, such as differentiation of stem cell, invasion and metastasis, aerobic glycolysis, and tumorigenesis [34, 38– 40, 42– 44]. [score:1]
[1 to 20 of 11 sentences]
42
[+] score: 31
Perhaps, up-regulation of male-specific miRNA, including the let-7 family, may play a role in preventing cell cycle progression despite high levels of expression of miR-17-92 cluster. [score:6]
By contrast, the expressions of miRNAs belonging to let-7 family (let-7a, d, e, f and g) were up-regulated after E11.5 and reached the highest levels at E13.5. [score:6]
In contrast to miR-17-92 cluster, the function of let-7 family is predicted as tumor suppressors through suppression of Ras/MAPK pathway [33], [34]. [score:5]
Interestingly, the up-regulation of the let-7 family was only observed in male PGCs. [score:4]
By contrast, expression levels of three miRNAs belonging to let-7 miRNA family (let-7a, d, e, f and g), as well as miR-125a and miR-9 increased in male PGCs but not in female PGCs (Figure 1D). [score:3]
It is known that let-7 family functions in multiple differentiation events in various tissues and inhibit cell proliferation in cancer cells [34]. [score:3]
Furthermore, the expression of let-7 miRNAs is higher in differentiated cells compared to tumor cells [34]. [score:2]
These let-7 miRNAs share similar seed sequences, also suggesting their synergistic role in developing PGCs. [score:1]
These results indicate that these let-7 members may contribute to differentiation of male PGCs. [score:1]
[1 to 20 of 9 sentences]
43
[+] score: 31
Description miR-451[39] Upregulated in heart due to ischemia miR-22[40] Elevated serum levels in patients with stablechronic systolic heart failure miR-133[41] Downregulated in transverse aortic constrictionand isoproterenol -induced hypertrophy miR-709[42] Upregulated in rat heart four weeks after chronicdoxorubicin treatment miR-126[43] Association with outcome of ischemic andnonischemic cardiomyopathy in patients withchronic heart failure miR-30[44] Inversely related to CTGF in two rodent mo delsof heart disease, and human pathological leftventricular hypertrophy miR-29[45] Downregulated in the heart region adjacent toan infarct miR-143[46] Molecular key to switching of the vascular smoothmuscle cell phenotype that plays a critical role incardiovascular disease pathogenesis miR-24[47] Regulates cardiac fibrosis after myocardial infarction miR-23[48] Upregulated during cardiac hypertrophy miR-378[49] Cardiac hypertrophy control miR-125[50] Important regulator of hESC differentiation to cardiacmuscle(potential therapeutic application) miR-675[51] Elevated in plasma of heart failure patients let-7[52] Aberrant expression of let-7 members incardiovascular disease miR-16[53] Circulating prognostic biomarker in critical limbischemia miR-26[54] Downregulated in a rat cardiac hypertrophy mo del miR-669[55] Prevents skeletal muscle differentiation in postnatalcardiac progenitors To further confirm biological suitability of the identified miRNAs, we examined KEGG pathway enrichment using miRNA target genes (see ). [score:31]
[1 to 20 of 1 sentences]
44
[+] score: 29
However among the top 100 upregulated tumour-derived miRNAs there are tumour-suppressors, in particular, miRNAs let-7 family (11 of 12 in the mammalian let-7 family, Figure 3) known to negatively regulate events of tumour progression [62], [63] and be important for cancer patient survival [64]. [score:7]
It is worth noting that all miRNAs from the let-7 family known to be tumour suppressors were upregulated in the tumour (Figure 3B). [score:6]
It is worth noting that in general the entire pattern of upregulated tumour-derived miRNAs is not unambiguous because we observed the activation of both tumour-suppressor (miRNAs of let-7 family, mir-451) and oncogenic miRNAs (mir-29b, mir-21). [score:6]
The typical pattern of changes in the levels of some oncogenic and tumour-suppressor miRNAs (A), and members of the let-7 miRNA superfamily (B) in LLC tumour tissue and serum of tumour-bearing mice after RNase A therapy. [score:3]
The analysis of miRNA profiles showed that the altered pool of miRNAs contained a considerable number of ascertained tumour -associated miRNAs, both oncogenic and tumour-suppressing, such as miRNAs from the let-7 family, mir-107, mir-155, mir-15, mir-16, mir-21, mir-10b, mir-145, mir-451a, mir-29b1, mir-17, mir-18a, and others. [score:3]
0083482.g003 Figure 3The typical pattern of changes in the levels of some oncogenic and tumour-suppressor miRNAs (A), and members of the let-7 miRNA superfamily (B) in LLC tumour tissue and serum of tumour-bearing mice after RNase A therapy. [score:3]
Here, we also found it necessary to show the data on miRNAs of the let-7 family (Figure 3B). [score:1]
[1 to 20 of 7 sentences]
45
[+] score: 29
Specifically, two miRNAs (miR-18a-5p and miR-574-3p) were upregulated in the Mn [2+] -induced NPA mo del, while let-7e-5p was downregulated and miR-205-5p was upregulated in the chlorpromazine -induced NPA mo del. [score:10]
In the lupus-like disease produced by chlorpromazine -induced NPA, let-7e-5p and miR-205-5p were downregulated and upregulated, respectively. [score:9]
Among them, let-7e-5p and miR-205-5p, found only in the mo del produced with chlorpromazine -induced NPA, are known to enhance TLR4 expression (let-7e-5p) [21], provoke ERBB3 downregulation, and decrease apoptosis (miR-205-5p) [47]. [score:6]
The remaining six deregulated miRNAs: let-7e-5p, miR-18a-5p, miR-23b-3p, miR-205-5p, miR-207, and miR-574-3p, which are specific to each of our murine lupus-like mo dels, highlight some differences between them, but also show roles on inflammation and immune disease. [score:4]
[1 to 20 of 4 sentences]
46
[+] score: 29
Systematic analysis of let-7 family members revealed that overexpression of let-7c inhibited M1 polarization and promoted M2 polarization through the regulation of CEBP-δ expression (187). [score:8]
There are several reports of changes in let-7 miRNA expression in human diseases, including asthma/allergy (182), myasthenia gravis (183), MS (184), and Alzheimer’s disease (185, 186). [score:7]
MicroRNA let-7 downregulates STAT3 phosphorylation in pancreatic cancer cells by increasing SOCS3 expression. [score:6]
The discovery of new let-7 family members and targets demonstrates there is a great deal that remains to be understood about this miRNA family in regulating SOCS expression and macrophage biology. [score:6]
Several miRNAs, mir-19b (177), mir-203 (178), and let-7 (179), are predicted to bind SOCS3 transcripts. [score:1]
The human genome contains 11 let-7 miRNA genes that produce eight different mature let-7 miRNAs. [score:1]
[1 to 20 of 6 sentences]
47
[+] score: 28
We identified a network containing seven upregulated conserved miRs (mmu-miR-1224-5p, mmu-miR-188-5p, mmu-miR-139-5p, mmu-miR-15b-5p, mmu-miR-721, mmu-miR-18a-5p and mmu-miR-130b-3p) and another network consisting of downregulated miRs belonging to 3 highly conserved miR families (let-7, mir-30 and mir-34). [score:7]
A complementary approach using miRHub analysis 37, 38 identified candidate key regulatory miRs based on conserved target sites in DE mRNAs, of which 10 individual miRs are differentially expressed (mmu-miR-125a-5p/mmu-miR-125b-5p, mmu-let-7a-5p/ mmu-let-7c-5p/mmu-let-7d-5p/mmu-let-7e-5p/mmu-let-7f-5p, mmu-miR-126-3p, mmu-miR-335-5p and mmu-miR-23b-3p; see Fig.   6 and Supplementary Tables  8 and 9). [score:6]
The consensus DE miRs whose expression is anti-correlated with their DE predicted targets (mmu-miR-125a-5p/mmu-miR-125b-5p, mmu-let-7b-5p/mmu-let-7c-5p/mmu-let-7d-5p/mmu-let-7e-5p/mmu-let-7f-5p, mmu-miR-126-3p, mmu-miR-335-5p and mmu-miR-23b-3p) are designated as candidate key regulatory miRs (miRhubs), which may represent major control points in the network-level neutrophil response to S. pneumoniae. [score:6]
Fourteen individual miRs belonging to six miR families (miR-125a-5p/125b-5p/351/670/4319, let-7, miR-126-3p, miR-205/205ab, miR-335/335-5p and miR-23abc/23b-3p) were downregulated during pneumonia (Supplementary Table  11). [score:4]
Ten individual miRs out of the 14 miRs belonging to five of the six miR families (miR-125a-5p/125b-5p/351/670/4319, let-7, miR-126-3p, miR-335/335-5p and miR-23abc/23b-3p) were consensus DE miRs, i. e., they were significantly downregulated at least 2-fold during S. pneumoniae pneumonia using both LVS and RMA normalization (Fig.   6 and Supplementary Table  11). [score:4]
These include 5 members of the broadly conserved let-7 family (mmu-let-7b-5p, mmu-let-7c-5p, mmu-let-7d-5p, mmu-let-7e-5p, and mmu-let-7f-5p); 2 members of the miR-30 family (mmu-miR-30a-5p and mmu-miR-30c-5p), and 3 members of the miR-34 family (mmu-miR-34a-5p, mmu-miR-34b-5p and mmu-miR-34c-5p). [score:1]
[1 to 20 of 6 sentences]
48
[+] score: 28
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-20a, hsa-mir-22, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-98, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-15b, mmu-mir-101a, mmu-mir-126a, mmu-mir-130a, mmu-mir-133a-1, mmu-mir-142a, mmu-mir-181a-2, mmu-mir-194-1, hsa-mir-208a, hsa-mir-30c-2, mmu-mir-122, mmu-mir-143, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-181a-1, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-122, hsa-mir-130a, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-142, hsa-mir-143, hsa-mir-126, hsa-mir-194-1, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-208a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29c, mmu-mir-98, mmu-mir-326, rno-mir-326, rno-let-7d, rno-mir-20a, rno-mir-101b, mmu-mir-101b, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-181b-2, mmu-mir-17, mmu-mir-19a, mmu-mir-181a-1, mmu-mir-26a-2, mmu-mir-19b-1, mmu-mir-181b-1, mmu-mir-181c, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-26a-2, hsa-mir-378a, mmu-mir-378a, hsa-mir-326, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-15b, rno-mir-16, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19a, rno-mir-22, rno-mir-26a, rno-mir-26b, rno-mir-29c-1, rno-mir-30c-1, rno-mir-30c-2, rno-mir-98, rno-mir-101a, rno-mir-122, rno-mir-126a, rno-mir-130a, rno-mir-133a, rno-mir-142, rno-mir-143, rno-mir-181c, rno-mir-181a-2, rno-mir-181b-1, rno-mir-181b-2, rno-mir-194-1, rno-mir-194-2, rno-mir-208a, rno-mir-181a-1, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, ssc-mir-122, ssc-mir-15b, ssc-mir-181b-2, ssc-mir-19a, ssc-mir-20a, ssc-mir-26a, ssc-mir-326, ssc-mir-181c, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-18a, ssc-mir-29c, ssc-mir-30c-2, hsa-mir-484, hsa-mir-181d, hsa-mir-499a, rno-mir-1, rno-mir-133b, mmu-mir-484, mmu-mir-20b, rno-mir-20b, rno-mir-378a, rno-mir-499, hsa-mir-378d-2, mmu-mir-423, mmu-mir-499, mmu-mir-181d, mmu-mir-18b, mmu-mir-208b, hsa-mir-208b, rno-mir-17-2, rno-mir-181d, rno-mir-423, rno-mir-484, mmu-mir-1b, ssc-mir-15a, ssc-mir-16-2, ssc-mir-16-1, ssc-mir-17, ssc-mir-130a, ssc-mir-101-1, ssc-mir-101-2, ssc-mir-133a-1, ssc-mir-1, ssc-mir-181a-1, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-378-1, ssc-mir-133b, ssc-mir-499, ssc-mir-143, ssc-mir-423, ssc-mir-181a-2, ssc-mir-181b-1, ssc-mir-181d, ssc-mir-98, ssc-mir-208b, ssc-mir-142, ssc-mir-19b-1, hsa-mir-378b, ssc-mir-22, rno-mir-126b, rno-mir-208b, rno-mir-133c, hsa-mir-378c, ssc-mir-194b, ssc-mir-133a-2, ssc-mir-484, ssc-mir-30c-1, ssc-mir-126, ssc-mir-378-2, ssc-mir-451, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, mmu-mir-101c, hsa-mir-451b, hsa-mir-499b, ssc-let-7a-2, ssc-mir-18b, hsa-mir-378j, rno-mir-378b, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-mir-451b, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-194a, mmu-let-7k, mmu-mir-126b, mmu-mir-142b, rno-let-7g, rno-mir-15a, ssc-mir-378b, rno-mir-29c-2, rno-mir-1b, ssc-mir-26b
Thus, miRNA families (e. g., miR-1 and miR-122) that are specifically or highly expressed in any one of the 3 tissues, or miRNAs that are expressed ubiquitously (e. g., let-7 and miR-26) in all 3 tissues, show a far greater frequency than other miRNAs. [score:5]
Interestingly, the expression abundance varies among the let-7 family members (Tables 1 and 2); let-7a and let-7j, each have 80 reads; similarly, let-7b, let-7c and let-7e have almost the same number of reads (63–64); let-7d, let-7f and let-7j have 18 to 32 reads; and let-7h, let-7i and let-7k have a lower number of reads (5–9) (Tables 1 and 2). [score:3]
For instance, let-7 is represented by 445 reads and miR-26 by 177 reads (Tables 1 and 2), and these two miRNAs are ubiquitously expressed in the heart, liver and thymus (Figure 3A and 3B). [score:3]
Hence the let-7 miRNA family is represented by 11 members, and this study provides the evidence for the expression of all 11 let-7 family members in pig. [score:3]
Here, we found evidence for the expression of all 10 let-7 members in pig. [score:3]
Additionally, many other miRNAs, such as let-7, miR-98, miR-16, miR22, miR-26b, miR-29c, miR-30c and miR126, were also expressed abundantly in thymus (Figure 3). [score:3]
Similarly, let-7, miR-98, miR-16 and miR-130a are abundantly expressed in 13 of the 14 tissues (except in pancreas) (Figure 3A). [score:3]
let-7, miR-98, miR-130a and miR-16 showed uniform levels of expression in 13 different tissues but were hardly detected in pancreas (Figure 3A). [score:3]
The miR-98 sequence differs from that of the let-7 family by one nt at position 11 from the 5' end, thus miR-98 is also a member of the let-7 family. [score:1]
The let-7 family has 10 members in diverse animal species (miRBase). [score:1]
[1 to 20 of 10 sentences]
49
[+] score: 28
Several of these miRs have previously been shown to exert regulatory effects in the heart: miR-486-3p, upregulated in the sinus node of the trained mice (Figure 2E and 2F), has previously been shown to be upregulated in the hearts of swim-trained mice and involved in the antifibrotic effects of exercise [37]; Let-7e, upregulated in the sinus node of the trained mice (Figure 2E and 2F), has previously been shown to have an antiarrhythmic effect mediated via a downregulation of the β1 adrenergic receptor in myocardial infarction rats [38]; finally, miR-10b-5p, downregulated in the sinus node of the trained mice (Figure 2E and 2F), has previously been shown to regulate the key cardiac transcription factor Tbx5, known to be involved with the cardiac conduction system. [score:18]
After applying a 5% Benjamini–Hochberg false discovery rate correction, miR-5099, miR-486-3p, miR-423-5p, Let-7d-3p, miR-676-3p, miR-181b-5p, and Let-7e-5p were significantly upregulated and miR-10b-5p downregulated (Figure 2E, hatched bars). [score:7]
Li X Wang B Cui H Du Y Song Y Yang L Zhang Q Sun F Luo D Xu C Chu W Lu Y Yang B let-7e replacement yields potent anti-arrhythmic efficacy via targeting beta 1-adrenergic receptor in rat heart. [score:3]
[1 to 20 of 3 sentences]
50
[+] score: 28
Thus, we hypothesize that modulation of let-7 expression and its target RAS is a promising strategy for HCC treatment, because let-7 might suppress HCC tumour growth by down -regulating all human ras genes. [score:8]
Next, we analysed the expression of let-7 target ras genes at the transcriptional and translational levels 48 h after transfection. [score:7]
A recent study in C. elegans reports that the let-7 family negatively regulates let-60/RAS, and also that the let-60/RAS 3′-UTRs, including the 3′-UTRs of the human ras genes, contain multiple let-7 complementary sites (LCSs), which allow let-7 to regulate RAS protein expression [12]. [score:5]
Furthermore, let-7 has been reported to inhibit tumour growth by down -regulating KRAS in some cancers, such as pancreatic carcinoma and lung cancer [13, 14]. [score:4]
A major challenge to the clinical utility of let-7 for hepatocellular carcinoma (HCC) therapy is the lack of an effective carrier to target tumours. [score:3]
Trang and colleagues [18] found that synthetic miR-34a and let-7 mimics caused lung tumour reduction in mice. [score:1]
[1 to 20 of 6 sentences]
51
[+] score: 27
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-30a, hsa-mir-98, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-132, mmu-mir-133a-1, mmu-mir-135a-1, mmu-mir-150, mmu-mir-155, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-217, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-150, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-34a, mmu-mir-98, mmu-mir-322, mmu-mir-338, hsa-mir-155, mmu-mir-17, mmu-mir-19a, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-217, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-338, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, hsa-mir-18b, hsa-mir-503, mmu-mir-541, mmu-mir-503, mmu-mir-744, mmu-mir-18b, hsa-mir-541, hsa-mir-744, mmu-mir-133c, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Since all members of the let-7 family are downregulated during osteocytic differentiation (Table 1) it was predicted that the downregulation of the let-7 family could be associated with an eventual repression of the dmp1 gene. [score:7]
miRNA downregulated by two weeks osteo-induction included members of the let-7 and miR-30 families (miR-30a/d/e) (Table 1). [score:4]
A recent study proposed that Lin28 is essential in embryonic stem cells (ESC), induced pluripotent stem cells (iPSC) and tumorigenesis and that the expression of LIN28 is controled by let-7, miR-9, miR-125 and miR-30 [41], indicating not only miR-30, but let-7, miR-9 and miR-125 can control lin28a during osteogenesis. [score:3]
Target of miR-30 family, miR-34 family, let-7 family, miR-15/16 family (including miR-322/424), miR-21 family, miR-541/654 was predicted and selected using cut off score −0.2. [score:3]
Stem, Dev, signals M miR-30b LRP6 −0.5 Frizzled co-receptor for Wnt signaling Dev, signal M miR-30b LIN28A −0.46 Inhibit pri-let-7 maturation in cytoplasm. [score:3]
LIN28A is essential in induced pluripotent stem cells (iPSC) and represses the let-7 tumor-suppressor miRNA family [40]. [score:3]
RNA, Stem C miR-30e LIN28B −0.71 Inhibit pri-let-7 maturation in nucleus. [score:3]
A let-7/miR-98 recognition site was predicted in the 3′-UTR region of dmp1 mRNA with broad conservation among vertebrates (Fig. S1). [score:1]
[1 to 20 of 8 sentences]
52
[+] score: 27
Upregulation of let-7 is a prominent feature of ESC differentiation, and ESCs are characterised by a striking down-regulated let-7 expression, which is dominantly expressed in most differentiated cells in the vast majority of tissues [105]. [score:9]
Down regulation of let-7 has also been associated with cisplatin and taxol resistance [111, 112], which suggests that restoring the expression of let-7 may be a useful therapeutic option overcoming drug resistance. [score:4]
Viral delivery of let-7 has also been shown to suppress the tumor growth in a mouse mo del of lung adenocarcinoma [113]. [score:3]
By using an in silico approach, let-7, Lin28 and Oct4 were identified as targets of miR-125b, suggesting that the manipulation of miR-125b -mediated pathways may be useful for reprogramming ESC to different lineages. [score:3]
Decreased expression of let-7 has been associated with the mesenchymal aggressive phenotype (C5) of high-grade serous ovarian carcinoma [110]. [score:3]
These studies suggest that increasing the expression of let-7 may be another novel therapeutic option to minimise/eradicate chemoresistant recurrent ovarian tumors. [score:3]
A high Lin28/low let-7 signature is common in ESC, iPSC and CSC [106]. [score:1]
In this context, let-7, miR-125. [score:1]
[1 to 20 of 8 sentences]
53
[+] score: 27
While over -expression of Let-7 blocks Lin28 gene expression, Lin28 expression degrades Let-7, maintaining a balance in their expression, controlling development and disease [37]. [score:11]
Levels of Lin28 expression decline over the course of embryonic development while let-7 miRNA’s simultaneously increase, suppressing self-renewal of undifferentiated cells and stimulating cell differentiation. [score:6]
Over -expression of Let-7 in Muse cells would potentially play a critical role in inhibiting Lin28 expression, and therefore would protect these cells from tumorigenic proliferation and teratoma formation after in vivo transplantation. [score:6]
Let-7, a microRNA that regulates embryonic development, cell differentiation and tumor suppression, has the opposite effect [37]. [score:4]
[1 to 20 of 4 sentences]
54
[+] score: 26
Within the epithelial compartment, cell type-specific expression was demonstrated for let-7 and miR-205, which were predominantly expressed in luminal and basal cells, respectively, confirming previous reports of their expression in human luminal and basal breast epithelium [40]. [score:7]
This observation is consistent with recent reports that let-7 expression is depleted in mouse mammary epithelial progenitors [38] and in breast tumour-initiating cells [39], and that enforced let-7 expression could inhibit the self-renewal capacities of cells [38, 39]. [score:7]
While many miRNAs in cluster 1, including six members of the let-7 family, showed high expression during puberty (six weeks), maturity (ten weeks) and early gestation (five days), members of cluster 2 frequently peaked in their expression before puberty (19 days) and during late gestation (15 days). [score:5]
During mouse mammary gland development we observed that many let-7 family members showed a peak in expression during puberty, the mature virgin stage, and early gestation, followed by a marked decrease and low levels during lactation and involution. [score:4]
The subsequent decrease in let-7 expression during lactation may allow for a relative expansion of the progenitor compartment which is necessary for the reconstitution of the alveolar compartment during the next pregnancy cycle. [score:3]
[1 to 20 of 5 sentences]
55
[+] score: 26
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-32, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-30b, mmu-mir-126a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-137, mmu-mir-140, mmu-mir-150, mmu-mir-155, mmu-mir-24-1, mmu-mir-193a, mmu-mir-194-1, mmu-mir-204, mmu-mir-205, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-143, mmu-mir-30e, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-222, mmu-let-7d, mmu-mir-106a, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-137, hsa-mir-140, hsa-mir-143, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-126, hsa-mir-150, hsa-mir-193a, hsa-mir-194-1, mmu-mir-19b-2, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-34a, rno-mir-322-1, mmu-mir-322, rno-let-7d, rno-mir-329, mmu-mir-329, rno-mir-140, rno-mir-350-1, mmu-mir-350, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-32, mmu-mir-200c, mmu-mir-33, mmu-mir-222, mmu-mir-135a-2, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-7b, hsa-mir-194-2, mmu-mir-194-2, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-30e, hsa-mir-375, mmu-mir-375, mmu-mir-133b, hsa-mir-133b, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-7b, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-17-1, rno-mir-19b-1, rno-mir-19b-2, rno-mir-23a, rno-mir-24-1, rno-mir-24-2, rno-mir-25, rno-mir-27b, rno-mir-29a, rno-mir-30c-1, rno-mir-30e, rno-mir-30b, rno-mir-30d, rno-mir-30a, rno-mir-30c-2, rno-mir-31a, rno-mir-32, rno-mir-33, rno-mir-34a, rno-mir-92a-1, rno-mir-92a-2, rno-mir-106b, rno-mir-126a, rno-mir-135a, rno-mir-137, rno-mir-143, rno-mir-150, rno-mir-193a, rno-mir-194-1, rno-mir-194-2, rno-mir-200c, rno-mir-200a, rno-mir-204, rno-mir-205, rno-mir-222, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, mmu-mir-410, hsa-mir-329-1, hsa-mir-329-2, mmu-mir-470, hsa-mir-410, hsa-mir-486-1, hsa-mir-499a, rno-mir-133b, mmu-mir-486a, hsa-mir-33b, rno-mir-499, mmu-mir-499, mmu-mir-467d, hsa-mir-891a, hsa-mir-892a, hsa-mir-890, hsa-mir-891b, hsa-mir-888, hsa-mir-892b, rno-mir-17-2, rno-mir-375, rno-mir-410, mmu-mir-486b, rno-mir-31b, rno-mir-9b-3, rno-mir-9b-1, rno-mir-126b, rno-mir-9b-2, hsa-mir-499b, mmu-let-7j, mmu-mir-30f, mmu-let-7k, hsa-mir-486-2, mmu-mir-126b, rno-mir-155, rno-let-7g, rno-mir-15a, rno-mir-196b-2, rno-mir-322-2, rno-mir-350-2, rno-mir-486, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
This is consistent with current mo dels of let-7 function which indicate that the family members are barely detectable during embryonic development before being up-regulated in differentiated cells where they are likely to possess highly redundant roles through targeting of an overlapping set of mRNAs [33]. [score:7]
Similarly, dysregulation of let-7 leads to a less differentiated cellular state and the development of cell -based diseases such as cancer [51, 52]. [score:5]
It remains to be determined whether the 8 let-7 family members that are expressed in the epididymis have different activities or whether they collectively target a similar cohort of genes. [score:5]
Nevertheless, it is tempting to speculate that the redundancy in let-7 expression may contribute to the stringent molecular mechanisms that help the epididymis evade tumorigenesis. [score:3]
Let-7 (lethal-7) is a founding member of the miRNA family that was originally described in Caenorhabditis elegans, where it controls the timing of terminal differentiation, acting as a key regulator of multiple genes required for exit from the cell cycle (reviewed by [33]). [score:2]
The role of let-7 in cell differentiation and cancer. [score:1]
The let-7 miRNA family has since been shown to display a remarkable level of sequence and functional conservation across the animal kingdom, with 14 and 13 different family members represented in mouse and human, respectively [33]. [score:1]
The let-7 family of microRNAs. [score:1]
Interestingly, among the conserved miRNAs found in all epididymal regions, we identified 8/14 and 4/7 members of the let-7 family (let-7a—let-7f, let-7i) and miR-30 (miR-30a— miR-30d) family, respectively. [score:1]
[1 to 20 of 9 sentences]
56
[+] score: 26
In light of the conflicting expression patterns of let-7 family across human cancers [8], we first tested the expression levels of seven kinds of let-7 family members we have chosen in our study in 40 paired HCC tissues and their corresponding normal controls. [score:5]
In the present study, we have identified that expression of let-7g was lowest among the seven let-7 family members that we have chosen in terms of basal expression in clinical HCC tissues using the real-time RT-PCR, and that it is only let-7g that is significantly associated with metastasis of HCC. [score:5]
To observe the basal expression of let-7 family in HCC, we performed real-time RT-PCR to detect the 7 members of let-7 miRNA family in 40 paired HCC clinical tissues and paired normal control. [score:3]
In our present study, we found that among the let-7 family miRNAs, endogenous expression of let-7g was lowest in the clinical HCC tissues. [score:3]
A growing evidence suggests that restoration of let-7 expression has an antiproliferative effect on cancer cells of different kinds [8], thus indicating that let-7 restoration may be a useful therapeutic option in HCC. [score:3]
Let-7 is a family consisting of 13 members located on nine different chromosomes whose expression usually has been lost, reduced, or deregulated in the majority of human cancers [2]. [score:3]
Let-7 family has been reported to be downregulated significantly in HCC [8] whose 9 members have been found in humans [9]. [score:3]
Among the 9 members of let-7 family, let-7g was reported to be significantly associated with metastasis of HCC and breast cancer [10, 11]. [score:1]
[1 to 20 of 8 sentences]
57
[+] score: 25
Our microRNA array analysis of kidney samples revealed that expression of the microRNA mmu-let-7 family was suppressed in the diabetic kidney; we found that expression of most of the microRNA let-7 family members was restored by therapy with the combination of imidapril+AcSDKP (Supplementary Figure  2). [score:7]
In conclusion, AcSDKP is potentially a valuable endogenous antifibrotic molecule that inhibits the EndMT and restores the expression of the let-7 microRNA family through FGFR restoration at least in part. [score:5]
Chen et al. [19] reported that FGF receptor -mediated induction of microRNA let-7 family members, which exhibits kidney protective roles [17, 18], acts as negative regulators of the EndMT program via inhibition of the TGF- β signaling pathway [19]. [score:4]
The FGF receptor-microRNA let-7 family axis can suppress TGF- β receptor I levels [19, 21]. [score:3]
qPCR analysis also confirmed that certain sets of microRNA let-7 were indeed inhibited in diabetic mice (Supplementary Figure  2); treatment with the imidapril+AcSDKP combination therapy completely restored their levels. [score:3]
B, C, D. qPCR analysis for the indicated members of the let-7 microRNA family. [score:1]
These data are included in main Figure 2 C-D. Figure 2: AcSDKP restored microRNA let-7 family. [score:1]
The antifibrotic/anti-EndMT effects of AcSDKP were associated with restoration of the FGF receptor's levels and associated induction of microRNA let-7. Regard with this, microRNA let-7 family has been shown to protect kidney from fibrotic stimuli [17, 18]. [score:1]
[1 to 20 of 8 sentences]
58
[+] score: 23
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-30a, hsa-mir-31, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-9-2, mmu-mir-141, mmu-mir-145a, mmu-mir-155, mmu-mir-10b, mmu-mir-24-1, mmu-mir-205, mmu-mir-206, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-10b, hsa-mir-34a, hsa-mir-205, hsa-mir-221, mmu-mir-290a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-106b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-206, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-24-2, mmu-mir-27a, mmu-mir-31, mmu-mir-34a, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-322, hsa-mir-200c, hsa-mir-155, mmu-mir-17, mmu-mir-25, mmu-mir-200c, mmu-mir-221, mmu-mir-29b-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, hsa-mir-106b, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-30e, hsa-mir-373, hsa-mir-20b, hsa-mir-520c, hsa-mir-503, mmu-mir-20b, mmu-mir-503, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, mmu-mir-30f, mmu-let-7k, mmu-mir-126b, mmu-mir-290b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In addition, let-7 also downregulates the expression of c- myc, a transcriptional activator of many tumor promoting genes that are dysregulated in lymphomas. [score:7]
The overexpression of certain oncogenic miRNAs (miR-21, miR-27a, miR-155, miR-9, miR-10b, miR-373/miR-520c, miR-206, miR-18a/b, miR-221/222) and the loss of several tumor suppressor miRNAs (miR-205/200, miR-125a, miR-125b, miR-126, miR-17-5p, miR-145, miR-200c, let-7, miR-20b, miR-34a, miR-31, miR-30) lead to loss of regulation of vital cellular functions that are involved in breast cancer pathogenesis [127, 128]. [score:6]
The let-7 miRNA was one of the first anti-oncomiRs, or tumor suppressor miRNAs, characterized, which is highly conserved among mammalian species, and is downregulated in many tumors including lung and breast cancers [111, 114, 123]. [score:4]
Lee Y. S. Dutta A. The tumor suppressor microrna let-7 represses the hmga2 oncogene Genes Dev. [score:3]
Akao Y. Nakagawa Y. Naoe T. Let-7 microrna functions as a potential growth suppressor in human colon cancer cells Biol. [score:2]
The let-7 miRNA family functionally inhibits a number of well-characterized oncogenes such as ras, c-myc and HMGA2 and induces apoptosis and cell cycle arrest in human colon cancer cells [123, 124, 125, 126]. [score:1]
[1 to 20 of 6 sentences]
59
[+] score: 22
Let-7 and MYC are mutually regulated, and Let-7 inhibits metastasis through a pathway consisting of BACH1 (a basic region-leucine zipper transcription factor) which is regulated by endocytosis, suppresses p53 -mediated cell senescence, and regulates oxidative-stress responses [22, 56]. [score:7]
DIDYMIN INHIBITS MYCN THROUGH RAF-DEPENDENT AND -INDEPENDENT MECHANISMS BY INHIBITING CDE THROUGH RKIP, GRK, PKC, AND LET-7 MICRO -RNA. [score:4]
Didymin inhibits MYCN through Raf -dependent and -independent mechanisms by inhibiting CDE through RKIP, GRK, PKC, and the Let-7 micro -RNA. [score:4]
Let-7 also regulates MMP1, a pro-angiogenic matrix metalloproteinase that regulates CDE [57]. [score:2]
These three kinases, as well as the MYCN-regulated Let-7 micro -RNA, can broadly regulate down-stream of multiple peptide hormone-ligand interactions by modulating CDE [26, 30– 33]. [score:2]
The Let-7 (lethal-7) micro -RNA is another MYC -dependent pathway through which RKIP could inhibit CDE and invasion [32]. [score:2]
Epidermal growth factor (EGF) and vascular endothelial growth factor (VEGF) are regulated by Let-7 [32, 58], but the mechanism underlying their activity and their functional significance in NB is not fully understood. [score:1]
[1 to 20 of 7 sentences]
60
[+] score: 22
In the livers of LPD offspring, mmu-miR-615, mmu-miR-124, mmu-miR-376b, and mmu-let-7e were significantly downregulated (fold change ≤ −2 and p value < 0.05). [score:4]
In addition to cancer, an altered expression of let-7 has been reported in inflammation. [score:3]
One clinical study showed that let-7e target genes were predicted to be associated with ulcerative colitis susceptibility [47]. [score:3]
Let-7 miRNAs demonstrated to be repressed in inflammation, which resulted in increased expression of pro-inflammatory cytokines and increased inflammatory status [46], which is consistent with our results. [score:3]
IL-6 and TNF are two validated target genes of let-7e. [score:3]
The six miRNAs, including mmu-miR-615, mmu-miR-124, mmu-miR-376b, mmu-let-7e, mmu-miR-708, and mmu-miR-879 had a total of 349 validated target genes in the miRWalk database (Table 2). [score:3]
The let-7 family of miRNAs is highly conserved across diverse animal species, and plays critical roles in the regulation of cell proliferation and differentiation [45]. [score:2]
Coskun M. Bjerrum J. T. Sei delin J. B. Troelsen J. T. Olsen J. Nielsen O. H. miR-20b, miR-98, miR-125b-1*, and let-7e* as new potential diagnostic biomarkers in ulcerative colitis World J. Gastroenterol. [score:1]
[1 to 20 of 8 sentences]
61
[+] score: 22
Auxiliary pairing regulates miRNA–target specificity in vivoAs a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:7]
As a striking indication that auxiliary pairing regulates miRNA–target specificity, duplex structure analysis revealed distinct binding patterns for members of miRNA seed families (for example, let-7, miR-30, miR-181 and miR-125) (Fig. 4d). [score:4]
Targets paired with their chimera-identified, cognate let-7 family member are shaded darker. [score:3]
Such specificity was previously illustrated for two let-7 family targets in Drosophila and has been speculated elsewhere 18. [score:3]
In all cases, let-7 family miRNAs formed more stable structures with their cognate target regions than other paralogues. [score:3]
We calculated duplex energies for target regions of each abundant let-7 family member in the brain with each let-7 miRNA in a four-way pair-wise comparison (Fig. 7c). [score:1]
Base pairing profiles from duplex structure maps for let-7 (a) and miR-30 (b) family members are shown. [score:1]
[1 to 20 of 7 sentences]
62
[+] score: 21
Given that let-7 family members are sometimes indistinguishable [19], we also checked the expression of let-7a, the only let-7 family member that was reported to function as a tumor suppressor in RCC cell lines [20]. [score:5]
Reported direct targets of let-7 include oncogenes such as RAS, MYC, and HMGA2 [25]. [score:4]
Conversely, let-7 is frequently downregulated in many human malignancies, such as lung cancer, breast cancer, and hepatocellular carcinoma [15– 17], possibly reflecting the reverse embryogenesis process that occurs during oncogenesis [18]. [score:4]
Let-7d belongs to the let-7 family that functions as tumor suppressor in many types of cancer [12]. [score:3]
High let-7 expression levels are subsequently maintained in a variety of adult tissues [14]. [score:3]
The let-7 family, originally identified in Caenorhabditis elegans, consists of 13 family members that are highly conserved across the animal phylogeny from C. elegans to human. [score:1]
Nine members of the let-7 family have been identified in humans [12]. [score:1]
[1 to 20 of 7 sentences]
63
[+] score: 21
Because c-myc, which activates AR transcription by binding to a consensus element in the AR promoter [14], was one of the targets of let-7c, and Lin28A can binds to the terminal loops of the precursors of let-7 family miRNAs and blocks their processing into mature miRNAs, we hypothesized that a let-7c target gene(c-myc) may function as a transcriptional regulator of AR. [score:6]
Recent evidence suggests that Lin28A does not rely solely on its regulation of let-7 miRNA biogenesis, but also modulates gene expression by altering translation [24– 26]. [score:6]
The let-7 family miRNAs are tumor suppressors and are implicated as prognostic factors in a multitude of cancers. [score:3]
The most important and well studied targets of let-7 are the oncogenes: HMGA2, RAS, and Myc. [score:3]
Lin28A also is a master regulator of let-7 miRNA processing, binds to the terminal loops of the precursors of let-7 family miRNAs and blocks their processing into mature miRNAs [10, 11]. [score:2]
Lin28A also increases c-myc by repressing let-7, and c-myc transcriptionally activates Lin28A [12]. [score:1]
[1 to 20 of 6 sentences]
64
[+] score: 20
For example, let-7 is downregulated in lung cancer, melanoma, and head and neck squamous carcinoma, while overexpression of let-7 can inhibit cancer cell growth [12], [13], [14], [15], [16], [17], [18]. [score:8]
Several oncogenes, such as RAS, MYC, and HMGA2, are direct targets of let-7 [19], [20], [21]. [score:4]
Recently, the expression levels of many let-7 -family members were found to be reduced in a variety of cancers. [score:3]
A previous report has shown that let-7 family members can act as tumor suppressors in many cancers. [score:3]
The let-7 family is a conserved family of miRNAs. [score:1]
Let-7f is one member of the let-7 family. [score:1]
[1 to 20 of 6 sentences]
65
[+] score: 20
Let-7c originates from two different transcripts, namely pri-let-7c-1 and pri-let-7c-2, while let-7b originates from a unique transcript, pri-let-7b, which forms a cluster with pri-let-7c-2. Interestingly, while mature let-7b/c was significantly upregulated during pituitary development, pri-let-7-c1 and pri-let-7b/c2 levels showed a poor increase, suggesting that a post-transcriptional control of let-7b/c expression occurs during pituitary development (Figure 5E and Figure S6). [score:8]
In accord with this hypothesis, we found that the expression of the mRNA encoding for Lin28A, which blocks let-7 biogenesis [28], [29], has an inverse temporal relationship to let-7b/c expression (Figure 5A, 5F and Figure S4B). [score:5]
This observation suggests that Lin28A may postranscriptionally regulate let-7 expression during pituitary development. [score:5]
Among miRNA precursors the processing of which is regulated by KSRP, we found the let-7 family [30], [32]. [score:2]
[1 to 20 of 4 sentences]
66
[+] score: 19
Altogether, the present data suggest that the high level of Zcchc11 expression in the young liver does not influence mature miRNA abundance, including let-7 family members. [score:3]
The Zcchc11 -deficient mice allowed the examination of miRNA regulation in primary cells of living animals, and they revealed that Zcchc11 is not an essential determinant of mature let-7 or any mature miRNA quantity in the neonatal liver. [score:2]
This may be relevant, since Lin28a is more specifically tied to Zcchc11 regulation of let-7, relating to cytoplasmic localization [11]. [score:2]
Knockdown of Zcchc11 or Lin28 in stem cell lines increases mature let-7 and decreases pluripotency markers [6], [8], [9]. [score:2]
Because Zcchc11 is necessary to limit let-7 in embryonic stem cell lines [6], [7], we anticipated that its loss might be incompatible with development and viability in utero. [score:2]
In embryonic stem cell lines, Zcchc11 knockdown increases let-7 levels, due to Zcchc11 -mediated uridylation of precursors [6], [7]. [score:2]
The present data show that Zcchc11 is not an absolute requirement for stem cell maintenance or low levels of let-7. There may be other conditions in which precursor uridylation by Zcchc11 is essential to regulating let-7, such as perhaps early embryogenesis when Lin28a is especially active. [score:2]
Since Zcchc11 -mediated uridylation of let-7 precursors in embryonic stem cells diminishes mature let-7 abundance [6], [7], we expected to observe increased quantities of these and perhaps other miRNAs in the Zcchc11 -deficient livers. [score:1]
In mouse embryonic stem cell lines, Zcchc11 recognizes complexes of Lin28 and pre-let-7 and adds an oligouridine tail to the 3′ terminus of the pre-miRNA, preventing maturation and/or enhancing degradation of the precursor [6], [7]. [score:1]
Furthermore, insertional mutagenesis of Zcchc11 did not increase let-7 quantities in primary embryonic stem cells derived from these mice. [score:1]
The relationships among these terminal uridyltransferases (Zcchc11 and Zcchc6), Lin28 proteins (a and b), and let-7 miRNAs in embryonic stem cells are complex and dynamic [26], [27]. [score:1]
[1 to 20 of 11 sentences]
67
[+] score: 19
In addition to regulating apoptosis by targeting caspase-3 [10], it was also demonstrated that let-7 family members regulate RAS and HMGA2 oncogene through the 3'UTR [53- 55]. [score:5]
In contrast, proapoptotic miRNAs are usually downregulated in cancer, and include miR-15, miR-16, the let-7 family and members of the miR-34 family. [score:4]
Let-7a, a member of the let-7 family, is associated with apoptosis by directly targeting caspase-3 [10]. [score:4]
In general, let-7 family members were upregulated at 3 days, and decreased at 8 days of differentiation. [score:4]
Let-7 was first identified in Caenorhabditis elegans and reported to control the timing of fate specification during larval development [11]. [score:1]
The let-7 family consists of eleven very closely related genes [51]. [score:1]
[1 to 20 of 6 sentences]
68
[+] score: 19
For example, both lin-4 and let-7 target multiple sequence motifs at the 3' UTR of Caenorhabditis elegans hunchback homolog mRNA, hbl-1, and regulate its expression in the ventral nerve cord neurones [63]. [score:6]
However, the expression of let-7 has been associated with neural differentiation and lineage specification processes in early brain development [46]. [score:4]
We identified the expression of 294 known miRNAs in the E15.5 developing mouse brain, which were mostly represented by let-7 family and other brain-specific miRNAs such as miR-9 and miR-124. [score:3]
The most abundantly expressed miRNA in the E15.5 developing mouse brain is let-7c-1 with its 7 family members (let-7a-2, let-7b, let-7d, let-7e, let-7f-2, let-7g and let-7i) having a combined 335,288 CPM. [score:3]
Despite their high level of expression in the brain, the functional role of let-7 in the development of the central nervous system is poorly characterised. [score:2]
Our finding agrees with the first report by Lagos-Quintana and colleagues [44] regarding the high representation of let-7 family members in the mouse brain, which was also later found in the primate brain [45]. [score:1]
[1 to 20 of 6 sentences]
69
[+] score: 19
We over-expressed a pool of miRNAs consisting mir-181c/338-5p/222/196a/196b/let-7e at 3 days of differentiated ES cells and then examined the DE markers 2 days later. [score:3]
The expression of two miRNAs identified in human DE differentiation, mir-125a-5p and mir-let-7e, were analyzed as presented. [score:3]
In order to over-express miRNAs in differentiating ESCs, six synthetic mature miRNAs (Invitrogen), mir-181c/338-5p/222/196a/196b/let-7e, were pooled together equivalently. [score:3]
Six synthetic mature miRNA inhibitors including mir-181c/338-5p/222/196a/196b/let-7e were pooled together equivalently. [score:3]
We examined the expression of two of them, mir-125a-5p and mir-let-7e, during mouse DE differentiation. [score:3]
We compared our results with previously published miRNAs data about human DE differentiation [18], [19], and found that there are many miRNAs over-lapping between mouse and human data, such as mir-196a/b, let-7e and so on, suggesting the molecular conservativeness between human and mouse DE differentiation in terms of miRNA expression. [score:2]
miRNAs such as lin-4 and let-7 are critical for temporal control of larval development in c. elegans [12], [13]. [score:2]
[1 to 20 of 7 sentences]
70
[+] score: 19
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-19a, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-30a, hsa-mir-33a, hsa-mir-96, hsa-mir-98, hsa-mir-103a-2, hsa-mir-103a-1, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-30a, mmu-mir-30b, mmu-mir-99b, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-9-2, mmu-mir-133a-1, mmu-mir-146a, mmu-mir-155, mmu-mir-182, mmu-mir-183, mmu-mir-24-1, mmu-mir-191, mmu-mir-199a-1, hsa-mir-199a-1, mmu-mir-200b, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-181b-1, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-221, hsa-mir-223, hsa-mir-200b, mmu-mir-299a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-146a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-20a, mmu-mir-21a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-96, mmu-mir-98, mmu-mir-103-1, mmu-mir-103-2, mmu-mir-148b, mmu-mir-351, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, mmu-mir-19a, mmu-mir-25, mmu-mir-200c, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-199a-2, mmu-mir-199b, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-181b-1, mmu-mir-125b-1, hsa-mir-30c-1, hsa-mir-299, hsa-mir-99b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-365a, mmu-mir-365-1, hsa-mir-365b, hsa-mir-375, mmu-mir-375, hsa-mir-148b, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-181b-2, mmu-mir-433, hsa-mir-429, mmu-mir-429, mmu-mir-365-2, hsa-mir-433, hsa-mir-490, hsa-mir-193b, hsa-mir-92b, mmu-mir-490, mmu-mir-193b, mmu-mir-92b, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-299b, mmu-mir-133c, mmu-let-7j, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
In addition to miR-23b, miR-30a, and miR-125b, which, as we showed by qRT-PCR and miRNA-Seq, are upregulated by HDI, several other putative Prdm1 targeting miRNAs, including miR-125a, miR-96, miR-351, miR-30c, miR-182, miR-23a, miR-200b, miR-200c, miR-365, let-7, miR-98, and miR-133, were also significantly increased by HDI. [score:6]
While let-7 miRNAs were not consistently altered by HDI, miR-98 was significantly upregulated by HDI in B cells in all the three experiments of CSR/plasma cell differentiation induction (p = 0.02). [score:4]
miR-98 potentially target the same site as let-7 in Prdm1 3′ UTR. [score:3]
org), we identified miR-125a, miR-125b, miR-96, miR-351, miR-30, miR-182, miR-23a, miR-23b, miR-200b, miR-200c, miR-33a, miR-365, let-7, miR-98, miR-24, miR-9, miR-223, and miR-133 as PRDM1/Prdm1 targeting miRNAs in both the human and the mouse. [score:3]
This together with our finding that all members of miR-99b~let-7e~125a cluster were increased by HDI further confirm that HDI modulation of miRNA expression occurs through modulation of miRNA primary transcript. [score:3]
[1 to 20 of 5 sentences]
71
[+] score: 19
miR-150 regulates MNC migration by targeting Cxcr4 Since miR microarray analysis revealed that miR-29c, miR-98/let-7 family, miR-150, miR-195 and miR-494 expression was significantly downregulated in BM-derived MNCs, we extensively examined databases for predicted targets of these miRNAs involved in MNC mobilization. [score:11]
Since miR microarray analysis revealed that miR-29c, miR-98/let-7 family, miR-150, miR-195 and miR-494 expression was significantly downregulated in BM-derived MNCs, we extensively examined databases for predicted targets of these miRNAs involved in MNC mobilization. [score:8]
[1 to 20 of 2 sentences]
72
[+] score: 18
Moreover, so-called "ES Cell Cycle Control" (or ESCC) miRNAs in the miR-290 family stimulate ES cell proliferation by indirectly activating c-Myc and N-Myc, and thus by extension Myc targets, while also blocking p21 translation and inhibiting the Myc inhibitor miRNA let-7 (Gilchrist et al., 2008, 2010; Kumar et al., 2007). [score:10]
Indeed, Myc is known to be downregulated directly by the let-7 miRNA family (Kumar et al., 2007), whose expression is normally kept very low in (Marson et al., 2008; Tang et al., 2006a), and miR-294 is thought to promote Myc activity in indirectly through repression of an unidentified Myc repressor (Melton et al., 2010). [score:8]
[1 to 20 of 2 sentences]
73
[+] score: 18
Selection of the differentially expressed miRNAs under the relatively strict conditions (≥500 sequence reads in at least one of the libraries selected for comparison, ≥5-fold difference in expression, and a p value of ≤ 0.01) identified nine upregulated miRNAs (let-7e-5p, miR-101a-3p, miR-151-5p, miR-181a-5p, miR-204-5p, miR-340-5p, miR-381-3p, miR-411-5p, miR-9-5p, and miR-219-2-3p) at 3 d, but none at 7 d or 14 d, suggesting that these upregulated miRNAs impact biological functions, particularly during the early stages after nerve allotransplantation with FK506 immunosuppression. [score:13]
Among the nine upregulated miRNAs (let-7e-5p, miR-101a-3p, miR-151-5p, miR-181a-5p, miR-204-5p, miR-340-5p, miR-381-3p, miR-411-5p, miR-9-5p, and miR-219-2-3p), miR-9-5p had the highest fold-change (≥50-fold at 3 d), followed by miR-340-5p with 38.8-fold. [score:4]
Nine candidate miRNAs (let-7e-5p, miR-101a-3p, miR-151-5p, miR-181a-5p, miR-204-5p, miR-340-5p, miR-381-3p, miR-411-5p, and miR-9-5p) were identified. [score:1]
[1 to 20 of 3 sentences]
74
[+] score: 18
41, 42, 43, 44, 45 To test whether p62 regulates MYC expression via let-7 cluster, total RNA was extracted from MDA-MB-231 cells with or without transient p62 overexpression. [score:6]
Both HUR and let-7 have been reported to bind to the 3'-element, thus destabilizing MYC mRNA level and repressing its expression. [score:3]
Previous studies have reported that the let-7 cluster can bind to the consensus binding sites in the 3'untranslated region (UTR) of MYC mRNA transcript, leading to its degradation via the RNA miRNA -induced silencing complex. [score:3]
RT-qPCR analysis of the let-7 cluster in the transfected cells showed that let-7a/b were significantly repressed by p62 overexpression (Figure 7C). [score:3]
Let-7 is a conserved microRNA family, which can function as a tumor suppressor. [score:2]
44, 45, 57 Our data suggested a negative feedback correlation between p62 and the let-7 microRNA family (Figure 7C), further confirming the oncogenic role of p62 in breast cancer. [score:1]
[1 to 20 of 6 sentences]
75
[+] score: 18
Clusters of miRNAs (including members of the let-7 and miR-17-92 families) are downregulated in hemopoietic stem/progenitor cells, potentially allowing the expression of target genes known to facilitate stem cell proliferation and homeostasis. [score:8]
In addition, our present data indicate the downregulation of miR-17-92 and let-7 families in LSK compared to promyelocytes, in conjunction with the overexpression of their reciprocal targets including hepatic leukemia factor (Hlf), V-myc myelocytomatosis viral related oncogene (Mycn) and krüppel-like factor 12 (Klf12) (Additional file 4). [score:7]
A subset of miRNAs were downregulated in LSKs compared to promyelocytes including members of the let-7 family and the polycistronic mir-17-92 cluster (Additional file 4). [score:3]
[1 to 20 of 3 sentences]
76
[+] score: 18
The let-7 family of microRNAs is prominently represented among downregulated microRNAs, consistent with a tumour suppressor role, and one of the predicted targets, HMG2A, was substantially upregulated in a validation cohort by 45.4±14.5-fold (mean±s. [score:11]
The microRNAs significantly upregulated in this cross-species analysis included miRs-15a/b, 17, 20a, 21, 31, 200a and 340b (Fig. 7a), and those significantly downregulated included let-7 family members and miRs-30a and 125b (Fig. 7b). [score:7]
[1 to 20 of 2 sentences]
77
[+] score: 18
Let-7 inhibits Lin28, thereby inhibiting self-renewal, and in addition inhibits Il-6. In the stochastic reaction kinetics framework, we define our mo del by listing reactant species, reactions (or events), and reaction propensities. [score:6]
Lin28, an important stem regulatory gene, decreases cellular differentiation and increases self-renewal, through downregulation of Let-7, a microRNA that limits capacity for self-renewal [30]. [score:4]
Let-7 directly inhibits both Lin-28 and IL-6. Population trajectories obtained by running 100 simulations for each scenario. [score:3]
Both Lin-28 and IL-6 are inhibited by Let-7. Akt is activated by HER2 and IL-8, while Stat3 is activated by IL-6 and IL-8 receptor binding. [score:2]
Cells Cytokines Receptors MET-like BCSC IL-6 gp130 EMT-like BCSC IL-8 CXCR1TGF- β HER2 BMP EGFR Complexes IL-6 ⋅ gp130 dimer IL-8 ⋅ CXCR1 HER2 ⋅ EGFR Lin-28 ⋅ HER2 mRNAI κB ⋅ p50 ⋅ RelA Let-7 ⋅ IL-6 Lin-28 ⋅ Let-7mir93 ⋅ TGF- β BMP Intracellular signals Stat3 activated Stat3 HER2 mRNA Akt activated AktI κB p50 ⋅ RelA Lin-28 Let-7 β-cateninactivated β-catenin mir-93 10.1371/journal. [score:1]
Cells Cytokines Receptors MET-like BCSC IL-6 gp130 EMT-like BCSC IL-8 CXCR1TGF- β HER2 BMP EGFR Complexes IL-6 ⋅ gp130 dimer IL-8 ⋅ CXCR1 HER2 ⋅ EGFR Lin-28 ⋅ HER2 mRNAI κB ⋅ p50 ⋅ RelA Let-7 ⋅ IL-6 Lin-28 ⋅ Let-7mir93 ⋅ TGF- β BMP Intracellular signals Stat3 activated Stat3 HER2 mRNA Akt activated AktI κB p50 ⋅ RelA Lin-28 Let-7 β-cateninactivated β-catenin mir-93 10.1371/journal. [score:1]
Initial counts for receptors, including gp130, HER2, EGFR, CXCR1, and TGF βR2, and signaling molecules, including Akt, I κB⋅p50⋅RelA, Let-7, β-catenin, mir-93, BMP, Stat3, HER2 mRNA, were set to 100. [score:1]
[1 to 20 of 7 sentences]
78
[+] score: 18
Another control mechanism is the upregulation of the microRNA let-7, which leads to a downregulation of PLFZ as “two conserved binding sides were found in the 3′UTR” of Zbtb16 (29). [score:7]
So far, the iNKT1 subset has been defined by the upregulation of T-bet (Tbx21) (26– 28, 31), Erg2 (34), FcεR1γ (27), and the microRNA let-7 (29). [score:4]
Interestingly, this paper showed conserved let-7 binding sides in mice and human, leading to the question if let-7 is also regulating expression profiles in human iNKT cells. [score:4]
Further, the mRNA expression profiles of Zbtb16 and let-7 showed inverse correlation (29). [score:3]
[1 to 20 of 4 sentences]
79
[+] score: 18
The most downregulated miRNA during EB formation was miR-let-7a, which is of interest because let-7 has been shown to regulate developmental timing in Caenorhabditis elegans [22]. [score:6]
RISC -mediated target RNA cleavage activity was determined by in vitro cleavage of a [32]P-target mRNA that perfectly matched the miR-302b or let-7 sequence. [score:5]
Fig 4A demonstrates the specific expression of miR-302b and let-7 in hES and HeLa cells, respectively. [score:3]
Conversely, let-7 RISC in HeLa extracts cleaved let-7 target RNA while hES RISC did not show detectable activity in this experiment. [score:3]
Since let-7a is abundant in HeLa, we selected let-7 as a control in our experiments. [score:1]
[1 to 20 of 5 sentences]
80
[+] score: 18
In oral cancer, the expression of OIP5 may not be regulated at the post-transcription level as the miR-143/145, miR-200 and let-7 family microRNAs were reported to be downregulated in oral cancer 9, 11, 14. [score:7]
However, OIP5 was targeted by stemness regulatory miR-143/145, EMT associated miR-200 family and oral cancer-specific tumor suppressor let-7 family. [score:6]
Interestingly, we also found many MREs for stemness regulatory miRNAs miR-143/145 family, EMT regulatory miRNA miR-200a/miR-200b/miR-141, TP53 induced miR-34a, let-7, and several other oral cancer specific tumor suppressive miRNAs in OIP5 mRNA 3′-UTR (Supplementary Table  S7). [score:5]
[1 to 20 of 3 sentences]
81
[+] score: 17
For instance, miR-223 was reported to negatively regulate both the proliferation and activation of neutrophils by targeting myeloid Elf1-like factor 2C [18]; miR-125b and let-7 were down-regulated in response to lipopolysaccharide (LPS) stimulation in macrophages, in which the miR-125b regulated the immune response by targeting tumor necrosis factor (TNF)-α mRNA [19], whereas let-7 through a mechanism of targeting IL-6 mRNA [20]; miR-21 has also been found to be able to further negatively regulate LPS-activated TLR4 signaling by targeting the tumor suppressor gene, Programmed Cell Death 4 (PDCD4), which in turn decreased nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) activation and resulted in the production of anti-inflammatory cytokine IL-10 [21]. [score:17]
[1 to 20 of 1 sentences]
82
[+] score: 17
Therefore, it is rational to presume that miR-26b may function together with these four let-7 family members to consistently regress the expression of Lin28B, and dysfunction of their functional cooperation may lead to up-regulation of Lin28B, which in turn contribute to tumorigenesis. [score:6]
The let-7 family has been wi dely identified to be a tumor suppressor that can inhibit cell proliferation in lung cancer. [score:5]
Emerging evidence shows that members of a miRNA family (such as the let-7 family) have similar functions since an abundance of overlapping targets resulted from their common seed sequences. [score:3]
Our results indicate that the miR-30 family may function together with the let-7 family and the miR-195/497 cluster to control cell proliferation by cooperatively destroying the Ras signaling pathway. [score:1]
The sub-network II is composed of six members of the let-7 family (let-7a, let-7b, let-7c, let-7d, let-7f, and let-7g), the miR-30 family, the miR-195/miR-497 cluster, and two unrelated miRNAs including miR-26b and miR-150. [score:1]
It is notable that miR-26b is highly connected with four let-7 family members including let-7a, let-7d, let-7f and let-7g. [score:1]
[1 to 20 of 6 sentences]
83
[+] score: 17
These results suggested that high-abundance miRNAs such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7 were closely related to the development of 18 d-old females before pairing, whereas during the development from 18 d to 23 d, all of these high-abundance miRNAs were down-regulated not only in 23 DSI, but also in 23SSI. [score:6]
Similar miRNA profiles were observed in 18SSI and 18DSI, with the presence of identically expressed high-abundance miRNA, such as miRNA-1, miRNA-71b-5p and let-7. By contrast, in 23DSI and 23SSI, most of these high-abundance miRNAs were down-regulated. [score:6]
In particular, nearly all high-abundance miRNAs, such as miR-1c, miR-1a, miR-10-5p, miR-71b-5p, and let-7, were down-regulated in both, compared with 18DSI or 18SSI. [score:3]
For example, their levels of miR-1c, miR-1a, miR-1, miRNA-71b-5p, and let-7 were far lower than those in 18 DSI or 18SSI. [score:1]
We found the level of high-abundance miRNAs such as miR-1, miR-1a, miR-1c, miR-71b-5p, and let-7 to be higher in 18DSI and 18SSI than in 23DSI and 23SSI. [score:1]
[1 to 20 of 5 sentences]
84
[+] score: 17
Previous reports indicate that let-7 is poorly expressed in a variety of human tumors and reduced let-7 level results in over -expression (cyclinD, RAS, MYC) of let-7-responsive genes in tumors [22], [23], [24], [25]. [score:5]
Recent studies have demonstrated that let-7 might act as a tumor suppressor and that reduced let-7 level results in let-7-responsive gene (cyclinD, RAS, MYC, etc. ) [score:3]
The 11 members of the let-7 family have similar target genes and functions on cell proliferation because of the high similarity among their sequences [23], [28]. [score:3]
Effects of the other members of let-7 family on CYP2J2 expression and cancer cell proliferation need further study. [score:3]
Previous study has shown that let-7 regulates RAS through its 3′UTR [27]. [score:2]
However, the exact role of let-7 in cancer is not yet fully understood. [score:1]
[1 to 20 of 6 sentences]
85
[+] score: 16
Several abundant miRNAs showed greater than a two-fold enrichment at P7 (i. e., let-7e, 127, 181b-2, 503, and 181b-1), while those showing the greatest fold enrichment (i. e., mir-122, 370, 770, 383, 410, 335, 615, 543, 665) were generally expressed at modest levels (Figure 2A). [score:3]
Since the majority of cells in the adult testis are spermatids, these modifications may be targeted to pre-miRNAs by spermatid proteins that bind to the loop domain of pre-miRNAs similar to LIN28 binding to let-7 pre-miRNAs. [score:3]
Since Let-7 family members are believed to restrain proliferation reduced effectiveness of let-7 against its targets due to editing may be beneficial in the predominantly mitotically active testis at P7. [score:3]
∼80% of all miRNAs in the testis at all three time-points were let-7 family miRNAs. [score:1]
At P7 the levels were 26% of the total let-7e-3p reads, but this declined on P14 to 15%. [score:1]
Since the majority of reads in the testis at the ages assessed are composed of let-7 family miRNAs, predominantly represented by their 5p reads, this further inflates this bias. [score:1]
Let-7 family members contribute 80% of juvenile miRNA reads but compose only 11% of adult testis reads. [score:1]
Mol Hum Reprod 41 Heo I Joo C Cho J Ha M Han J 2008 Lin28 mediates the terminal uridylation of let-7 precursor MicroRNA. [score:1]
LIN28 -dependent uridylation of let-7 miRNAs by polyuridine polymerase ZCCHC11 is the most notable example of this modification [41], [42], [43]. [score:1]
Most high abundance (10 [4] reads) miRNAs such as let-7 family member let-7b-5p showed very little internal editing. [score:1]
[1 to 20 of 10 sentences]
86
[+] score: 16
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-21, hsa-mir-23a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-98, hsa-mir-99a, hsa-mir-106a, mmu-let-7g, mmu-let-7i, mmu-mir-23b, mmu-mir-99a, mmu-mir-127, mmu-mir-128-1, mmu-mir-136, mmu-mir-142a, mmu-mir-145a, mmu-mir-10b, mmu-mir-182, mmu-mir-183, mmu-mir-187, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-206, mmu-mir-143, hsa-mir-139, hsa-mir-10b, hsa-mir-182, hsa-mir-183, hsa-mir-187, hsa-mir-210, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-224, hsa-mir-200b, mmu-mir-302a, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-128-1, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-127, hsa-mir-136, hsa-mir-193a, hsa-mir-195, hsa-mir-206, mmu-mir-19b-2, mmu-mir-200a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-21a, mmu-mir-23a, mmu-mir-31, mmu-mir-92a-2, mmu-mir-96, mmu-mir-98, hsa-mir-200c, mmu-mir-17, mmu-mir-139, mmu-mir-200c, mmu-mir-210, mmu-mir-216a, mmu-mir-219a-1, mmu-mir-221, mmu-mir-222, mmu-mir-224, mmu-mir-19b-1, mmu-mir-92a-1, mmu-mir-128-2, hsa-mir-128-2, mmu-mir-217, hsa-mir-200a, hsa-mir-302a, hsa-mir-219a-2, mmu-mir-219a-2, hsa-mir-363, mmu-mir-363, hsa-mir-302b, hsa-mir-302c, hsa-mir-302d, hsa-mir-371a, hsa-mir-18b, hsa-mir-20b, hsa-mir-452, mmu-mir-452, ssc-mir-106a, ssc-mir-145, ssc-mir-216-1, ssc-mir-217-1, ssc-mir-224, ssc-mir-23a, ssc-mir-183, ssc-let-7c, ssc-let-7f-1, ssc-let-7i, ssc-mir-128-1, ssc-mir-136, ssc-mir-139, ssc-mir-18a, ssc-mir-21, hsa-mir-146b, hsa-mir-493, hsa-mir-495, hsa-mir-497, hsa-mir-505, mmu-mir-20b, hsa-mir-92b, mmu-mir-302b, mmu-mir-302c, mmu-mir-302d, hsa-mir-671, mmu-mir-216b, mmu-mir-671, mmu-mir-497a, mmu-mir-495, mmu-mir-146b, mmu-mir-708, mmu-mir-505, mmu-mir-18b, mmu-mir-493, mmu-mir-92b, hsa-mir-708, hsa-mir-216b, hsa-mir-935, hsa-mir-302e, hsa-mir-302f, ssc-mir-17, ssc-mir-210, ssc-mir-221, mmu-mir-1839, ssc-mir-146b, ssc-mir-206, ssc-let-7a-1, ssc-let-7e, ssc-let-7g, ssc-mir-128-2, ssc-mir-143, ssc-mir-10b, ssc-mir-23b, ssc-mir-193a, ssc-mir-99a, ssc-mir-98, ssc-mir-92a-2, ssc-mir-92a-1, ssc-mir-92b, ssc-mir-142, ssc-mir-497, ssc-mir-195, ssc-mir-127, ssc-mir-222, ssc-mir-708, ssc-mir-935, ssc-mir-19b-2, ssc-mir-19b-1, ssc-mir-1839, ssc-mir-505, ssc-mir-363-1, hsa-mir-219b, hsa-mir-371b, ssc-let-7a-2, ssc-mir-18b, ssc-mir-187, ssc-mir-218b, ssc-mir-219a, mmu-mir-195b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-21c, ssc-let-7d, ssc-let-7f-2, ssc-mir-20b-1, ssc-mir-20b-2, ssc-mir-31, ssc-mir-182, ssc-mir-216-2, ssc-mir-217-2, ssc-mir-363-2, ssc-mir-452, ssc-mir-493, ssc-mir-671, mmu-let-7k, ssc-mir-7138, mmu-mir-219b, mmu-mir-216c, mmu-mir-142b, mmu-mir-497b, mmu-mir-935, ssc-mir-9843, ssc-mir-371, ssc-mir-219b, ssc-mir-96, ssc-mir-200b
However, the mpiPSCs did not show down-regulation of most let-7 family members, including let-7c, let-7d, let-7e, let-7f, let-7g and let-7i. [score:4]
Inhibition of the let-7 family by Lin 28a, a very important pluripotent factor, improves the efficiency of somatic cell reprogramming [39]. [score:3]
The expression of the let-7 family was investigated because inhibition of the let-7 family was previously suggested to promote the reprogramming of somatic cells into piPSCs. [score:3]
MiR-98 belongs to the let-7 family and also targets MYC [38]. [score:3]
We found that most members of the let-7 family (except let-7a) were down-regulated in hpiPSCs compared with pEFs (Fig 5B). [score:3]
[1 to 20 of 5 sentences]
87
[+] score: 16
For 12 MYCN -targeting miRNAs we observed significant inverse correlation to MYCN expression or activity and thus provide evidence that they regulate MYCN in a neuroblastoma tissue context: eight let-7 family miRNAs (let-7a-5p, let-7b-5p, let-7c-5p, let-7d-5p, let-7f-5p, let-7g-5p, let-7i-5p and miR-98), three miR-29 family miRNAs (miR-29a-3p, miR-29b-3p, miR-29c-3p) and miR-34a-5p. [score:6]
Buechner and colleagues [3] showed that let-7e-5p, miR-101-3p and miR-202-3p are able to affect MYCN expression in a MYCN amplified neuroblastoma cell line, whereas we found no evidence that they are regulating MYCN in MYCN non-amplified primary neuroblastoma tumors. [score:4]
Notably, three of these excluded miRNAs, let-7e-5p, miR-101-3p and miR-202-3p, have been reported to target MYCN in a MYCN amplified neuroblastoma cell line [3]. [score:3]
Eleven MYCN -targeting miRNAs have thus been identified, of which miR-34a, miR-101, let-7e and miR-202 were shown to affect neuroblastoma proliferation in vitro [3, 8]. [score:3]
[1 to 20 of 4 sentences]
88
[+] score: 16
In contrast to miR-125a, LPS did not up-regulate the levels of either miR-99b or let-7e (Fig. 4B), suggesting that they were regulated independently of miR-125a. [score:5]
In contrast, a recent report showed that LPS could up-regulate let-7e in peritoneal macrophages and that this was dependent on Akt1 activity [26]. [score:4]
In BMDMs no significant up-regulation of either miR-99b or let-7e in response to LPS or heat killed C. albicans was observed in this study. [score:4]
miR-125a is located in the genome within 1 kb of miR-99b and let-7e. [score:1]
Two further miRNAs, miR-99b and let-7e. [score:1]
In addition two further miRNAs, miR-99b and let-7e are located within a 1kb region upstream of miR-125a (Fig. 4A). [score:1]
[1 to 20 of 6 sentences]
89
[+] score: 16
A strong decrease of let-7 expression levels has been associated with an aberrant overexpression of HMGA1 and HMGA2 in several human highly malignant carcinomas (58, 59). [score:5]
Moreover, HMGA2 overexpression correlated with low levels of let-7, a miRNA able to target and repress HMGA2, and with p53 (40). [score:5]
A more recent study confirmed that HMGA2 is highly expressed in metastatic lung adenocarcinoma, where it contributes to cancer progression and metastasis by acting as a competing endogenous RNA for let-7 miRNA family (47). [score:3]
Moreover, it is worthy to note that the 3′-UTR of HMGA2 carries as many as seven let-7 binding sites, then taking also part in the modulation of HMGA1 expression levels (47). [score:3]
[1 to 20 of 4 sentences]
90
[+] score: 16
How does Lin28 let-7 control development and disease? [score:4]
Lin28 recruits the TUTase Zcchc11 to inhibit let-7 maturation in mouse embryonic stem cells. [score:3]
Lin28 -mediated control of let-7 microRNA expression by alternative TUTases Zcchc11 (TUT4) and Zcchc6 (TUT7). [score:3]
Zcchc6 and Zcchc11 TUTs have been reported to regulate miRNA maturation in embryonic stem cells and cancer cell lines by oligo-uridylating let-7 family member precursor miRNAs in conjunction with Lin28a [14, 15, 21, 45, 46]. [score:2]
At first thought, these findings are clearly anticipated given that abundant levels of mature let-7 microRNA family members are positively associated with differentiated tissue [36] and that Zcchc6 and Zcchc11 are negative regulators of let-7 [21]. [score:2]
Lin28 and let-7: ancient milestones on the road from pluripotency to neurogenesis. [score:1]
Lin28 mediates the terminal uridylation of let-7 precursor MicroRNA. [score:1]
[1 to 20 of 7 sentences]
91
[+] score: 15
Muse cells also express high levels of Let-7, a microRNA responsible for regulating embryonic development, tumor suppression, and phenotypic differentiation, as a potential counteracting protective mechanism against Lin 28 and against tumorigenesis [18]. [score:6]
A steady decline in Lin28 is seen throughout embryonic development in combination with an increase in Let-7 expression, resulting in suppression of undifferentiated cell renewal while also stimulating cell differentiation [33]. [score:5]
Thornton JE Gregory RI How does Lin28 let-7 control development and disease?Trends Cell Biol. [score:4]
[1 to 20 of 3 sentences]
92
[+] score: 15
Furthermore, it has been shown that several let-7 family members are expressed in the postnatal murine cochlea, and that their expression levels persist up to at least P100 [43], suggesting that let7miRs could negatively regulate Hmga2 in the postnatal and adult cochleas and prevent both hair cells and supporting cells proliferation. [score:6]
Indeed, during oncogenic transformation process, microRNA levels of the translation-regulatory factor let-7 inversely correlate with expression of the Hmga2. [score:6]
Interestingly, the expression of several let7 miRs are significantly decreased during hair cell regeneration in the adult newt [42], suggesting that let-7 miRNAs may indeed be important for the maintenance of quiescence in inner ear mechanosensory epithelia. [score:3]
[1 to 20 of 3 sentences]
93
[+] score: 15
Since a decrease in expression of let-7, a family of microRNAs tightly regulated during embryonic stem cell differentiation [34], enables self-renewal in embryonic stem cells [35], it appears as if self-renewal in incipient central memory T cells may result from a concomitant suppression of the let-7 family of microRNAs. [score:6]
Of note, we found that members of the let-7 family (let-7 a, b, c, d and g) were all consistently down-regulated (∼30%) in IL-15 treated T cells (Fig. 2 and Figure S2,A). [score:4]
This is consistent with the fact that microRNAs of the let-7 family are down-regulated during IL-15 -driven central memory fate determination (Fig. 2). [score:4]
We posit instead that activated T cells committed to a central memory fate (T [CM] precursors) activate a program that enables the acquisition of central memory phenotype through the balancing effects of miR-150/miR-155, and self-renewal characteristics through a decrease expression of let-7 microRNAs, a shared trait between embryonic stem cells and central memory T cells. [score:1]
[1 to 20 of 4 sentences]
94
[+] score: 15
In the case of the Let-7 family of miRNAs, there are variations in expression levels among tissues and overlap in target sequence recognition among the various family members; therefore, even if one of the members is downregulated in a cancer cell the other family members can continue to target the virus, thereby reducing its efficacy. [score:10]
Some studies also have used universally expressed Let-7 targets for broad control of oncolytic viruses, including vesicular stomatitis virus, poliovirus, and vaccinia virus (23, 45, 50). [score:4]
Edge RE, Falls TJ, Brown CW, Lichty BD, Atkins H, Bell JC 2008 A let-7 MicroRNA-sensitive vesicular stomatitis virus demonstrates tumor-specific replication. [score:1]
[1 to 20 of 3 sentences]
95
[+] score: 15
Similarly to human PTCLs, these tumor cells overexpressed SYK, had decreased let-7 expression, increased IL-6 expression, activation of the NF-κB pathway, infiltration by B-cells, and lymphadenopathy (34) (Table 1). [score:7]
LIN28B, a master regulator of cellular transformation, is commonly upregulated in PTCL ~7.5-fold to that of control, activated CD4+ cells (34) and controls the let-7 family of microRNAs. [score:5]
Gene manipulated TS or oncogene Chr(hum) T-cell subtype affected Functional pathway % penetrance Reference Snf5− /− TS Ch22 Mature, activated memory Self-renewal 100(11, 17, 18) ITK–SYK Oncogenet(5;9)(q33;q22) [a] Mature, activated memory TCR signaling 100(13) Lin28b Oncogene 6q21 Mature, activated memory Let-7 miRNA signaling 100(34) TS, tumor suppressor; Chr, chromosome; Hum, human. [score:3]
[1 to 20 of 3 sentences]
96
[+] score: 14
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-20a, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-93, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-107, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-15b, mmu-mir-23b, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-30b, mmu-mir-101a, mmu-mir-124-3, mmu-mir-125a, mmu-mir-130a, mmu-mir-9-2, mmu-mir-135a-1, mmu-mir-136, mmu-mir-138-2, mmu-mir-140, mmu-mir-144, mmu-mir-145a, mmu-mir-146a, mmu-mir-149, mmu-mir-152, mmu-mir-10b, mmu-mir-181a-2, mmu-mir-182, mmu-mir-183, mmu-mir-185, mmu-mir-24-1, mmu-mir-191, mmu-mir-193a, mmu-mir-195a, mmu-mir-200b, mmu-mir-204, hsa-mir-30c-2, hsa-mir-30d, mmu-mir-30e, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-204, hsa-mir-181a-1, hsa-mir-221, hsa-mir-222, hsa-mir-200b, mmu-mir-301a, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, mmu-mir-130b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-138-2, hsa-mir-140, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-136, hsa-mir-138-1, hsa-mir-146a, hsa-mir-149, hsa-mir-185, hsa-mir-193a, hsa-mir-195, hsa-mir-320a, mmu-mir-30c-1, mmu-mir-30c-2, mmu-mir-30d, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-15a, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-20a, mmu-mir-23a, mmu-mir-24-2, mmu-mir-26a-1, mmu-mir-26b, mmu-mir-29a, mmu-mir-29c, mmu-mir-93, mmu-mir-34a, mmu-mir-330, mmu-mir-339, mmu-mir-340, mmu-mir-135b, mmu-mir-101b, hsa-mir-200c, hsa-mir-181b-2, mmu-mir-107, mmu-mir-10a, mmu-mir-17, mmu-mir-200c, mmu-mir-181a-1, mmu-mir-320, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-29b-2, mmu-mir-135a-2, mmu-mir-124-1, mmu-mir-124-2, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-138-1, mmu-mir-181b-1, mmu-mir-181c, mmu-mir-7a-1, mmu-mir-7a-2, mmu-mir-7b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-361, mmu-mir-361, hsa-mir-376a-1, mmu-mir-376a, hsa-mir-340, hsa-mir-330, hsa-mir-135b, hsa-mir-339, hsa-mir-335, mmu-mir-335, mmu-mir-181b-2, mmu-mir-376b, mmu-mir-434, mmu-mir-467a-1, hsa-mir-376b, hsa-mir-485, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, mmu-mir-485, mmu-mir-541, hsa-mir-376a-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, mmu-mir-301b, mmu-mir-674, mmu-mir-146b, mmu-mir-467b, mmu-mir-669c, mmu-mir-708, mmu-mir-676, mmu-mir-181d, mmu-mir-193b, mmu-mir-467c, mmu-mir-467d, hsa-mir-541, hsa-mir-708, hsa-mir-301b, mmu-mir-467e, mmu-mir-467f, mmu-mir-467g, mmu-mir-467h, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, mmu-mir-467a-2, mmu-mir-467a-3, mmu-mir-467a-4, mmu-mir-467a-5, mmu-mir-467a-6, mmu-mir-467a-7, mmu-mir-467a-8, mmu-mir-467a-9, mmu-mir-467a-10, hsa-mir-320e, hsa-mir-676, mmu-mir-101c, mmu-mir-195b, mmu-mir-145b, mmu-let-7j, mmu-mir-130c, mmu-mir-30f, mmu-let-7k, mmu-mir-9b-2, mmu-mir-124b, mmu-mir-9b-1, mmu-mir-9b-3
Similarly, these two miRNAs were also upregulated in PFC of human alcoholics [4, 11], and a let-7 family member was demonstrated to alter cocaine -induced conditioned place preference behavior when manipulated in the nucleus accumbens of rats [27]. [score:4]
The miRNA families that change expression in both mouse and human were: let-7, miR-7, miR-15, miR-101, miR-140, miR-152 (all validated by qPCR, P < 0.05), as well as miR-17, miR-34, miR-135, miR-144, miR-146, miR-301, miR-339, miR-368 (qPCR not performed). [score:3]
To assess the validity of this approach, we corroborated the positively correlated expression levels of interacting miRNAs and mRNAs (i. e., mmu-let-7 vs. [score:3]
We are enthusiastic about future prospects of using let-7 modulation in mouse brain to induce behavioural changes related to alcohol consumption and development of dependence. [score:2]
Syt11 and mmu-let-7 vs. [score:1]
P. Val1mmu-let-7g-5plet-70.3012.202.12E-071.27E-042mmu-let-7d-5plet-70.2711.535.98E-071.27E-044mmu-let-7c-5plet-70.2911.781.09E-061.49E-045mmu-let-7b-5plet-70.2512.481.17E-061.49E-0410mmu-let-7a-5plet-70.2712.599.73E-066.88E-047mmu-let-7i-5plet-70.2411.171.08E-056.88E-0422mmu-let-7e-5plet-70.2111.251.67E-044.83E-0342mmu-miR-125a-5pmir-100.2211.791.49E-032. [score:1]
[1 to 20 of 6 sentences]
97
[+] score: 14
By analyzing regulation of miRNA expression in wild type cells and cells expressing a GR with impaired dimerization 11, we found several miRNAs up-regulated including let-7, miR-146a, miR-148a, miR-148b and miR-152 by GC treatment, some of them exclusively in wildtype cells, and not in GR [dim] cells. [score:9]
Venn analyses revealed sixteen differentially expressed miRNAs in wildtype primary mesenchymal cells that were treated with dexamethasone (Fig. 1A), of which eleven were up regulated (let-7 family, miR-125b, miR-146a, miR-148a + b, miR-152, miR-423) (Table S1) and five were down regulated (miR-1724a, miR-23a+b, miR-24-1,-2, miR-29a) (Table S1). [score:5]
[1 to 20 of 2 sentences]
98
[+] score: 14
Here, we found that five genes were downregulated, including Lin28a, Zcchc6, and Zcchc11, which act as suppressors during the biogenesis of the let-7 miRNA family and in the terminal processing of miRNA precursors (Table 1, Supplementary Table 2). [score:6]
These data might account for the observed upregulation of a wide spectrum of miRNAs (including miRNAs of the let-7 family) in tumor tissue after treatment with RNase A [20]. [score:4]
Zcchc6 and Zcchc11 act as suppressors of miRNA biogenesis by mediating the terminal uridylation of some miRNA precursors, including pre-let-7 (by Zcchc6 and Zcchc11) and mir-107, mir-143, and mir-200c (by Zcchc11) [65]. [score:3]
Lin28a prevents terminal processing of the let-7 family of miRNA [64]. [score:1]
[1 to 20 of 4 sentences]
99
[+] score: 14
TargetScan analyses also revealed specific miRNAs highly involved in targeting relevant gene functions in repair such as miR-290 and miR-505 at 7 dpi; and let-7, miR-21 and miR-30 at 15 dpi. [score:5]
The let-7 miRNAs are implicated in developmental functions and cellular proliferation, and also regulate and inhibit proliferation in a cancer context. [score:5]
For example, due to the nature of miRNA targeting, some of these miRNAs (such as miR-21 and let-7) may even serve dual roles of limiting damage and accelerating repair as they possess anti-inflammatory properties besides regulating pulmonary repair activities, i. e. they may minimize damage from inflammation secondary to infection [43, 44]. [score:4]
[1 to 20 of 3 sentences]
100
[+] score: 14
Comparison of mouse ES and iPS cells identified several miRNAs that are expressed at significantly different levels in ES and iPS cells, and members of the let-7 and miR-30 families are more highly expressed in iPSCs than in ESCs (Fig. 5A). [score:5]
Members of let-7 (a, b, c, d, e), and 11 other miRNAs (miR-100, -10a, -10b, -132, -143, -181a, -196b, -199a-5p, -23a, -383, -505) are also listed as miRNA that are expressed at high level in somatic cells in human analysis (Fig. 1C), suggesting that these miRNAs are relatively low expression level in pluripotent cells commonly in human and mouse. [score:5]
Members of the let-7 group, which are involved in developmental timing and expressed at higher levels in fibroblasts than in ESCs, are on the list (Fig. 1C), in accordance with a previous study [13]. [score:4]
[1 to 20 of 3 sentences]