sort by

92 publications mentioning hsa-mir-186

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-186. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 415
Over -expression of CRNDE inhibited miR-186 expression, down regulation of CRNDE or over -expression of miR-186 inhibited the expression of XIAP and PAK7. [score:14]
The mechanism underlying the suppression of GSCs by down -regulating of CRNDE is schematically presented in Figure 8. Figure 8 In summary, this is the first study that discovered and proved that CRNDE was up-regulated while miR-186 was down-regulated in GSCs. [score:10]
To verify whether CRNDE was involved in the regulation of XIAP and PAK7 expression as well as the biological behavior of GSCs through the miR-186 pathway, GSCs were transfected with over-express or down-regulate CRNDE and miR-186. [score:9]
Results showed that the overexpression of CRNDE increased the mRNA and protein expression levels of XIAP and PAK7, whereas the overexpression of miR-186 reduced their expression levels. [score:9]
Knockdown of CRNDE combined with overexpression of miR-186 significantly inhibited tumor growth in vivoTo determine the functions of CRNDE and miR-186 in vivo, we analyzed the effects of CRNDE knockdown, miR-186 overexpression and their combination on the glioma growth in tumor-bearing nude mice. [score:9]
The combination of CRNDE overexpression and miR-186 knockdown produced higher XIAP and PAK7 expression levels than those in either CRNDE or miR-186 overexpression group alone. [score:8]
Compared with the pGPU6-NC group, the expression of XIAP and PAK7 protein was down-regulated in the miR-186 group but was upregulated in the sh-miR-186 group. [score:8]
This evidence indicated that miR-186 played a role in regulating the expression levels of caspase 3, BAD, cyclin D1 and MARK2 through negative regulation of XIAP and PAK7 expression, which might be the mechanism in the regulation of the biological behavior of GSCs. [score:8]
Effect of CRNDE and miR-186 on proliferation, migration, invasion and apoptosis on GSCs and over -expression CRNDE elevated levels of the expression of XIAP and PAK7 by downregulating miR-186. [score:8]
Quantitative RT-PCR results demonstrated that miR-186 expression was down-regulated in the pEX2-CRNDE group compared with the pEX2-NC group, whereas it was up-regulated in the sh-CRNDE group compared to the sh-CRNDE NC group (Figure 4A). [score:7]
The mice were divided into five groups randomly: control group (only GSCs), miR-186-NC group (miR-186-NC stable GSCs), miR-186 group (empty vector of miR-186 group), sh-CRNDE-NC group (empty vector of sh-CRNDE group), sh-CRNDE group (CRNDE inhibition stable GSCs), sh-CRNDE+miR-186 group (CRNDE inhibition and miR-186 overexpression stable GSCs). [score:7]
To determine whether miR-186 could target XIAP and PAK7 on their 3′UTR region, and affect GSCs' behavior by regulating the expression of caspase3, cyclin D1, BAD and MARK2, cells were divided into four groups:miR-186-NC+XIAP-NC group (transfected with both pGPU6 and empty plasmid of XIAP), miR-186+XIAP-NC group (transfected with both miR-186-5p and empty plasmid of XIAP), miR-186+XIAP group (transfected with both miR-186-5p and XIAP full length plasmid (with 3′UTR)), miR-186+XIAP (non-3′UTR) group (transfected with both miR-186-5p and XIAP without 3′UTR plasmid); miR-186-NC+PAK7-NC group (transfected with both pGPU6 and empty plasmid of PAK7), miR-186+PAK7-NC group (transfected with both miR-186-5p and empty plasmid of PAK7), miR-186+ PAK7 group (transfected with both miR-186-5p and PAK7 full length plasmid (with 3′UTR)), miR-186+PAK7 (non-3′UTR) group (transfected with both miR-186-5p and PAK7 without 3′UTR plasmid). [score:6]
Overexpression of CRNDE or knockdown of miR-186 regulated the biological behavior of GSCs by regulating XIAP and PAK7. [score:6]
Knockdown of CRNDE combined with overexpression of miR-186 significantly inhibited tumor growth in vivo. [score:6]
XIAP and PAK7 protein expression levels in the pEX2-CRNDE+sh-miR-186 group were significantly increased compared with the pEX2-CRNDE+miR-186 group, while they were significantly decreased in the sh-CRNDE+miR-186 group compared with the sh-CRNDE+sh-miR-186 group (Figure 5D), indicating that CRNDE inhibited miR-186 expression and accordingly regulated the biological behavior of GSCs. [score:6]
Moreover, MiR-186 could also regulate the expression of caspase3, BAD, cyclin D1 and MARK2 by binding to the target genes and negatively regulating XIAP and PAK7. [score:6]
Previous studies have shown that miR-186 acted as a tumor suppressor and was down-regulated in many tumors such as lung adenocarcinoma, esophageal and colorectal cancers. [score:6]
CRNDE full length (pEX2-CRNDE) plasmid, four hairpin CRNDE (sh-CRNDE, CRNDE-homo-420, CRNDE-homo-452, CRNDE-homo-572, CRNDE-homo-787) plasmids and their respective non -targeting sequence (negative control, NC); miR-186-5p plasmid, sh-miR-186-5p plasmid and their respective non -targeting sequence (negative control, NC) were synthesized (GenePharma, Shanghai, China). [score:5]
To determine whether CRNDE -mediated regulation of miR-186 expression could regulate the behavior of GSCs, cells were divided into seven groups: control group, pEX2-NC+pGPU6-NC group (transfected with both pEX2-NC and pGPU6-NC), pEX2-CRNDE+miR-186 group (transfected with both pEX2-CRNDE and miR-186-5p), pEX2-CRNDE+sh-miR-186 group (transfected with both pEX2-CRNDE and sh-miR-186-5p), sh-NC+pGPU6-NC group (transfected with both sh-NC and pGPU6-NC), sh-CRNDE+sh-miR-186 group (transfected with both sh-CRNDE and sh-miR-186-5p), sh-CRNDE+miR-186 group (transfected with both sh-CRNDE and miR-186-5p). [score:5]
This evidence indicated that miR-186 could be regarded as a tumor suppressor gene that inhibited the biological behavior of GSCs, which was consistent with the results observed in non-small cell lung cancer. [score:5]
Furthermore, the pEX2-CRNDE+sh-miR-186 group had a significant lower apoptotic rate than pEX2-CRNDE+miR-186 group, suggesting that CRNDE inhibited miR-186 expression and further prevented the apoptosis of GSCs. [score:5]
MiR-186-3′UTR, XIAP 3′-UTR and PAK7 3′-UTR sequences were amplified by PCR and cloned into a pmirGlo Dualluciferase miRNA Target Expression Vector (Promega, Madison, WI, USA) to construct 3′-UTR-luciferase reporter vector (miR-186-WT, XIAP-WT, PAK7-WT) (GenePharma). [score:5]
D. Representative images of experiments of (red) of GSCs with the expression of with the expression of CRNDE and miR-186 changed. [score:5]
Similarly, the protein expression levels of MARK2 and BAD in the miR-186+PAK7 group were decreased, while cyclin D1 was significantly up-regulated compared with the miR-186+PAK7 group (Figure 6C). [score:5]
CRNDE expression in GSCs and miR-186 expression in glioma tissues and GSCs. [score:5]
was performed to detect the protein expression levels of XIAP and PAK7 in the GSCs at different expression levels of CRNDE and miR-186. [score:5]
The present study showed that CRNDE was highly expressed in the GSCs, while miR-186 was lowly expressed in glioma tissue and GSCs. [score:5]
CRNDE was highly expressed in GSCs while miR-186 was lowly expressed in glioma tissue and GSCs. [score:5]
The XIAP and PAK7 protein expression levels were determined by at different expression levels of CRNDE or miR-186 in GSCs (Figure 4B). [score:5]
In summary, CRNDE could bind to miR-186 and negatively regulate its expression, which contributes to the regulation of GSC biological properties. [score:5]
Experimental findings indicated that CRNDE and miR-186 can exert biological effects by regulating XIAP and PAK7 expression. [score:4]
CRNDE could promote GSCs proliferation, migration, invasion and inhibit GSCs apoptosis by negatively regulating miR-186. [score:4]
Knockdown of miR-186 promoted the proliferation, migration and invasion of GSCs and inhibited the apoptosis. [score:4]
was performed to determine whether miR-186 could regulate the expression of XIAP, PAK7, caspase3, BAD, cyclin D1 and MARK2. [score:4]
CRNDE attenuated miR-186 -induced inhibition of XIAP and PAK7 and affected the biological behavior of GSCs through negative regulation of miR-186. [score:4]
The present study showed that miR-186 was lowly expressed in glioma tissue compared to normal brain tissue, and the expression was also lower in the GSCs than that in the non-stem cells. [score:4]
D. qRT-PCR and western blot analysis for miR-186 regulated XIAP and PAK7 expression in GSC-U87 and GSC-U251. [score:4]
A. qRT-PCR analysis for CRNDE regulated miR-186 expression in GSCs. [score:4]
miR-186 regulated caspase3, cyclin D1, BAD and MARK2 by targeting XIAP and PAK7′s 3′-UTR. [score:4]
Results of the present study showed that, the pro-caspase 3 protein expression was significantly increased while cleaved caspase3 protein expression was significantly decreased in the miR-186+XIAP (non-3′UTR) transfected GSCs compared to the miR-186+XIAP transfected GSCs. [score:4]
miR-186 bound to the 3′UTR of XIAP and PAK7 and regulated the expression of caspase 3, BAD, cyclin D1 and MARK2. [score:4]
To verify whether the two factors were involved in the CRNDE or miR-186 -induced regulation of GSC biological behavior, we transfected GSCs to alter the expression of CRNDE and miR-186. [score:4]
Flow cytometry analysis results showed that the apoptosis rates were 14% ± 1.31%, 20% ± 1.65% and 8% ± 1.19% in pGPU6-NC, miR-186 over -expression and miR-186 knockdown groups respectively (Figure 3C). [score:4]
Figure 4 A. qRT-PCR analysis for CRNDE regulated miR-186 expression in GSCs. [score:4]
We further investigated whether miR-186 affected the GSC properties by regulating PAK7 and found that the miR-186+PAK7(non-3′UTR) -transfected GSCs had significantly higher expression levels of BAD and MARK2 proteins and lower expression level of cyclin D1 protein than the miR-186+PAK7 -transfected GSCs. [score:4]
Furthermore, we found that miR-186 might negatively regulate XIAP and PAK7, thus affecting the expression levels of caspase3, BAD, cyclin D1 and MARK2. [score:4]
To determine the functions of CRNDE and miR-186 in vivo, we analyzed the effects of CRNDE knockdown, miR-186 overexpression and their combination on the glioma growth in tumor-bearing nude mice. [score:4]
The protein expression levels of pro-caspase3 in the miR-186+XIAP (non-3′UTR) group were significantly increased, while the expression of cleaved caspase 3 was significantly decreased compared with the miR-186+XIAP group (Figure 6B). [score:4]
Results of in vivo studies showed that the overexpression of CRNDE combined with knockdown of miR-186 reduced the tumor volumes and weights of tumor-bearing nude mice. [score:4]
Moreover, we found that CRNDE bound to miR-186 and negatively regulated its expression. [score:4]
The stably transfected stem cell lines with overexpression or knockdown of miR-186 were established. [score:4]
MiR-186 could bind to XIAP and PAK7 3′UTR and accordingly played a negative role on regulating the expression of caspase3, BAD, cyclin D1 and MARK2. [score:3]
In human colon cancer HCT116 cells, miR-186 also acted as a tumor suppressor to promote the cellular senescence through p53–p21 Cip1/WAF1 pathway [9– 11]. [score:3]
However, the expression and function of miR-186 in gliomas still remain unclear. [score:3]
The expression levels of CRNDE and miR-186 in GSCs, non-stem cells (non-GSCs) and glioma tissues of different grades were detected with qRT-PCR. [score:3]
In non-small cell lung carcinoma, miR-186 could inhibit the proliferation by inducing G(1)-S checkpoint arrest. [score:3]
These results implied that CRNDE served as an oncogene while miR-186 acted as a tumor suppressor gene and both of them would be involved in the biological processes of GSCs. [score:3]
Results of dual-luciferase gene reporter assay showed that the luciferase activity in the pEX-2-CRNDE+miR-186-3′UTR-Wt group was lower than that in the pEX-2-CRNDE-NC+miR-186-NC group (Figure 4B), indicating that CRNDE binded to miR-186 and negatively regulated its expression. [score:3]
As previously described, miR-186 was lowly expressed in glioma tissue and GSCs. [score:3]
In contrary to CRNDE, miR-186 might serve as a tumor suppressor and affect the proliferation, migration, invasion and apoptosis of the GSCs. [score:3]
As previously described, CRNED bound to and negatively regulated miR-186 and both factors affected the biological characteristics of GSCs through regulating the expression of XIAP and PAK7. [score:3]
However, the expression and functions of miR-186 in glioma are poorly understood. [score:3]
As shown in figure 4A, the expression level of endogenous miR-186 was negatively correlated with the CRNDE. [score:3]
C. Flow cytometry analysis of GSCs with the expression of miR-186 changed. [score:3]
After infection, the stable expressing cells of miR-186 and sh-CRNDE were picked. [score:3]
Therefore, we suggested that CRNDE/miR-186 played an important role in GSCs and the present study provided evidence for novel targets in glioma treatment. [score:3]
According to the bioinformatics database (Targetscan, Pictar, miRanda), miR-186 might bind to XIAP and PAK7 3′UTR region. [score:3]
MiR-186 expression in glioma tissues was significantly decreased compared with the normal brain tissue (NBTs) and the expression was negatively correlated with the increasing pathological grades of glioma (Figure 1B). [score:3]
C. Flow cytometry analysis of GSC-U87 and GSC-U251 with the expression of CRNDE and miR-186 changed. [score:3]
We then investigated whether CRNDE -induced negative regulation of miR-186 would influence the biological characteristics of GSCs and found that the overexpression of CRNDE and knockdown of miR-186 promoted the proliferation, migration and invasion while inhibited the apoptosis in GCSs. [score:3]
MiR-186 3′UTR region was identified as the binding site between PAK7 and XIAP by the biological softwares (Targetscan, Pictar, miRanda). [score:3]
In addition, miR-186 was found to inhibit the proliferation, migration, invasion and promoted apoptosis in GSCs. [score:3]
B. Expression levels of miR-186 in glioma tissues of different grades and normal brain tissues (NBTs). [score:3]
The miR-186-5p and short-hairpin RNA targeting human CRNDE were ligated into the pLenti6.3/V5eDEST vector and LV3-CMV-GFP-Puro vector (GenePharma, Shanghai, China), respectively. [score:3]
B. Quantification of migration and invasion cells with the expression of CRNDE and miR-186 changed. [score:3]
C. Relative expression of miR-186 in non-GSCs and GSCs. [score:3]
B. Quantification of migration and invasion cells with the expression of miR-186 changed. [score:3]
D. Representative images of experiments of (green) of GSCs with the expression of miR-186 changed. [score:3]
The miR-186 group had a lower expression level of XIAP and PAK7 mRNA than pGPU6-NC group, while the sh-miR-186 group showed the contrary results. [score:3]
This result implied that CRNDE regulated GSC proliferation through miR-186 pathway. [score:2]
B. of the pro-caspase3 and cleaved caspase3 regulated by miR-186 and XIAP in GSC-U87 and GSC-U251. [score:2]
The above results have shown that CRNDE or miR-186 might be involved in the regulation of the biological behavior of GSCs. [score:2]
E. for CRNDE and miR-186 regulated IDVs of XIAP and PAK7, they are shown using GAPDH as endogenous control. [score:2]
In this study, we aimed at investigating the expression levels of CRNDE and miR-186 in glioma stem cells and the effects of CRNDE on miR-186 -induced regulation of XIAP and PAK7 as well as the underlying mechanism in the process. [score:2]
CRNDE bound to and negativelyregulated miR-186. [score:2]
To further explore the mechanisms, qRT-PCR and Western blot assays were performed to detect the effects of CRNDE or miR-186 on the mRNA and protein expression levels of XIAP and PAK7. [score:2]
C. of the cyclin D1, BAD and MARK2 regulated by miR-186 and PAK7 in GSC-U87 and GSC-U251. [score:2]
MiR-186 expression in GSCs was lower than that in non-GSCs (Figure 1C). [score:2]
The schematic cartoon of the mechanism of CRNDE as a oncogene negative regulation of miR-186 of GSCs. [score:2]
sh-CRNDE+sh-miR-186 group; [▲] P < 0.05 vs. [score:1]
A. The predicted miR-186 binding sites in the 3′-UTR region of XIAP (XIAP-3′-UTR-Wt) or PAK7 (PAK7-3′-UTR-Wt) and the designed mutant sequence (XIAP-3′UTR-Mut or PAK7-3′UTR-Mut) were indicated. [score:1]
From 2 [th] to 4 [th] week, sh-CRNDE group and miR-186 group developed significantly smaller tumors than pEX2-NC group and pGPU6-NC group. [score:1]
pEX2-CRNDE+miR-186 group; [#] P < 0.05 vs. [score:1]
The lentiviruses of miR-186 were transduced in sh-CRNDE stably transfected cells to generate miR-186+sh-CRNDE cells. [score:1]
The cells were divided in five groups: control group, miR-186 WT+pEX2-CRNDE NC (transfected with miR-186-WT and pEX2-CRNDE-NC), miR-186 WT+ pEX2-CRNDE group (transfected with miR-186-WT and pEX2-CRNDE), miR-186 Mut+ pEX2-CRNDE NC group (transfected with miR-186-Mut and pEX2-CRNDE-NC), miR-186 Mut+ pEX2-CRNDE group (transfected with miR-186-Mut and pEX2-CRNDE); control group, XIAP WT+miR-186 NC (transfected with XIAP-WT and pGPU6-NC), XIAP WT+miR-186 group (transfected with XIAP-WT and miR-186-5p), XIAP Mut+miR-186 NC group (transfected with XIAP-Mut and pGPU6-NC), XIAP Mut+miR-186 group (transfected with XIAP-Mut and miR-186-5p); control group, PAK7 WT+miR-186 NC (transfected with PAK7-WT and pGPU6-NC), PAK7 WT+miR-186 group (transfected with PAK7-WT and miR-186-5p), PAK7 Mut+miR-186 NC group(transfected with PAK7-Mut and pGPU6-NC), PAK7 Mut+miR-186 group(transfected with PAK7-Mut and miR-186-5p) The stably transfected GSCs were used in the in vivo study. [score:1]
miR-186+PAK7-NC group. [score:1]
To determine the effect of miR-186-5p on GSCs, cells were divided into four groups: control group, pGPU6-NC (also shown as miR-186 NC) (transfected with empty plasmid), miR-186 group (transfected with miR-186-5p plasmid), sh-miR-186 group (transfected with sh-miR-186-5p plasmid). [score:1]
The aforementioned experiments demonstrated the controversial functions of CRNDE and miR-186 in GSCs. [score:1]
And then pLenti6.3/V5eDEST-miR-186 and LV3-CMV-GFPPuro-sh-CRNDE vectors were generated. [score:1]
HEK-293T cells were seeded in 96-well plates and the cells were co -transfected with miR-186-WT(or miR-186-Mut) or XIAP-WT (or XIAP-Mut) or PAK7-WT (or PAK7-Mut) and pEX2-CRNDE or miR-186 plasmids when they reached 50–70% confluence. [score:1]
The sequence of sh-miR-186-5p was: 5′-CACCGCGCCCAA AAGGAGAATTCTTTGTT CAAGAGACAAAGAATTCCTTTTGGGCTTTTTTT G-3′, 5′-GATCCAAAAAAAGC CCAAAAGGAATTCT TTGTCTCTTGAACAAAGAATTCTCCTTTTGGGCT C-3′. [score:1]
The sequence of miR-186-5p was 5′-CACCGCAAAGAATTCTCC TTTTG GGCTTTCAAGAGAAGCCCAAAGAGAATTC TTTG TTTTTG-3′, 5′-GATCCAAAAAACAAAGAATT CTCTTTGGGCTTC TCTTGAAAGCCCAAAAGGAGA ATTCTTTGC-3′. [score:1]
Results of dual-luciferase reporter assay showed that CRNDE was capable of binding to miR-186, suggesting that CRNDE might affect the biology of GSCs by regulating miR-186. [score:1]
The apoptotic rate was significantly increased in the sh-CRNDE+sh-miR-186 and sh-CRNDE+miR-186 groups (Figure 5C). [score:1]
The volumes and weights of transplanted tumors were reduced in the sh-CRNDE group or miR-186 group compared with control group, and in co -transfected sh-CRNDE+miR-186 group, the inhibition of transplanted tumors were enhanced compared with either sh-CRNDE or miR-186 group alone (Figure 7A, 7B). [score:1]
However the numbers of migrating and invading GSCs in the sh-CRNDE+miR-186 group were significantly lower than those in the sh-CRNDE+sh-miR-186 group. [score:1]
Figure 6 A. The predicted miR-186 binding sites in the 3′-UTR region of XIAP (XIAP-3′-UTR-Wt) or PAK7 (PAK7-3′-UTR-Wt) and the designed mutant sequence (XIAP-3′UTR-Mut or PAK7-3′UTR-Mut) were indicated. [score:1]
miR-186 group; [Ψ] P < 0.05 vs. [score:1]
miR-186+XIAP group; [#] P < 0.05 vs. [score:1]
Our hypothesis was confirmed by the dual-luciferase reporter assay, suggesting that miR-186 possibly affected the biological behavior of GSCs through the negative regulation of XIAP and PAK7. [score:1]
According to the bioinformatics databases (RNAhybrid), we predicted that CRNDE might be associated with the miR-186 binding sites. [score:1]
Effect of miR-186 on proliferation, apoptosis, migration and invasion of GSCs. [score:1]
miR-186+PAK7 group; [#] P < 0.05 vs. [score:1]
The sequence of putative binding site was replaced as indicated (miR-186-Mut, XIAP-Mut, PAK7-Mut) to mutate the putative binding site of CRNDE or miR-186 in the 3′-UTR-containing vector. [score:1]
Lentivirus encoding miR-186-5p was generated using pLenti6.3/V5eDEST Gateway Vector Kit (Life Technologies Corporation, Carlsbad, CA, USA). [score:1]
miR-186+XIAP-NC group. [score:1]
XIAP-WT & miR-186 NC group and PAK7-WT & miR-186 NC group. [score:1]
The sequence of the negative control of miR-186-5p and sh-miR-186-5p (pGPU6-NC) was: 5′-CACCGTTCTCCGAACGTGTGT CACGTCACGT CAAGAGATTACGTGACACGTTCGGAGAATTTTTG -3′, 5′-GATCCAAAAAATTCTCCGAA CGTGTCACG TGTCACGTAATCTCTTGACGTGACACGTTCGGAG AA C-3′. [score:1]
[1 to 20 of 118 sentences]
2
[+] score: 322
Other miRNAs from this paper: hsa-mir-494
NSBP1 is a direct target of miR-186 and the overexpression of miR-186 suppresses cell proliferation and invasion of bladder cancer through suppression of NSBP1 expression and EMT. [score:12]
Consistent with the effects induced by overexpression of miR-186, knockdown of NSBP1 significantly suppressed the cell viability (Fig.   3a) and invasion (Fig.   3b and c), whereas overexpression of miR-186 did not have further suppressive effects on cell growth and metastasis in NSBP1-siRNA -transfected J82 cells. [score:10]
showed that miR-186 targets NSBP1 3′-untranslated region (UTR) directly and suppresses NSBP1 (HMGN5) expression in human bladder cancer cells. [score:10]
In addition, a significant downregulation of NSBP1 protein levels was observed following miR-186 overexpression, indicating the post-transcriptional regulation of NSBP1 via targeting its 3′UTR. [score:9]
So we speculated that miR-186 function as tumor suppressor and inhibit bladder cancer proliferation and invasion by suppressing NSBP1 expression. [score:9]
Expression analysis of a set of epithelial-mesenchymal transition (EMT) markers showed that NSBP1 involves miR-186 suppressed EMT which reducing the expression of mesenchymal markers (vimentin and N-cadherin) and inducing the expression of epithelial marker (E-cadherin). [score:9]
&, p < 0.01 versus miR-186 group Recently, miR-186 function as a tumor suppressive miRNA and miR-186 expression level is down-regulated in various human malignancies [26, 27]. [score:8]
NSBP1 siRNA- and miR-186 -mediated NSBP1 knock-down experiments revealed that miR-186 suppresses cell proliferation and invasion through suppression of NSBP1 expression. [score:8]
Recently, miR-186 function as a tumor suppressive miRNA and miR-186 expression level is down-regulated in endometrial cancer [23], prostate cancer [24], medulloblastomas [25], non-small cell lung carcinoma [26, 27]. [score:8]
Recently, miR-186 function as a tumor suppressive miRNA and miR-186 expression level is down-regulated in various human malignancies [26, 27]. [score:8]
Our results demonstrated that miR-186 directly targets the 3′UTR of NSBP1, as its overexpression was associated with suppression of luciferase activity in a reporter plasmid driven by the NSBP1 -3′UTR. [score:8]
Recently, miR-186 function as a tumor suppressive miRNA and miR-186 expression level is down-regulated in various human malignancies: endometrial cancer [23], prostate cancer [24], medulloblastomas [25], non-small cell lung carcinoma [26, 27]. [score:8]
Interestingly, we demonstrated that miR-186 mimics and NSBP1 siRNA inhibited EMT and were associated with reduced expression of E-cadherin and elevated expression of N-cadherin and vimentin in bladder cancer. [score:7]
In addition, overexpression of miR-186 markedly reduced the expression of NSBP1 (Fig.   2b), but silenced NSBP1 did not affect miR-186 expression. [score:7]
Here, we report downregulation of miR-186 and demonstrate its role as a tumor suppressor in bladder cancer. [score:6]
Ectopic miR-186 results in suppression of the proliferative, invasive ability and EMT of bladder cancer by directly targeting NSBP1. [score:6]
miR-186 regulated BC cell proliferation and invasion by suppressing NSBP1 expression. [score:6]
b and c, Overexpressed miR-186 and silenced NSBP1 suppressed cell invasion. [score:5]
The miR-186 expression was downregulated in all bladder cancer cell lines as compared with that in HCV29 (Fig.   1c). [score:5]
This indicated miR-186 represses the expression of N-cadherin and Vimentin, while promoting the induction of E-cadherin by targeting NSBP1. [score:5]
Statistical comparisons between groups were analyzed using correlation between expression levels of miR-186 and its target genes in BC tissues was analyzed using Spearman’s correlation coefficient. [score:5]
org and TargetScan identified the NSBP1 as a possible target of miR-186. [score:5]
Taken together, miR-186 suppress BC cell EMT by targeting NSBP1. [score:5]
a, Overexpressed miR-186 and silenced NSBP1 suppressed cell proliferation. [score:5]
Overexpression of miR-186 significantly inhibited the luciferase activity of the Wt NSBP1 3′-UTR reporter gene but not the Mut reporter gene (Fig.   2a). [score:5]
Here, we determined the expression of epithelial marker, E-cadherin, and mesenchymal marker, vimentin and N-cadherin in bladder cancer cells with altering expression of miR-186 and NSBP1. [score:5]
N-cadherin and Vimentin was downregulated significantly in miR-186 group (Fig.   4a, c and d). [score:4]
MiR-186 induces EMT of BC cells by suppressing NSBP1 expression. [score:4]
Here, our study showed miR-186 was down-regulated in bladder cancer tissues and cell lines. [score:4]
For example, miR-186 was reported to be significantly upregulated in most pancreatic cancer [22]. [score:4]
Additional studies identified NSBP1 as a direct functional target of miR-186. [score:4]
In conclusion, our study demonstrates that miR-186 is significantly downregulated in bladder cancer. [score:4]
These results demonstrated that NSBP1 is a direct target of miR-186 in BC cells (Fig.   2c). [score:4]
Accumulating studies showed that the deregulated expression of miR-186 was observed in various cancers. [score:4]
Our data first time identified miR-186 as the upstream regulator of NSBP1 and also suggest miR-186 -suppressed NSBP1 as a novel therapeutic approach for bladder cancer. [score:4]
miR-186 directly targeted NSBP1. [score:4]
Moreover, our data indicated that there was an inverse correlation between miR-186 and NSBP1 expression (Fig.   1b). [score:3]
c, analysis revealed the miR-186 expression in human bladder cancer cell lines (J82, HT1376, RT4, T24 and TCCSUP) and immortalized human bladder epithelium (HCV29) cells. [score:3]
To further confirm these results, we constructed luciferase reporter vectors containing the wild-type (Wt) or mutant (Mut) miR-186 target sequences of the NSBP1 3′-UTR (Fig.   2a). [score:3]
The relative expression of miR-186 was shown as fold difference relative to U6. [score:3]
The expression of miR-186 and NSBP1 in BC tissues and cell lines. [score:3]
a, Western bolt analysis revealed the effects of miR-186 and NSBP1 on EMT-relative protein expression. [score:3]
b, analysis revealed the effects of NSBP1 siRNA and miR-186 mimics on the expression level of miR-186. [score:3]
b The inverse correlation between NSBP1 and miR-186 expression in 20 BC samples was determined using Spearman’s correlation analysis (r = −0.8946, P <0.05) * P <0.05. [score:3]
Fig. 1The expression of miR-186 and NSBP1 in bladder cancer tissues and cell lines. [score:3]
We found that miR-186 expression was significantly decreased in BC tissues relative to the matched non-tumor tissues (P < 0.05, Fig.   1a). [score:3]
Moreover, E-cadherin expression in siRNA group was higher than that in miR-186 group (miR-186 mimics) and similar with that in miR-186 + siRNA group. [score:3]
do) to predict the possible target gene of miR-186. [score:3]
c, The effects of miR-186 and NSBP1 on N-cadherin expression. [score:3]
However, the expression and mechanism of miR-186 in bladder cancer remain unclear. [score:3]
Here, we analyzed the miR-186 expression in 20 paired clinical BC and adjacent noncancerous bladder tissues using. [score:3]
These data indicates that miR-186 may function as tumor suppressor in bladder cancer cells. [score:3]
Overall, these studies describe a promising therapeutic role for miR-186 in bladder cancer, which appears to act at least in part by mimicking pharmacological inhibitors of NSBP1. [score:3]
c, analysis revealed the effects of NSBP1 siRNA and miR-186 mimics on the expression level of NSBP1. [score:3]
Moreover, N-cadherin and Vimentin expression in siRNA group were lower than that in miR-186 group (miR-186 mimics) and similar with that in miR-186 + siRNA group. [score:3]
Increasing evidence has shown that microRNAs function as oncogenes or tumor suppressors in human malignancies, but the roles of miR-186 in human bladder cancer (BC) is still unclear. [score:3]
Our results suggest silencing of miR-186 as a possible mechanism for NSBP1 overexpression in bladder cancer. [score:3]
b, The effects of miR-186 and NSBP1 on E-cadherin expression. [score:3]
miR-186 -mediated suppression of NSBP1 attenuates cell proliferation and invasion of bladder cancer. [score:3]
We observed miR-186 to be downregulated in bladder cancer cell lines compared with bladder epithelium (HCV29) cells. [score:3]
First, quantitative real-time PCR (qRT-PCR) was performed to detect miR-186 expression in bladder cancer tissues and cell lines. [score:3]
d, The effects of miR-186 and NSBP1 on Vimentin expression. [score:3]
Then, Bioinformatics analysis, combined with luciferase reporter assay demonstrated the target gene of miR-186. [score:2]
The miR-186 has been commonly deregulated in various cancers. [score:2]
indicated the expression of E-cadherin was increased in miR-186 mimics group compared with NC (Fig.   4a and b). [score:2]
Here, to explore protein regulated by miR-186 in the EMT process, we investigated the expression of three EMT related proteins, E-cadherin, N-cadherin and Vimentin by. [score:2]
In this study, we examined both the regulation of the NSBP1 pathway by miR-186 in bladder cancer, as well as its functional significance. [score:2]
a, miR-186 expression is markedly decreased in tumor samples compared to adjacent noncancerous bladder tissues. [score:2]
HEK 293 T cells (3.5 × 10 [4]) were seeded in triplicate in 24-well plates and cotransfected with wild-type (WT) or mutant (Mut) 3′-UTR vectors and miR-186 mimics using Lipofectamine 2000. [score:1]
with co-transfection of wild-type or mutant NSBP1 and miR-186 mimics or miR–control (scramble control mimics). [score:1]
a, Sequence alignment of miR-186 and 3′ UTR of NSBP1 using mirco -RNA. [score:1]
miR-186 mimics and scramble control mimics (GenePharma, Suzhou, China) were transfected in J82 cells at a final concentration of 50 nM using Lipofectamine 2000 reagent (Invitrogen). [score:1]
&, p < 0.01 versus miR-186 group NSBP1, also named HMGN5, is a novel member of HMGN family, which modifies the structure of chromatin to attain a conformation that facilitates and enhances transcription, histone modifications, replication and repair [5, 6]. [score:1]
To determine the role of NSBP1 and miR-186 in the bladder cancer cell growth and metastasis, J82 cells were transiently co -transfected with NSBP1 siRNA (siRNA) and miR-186 mimic (miR-186). [score:1]
Bladder cancer cells were transfected with NC, miR-186 mimics, NSBP1 siRNA and co -transfected with miR-186 mimics and NSBP1 siRNA. [score:1]
We found that NSBP1 contained theoretical miR-186 binding sites in its 3′ UTR (Fig.   2a). [score:1]
[1 to 20 of 76 sentences]
3
[+] score: 311
Although about miR186 regulation of Twist1 expression implicating in cisplatin resistance in ovarian cancer has been recently reported [34], our data demonstrate that miR186 plays a tumor suppressive role in PCa by inhibiting tumorigenesis and metastasis, and its expression level is reversely correlated to the clinical grade and pathological grading, and the low miR186 expression is correlated with poor patient survival. [score:12]
Overexpression of miR186 in PC3 [luc] cells strikingly suppressed tumor metastasis in vivo, while re -expression Twist1 in the PC3 [luc]-miR186 cells significantly rescued metastasis formation which was inhibited by overexpression of miR186 (Figure 6H & Supplementary Figure S6). [score:11]
In this study we found that miR186 was downregulated inmalignant PCa cell lines and clinical PCa specimens, and we experimentally demonstrated that miR186 maintained the epithelial phenotype and reduced migration and invasion, soft-agar colony formation, vasculogenic mimicry (VM) formation capability of human PCa cells through targeting Twist1, suggesting that miR186 might serve as a tumor-suppressive miRNA in the development and progression of PCa. [score:9]
The ectopic expression of miR186 in M12 markedly downregulated N-cadherin and Vimentin (mesenchymal markers) (Figure 2A, left panel); on the contrary, the silencing of endogenous miR186 in P69 upregulated N-cadherin, Vimentin and decreased E-cadherin (Figure 2A, right panel). [score:9]
To assess the role of the dyregulated miR186 in PCa cells, we tested whether the ectopic expression or the inhibition of miR186 expression can block or accelerate the PCa progrssion, respectively. [score:8]
For examples, miR186 inhibits proliferation by targeting cyclin D1, CDK2, and CDK6 in NSCLC cells, and miR186 downregulation is correlated with poor prognosis of NSCLC patients [24]. [score:8]
Briefly, the lentiviral expression vector pGreenPuro [TM] shRNA (System Biosciences) was used to generate artificial mature miR186 for overexpression and miRZip shRNA anti-miR186 for silencing the expression of miR186. [score:7]
Overexpression of Twist1 in M12-miR186 cells (as shown in Supplementary Figure S3A) abrogated miR186 mediated inhibition of N-cadherin/Vimentin expression (Figure 5A), cell migration (Figure 5B & Supplementary Figure S3B), cell invasion (Figure 5B & Supplementary Figure S3C), cell anchorage-independent growth (Figure 5D), 3D culture growth (Figure 5E) and VM formation (Figure 5F). [score:7]
These results indicate that miR186 directly suppresses Twist1 by targeting Twist1 3′-UTR. [score:6]
Through overexpression or knockdown of miR186 in LNCaP cells with the lentiviral vector system, we found that miR186 suppressed EMT (Supplementary Figure S5A) and migration (Supplementary Figure S5B), which are similar to as those in PC3. [score:6]
Thus, above data suggested that miR186 downregulation is a risk factor of prostate cancer, and decreased miR186 expression likely contributes to prostate cancer progression and might represent a prognostic biomarker for prostate cancer. [score:6]
Firstly, overexpression of miR186 in PC3 suppressed whereas knockdown of miR186 promoted the EMT progression (Figure 6A). [score:6]
Here we identified Twist1 as a direct target of miR186 is highly expressed in human PCa specimens and cells. [score:6]
Further one-way ANOVA analysis showed that the miR186 expression levels were statistically significant differences in subgroups Cleason (P < 0.001), clinical grade (P < 0.001), TNM stage (P < 0.01), suggesting the miR186 expression level is significantly associated with prostate cancer progression (Figure 7C). [score:5]
On the other hand, miR186 as a oncogene promotes endometrial tumorigenesis by repressing the expression of tumor suppressor gene FOXO1 [26]. [score:5]
The results showed that the cell migratory capacity was greatly inhibited by overexpression of miR186 in M12, on the contrary, enhanced by silencing of miR186 in P69, respectively. [score:5]
Secondly, overexpression of Twist1 in PC3-miR186 cells abolished miR186 -mediated suppression of cell migration (Figure 6B & Supplementary Figure S4A), cell invasion (Figure 6C & Supplementary Figure S4B), cell anchorage-independent growth (Figure 6D). [score:5]
Most importantly, one-way ANOVA analysis showed that the miR186 expression levels were statistically significant differences in subgroups clinical grade (P < 0.001), Cleason (P < 0.001), TNM stage (P < 0.01), indicating that the decreased miR186 expression contributed to PCa progression and might represent a prognostic biomarker for PCa. [score:5]
Collectively, above data demonstrate that miR186 playstumor suppressive roles in PCa progression by inhibiting EMT, migration, invasion, anchorage-independent growth, 3D culture growth and VM formation. [score:5]
Through high-throughput sequencing of digital gene expression (DGE) and Western blotting analysis, we found that the expression level of Twist1, which was higher in M12 than those in P69 (Figure 3B– 3C), was inversely correlated with miR186 (Figure 1E). [score:5]
miR186 also inhibits the invasive activity of NSCLC cells by modulating PTTG1 expression [25]. [score:5]
miR186 functions by downregulation of Twist1 in PCa cells. [score:4]
miR186 is downregulated in malignant prostate cancer cell line M12. [score:4]
Twist1 is a direct target of miR186 in PCa. [score:4]
miR186 is downregulated in a malignant PCa cell line M12. [score:4]
Thus, miR186 downregulation likely contributed to PCa pathogenesis and might represent a prognostic biomarker for PCa. [score:4]
Knockdown of Twist1 significantly reduced cell migration (Figure 4A–4B & Supplementary Figure S2B), invasion (Figure 4C & Supplementary Figure S2C), anchorage-independent growth (Figure 4D) and VM formation (Figure 4E), which all were similar to the phenotypies mediateded by overexpression of miR186. [score:4]
Moreover, we knocked down AR in stable cell line LNCaP-Ctrl or LNCaP-anti-miR186 and showed that the miR186 -mediated Twist1 inhibition was not influenced by AR (Supplementary Figure S5E). [score:4]
In functional studies, ectopically expressed miR186 in M12 cells or knockdown of miR186 in P69 dramatically repressed or enhanced EMT, anchorage-independent growth, cell migration cell invasion, 3D culture growth and VM formation, respectively. [score:4]
On the contrary, ectopic expression of Twist1 in P69 cells resulted in enhancement of migration (Figure 4F & Supplementary Figure S2D), invasion ability (Figure 4G & Supplementary Figure S2E), anchorage-independent growth (Figure 4H), VM formation (Figure 4I) and 3D culture growth (Figure 4J), as like phenocopying those in knockdown of miR186 in P69 (P69-anti-miR186 cells). [score:4]
Moreover, miR186 overexpression or knockdown in a AR -negative metastatic prostate cancer cell line PC3 or an AR -positive cell line LNCap also showed the same phenotypes as in M12/P69. [score:4]
In this study we found that miR186 is remarkably downregulated in malignant M12 cells and PCa specimens (especially in bone metastatic adenocarcinoma), and is negative correlated to histological grade. [score:4]
Indeed, knockdown of Twist1 reversed various phenotypes of P69-anti-miR186 cells, including expressions of EMT markers (Supplementary Figure S3E), cell migration (Figure 5G & Supplementary Figure S3F), cell invasion (Figure 5H & Supplementary Figure S3G), anchorage-independent growth (Figure 5I), 3D culture growth (Figure 5J) and VM formation (Figure 5K). [score:4]
Taken together, the above results suggest that Twist1 is a functional target of miR186 in PCa cells. [score:3]
38 of PCa patients (missing 2 patient's data) were divided into 2 groups based on the miR186 expression level, the miR186-low group (less than the median value) and the miR186 -high group (more than the median value) for clinical survival analysis. [score:3]
MiR186 was introduced to M12, or silenced with antisense inhibitor (anti-miR186) in P69. [score:3]
These results demonstrated that miR186 directly regulates the Twist1 level in clinical PCa specimens, indicating the potential application value of miR186 and Twist1 in the early diagnosis and treatment of PCa. [score:3]
Collectively, above results proved that the miR186-Twist1 axis suppresses PCa progression in vitro and metastasis in vivo. [score:3]
The efficiency of ectopic expression in M12 was determined by real-time PCR, the miR186 level was increased up to 2 fold similar to that in P69 (Supplementary Figure S1A). [score:3]
The miR186-Twist1 axis suppresses PCa progression. [score:3]
miR186 has dual roles either as an oncogene or a tumor suppressor gene in a certain type of cancer. [score:3]
E. Real-time PCR analysis for the expression levels of miR186 in P69 and M12 cells. [score:3]
However, ectopic expression of miR186 abolished cell penetrating into the matrigel, instead, cells grew into tight colonies and only a small percentage of cells showed invasive ability in the matrigel (Figure 2E, left panels). [score:3]
The malignant PC3 [luc] cells which were engineered to stably express a firely luciferase were infected with the lentiviral empty vector or carrying miR186 construct. [score:3]
M12 was able to rapidly form vasculogenic networks on the matrigel, which was destroyed by ectopic expression of miR186 (Figure 2G). [score:3]
To investigate the key target(s) involved in PCa progression by miR186, we searched putative target genes using bioinformatics prediction program miRanda-mirSVR. [score:3]
All these data from PC3 strengthened our conclusion the miR186-Twist1 axis suppresses PCa cell progression. [score:3]
Ectopic expression of miR186 in M12 dramatically decreased while silencing of miR186 in P69 increased the soft-agar colony formation in numbers and sizes (Figure 2F). [score:3]
For determination of miR186 targeting Twist1 3′-UTR, 293T cells (5×10 [4] cells per well) were plated in a 24-well plate and then co -transfected with 200 ng of either pGreenpuro-miR186 or a pGreenpuro control, 100 ng of either pMIR-REPORT [TM] (AmBion) Firefly luciferase constructs containing the Twist1 3′-UTR WT or MUT, and 20 ng of pRL-SV40 Renilla Luciferase vector as a normalization control using Lipofectamine [TM] 2000. [score:3]
These results suggest that miR186 can inhibit the EMT progression. [score:3]
miR186 suppresses PCa cell progression. [score:3]
Thus, these results demonstrate that miR186 plays a tumor suppressive role in PCa. [score:3]
As expected, ectopic expression of miR186 in M12 strikingly decreased the number of cells penetrated into matrigel, while silencing of miR186 in P69 promoted cell aggressiveness (Figure 2D and Supplementary Figure S1C). [score:3]
In vivo metastasis experimentsPC3 [Luc] cells [39] stably expressing the empty vector, miR186, miR186-CD513B (vector), or miR186+Twist1 were used in in vivo metastasis assays. [score:2]
MiR186 suppresses PCa progression. [score:2]
Thirdly, knockdown of Twist1 in PC3-anti-miR186 cells reversed the enhancement of cell migration (Figure 6E & Supplementary Figure S4C), cell invasion (Figure 6F & Supplementary Figure S4D), cell anchorage-independent growth (Figure 6G) caused by miR186 silencing. [score:2]
In contrast, knockdown of miR186 in P69 triggered cells invading into the matrigel (Figure 2E, right panels). [score:2]
The real-time PCR for miR186 was performed to confirm the results of ISH, showing that the expression levels of miR186 were reduced in prostate cancer specimens, especially most significantly in the metastatic patient specimens, compared with paired normal tissues (Figure 7B). [score:2]
PC3 [Luc] cells [39] stably expressing the empty vector, miR186, miR186-CD513B (vector), or miR186+Twist1 were used in in vivo metastasis assays. [score:2]
P69 could only accumulate in clumps on the matrigel, whereas the pipe-like structures was observed when miR186 was knocked down (Figure 2G). [score:2]
Lastly, we also measured the mRNA levels of AR and PSA in LNCaP-miR186 or LNCaP-Ctrl cells, and found that the mRNA levels of both AR and PSA (AR downstream) were moderately downregulated (Supplementary Figure S5F–S5G). [score:2]
When knocked down AR in LNCaP cells by siRNA (Supplementary Figure S5C), we found that the levels of miR186 were not affected (Supplementary Figure S5D). [score:2]
By in situ hybridization (ISH), we showed that the expression levels of miR186 were reduced in prostate tumor specimens (n=40) compared to those of normal prostate tissues (n=8) (Figure 7A and & Supplementary Table S1). [score:2]
Western blotting analysis for Twist1 in P69 and M12 (C), M12-vector and M12-miR186 (D), or P69-vector and P69-anti-miR186 cells (E). [score:1]
Figure 2 A. Immunoblotting of epithelial and mesenchymal markers in M12-vector and M12-miR186 or P69-vector and P69-anti-miR186 cells. [score:1]
The synthetic double-stranded miR186 oligonucleotide sequences were: miR186 forward, GATCCGCAAAGAATTCTCCT TTTGGGCTCTTCCTGTCAGAAGCCCAAAAGCTCAATTCTTTGCTTTTTG; miR186 reverse, AATT CAAAAAGCAAAGAATTGAGCTTTTGGGCT TCTGACAGGAAGAGCCCAAAAGGAGAATTCTTTGCG. [score:1]
We also assessed whether miR186 influences vasculogenic mimicry (VM) formation of PCa cells. [score:1]
The synthetic double-stranded miR186 oligonucleotide sequences were: miR186 forward, GATCCGCAAAGAATTCTCCT TTTGGGCTCTTCCTGTCAGAAGCCCAAAAGCTCAATTCTTTGCTTTTTG; miR186 reverse, AATT CAAAAAGCAAAGAATTGAGCTTTTGGGCT TCTGACAGGAAGAGCCCAAAAGGAGAATTCTTTGCG. [score:1]
M12-vector and M12-miR186 or P69-vector and P69-anti-miR186 cells were seeded into a CIM-Plate without or with pre-coated matrigel (1:40) and subjected to a dynamic analysis lasting for 48 h, respectively. [score:1]
A. Immunoblotting of epithelial and mesenchymal markers in M12-miR186-Vector and M12-miR186-Twist1 cells. [score:1]
Figure 7 A. Assessment of miR186 levels by in situ hybridization in normal prostate tissues (n=8) and prostate carcinomas (n=40). [score:1]
The correlation between the miR186 and Twist1 levels in human clinical PCa specimens was analyzed by Pearson Correlation test and linear correlation and regression. [score:1]
Overall, the miR186/Twist1 pathway may also affect the AR signaling pathway, but is independent on the AR pathway. [score:1]
H. 1.0×10 [6] of stable cell lines PC3 [Luc]-Vector, PC3 [Luc]-miR186, PC3 [Luc]-miR186-Vector and PC3 [Luc]-miR186-Twist1 were respectively injected into the left cardiac ventricle of BALB/c nude mice at 7 weeks old by intracardiac injection. [score:1]
Comparisons of the miR186 levels in subgroups (clinical grade, Cleason, TNM stage) for significance were analyzed by one-way ANOVA. [score:1]
To investigate which miRNA is involved in the progression from P69 to M12, we performed the real-time PCR and found that miR186 was significantly downregulated in M12 compared to that in P69 (Figure 1E). [score:1]
Most importantly, the protein level of Twist1 was indeed reduced drastically in M12-miR186 cells (Figure 3D) but elevated in P69-anti-miR186 cells (Figure 3E). [score:1]
One group (PC3-Vector, PC3-miR186, PC3-miR186-CD513B and PC3-miR186-Twist1) and another group (PC3-Vector, PC3-anti-miR186, PC3-anti-miR186-pLko. [score:1]
B. The miR186 expression levels in clinical specimens were measured by real-time PCR. [score:1]
Thus, the miR186-Twist1 pathway seems to work in either negative or positive AR PCa cell line. [score:1]
To further validate that the biological relevance of the miR186-Twist1 axis is a general phenomenon in PCa, similar experiments were performed with a highly malignant and metastatic PCa cell line, PC3. [score:1]
anti-miR186 forward, GATCCGCAAAGAATTCAGGTTTTGGGCTCTTCCTGTCAGAAGCCCAAA AGGAGAATTCTTTGCTTTTTG; anti-miR-186 reverse, AATTCAAAAAGCAAAGAATTCTCCTTTTGGGCTTCTGACAGGAAGAGCCCAAAACCTGAATTCTTTGCG. [score:1]
The miR186 significantly repressed the activity of the Twist1-3′-UTR luciferase reporter construct containing a wild-type but not a mutated miR186 binding site (Figure 3A). [score:1]
Stable M12 group (M12-vector, M12-miR186, M12-pL KO. [score:1]
1 and P69-anti-miR186-shTwist1-3 in G–H) cells were seeded into a CIM-Plate without or with pre-coated matrigel (1:40) and subjected to a dynamic analysis lasting for 48 or 72 h, respectively. [score:1]
anti-miR186 forward, GATCCGCAAAGAATTCAGGTTTTGGGCTCTTCCTGTCAGAAGCCCAAA AGGAGAATTCTTTGCTTTTTG; anti-miR-186 reverse, AATTCAAAAAGCAAAGAATTCTCCTTTTGGGCTTCTGACAGGAAGAGCCCAAAACCTGAATTCTTTGCG. [score:1]
Clinical significance of the miR186-Twist1 axis in PCa progression. [score:1]
E. Assessment of miR186 levels by immunohistochemistry in normal prostate tissues (n=8) and prostate carcinomas (n=40). [score:1]
A. Immunoblotting of epithelial and mesenchymal markers in PC3-Vector, PC3-miR186 and PC3-anti-miR186 cells. [score:1]
M12 group (M12-Vector, M12-miR186, M12-miR186-CD513B and M12-miR186-Twist1 in B–C) or P69 group (P69-Vector, P69-anti-miR186, P69-miR186-pL KO. [score:1]
The above pretreated tissue array slides were hybridized with Digoxigenin-conjugated oligonucleotide probes for human hsa-miR186 (40 μM) for 1 hour at 37°C or at 4°C overnight, and incubated with DNase for 30 minutes at 37°C, rinsed 3 times with DEPC-PBS buffer. [score:1]
The correlation analysis revealed the Twist1 levels (detected by IHC) were significantly negatively correlated with the expression levels of miR186 (measured by the real-time PCR) in clinical PCa specimens (Figure 7F). [score:1]
Figure 5 A. Immunoblotting of epithelial and mesenchymal markers in M12-miR186-Vector and M12-miR186-Twist1 cells. [score:1]
Figure 6 A. Immunoblotting of epithelial and mesenchymal markers in PC3-Vector, PC3-miR186 and PC3-anti-miR186 cells. [score:1]
Twist1 mimics miR186 -mediated phenotypes in PCa cells. [score:1]
D. The correlation between the miR186 level and survival of patients with PCa was analyzed by Kaplan–Meier analysis. [score:1]
A. Immunoblotting of epithelial and mesenchymal markers in M12-vector and M12-miR186 or P69-vector and P69-anti-miR186 cells. [score:1]
1 and M12-shTwist1-3 in B–C) or P69 group (P69-vector, P69-anti-miR186, P69-CD513B, and P69-Twist1 in F–G) cells were seeded to a CIM-Plate without or with pre-coated matrigel (1:40) and subjected to a dynamic analysis lasting for 48 or 72 h, respectively. [score:1]
Above results demonstrated that miR186 and Twist1 execute opposite effects during PCa progression. [score:1]
A. Assessment of miR186 levels by in situ hybridization in normal prostate tissues (n=8) and prostate carcinomas (n=40). [score:1]
In order to determine that miR186 directly binds the Twist1 3′-UTR, we performed the luciferase reporter assay. [score:1]
C. The relevance between the clinical characteristics and the miR186 expression levels of prostate cancer patients was analyzed by one-way ANOVA. [score:1]
All these in vitro results prompted us to explore the effects of the miR186-Twist1 axis on tumor metastasis of xenografted mouse mo del in vivo. [score:1]
Moreover, Kaplan–Meier survival analysis revealed that patients with the high level of miR186 had a higher survival rate than those with the low level of miR186 (P=0.028) (Figure 7D). [score:1]
1 and PC3-anti-miR186-shTwist1) cells were seeded into a CIM-Plate without or with pre-coated matrigel (1:40) and subjected to a dynamic analysis lasting for 48 or 96 h, respectively. [score:1]
[1 to 20 of 105 sentences]
4
[+] score: 281
Other miRNAs from this paper: hsa-mir-21, hsa-mir-155
[26] We have previously demonstrated that miR186 greatly suppresses tumor formation and metastasis in vitro and in vivo by downregulation of its target Twist1, and the miR186 expression level is significantly decreased and negatively correlated with Twist1 in clinical PCa specimens. [score:10]
The NF-κB pathway is thought to have a role in oncogenic function; however, in our study, we revealed that NF-κB acted as a tumor suppressor by inducing miR186 expression and subsequently downregulating Twist1 expression in BPH1 and P69 under inflammatory stimulation. [score:10]
However, we surprisingly observed Twist1 protein upregulation rather than downregulation in P69 cells stably transfected with anti-miR186 inhibitor for silencing endogenous miR186, under the treatment with LPS or TNFα in a time course (Supplementary Figures S3e and f). [score:9]
We further demonstrated that the regulatory mechanism of Twist1/miR186 expression was a double -negative feedback regulatory circuit: Twist1, a downstream target of miR186, negatively repressed miR186 expression by increasing Dnmt3a -mediated CpG methylation of the miR186 promoter, which abolished the NF-κB -dependent enhancement of miR186 transcription in malignant cells. [score:9]
We observed that miR186 overexpression significantly decreases the Twist1 protein level in LT-BPH1, M12 and PC3, which provided crucial insight into miR186 executing tumor-suppressing function by directly targeting Twist1 in malignant PCa cells. [score:8]
Last, we confirmed that the TNFα -induced miR186 expression was abolished by ectopically expressing Twist1 in BPH1, which was rescued by knockdown of Dnnmt3a, suggesting that the association of Twist1 with E-box5 could inhibit the binding of NF-κB to BS2 and its transcriptional activity of the miR186 promoter in a Dnmt3a -dependent manner (Figure 5i). [score:8]
More importantly, we observed that the pretreatment of 5-aza-CdR restored miR186 responsiveness to LPS (Figure 3f and Supplementary Figure S4c) and TNFα (Figure 3g and Supplementary Figure S4d) and subsequently inhibiting the Twist1 expression in LT-BPH1 cells, which suggested that miR186 expression was strictly controlled by the methylation level of its promoter. [score:7]
Thus, the above results elucidated a negative feedback loop of Twist1 regulating the miR186 expression through directly recruiting an active Dnmt3a to the miR186 promoter, which facilitated methylation in turn repressing miR186 expression. [score:7]
[25] The results showed that the rapidly induced miR186 levels were perfectly inversely correlated with downregulation of Twist1 protein in both BPH1 (Supplementary Figures S3a and b) and P69 (Supplementary Figures S3c and d) cells with the stimulation of LPS or TNFα in a time course, suggesting that NF-κB activation by LPS or TNFα was required for downregulation of Twist1, most likely via enhancing miR186 transcription. [score:7]
Twist1 was downregulated by the NF-κB–miR186–Twist1 pathway in non-transformed and normal cells (BPH1, P69), whereas this pathway was abolished due to the CpG hypermethylation of the miR186 promoter in the malignantly transformed and cancer cells (LT-BPH1, M12, PC3), thereby losing antagonization of Twist1 upregulation from the NF-κB–Twist1 pathway, which was still active. [score:7]
During PCa progression, Twist1 upregulation and miR186 downregulation become a stable event with the feedback of miR186/Twist1 maintaining the cell malignantly transformed phenotype and promoting metastasis. [score:7]
To better understand the relationship between miR186 and Twist1, we stably overexpressed Twist1 in P69 and BPH1 cells and found the expression levels of miR186 were remarkably decreased (Figure 4a), which indicated that miR186 and Twist1 probably constituted a negative regulatory feedback loop. [score:6]
In this study, we established a chronic inflammation -associated PCa mo del of benign prostatic hyperplasia (BPH) epithelial cell line BPH1/LT-BPH1 (LPS long-term treated BPH1) and combined with another cellular transformation mo del of P69/M12, 22, 23 to screen out a crucial miRNA, miR186, which was significantly downregulated in the malignant transformed cells LT-BPH1 and M12 rather than in their parental cells BPH1 and P69, respectively, and its ectopic expression could rescue the transformed phenotypes. [score:6]
As miR186 is low expressed in the transformed LT-BPH1 (Figure 1h) or malignant PC3 (Supplementary Figure S3g), we tested the expressions of miR186 and Twist1 in these two cell lines with inflammatory stimulations. [score:5]
We found that miR186 was most significantly downregulated in malignant LT-BPH1 compared with that in BPH1 (Figure 1h), which was similar to the pattern that the miR186 expression level in M12 is lower than that in P69. [score:5]
[23] To confirm that miR186 is involved in the malignant transformation of LT-BPH1, we re-ectopically expressed miR186 in LT-BPH1 with a lentiviral expressing system, [27] which largely reversed above their phenotypes including cell proliferation/growth (Figures 1I and j and Supplementary Figure S1d), migration (Figure 1k and Supplementary Figure S1e), invasion (Figure 1l and Supplementary Figure S1f) and three-dimensional culture growth (Figure 1m). [score:5]
Twist1, which is highly expressed in 90% of PCa tissues and positively associated with PCa Gleason grading, [24] is a key target of miR186 in PCa [25] and ovarian cancer. [score:5]
Moreover, to confirm whether the Dnmt3a is indeed involved in the miR186 expression through methylating its promoter, we knocked down DNMTs by siRNAs in BPH1 cells and found that only knockdown of Dnmt3a, but not of either Dnmt1 or Dnmt3b, significantly increased the miR186 levels (Figure 4i). [score:5]
Given the role of the promoter methylation in silencing gene expression, we wondered whether the miR186 promoter is highly methylated thus inhibiting NF-κB transcriptional activation. [score:5]
Collectively, these results demonstrated that the inflammatory cytokine induced a dynamic expression of miR186 in a p65 -dependent manner through directly binding to the promoter of miR186. [score:4]
In particular, we demonstrated that NF-κB/p65 activation on stimulation of inflammatory cytokines induced the miR186 expression through direct binding to its promoter in the non-transformed BPH1, but not in the chronic inflammation-transformed LT-BPH1. [score:4]
Consistently, the luciferase activity of the ZRANB2/miR186 promoter in P69 cells was induced in a time -dependent manner upon inflammatory stimulation with LPS or TNFα (Figure 2c and Supplementary Figure S2c), suggesting that inflammatory cytokine -induced expression of miR186 was regulated at the transcriptional level. [score:4]
Collectively, our results demonstrated that the hypermethylation of the miR186 promoter was responsible for its downregulation or blocking p65 transcription activity, thus no responsiveness to inflammatory signals in the transformed or malignant PCa cells. [score:4]
And simultaneously, miR186 was not able to be induced, indicating that the pathway of miR186 -mediated Twist1 downregulation was blocked in those transformed or malignant PCa cells. [score:4]
To confirm that Twist1 interacting with Dnmt3a is required for the latter binding to the specific CpG island, we ectopically expressed or knocked down Twist1 in BPH1 and found that the binding of Dnmt3a to the CpG inlands in the miR186 promoter was significantly increased or decreased, respectively (Figure 5b and Supplementary Figure S6b). [score:4]
These indicated a fine-tuned regulatory mechanism of Twist1–Dnmt3a– [m]CpG-NF-κB axis on the miR186 expression. [score:4]
Our data showed that miR186 was rapidly induced through the direct binding of activated NF-κB/p65 to the miR186 promoter in P69 and BPH1 cells under inflammatory stimuli (LPS, TNFα), suggesting that miR186 was a new inflammatory response gene except for miR155 [16] and miR21, [18] which are regulated by inflammation signaling, linking inflammation to prostate carcinogenesis. [score:3]
It is noted that methylation of a single nucleotide C can be sufficient for repression of the promoter activation, [48] and we finally identified that methylation of CpG8 by Twist1–Dnmt3a complex was required and sufficient for blocking the binding of NF-κB to BS2, which led to repressing the miR186 expression (Figure 6e). [score:3]
The miR186 expression and its promoter methylation are related with inflammation -associated human PCa. [score:3]
Consistently with this, the miR186 expression was obviously increased by about sixfold under the treatment with 5-aza- CdR (Figure 3e). [score:3]
46, 47The mechanism underlying miR186 lowly expressed in PCa remains unknown. [score:3]
According to these results, we proposed that the Twist1 protein level was fine-tuned by two signaling pathways; one was a known oncogenic signaling pathway NF-κB–Twist1, whereas the other was a new identified tumor-suppressing pathway NF-κB–miR186–Twist1. [score:3]
The high methylation level of the miR186 promoter in LT-BPH1 was reversed by the treatment with 5-aza-CdR, a DNA methyltransferase inhibitor (Figure 3d). [score:3]
The miR186 expression levels in the prostate tissues were normal > chronic inflammation > proliferative inflammatory atrophy > adenocarcinoma (Figure 6d). [score:3]
Moreover, the double mutation of BS1/2 abrogated TNFα- or LPS -mediated luciferase activity of the promoter (Figure 2i and Supplementary Figure S2h), suggesting the direct bindings of p65 to BS1/2 were required for the inflammatory induction of miR186. [score:3]
These results indicated that p65 may be involved in the inflammation -induced miR186 expression. [score:3]
More interestingly, the in situ hybridization analysis revealed that the expression levels of miR186 were reduced not only in the tumor tissues, but also in the chronic inflammation and proliferative inflammatory atrophy tissues, which is a lesion that links inflammation and PCa. [score:3]
Furthermore, we performed the same experiment as in Figure 5d, and showed that the reduction of the luciferase activity of the wild-type minimal miR186 promoter by M. Sssl premethylation was partially recovered by mutating ‘G’ of CpG8 to ‘A’, suggesting that CpG8 is a key methylation site for inhibition of NF-κB binding to BS2 and transcriptional activity (Figure 5h). [score:3]
Most interestingly, the methylation-specific PCR assays revealed that stable overexpression or knockdown of Twist1 significantly increased or decreased the methylation levels of the miR186 promoter, respectively (Figure 4b). [score:3]
As above data have revealed that NF-κB activation by LPS or TNFα can induce miR186 expression in non-transformed BPH1 and P69 cells, so we simultaneously measured the protein levels of Twist1, which is a key target of miR186 in PCa as reported in our previous study. [score:3]
[25] In this study, we further showed that Twist1 repressed miR186 expression by a novel negative feedback loop, in which Twist1 could recruit Dnmt3a to the miR186 promoter to facilitate the site-specific CpG methylation, subsequently blocking the transcriptional activity of NF-κB/p65. [score:3]
The methylation levels of CpG6~10 were obviously increased when Twist1 was overexpressed in BPH1, which indicated that Twist1 was involved in the site-specific methylation of CpG6~10 in the miR186 promoter (Figure 5e, lower panels). [score:3]
The inflammation -induced miR186 expression was presumably a general response in the non-tumorigenic, non-transformed cell lines but not in the transformed or malignant prostate cancer cell lines (LT-BPH1, M12 or PC3). [score:3]
This mo del might explain the epigenetic switch from non-transformed to transformed, in which the high Twist1 level constituted the feedback loop to inhibit the transcriptional activation of miR186 induced by NF-κB. [score:3]
These HpaII-resistant fragments were strengthened in GST-Twist1 incubated with cell extracts from the Dnmt3a -overexpressing cells, whereas they were greatly weakened in GST-Twist1 incubated with cell extracts from the Dnmt3a-silencing cells (Figure 4h), which suggested that Twist1 recruited Dnmt3a from cell extracts to de novo methylate the miR186 promoter. [score:3]
Our results strongly pointed out that the very low expression of miR186 in the transformed or malignant PCa cells was mainly due to the hypermethylation of miR186 promoter to block the responsiveness to the inflammatory signals and NF-κB transcription activity. [score:3]
46, 47 The mechanism underlying miR186 lowly expressed in PCa remains unknown. [score:3]
Thus, we showed the mutation of E-box5 significantly increased the affinity of NF-κB binding to the miR186 promoter (Figure 5g). [score:2]
A double -negative feedback regulatory circuit of NF-κB–miR186–Twist1–Dnmt3a. [score:2]
Here, we described an inflammatory signaling feedback loop involving NF-κB/p65, miR186, Twist1 and Dnmt3acontrolled PCa development through epigenetic switch, which was responsible for maintenance of the malignantly transformed state. [score:2]
In addition, p65 knockdown by siRNA (Supplementary Figure S2i) prevented miR186 induction by TNFα (Figure 2j and Supplementary Figure S2i), supporting that p65 was required for miR186 induction in response to inflammatory stimulation. [score:2]
Twist1 represses miR186 in a negative feedback loop through directly interacting with and recruiting Dnmt3a to the miR186 promoter. [score:2]
To pinpoint the exact BSs, we introduced point mutations into the pGL3-miR186 (−210~+289). [score:2]
To further pinpoint the exact CpG that is critical for NF-κB -dependent miR186 expression, the luciferase reporter assays for the full-length or truncated miR186 promoters premethylated by M. SssI in vitro were performed. [score:2]
This suggested that Twist1 was involved in the regulation of the miR186 promoter methylation level. [score:2]
To reveal how Twist1 negatively regulates miR186, we first searched the E-boxes in the miR186 promoter and found multiple E-boxes adjacent to TSS. [score:2]
This regulation involved the site-specific CpG methylation, which blocked NF-κB binding to its BSs at the miR186 promoter. [score:2]
The indicated miR186 reporter constructs were methylated by incubation with M. SssI methylase (New England BioLabs, Beijing, China) for 3 h at 37 °C in the presence of 160 m m S-adenosylmethionine. [score:1]
These data strongly suggested that Twist1 promoted the association of Dnmt3a with the CpG inlands at the miR186 promoter. [score:1]
In vitro methylation of the miR186 promoterThe indicated miR186 reporter constructs were methylated by incubation with M. SssI methylase (New England BioLabs, Beijing, China) for 3 h at 37 °C in the presence of 160 m m S-adenosylmethionine. [score:1]
The ChIP and qChIP assays further demonstrated that Twist1 directly interacted with the miR186 promoter at E-boxes 3, 4 and 5, rather than E-boxes 1, 2 in LT-BPH1 cells (Figure 4c). [score:1]
The p-S536-p65 levels in the nuclear extracts (Supplementary Figures S2d–g) were correlated with the miR186 induction in P69 and BPH1 treated with LPS or TNFα. [score:1]
These data proposed a novel signaling pathway of NF-κB–miR186–Twist1 in BPH1 and P69 cells. [score:1]
To reveal whether Dnmt3a directly binds to the miR186 promoter, we performed a ChIP assay and showed that Dnmt3a indeed bound to the promoter CpG inland region and this binding in LT-BPH1 was much stronger than that in BPH1 (Figure 5a), which could explain for the hypermethylation of miR186 promoter in LT-BPH1. [score:1]
NF-κB–miR186–Twist1 versus NF-κB–Twist1. [score:1]
These results suggested that the CpG methylation of miR186 promoter was involved in the p65 -mediated transcription activity, and the p65-BS2 was sensitive to the CpG methylation. [score:1]
Taken together, above data suggested that the NF-κB–miR186–Twist1 axis was dependent on miR186 activation by inflammatory signals in non-transformed or low-tumorigenic cells (BPH1 and P69) rather than in transformed/malignant cells (LT-BPH1 and PC3). [score:1]
In particular, the site-specific methylation of CpG (CpG6~10) region containing NF-κB BS2 blocked the binding and transcription activity of NF-κB on the miR186 promoter. [score:1]
Further, to locate the NF-κB binding sites (BSs), we have constructed a series of truncated mutants of the miR186 promoter. [score:1]
Next, to test whether Twist1 -associated Dnmt3a is de novo methyltransferase-active, GST-Twist1 and the miR186 promoter construct were incubated with different extracts of cells transfected with the control Vecter, Dnmt3a or siDnmt3a, and followed by DNA digestion with HpaII, a methylation-resistant restriction enzyme. [score:1]
We found that the CpG islands adjacent to the NF-κB BS2 were hypermethylated and NF-κB was no longer able to associate with the miR186 promoter, which resulted in repression of miR186 transcription. [score:1]
These data indicated that the hypermethylation of the miR186 promoter is probably a general phenomenon in the transformed or malignant PCa cells. [score:1]
Furthermore, the bisulfite sequencing results showed that the methylation levels in the miR186 promoter, especially the region CpG6~10, which is overlapping or around the p65-BS2, were much higher in LT-BPH1 than BPH1 (Figure 5e, upper panels). [score:1]
After GST-Twist1 was incubated with cell extracts from the control Vector -transfected cells, HpaII-resistant DNA fragments of the miR186 promoter was observed. [score:1]
Unexpectedly, we observed miR186 was not inducible and Twist1 was increasingly induced in both LT-BPH1 (Figure 3a and Supplementary Figure S3h) and PC3 (Figure 3b and Supplementary Figure S3i) on inflammatory signals under the same treatment with LPS or TNFα in a time course. [score:1]
Here, we observed that losing of miR186 induction under inflammatory stimuli in malignancy was connected to the promoter methylation. [score:1]
Twist1–Dnmt3a complex facilitates the site-specific CpG methylation of the miR186 promoter to block the transcriptional activity of NF-κB. [score:1]
We found that Dnmt3a itself with no substrate specificity was recruited for the site-specific CpG methylation on the miR186 promotor by Twist1, which efficiently bound to the E-box motif at the miR186 promotor. [score:1]
As Twist1 E-box5 is the closest to NF-κB BS2 and located in the region of CpG 6–10 islands (Supplementary Figure S6a), we wondered whether the binding of Twist1 to E-box5 prevents NF-κB from interacting with BS2, which is essential for the miR186 promoter activation and sensitive to CpG methylation. [score:1]
Collectively, these results demonstrated that miR186 had a critical role in inflammation -associated malignant transformation of PCa. [score:1]
This result suggested that both BS1 and BS2 in the miR186 promoter were the key sites for the p65-activated transcription. [score:1]
Twist1 lacking enzymatic activity interacted with Dnmt3a in vivo and in vitro, and this interaction re-localized Dnmt3a from the nuclear matrix into chromatin, specifically increasing the association of Dnmt3a with the miR186 promoter. [score:1]
To address this, we first searched for CpG islands in the miR186 promoter and found a major CpG island (Supplementary Figure S4a), which is close to the TSS and contains 19 CpG dinucleotides predicted to be methylated. [score:1]
In vitro methylation of the miR186 promoter. [score:1]
In particular, the top 120 most significant difference paired clinical cases of them were selected for comparison analysis to show that the methylation levels of the miR186 promoter in the PCa tissues was higher than those in normal tissues (Figure 6b). [score:1]
Taken together, these results demonstrated that Twist1 recruited Dnmt3a and consequently facilitated the site-specific CpG methylation to decrease the binding and the transcriptional activity of NF-κB on the miR186 promoter. [score:1]
As expected, miR186 in both P69 and BPH1 cells was rapidly induced in a short period of time (0–2 h) after stimulation with LPS (Figures 2a and b) or TNFα (Supplementary Figures S2a and b). [score:1]
MiR186 is directly activated by NF-κB under inflammation signals. [score:1]
These results indicate that miR186 may be involved in the process of malignant transformation of prostate cells. [score:1]
Next, we attempted to explore the mechanism underlying the inactivation of the NF-κB–miR186–Twist1 pathway in transformed/malignant cells. [score:1]
Further to investigate whether the methylation levels of the miR186 promoter is related with the miR186 expression level in the clinical inflammation -associated human PCa specimens, we analyzed the miR186 promoter methylations in PCa and normal tissues across a large number of PCa samples (n=270) and normal controls (n=270) through the TCGA database (The Cancer Genome Atlas). [score:1]
Collectively, these results suggested that the miR186 promotor methylation was correlated with inflammation -associated PCa progression and decreased miR186 likely contributed to inflammation–cancer transformation. [score:1]
High methylation of CpG islands in the miR186 promoter blocks its response to inflammation signals in transformed or malignant cells. [score:1]
The results showed that the premethylation dramatically reduced the luciferase activity of the full-length (containing CpG 1–19) and D1 (containing CpG 6–19) but not D2 (containing CpG 11–19) miR186 promoter, indicating that the reduction of miR186 promoter activity was mainly dependent on the methylation of CpG 6~10 island, which is overlapping or around the NF-κB BS2 (Figure 5d). [score:1]
We also found that only Dnmt3a, but not Dnmt3b, mediated methylation of the miR186 promoter. [score:1]
To further figure out whether the CpG methyaltion is connected with the NF-κB -mediated transcriptional activation, the pGL3-miR186 (−210~+289) encompassing p65 BSs and CpG islands was premethylated in vitro with a CpG methyltransferase M. SssI (specifically methylates CpG dinucleotides), and then transfected into 293T cells. [score:1]
[1 to 20 of 96 sentences]
5
[+] score: 281
In conclusion, we for the first time demonstrated that miR-186 expression is down-regulated in gastric cancer, and overexpression of miR-186 inhibited cell proliferation, invasion and migration partially via regulation of Twist1 expression. [score:13]
After that, we transfected cells with the Twist1 expression vector to restore Twist1 expression in HGC-27 cells, and found that the restoration of Twist1 expression improved the miR-186 -inhibited proliferation ability of HGC-27 cells. [score:9]
In this study, we found that the expression of miR-186 was generally down-regulated in GC samples, indicating that the expression of miR-186 might independently predict a poor prognosis in patients with gastric cancer. [score:8]
As shown in Figure 1, the expression of miR-186 was significantly down-regulated in human GC cell lines HGC-27, MKN-28, and MKN-74, but the expression of miR-186 was not changed in the normal gastric epithelial mucosa cell line GES1. [score:8]
Up-regulated Twist1 expression attenuates miR-186 -inhibited tumor biology. [score:8]
To further determine whether miR-186 -dependent inhibition of GC cell proliferation, invasion and migration was indeed mediated by regulation of Twist1, we transfected cells with the Twist1 expression vector to restore Twist1 expression in HGC-27 cells (Figure 5a). [score:8]
Meanwhile, we also found that ectopic expression of miR-186 could affect cell proliferation, invasion and migration of gastric cancer partially via targeting the expression of Twist1. [score:7]
At the same time, it has been reported that miR-186 has a wide role in regulation of some functions involving suppression of cancer cell proliferation and inhibition of organ metastasis of different cancers. [score:6]
As reported, the expression of miR-186 was found to be down-regulated in some cancers, inducing prostate cancer, colorectal neuroendocrine tumors, ovarian cancer and non-small cell lung cancer [9– 12]. [score:6]
In our study, we thought that miR-186 might be epigenetically repressed by histonedemethylase et al. Besides, Twist1 is identified as a target of miR-186, but Twist1 is not the only one that can be targeted by miR-186 for a single miRNA is more likely to regulate thousands or hundreds of mRNAs in oncogenesis. [score:6]
Our findings showed that the expression of miR-186 remarkably decreased the activity of wild type 3′-UTR of Twist1 in a dose -dependent fashion (p<0.001; Figure 4a), however the expression of miR-186 did not change the activity of mutant 3′-UTR of Twist1 (p>0.001; Figure 4b). [score:5]
These findings mean that miR-186 could inhibit GC cell invasion and migration probably via controlling the expression of Twist1. [score:5]
Figure 2 a. Relative expression levels of miR-186 in HGC-27 cells transfected with miR-186 mimics and inhibitors was tested by RT-PCR. [score:5]
As mentioned above, we further evaluated the relationship between miR-186 and clinicopathologic features of gastric cancer, all 90 cases of GC samples were divided into two groups according to the median of relative expression intensity of miR-186 in cancer samples, including low miR-186 expression group and high miR-186 expression group. [score:5]
On the basis of cell functions, the overexpression of miR-186 is able to inhibit cell invasion and migration as well as cell proliferation. [score:5]
At the same time, the restoration of Twist1 expression significantly abrogated miR-186 -induced inhibition of HGC-27 cell migration and invasion (both p<0.001; Figure 5c and 5d). [score:5]
Taken together, these findings suggested that Twist1 was a direct target for miR-186 in the development of GC. [score:5]
Twist1 overexpression reversed the inhibitory effect of miR-186 on HGC-27 cell proliferation, migration and invasion. [score:5]
As expected, the overexpression of miR-186 inhibited the migratory ability of HGC-27 cells. [score:5]
As shown in Figure 3, the overexpression of miR-186 inhibited the invasive ability of HGC-27 cells. [score:5]
Overexpression of miR-186 could inhibit HGC-27 cell invasion and migration. [score:5]
miR-186 and Twist1 expression were examined by qRT-PCR, and normalized to U6 and GAPDH expression (shown as ΔCT) *p<0.001, v. s. normal tissues, one-way ANOVA. [score:5]
miR-186 overexpression inhibits invasion and migration. [score:5]
a. Relative expression levels of miR-186 in HGC-27 cells transfected with miR-186 mimics and inhibitors was tested by RT-PCR. [score:5]
We found that the restoration of Twist1 expression improved the miR-186 -inhibited proliferation ability of HGC-27 cells (p<0.001; Figure 5b). [score:5]
To further investigate the molecular mechanisms underlying miR-186 -mediated proliferation, invasion and migration of GC cells, we used western blot analysis to detect related targets, and observed that overexpression of miR-186 reduced the expression of Twist1 protein. [score:5]
Twist1 is a direct target of miR-186. [score:4]
In this work, luciferase vectors containing the wild type/mutation type 3′-UTR of Twist1 were constructed, and co -transfected along with the miR-186 mimic/inhibitor into cells. [score:4]
Therefore, it is essential to identify other potential novel targets of miR-186 or Twist1-related miRNAs, which will allow us to understand the deep molecular mechanisms underlying the development and progression of gastric cancer. [score:4]
Subsequently, revealed that the overexpression of miR-186 exerted an inhibitory effect on the proliferation of HGC-27 cells as compared with miR-NC (Figure 2b), which suggested that miR-186 might participate in other biological processes of GC. [score:4]
To figure out the significance of miR-186 and Twist1 in the development of gastric cancer, firstly, we detected and analyzed the expression of miR-186 and Twist1 in cancer samples of GC and their paired normal samples. [score:4]
Our findings revealed that the expression of miR-186 was significantly increased in miR-186 mimics -transfected HGC-27 cells, but not changed in inhibitor -transfected HGC-27 cells compared with their own controls (Figure 2a). [score:4]
b. showed that miR-186 overexpression had an inhibitory effect on the growth of HGC-27 cells compared with their matched cells. [score:4]
Increasing studies identified that miR-186 can be found to be down-/up-regulated in diverse cancer tissues. [score:4]
To elucidate the biological role of miR-186 in the development of GC, miR-186 mimics and inhibitors were transfected into HGC-27 cells respectively. [score:4]
These findings indicate that Twist1 activated by down-regulation of miR-186 resulted in the proliferation, migration and invasion. [score:4]
miR-186 was a direct transcriptional target of Twist1 in HGC-27 cells. [score:4]
In this work, we used the luciferase -based reporter assay and identified that miR-186 can bind a conservative sequence within the 3′-UTR of Twist1 to partially inhibit the expression of Twist1. [score:4]
Generally, this study provides a new idea that miR-186 may act as a novel target for early diagnosis and treatment of gastric cancer patients. [score:3]
The miR-186 mimic inhibited the luciferase activity controlled by wild-type Twist1 −3′-UTR a. but did not affect the luciferase activity controlled by mutant Twist1 −3′-UTR b. in HGC-27 cells. [score:3]
GC cell line HGC-27 was plated for approximately 24 h before transfection, miR-186 mimics, inhibitor and their respective miR -negative controls (Genepharma, Shanghai, China) were transfected using Lipofectamine™ 2000 (Invitrogen, USA) according to the manufacturer's procedures. [score:3]
However, miR-186 expression was not associated with other parameters such as gender and age et. [score:3]
To explore the molecular mechanisms by which miR-186 medicates the proliferation, invasion and migration, we determined a few candidate target genes of miR-186 using putative online databases. [score:3]
c., d. The migration and invasion of miR-186 -overexpressing HGC-27 cells were effectively improved when cells were transfected with Twist1 plasmids. [score:3]
Relative miR-186 and Twist1 expression in GC tissues. [score:3]
In the present study, qRT-PCR analysis was applied to detect the expression of miR-186 in 90 cases of GC samples and their adjacent normal tissues according to histology. [score:3]
In recent decades, increasing reports have highlighted the molecular mechanisms and significance of the expression of miR-186 in different human tumors, such as lung cancer, gastric cancer [13– 16]. [score:3]
The number of invasive and migratory cells was significantly decreased due to miR-186 overexpression. [score:3]
Figure 1 a., b. miR-186 and Twist1 expression levels in GC and normal tissues were analyzed using qRT-PCR. [score:3]
b. The proliferation capacity of miR-186 -overexpressing HGC-27 cells was partially improved when cells were transfected with Twist1 plasmids in comparison with control. [score:3]
Subsequently, we selected a useful target Twist1 to explore the miR-186-Twist1 pathway. [score:3]
At first, we carried out the qRT-PCR analysis to analyze the expression mo del of miR-186 in three kinds of human GC cell lines. [score:3]
a., b. miR-186 and Twist1 expression levels in GC and normal tissues were analyzed using qRT-PCR. [score:3]
The expression of miR-186 and Twist1 in GC samples. [score:3]
Figure 4The miR-186 mimic inhibited the luciferase activity controlled by wild-type Twist1 −3′-UTR a. but did not affect the luciferase activity controlled by mutant Twist1 −3′-UTR b. in HGC-27 cells. [score:3]
These findings suggest that miR-186 played an important role in regulation of GC cell proliferation, invasion and migration. [score:2]
d. miR-186 and Twist1 expressions in human GC cell lines were compared with gastric epithelial mucosa cell line GES1 by qRT-PCR. [score:2]
However, little is known about the role of miR-186 in the development of GBM. [score:2]
In view of the importance of miR-186 in the development of GC, we investigated miR-186 as a subject, and observed that miR-186 was obviously down-regulated in GC tissues as compared with their adjacent normal tissues using qRT-PCR analysis. [score:2]
c. Relative expression of miR-186 and Twist1 in human GC tissues compared with corresponding normal tissues. [score:2]
As shown in Figure 1a, we found that the expression of miR-186 was indeed reduced in tumor tissues as compared with that in their adjacent paired normal samples. [score:2]
After that, we performed a luciferase activity assay to identify whether Twist1 genes was indeed targeted by miR-186. [score:2]
These findings indicated that miR-186 and Twist1 might be involved in the development of gastric cancer. [score:2]
The expression of miR-186 and Twist1 is correlated with clinical characteristics. [score:1]
Effect of miR-186 on HGC-27 cell proliferation. [score:1]
To construct a luciferase reporter vector, Twist1 3′-UTR fragment containing putative binding sites for miR-186 was amplified by PCR, and then the PCR product was subcloned downstream of the luciferase gene in the pLUC Luciferase vector (Ruibo, Guangzhou, China) and named Twist1 −3′-UTRWT. [score:1]
Effect of miR-186 on GC cell proliferation. [score:1]
Of these candidates, Twist1 was chosen and exhibited the highest prediction scores because the sequence of Twist1 mRNA had the most complementary sequences with those of miR-186. [score:1]
The clinicopathological characteristics of 90 GC patients were summarized in Table 1. Notably, low miR-186 expression in GC was significantly correlated with advanced TNM stage, lymph node metastasis and tumor size (all p<0.000). [score:1]
Correlations of miR-186 and Twist1 with clinicopathological indicators. [score:1]
[1 to 20 of 70 sentences]
6
[+] score: 150
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-16-2, hsa-mir-138-2, hsa-mir-138-1
As for glycolysis process, miR-186 overexpression inhibited glucose uptake, lactate and ATP and NADH accumulation, whereas HIF-1α cotransfection rescued the glucose uptake, lactate, ATP and NADH production; miR-186 knockdown upregulated the glucose uptake, lactate and ATP/ADP ratio, meanwhile it downregulated NAD+/NADH; however, HIF-1α knockdown attenuated the process (Figures 4d–g). [score:13]
PD-L1, HK2 and PFKP expression levels (Figures 5b and c) as well as HK2 and PFK activities (Figures 5d and e) were downregulated by miR-186 introduction and were rescued by HIF-1α overexpression (Figures 6a and b). [score:8]
Overexpression of miR-186 downregulated PD-L1 and glycolytic rate-limiting enzyme HK2, PFKP content and activities by inhibiting HIF-1α. [score:8]
MiR-186 targeted HIF-1α and inhibited its protein expression. [score:6]
Protein expression levels of HIF-1α were analyzed when miR-186 or HIF-1α was overexpressed or knocked down. [score:6]
[39] The present study showed that miR-186 regulated complex signaling cascade to have a role of glucose metabolism regulation via targeting HIF-1α. [score:5]
41, 42 All these effects can be achieved through HIF-1α inhibition caused by miR-186 overexpression. [score:5]
These results suggested that miR-186 could reduce PD-L1 abundance and HK2 and PFKP expression levels and activities by targeting HIF-1α. [score:5]
[14] The glycolytic markers, including glucose intake, lactic acid production, ATP and NADH production, were all upregulated when miR-186 was knocked down. [score:5]
The reverse correspondence between miR-186 expression and pathological grading prompted that miR-186 may act as a tumor suppressor in gastric adenocarcinoma. [score:5]
Ectopic expression of miR-186 suppresses proliferation and glycolytic metabolism of gastric cancer cells mainly by HIF-1α. [score:5]
Overexpression of miR-186 combined with HIF-1α knockdown suppressed tumor growth in nude mice xenograft assay. [score:5]
MiR-186 is lowly expressed acts as a tumor-suppressor gene in gastric cancer. [score:4]
The results confirmed that HIF-1α was the direct target of miR-186 in gastric adenocarcinoma. [score:4]
MiR-186 inhibited proliferation and glycolysis process and induced apoptosis by targeting HIF-1α-3′UTR in MKN45 and SGC7901 cells. [score:4]
To further investigate whether miR-186 functions through targeting HIF-1α, we transfected agomir-186 and antagomir-186 into HIF-1α stably overexpressed or knockdown cells. [score:4]
For the in vivo study, the stably overexpressed miR-186 cells, HIF-1α stable knockdown cells and agomir-186 combined with shHIF-1α cells were collected. [score:4]
The results demonstrated that miR-186 was significantly downregulated in HDAC specimens, it was even lower in PDAC (Figure 1a). [score:4]
In the present study, we seek to determine whether and how aberrant expression of miR-186 effects on gastric adenocarcinoma cell proliferation, apoptosis. [score:3]
[6] MicroRNA-186 (miR-186) acts as a tumor suppressor in many malignancies. [score:3]
HIF-1α activated HK2 and accelerated energy supply from glycolysis; the degradation of HIF-1α by miR-186 could partly reverse the process and inhibit cell proliferation. [score:3]
We detected HIF-1α, the putative downstream target gene of miR-186 through bioinformatics prediction (http://www. [score:3]
MKN45 and SGC7901 cells that overexpressed miR-186 had less intracellular glucose, lactate production and ATP/ADP ratio, besides NAD+/NADH ratios were higher than the agomir-186-NC groups (P<0.05). [score:3]
[10] As a potential therapy target, miR-186 is rarely studied in gastrointestinal carcinoma. [score:3]
The results hinted that miR-186 could inhibit cellular glycolysis steps. [score:3]
The in vivo study provided strong support for miR-186 on tumor suppression. [score:3]
Our study supported that miR-186 was a hopeful novel target for gastric adenocarcinoma treatment. [score:3]
MiR-186 inhibited glycolysis in MKN45 and SGC7901 cells. [score:2]
To further investigate any potential differences at the functional level, miR-186 overexpression and knockdown cell lines were established (Figure 2a). [score:2]
The negative regulatory effect of miR-186 on HIF-1α was verified through miR-186 introduction and ablation. [score:2]
MiR-186 was lowly expressed in human gastrocarcinama. [score:2]
MiR-186 is aberrantly expressed in several cancers. [score:2]
MiR-186 inhibited MKN45 and SGC7901 cell proliferation and promoted apoptosis. [score:2]
To further clarify the precise regulation mechanism of miR-186 to HIF-1α, luciferase reporter assay was conducted (Figures 3e and f). [score:1]
We first detected miR-186 abundance in HDAC and PDAC, and it represented a downward trend along with differentiation degree. [score:1]
According to cell viability assay and apoptotic assay in MKN45 and SGC7901 cells, introducing of miR-186 significantly inhibited cell proliferation and induced apoptosis. [score:1]
According to this result, some malignant tumor treatments, for instance, viral vector carrying miR-186 may be taken into consideration. [score:1]
The theoretical binding sequence of miR-186 in HIF-1α gene and its mutant sequence was designed. [score:1]
The results above prompted us to examine the effective mechanism of the miR-186–HIF-1α axis on tumorous growth in vivo. [score:1]
We seek to determine whether and how miR-186/HIF-1α axis could reprogram cellular metabolism and proliferation in gastric adenocarcinoma. [score:1]
MiR-186 sequence was cloned into pLenti6.3/V5-DEST vector to construct PLenti6.3/V5-DEST-agomir-186 lentiviral vector. [score:1]
The luciferase reporter assay confirmed the direct binding of miR-186 to HIF-1α. [score:1]
It demonstrated that miR-186 reliably had an antiproliferative role in MKN45 and SGC7901 cells. [score:1]
Quantitative real-time PCR (qRT–PCR) was applied to detect miR-186 abundance in normal gastric tissues (GT), highly differentiated gastric adenocarcinoma tissues (HDAC), poorly differentiated gastric adenocarcinoma tissues (PDAC) and cell lines GES-1, MKN45 and SGC7901. [score:1]
[1 to 20 of 44 sentences]
7
[+] score: 139
MDR1 and GST-π mRNA and protein expression levels were downregulated after transfection with miR-186 but upregulated following anti-miR-186 transfection compared to the mock and negative control cancer cells; however, the MRP1 expression levels did not significantly differ among the groups. [score:10]
Based on these findings and our study results, we consider that miR-186 may inhibit the development of drug resistance by targeting ABCB1 and regulating GST-π expression in ovarian cancer cells. [score:9]
However, our results showed that miR-186 overexpression downregulated both the mRNA and protein expression levels of MDR1 and GST-π in the ovarian cancer cell lines compared to the negative control cells or mock transfected cells, while there was no significant difference in the expression of MRP1. [score:9]
MiR-186 overexpression sensitized ovarian cancer cells to paclitaxel and cisplatin of the RT-PCR revealed lower miR-186 expression level in A2780/DDP and A2780/Taxol than in A2780 cells (Fig.   1a, p < 0.05), while higher MDR1 and GST-π mRNA expression level in A2780/DDP and A2780/Taxol than in A2780 cells (Fig.   1b & c, p < 0.05). [score:7]
MiR-186 overexpression downregulates the expression of MDR1 and GST-π. [score:7]
In conclusion, we demonstrated for the first time that miR-186 overexpression may increase the sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1 and modulating GST-π. [score:5]
MiR-186 overexpression increased the sensitivity of ovarian cancer cell lines to paclitaxel and cisplatin compared with the negative control or mock cells, miR-186 transfection induced cell apoptosis while anti-miR-186 transfection reduced cell apoptosis, suggesting that miR-186 may inhibit the development of drug resistance in ovarian cancer cells. [score:5]
of the RT-PCR showed (a) lower miR-186 expression level in A2780/DDP and A2780/Taxol than in A2780, (b) while higher MDR1 and (c) GST-π mRNA expression level in A2780/DDP and A2780/Taxol than in A2780. [score:5]
Our results are the first to demonstrate that miR-186 may sensitize ovarian cancer cell to paclitaxel and cisplatin by targeting ABCB1 and modulating the expression of GST-π. [score:5]
Ours is the first study to demonstrate that miR-186 overexpression may increase the sensitivity of ovarian cancer cells to paclitaxel by targeting ABCB1 and modulating GST-π. [score:5]
Cui et al. reported that miR-186 targets ROCK1 to suppress the growth and metastasis of non-small cell lung cancer cells [21]. [score:5]
Previous evidence has indicated that miR-186 overexpression can lead to reduced expression of twist family bHLH transcription factor 1 (Twist1) along with morphological, functional, and molecular changes consistent with mesenchymal-to-epithelial transition, G1 cell-cycle arrest, and enhanced cell apoptosis, rendering the cells more sensitive to cisplatin [11]. [score:5]
Cai et al. reported that miR-186 downregulation correlates with poor survival in lung adenocarcinoma [22]. [score:4]
The predicted seed region in the 3’-UTR of ABCB1 and ABCC1 showed that both these genes are the direct targets of miR-186. [score:4]
a The 3’-untranslated region (3’-UTR) of ABCB1 contains a potential miRNA -binding site for miR-186. [score:3]
Our results showed that restoring miR-186 could induce apoptosis while transfection with anti-miR-186 inhibited apoptosis in ovarian cancer cell lines (Fig.   3, p < 0.05). [score:3]
Transfection with miR-186 could induce ovarian cancer cell lines A2780 (a), A2780/DDP (b), A2780/Taxol (c) and OVCAR3 (d) cell apoptosis while anti-miR-186 transfection inhibited cell apoptosis in ovarian cancer cell lines. [score:3]
Our computational programs predicted that the 3’-untranslated region (3’-UTR) of ABCB1 contains a potential miRNA -binding site for miR-186. [score:3]
Therefore, we suggest that miR-186 may increase cell sensitivity of ovarian cancer cells lines to paclitaxel and cisplatin by targeting ABCB1 but not ABCC1. [score:3]
Our results showed that both A2780/DDP and A2780/Taxol cells expressed miR-186 at lower levels than A2780. [score:3]
Computational programs have predicted that the 3’-untranslated region (3’-UTR) of ABCB1 contains a potential miRNA -binding site for miR-186. [score:3]
Similarly, results of the revealed that the MDR1 and GST-π protein levels were decreased after miR-186 transfection but remained higher than the corresponding levels in the negative control and mock transfected groups (Fig.   5b), however, the MRP1 expression levels did not significantly differ among the groups. [score:3]
d MiR-186 transfection significantly induced miR-186 expression. [score:3]
a MRNA and (b) protein expression levels of MDR1 and GST-π with miR-186 andanti-miR-186 transfection. [score:3]
Lower miR-186 while higher MDR1 and GST-π mRNA expression levels were found in the A2780/Taxol and A2780/DDP cells than in the A2780 cells. [score:3]
These studies suggest that miR-186 may function as a tumor suppressor gene. [score:3]
MiR-186 overexpression (Fig.   1d, p < 0.05) induced the sensitivity of ovarian cancer cells to paclitaxelb (Fig.   2a) and cisplatin (Fig.   2b), compared with the untreated groups and miR-C transfected groups. [score:2]
a and b MiR-186 overexpression induced the sensitivity of ovarian cancer cells to paclitaxel and cisplatin compared with miR-C transfected cells. [score:2]
The dual-luciferase reporter assay verified that that miR-186 combined with the 3’-untranslated region (UTR) of ABCB1. [score:2]
Zhu X, Shen H, Yin X, Long L, Xie C, Liu Y, Hui L, Lin X, Fang Y, Cao Y, Xu Y, Li M, Xu W, Li Y: miR-186 regulation of Twist1 and ovarian cancer sensitivity to cisplatin. [score:2]
was used to reveal the correlation between miR-186 and ABCB1. [score:1]
MiR-186 transfection induced apoptosis while anti-miR-186 transfection reduced apoptosis. [score:1]
MiR-186 has been reported to regulate glycolysis through Glut1 during the formation of cancer -associated fibroblasts [20]. [score:1]
Our results demonstrate that miR-186 significantly decreased the relative luciferase activity of the wild-type ABCC1 3’UTR compared with the mutant ABCC1 3’UTR, indicating that miR-186 may directly bind to the 3’UTR of ABCC1 (Fig.   4b, P < 0.05). [score:1]
The cell lines were placed in humidified atmosphere of 5 % CO [2] at 37 °C with or without paclitaxel or cisplatin treatment and miR-186 transfection using Lipofectamine-2000 in accordance with the manufacturer’s gui delines (Invitrogen). [score:1]
Besides, miR-186 transfection also reduced cancer cell proliferation (Fig.   2c & d, p < 0.05). [score:1]
c and d Besides, miR-186 transfection also reduced cancer cell proliferation. [score:1]
After miR-186 transfection, all the cell lines showed increased sensitivity to paclitaxel and cisplatin. [score:1]
show that mir-186 decreased both mRNA and protein levels of MDR1 and GST-π while anti-miR-186 increased both these levels. [score:1]
Importantly, we find that combination of miR-186 with chemotherapeutic agents can increase the sensitivity of ovarian cancer cells to paclitaxel. [score:1]
[1 to 20 of 40 sentences]
8
[+] score: 131
Finally, silencing Dicer in DU145 mPGES-1 [−/−] cells promoted VEGF expression/secretion (Figure 5A and 5B) and down-regulated miR-15a and miR-186 (Figure 5C), indicating that mPGES-1/PGE-2 signaling decreases the miR-15a and miR-186/VEGF pathways through inhibition of Dicer expression. [score:10]
Immunohistochemical analysis of mPGES-1 expression revealed that the enzyme was strongly expressed in human tumors with high Gleason score, VEGF, and HIF-1α as well as with microvessel density, and low expression of Dicer, miR15a and miR-186. [score:7]
We also found that treatment of mPGES-1 [+/+] cells with miR-15a, miR-103 or miR-186 mimics (50 nM), besides increasing the endogenous pool of their respective miRNAs (Supplementary Figure S4B), down-regulated VEGF expression/production (p < 0.001, Supplementary Figure S4C, S4D, S4E and Figure 4A). [score:6]
miR-15a and miR-186 controls VEGF expression in vitroAmong the miRNAs down-regulated by mPGES-1/PGE-2 signaling in DU145 cells, some have been involved in angiogenesis, others in inflammation or stemness (Supplementary Table S1). [score:6]
mPGES-1 down-regulates miR-15a and miR-186 upstream of VEGF expression. [score:6]
We observed that 66.7% of OC samples expressed significant levels of miR-15a and miR-186, whereas only 30% and 20% of AC samples expressed significant levels of miR-15a and miR-186, respectively (Figure 7A). [score:5]
miRNA mimics and inhibitors target the following mature miRNA sequences: for miR-186-5p (5′-CAAAGAAUUCUCCUUUUGGGCU-3′), for miR-15a-5p (5′-UAGCAGCACAUAAUGGUUUGUG-3′) and for miR-103-3p (5′-AGCAGCAUUGUACAGGGCU AUGA-3′). [score:5]
Five miRNAs (miR-15b, miR-93 miR-15a, miR-186 and miR-103) have been predicted to target VEGF and HIF-1α on the basis of DianaMT, PICTAR5, miRanda, miRBASE, miRWALK and Target Scan analysis (Supplementary Table S2). [score:5]
The opposite emerged from experiments on mPGES-1 [−/−] cells incubated with synthetic antagomirs, where we observed a large increase in VEGF output and a rich network of cord-like structures of endothelial cells, similar to that obtained after exposure to PGE-2. PGE-2 showed a surprising ability to reverse the up-regulation of miR-15a and miR-186 in mPGES-1 [−/−] cells, which indicates that the effect occurred up-stream of the miRNA system. [score:4]
Moreover, MF63 increased levels of both miRs in mPGES-1 [+/+] cells (Figure 4C), and miR-15a and miR-186 were up-regulated with respect to mPGES-1 [+/+] tumors in DU145 mPGES-1 [−/−] xenografts in vivo (Figure 4D). [score:4]
analysis provided further evidence of down-regulation of miR-15a, miR-186 and miR-103 in mPGES-1 [+/+] cells (Supplementary Figure S4A). [score:4]
These data indicate that VEGF 3′UTR is a specific direct target of miR-15a and miR-186. [score:4]
PGE-2 -mediated downregulation of miR-15a and miR-186 is specifically related to VEGF production and angiogenesis. [score:4]
To test this link, we assayed whether miR-186 inhibiting VEGF expression, could reduce angiogenesis and tumor size in vivo. [score:4]
3 × 10 [4] cells were exposed to 10% FBS or to PGE-2 (1 μM) for 48 h or siRNA -transfected for Dicer or transfected with mimics for miR-15a, miR-186, miR-103 or with miRNA inhibitors for miR-15a and miR-186. [score:3]
An important experiment performed on mPGES-1 [+/+] mouse xenograft mo dels clearly showed that sub-chronic treatment with miR-186 mimic significantly reduced tumor growth, angiogenesis and VEGF expression [34, 35, 36]. [score:3]
Finally, silencing of Dicer in DU145 mPGES-1 [+/+] cells increased HUVEC -mediated sprouting in the co-cultured mo del (Supplementary Figure S7D, panel B, and C), indicating that mPGES-1/PGE-2 promotes activation of endothelial cells in prostate cancer cells by reducing Dicer, miR-15a and miR-186 expression, thus promoting VEGF secretion. [score:3]
miR-15a and miR-186 controls VEGF expression in vitro. [score:3]
Bars show expression of the VEGF 3′UTR reporters in DU145 and PC3 mPGES-1 [+/+] cells treated with miR-15a and miR-186 mimics. [score:3]
This indicates that miR-186 is downstream of mPGES-1/PGE-2 and that it inhibiting VEGF in prostate cancer might decrease prostate cancer growth and angiogenesis. [score:3]
A weak but negative association among miR-15a or miR-186 and mPGES-1 and VEGF expression in OC and AC tissue was noted. [score:3]
The miRNA mimics and inhibitors for miR-103, miR-186 and miR-15a were from Qiagen and transfection was performed with Lipofectamine 2000 (Life Technologies) following the manufacturer's protocol. [score:3]
Other evidence documents the role of miR-15a and miR-186 as pro-oncogenic molecules [25, 26], as clinical studies have observed that reduced expression of these miRNAs is associated with poor clinical prognosis in prostate cancer, and other tumors [25, 27, 28]. [score:3]
As recommended by EEC gui delines and Italian National laws for animal experimentation, to investigate the role of miR-15a and miR-186 mimics and inhibitors on VEGF expression and growth of DU145 and PC3 xenografts, we minimized the number of animals focusing on miR-186 mimic. [score:3]
Conversely, in mPGES-1 [−/−] cells, antagomirs for miR-15a and miR-186 (50 nM), which decreased the amount of detectable endogenous miR-15a or miR-186 (Supplementary Figure S5A), induced VEGF expression/production (Supplementary Figure S5B, S5C and S5D). [score:3]
Consistently, PGE-2 treatment (1 μM) reversed miR-15a and miR-186 expression in mPGES-1 [−/−] cells (Supplementary Figure S6A and S6B, DU145 cells), corroborating the indication that mPGES-1/PGE-2 signaling is upstream of miRNAs. [score:3]
However, miR-15a and miR-186 had no effect on luciferase activity of pMir-target vector (Figure 4B). [score:3]
To verify the putative direct interaction between miR-15a and miR-186 and the VEGF 3′-UTR, the 3′-UTR-luciferase reporter construct of VEGF and the control construct were independently transfected into the DU145 and PC3 mPGES-1 [+/+] cells. [score:2]
miR-186 mimic treatment (3 μg/mouse) of DU145 and PC3 mPGES-1 [+/+] mouse xenograft led to a significant reduction in mPGES-1 [+/+] tumor size compared to control tumors (Figure 6A), showed lower vessel density and smaller luminal size (Figure 6B left and right graph, respectively), as well as a comparable reduction in VEGF protein expression (Figure 6C and 6D). [score:2]
Genome-wide sequencing of miRNAs in mPGES-1 [+/+] compared to mPGES-1 [−/−] cells revealed repression of miR-15a and miR-186, both associated with VEGF expression. [score:2]
Combination of miR-15a and miR-186 mimics or antagomirs did not show addictive effects. [score:1]
MiR-186 decreased in response to PGE-2 in a time dependent manner, while miR-15a showed a more complex kinetic, which might be associated with the complexity of the system or the technical issue [21]. [score:1]
Conversely, antagomirs for miR-15a and miR-186 (50 nM) induced abundant sprouting in mPGES-1 [−/−] cells (Supplementary Figure S7C panel B, C, and D). [score:1]
In 6 OC and 10 AC samples we also investigated miR-15a and miR-186 expression. [score:1]
Figure 4(A) ELISA for VEGF in DU145 and PC3 mPGES-1 [+/+] cells (1% FBS, 48 h) transfected with miR-15a, miR-186 or miR-103 mimics (50 nM). [score:1]
miR-186 controls tumor growth and VEGF output in vivo. [score:1]
miR-186 controls tumor growth and angiogenesis in vivo. [score:1]
miR-186 controls tumor growth and VEGF output in vivoThe data presented so far underscores the potential link between miR-186 and VEGF/angiogenesis in vivo. [score:1]
Collectively, these results suggest miR-15a and miR-186 as potential prognostic biomarkers in advanced prostate cancer linking high mPGES-1 levels with enhanced VEGF/angiogenic features. [score:1]
Considering the influence of miR-15a and miR-186 on angiogenesis and VEGF output in prostate cancer cells, we suggest that these miRs could be potential candidates for attenuating the aggressive traits of prostate cancer. [score:1]
The data presented so far underscores the potential link between miR-186 and VEGF/angiogenesis in vivo. [score:1]
In line with the above results we found that treatment of DU145 mPGES-1 [+/+] cells with miR-15a or miR-186 mimics (50 nM) reduced the ability of HUVEC to form cord-like structures (Supplementary Figure S7B, panel B, C, and D). [score:1]
[1 to 20 of 42 sentences]
9
[+] score: 30
Notably, five of these six miRNAs exhibit congruent changes between our functional experiments in vitro and their expression patterns in vivo in at least one study, i. e. reduction upon E6/E7 silencing in HeLa and upregulation in cervical cancer biopsies (miR-7–5p [43], miR-17–5p [27– 30, 34, 37], miR-186–5p [35]) or increase upon E6/E7 silencing in HeLa and downregulation in cervical cancer tissue (miR-23b-3p [28, 37] and miR-143–3p [23, 29, 31, 33, 37, 38, 82]) (S2 Dataset). [score:9]
Statistical significance of the qRT-PCR data was obtained for ten of these 17 miRNAs: downregulation of miR-17–5p, miR-186–5p, miR-378a-3p, miR-378f, miR-629–5p and miR-7–5p and upregulation of miR-143–3p, miR-23a-3p, miR-23b-3p and miR-27b-3p, upon E6/E7 silencing (Fig. 2E and indicated in bold in S2 Table). [score:7]
Only two miRNAs, miR-186–5p and miR-378f, showed a discrepant regulation in that they were no longer repressed in “p53 -null” HeLa cells upon E6/E7 silencing, suggesting that p53 may directly or indirectly reduce their expression. [score:6]
Finally, miR-186–5p is an inhibitor of the FOXO1 tumor suppressor gene, which can exert anti-proliferative, pro-apoptotic and pro-senescent activities [90, 91]. [score:5]
Specifically, continuous E6/E7 expression is necessary to maintain high intracellular levels of miR-7–5p, miR-629–5p, miR-378a-3p, miR378f, miR-17–5p, and miR-186–5p (S2 Table), which all have been linked to pro-tumorigenic activities. [score:3]
[1 to 20 of 5 sentences]
10
[+] score: 30
It is interesting to note that both miR-186 and miR-455 have previously been shown to have an altered expression level in AD cerebrospinal fluid (CSF) samples, which further underscores the possible association between these miRNAs and AD development. [score:4]
We observed a significant reduction of luciferase expression upon miR-24, miR-186, and miR-455 expression (Figure 1A) compared to a scrambled miRNA (SCR) negative control. [score:4]
In conclusion, we identified NCSTN -targeting miRNAs (miR-24, miR-186, and miR-455) that could decrease Aβ secretion. [score:3]
FIGURE 2 miR-24, miR-186, and miR-455 expression results in decreased Aβ secretion. [score:3]
In order to determine the functional consequences of miR-24, miR-186, and miR-455 expression on Aβ production, we performed using HEK293-APPSwe cells. [score:3]
This analysis resulted in a list of 22 miRNAs (Table 1), which we narrowed down to six (i. e., miR-24, miR-186, miR-340, miR-455, miR-656, and miR-1301) based on our previous expression profiling studies in the human cerebral neocortex (45 raw reads cut-off; Hébert et al., 2013). [score:3]
We thus identified miR-24, miR-186, and miR-455 as endogenous regulators of human NCSTN. [score:2]
Taken together, we identified miR-186 and miR-455, which are functionally affected by polymorphisms. [score:1]
Notably, only miR-186 and miR-455 decreased both the mature and immature forms of NCSTN (Edbauer et al., 2002). [score:1]
On the other hand, both seed region SNPs T623G and delCA515–516 reduced miR-186 and miR-455 -mediated repression, respectively (Figures 3B–D). [score:1]
Both miR-186 and miR-455 decreased (soluble) Aβ40 and Aβ42 levels, while miR-24 had a small, nonetheless significant effect on Aβ42 (Figure 2). [score:1]
FIGURE 3 SNP delCA 515–516 and SNP T623G reduce miR-455- and miR-186 -mediated NCSTN repression. [score:1]
Our data provide additional proof of principle that polymiRTS could contribute to neurodegenerative disorders, and that miR-186 and miR-455 could be important players in AD pathology. [score:1]
MiR-186 and miR-455 were previously shown to be altered in AD CSF samples, and we demonstrated that the miRNA -mediated repression of NSCTN mRNA is altered by the presence of SNPs rs113810300 and rs141849450. [score:1]
SNPID Position in 3′UTR Polymorphism Predicted microRNA Seed region Number of raw reads Ts10059 18 C/T hsa-miR-31 Y 0 Ts41266889 196 C/T hsa-miR-3153 Y 0 Ts180769907 360 A/T hsa-miR-1226* Y 0 hsa-miR-608 N 0 hsa-miR-92a* N 0 Ts1043230 367 C/A hsa-miR-92a-2* Y 0 hsa-miR-4298 N 0 Ts1043329 460 C/T hsa-miR-24 N 150 Ts141849450 515–516 delCA hsa-miR-455-5p Y 95 Ts34629439 582 delT hsa-miR-1301 N 45 hsa-miR-590-5p N 11 hsa-miR-27b* N 23 hsa-miR-582-5p N 15 hsa-miR-656 N 107 Ts113810300 623 T/G hsa-miR-1252 Y 0 hsa-miR-3125 Y 0 hsa-miR-340 Y 1708 hsa-miR-142-5p Y 20 hsa-miR-186 Y 1209 hsa-miR-3121 N 0 hsa-miR-4311 N 0 Ts71719087 638/639 delAT hsa-miR-3145 Y 0The SNP ID and the nature of the polymorphism are indicated. [score:1]
[1 to 20 of 15 sentences]
11
[+] score: 24
Overexpression of miR-186 suppressed the effects of CUR on the drug-resistant cells. [score:5]
miR-186 was determined to be down-regulated by CUR treatment of A549 cells. [score:4]
Treatment of the cells with a miR-186 inhibitor induced apoptosis of the cells [171]. [score:3]
In these studies, with miR-186 and lung cancer, miR-186 appears to have promoted growth and suppression of miR-186 results in apoptosis and drug resistance. [score:3]
Caspase-10 was determined to be a target of miR-186 [170]. [score:3]
CUR treatment also decreased the expression of miR-186 in these cells. [score:3]
CUR appears to decrease miR-186 expression. [score:3]
[1 to 20 of 7 sentences]
12
[+] score: 23
The third category had a high expression level on day 1 and down-regulated expression on day 7, and included miR-132, miR-186, miR-199, miR-338, and miR-219. [score:8]
Expression levels of the other miRNAs were calculated as fold changes based on the miR-214 expression level of 1. miR-148, miR-494, miR-124, miR-193, and miR-300 showed increased expression levels from day 1 to 7. miR-148 showed very high expression levels (2272 to 6517 fold changes compared with that of miR-214) (Figure 3B), while miR-132, miR-186, miR-199, miR-338, and miR-219 showed decreased expression from day 1 to 7 (Figure 3C). [score:8]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG We have previously shown that miR-124 is expressed in human core blood hematopoietic progenitor cells (HPCs) and it specifically binds to the Tip110 3′UTR and has a regulatory effect on core blood HPCs [7]. [score:4]
Figure 3Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
| | | | | | |3' UCUCUCUCAGACGGGAACAUAU Table 2 miRNA mimic name Sequence hsa-miR-124-3p UAAGGCACGCGGUGAAUGCC hsa-miR-148b-3p UCAGUGCAUCACAGAACUUUGU hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-186-5p CAAAGAAUUCUCCUUUUGGGCU hsa-miR-132-3p UAACAGUCUACAGCCAUGGUCG hsa-miR-338-3p UCCAGCAUCAGUGAUUUUGUUG hsa-miR-494 UGAAACAUACACGGGAAACCUC hsa-miR-214-5p UGCCUGUCUACACUUGCUGUGC hsa-miR-199a-3p ACAGUAGUCUGCACAUUGGUUA hsa-miR-193a-3p AACUGGCCUACAAAGUCCCAGU hsa-miR-300 UAUACAAGGGCAGACUCUCUCU hsa-miR-219-1-3p AGAGUUGAGUCUGGACGUCCCG (A) Schematic of the Tip110 3′UTR region with predicted miRNA binding sites (Tip110 miRNA). [score:1]
Human core blood CD34+ cells were isolated, cultured for 1 day (D1) or 7 days (D7), and harvested for RNA isolation followed by qRT-PCR for miR-214 (A), miR-148, miR-494, miR-124, miR-193, and miR-300 (B), and miR-132, miR-186, miR-199, miR-338, and miR-219 (C). [score:1]
[1 to 20 of 6 sentences]
13
[+] score: 18
miR-186, which inhibits muscle cell differentiation through the down-regulation of myogenin [17], was found to be down-regulated in LR during the embryonic stages. [score:9]
In line with the phenomenon that LR showed intense secondary myofiber formation, the reduced expression of miR-186 may have benefited muscle differentiation in LR. [score:3]
Thus, miR-206 plays an opposite role to miR-186 and showed higher expression in LR than in LT across the studied embryonic stages (G1 up). [score:3]
After birth, however, the expression of miR-186 showed no difference between breeds, suggesting that miR-186 may not participate in muscle hypertrophy. [score:3]
[1 to 20 of 4 sentences]
14
[+] score: 17
Other miRNAs from this paper: mmu-mir-150, mmu-mir-186, hsa-mir-150
Over -expression of miR-186 and miR-150 inhibits the synthesis of P2X [7] mRNA, while inhibition of miR-186 and miR-150 up-regulates the synthesis of P2X [7] mRNA and increases ligand -induced P2X [7] pro-apoptotic effects [8]. [score:10]
Mechanisms that induce reduced expression of P2X [7] receptor in cancer epithelial cells involve hypermethylation of the P2X [7] gene and decreased transcription; enhanced degradation of the P2X [7] transcript occurs through the action of microRNAs miR-186 and miR-150 [8], [11], [24]. [score:3]
Mechanisms that induced reduced expression of P2X [7] receptor in cancer epithelial cells involved hypermethylation of the P2X [7] gene and decreased transcription; enhanced degradation of the P2X [7] transcript occurs through the action of miR-186 and miR-150 [8], [10], [16]. [score:3]
The human P2X [7] 3′UTR contains binding sites for miR-186 and miR-150 that confer instability to the P2X [7] transcript. [score:1]
[1 to 20 of 4 sentences]
15
[+] score: 16
stress also downregulated miR-186 in the maternal frontal cortex, which is in contrast to the upregulation found in frontal cortex, hippocampus, and cerebellum in male rats [25]. [score:7]
Note that prenatal stress downregulated miR-181 and miR-186 expression in the frontal cortex. [score:6]
Stress also led to critical decreases in let-7c, miR-23b, miR-181, and miR186 amounts. [score:1]
miR-181 and miR-186 were chosen for verification using qRT-PCR analysis. [score:1]
The following miRNAs were analyzed (5′ to 3′): mirR-181 and miR-186 (dams); miR-103, miR-151, miR-323, miR-145, miR-425, miR-98 (newborns). [score:1]
[1 to 20 of 5 sentences]
16
[+] score: 14
RT-qPCR was performed to evaluate the expression levels of hsa_circ_0043497 (A) and its top 5 predicted miRNA targets (miR-335-3p, miR-186-5p, miR-380-5p, miR-296-3p and miR-522-3p) (B), hsa_circ_0001204 (C) and its top 5 predicted miRNA targets (miR-612, miR-657, miR-362-3p, miR-377-3p and miR-136-5p) (D) in ten human MDMs after 24 h of infection with H37Rv. [score:5]
And the data of RT-qPCR showed that the expression levels of miR-377-3p were markedly elevated and the expression levels of miR-186-5p were significantly reduced in Mtb-infected MDMs. [score:5]
The potential miRNAs targets of hsa_circ_0043497 include miR-335-3p, miR-186-5p, miR-380-5p, miR-296-3p and miR-522-3p. [score:3]
Of the ten miRNAs studied, the levels of miR-186–5p were significantly reduced and the levels of miR-377-3p were significantly elevated in Mtb-infected MDMs (Fig.   7). [score:1]
[1 to 20 of 4 sentences]
17
[+] score: 14
In numerous cancers miR-186 has been shown to inhibit cell proliferation and act as an antioncogenic miR [28– 30] furthermore previous work from Zhu et al. shows that miR-186 can promote MErT by enhancing E-cadherin expression and suppressing vimentin [31] Upregulation of the let-7 family has been shown to be involved cancer cell differentiation, and to inhibit liver metastasis by >50%. [score:12]
miRNA arrays performed on MDA-231 treated with Hum Hep/NPC derived exosomes showed significant changes in the levels of a select number of miRNAs involved in epithelial cell differentiation and miRNAs, such as miR186, miR23a and miR205, from our top and bottom bins have previously been reported to regulate E-cadherin transcription and MErT induction in various cancer types. [score:2]
[1 to 20 of 2 sentences]
18
[+] score: 14
Other miRNAs from this paper: hsa-mir-217, hsa-mir-145, hsa-mir-136, hsa-mir-384
Preliminary evidence indicated that CRNDE could interact with chromatin-modifying complexes in the epigenetic regulation of gene expression, and may enhance glioma development and malignancy via the mTOR, insulin/IGF, or EGFR signaling pathways, as well as by regulating the expression of miR-186 or miR-384 [15– 19]. [score:8]
Interestingly, during the completion of the present manuscript Zheng et al. reported that elevated CRNDE expression promotes cell proliferation, invasion, and migration, and inhibits apoptosis of glioma cells through negative regulation of miR-384 and miR-186 [18, 19]. [score:6]
[1 to 20 of 2 sentences]
19
[+] score: 14
Authors observed that the use of an inhibitor for mRNA186*, not only reduce cellular proliferation but also promote apoptosis, indicating that miR-186* may play an oncogenic role in the development of lung cancer. [score:4]
Curcumin increased miRNA16 in A549 human lung adenocarcinoma cell line, but promoted a significantly downregulation in miRNA186*. [score:4]
These cells are sensitive to curcumin treatment, which can modify miRNA186* expression. [score:3]
Moreover, it was observed that modifications in miR-186* levels cause changes in caspase-10 levels. [score:1]
Zhang J. Du Y. Wu C. Ren X. Ti X. Shi J. Zhao F. Yin H. Curcumin promotes apoptosis in human lung adenocarcinoma cells through miR-186 signaling pathway Oncol. [score:1]
Another study showed the relationship between curcumin and miRNA186* in treatment of multidrug-resistant cells of lung carcinoma (A549/DDP cells). [score:1]
[1 to 20 of 6 sentences]
20
[+] score: 14
In addition to the polyadenylation site, this region contains a miR-7-3p target site that has been lost from the Pelodiscus sequence (Fig.  2b), a conserved let-7-3p target site (Fig.  2c) and a conserved miR-186 target site (Fig.  2d). [score:7]
The 4.8-kb gigaloop is a putative structure formed by pairing of VCR and a complementary sequence (cVCR) Figure 2. Conserved sequences of stratum 1 (shared by Homo and Callorhinchus IGF1R 3'-UTRs): (a) the 3' end of the long IGF1R transcript; (b) a miR-7-3p target site that has been lost from the Pelodiscus sequence; (c) let-7-3p target site; (d) miR-186 target site; (e) The VCR with predicted binding sites for miR-376c, miR-675 (derived from the imprinted H19 RNA) and miR-16. [score:7]
[1 to 20 of 2 sentences]
21
[+] score: 13
Several miRNAs have been documented to directly inhibit TWIST1, including miR-1-1 [26], miR-33a [27, 28], miR-137 [29], miR-186 [30], miR-300 [31], miR-520d-5p [32], miR-539 [31], miR-543 [31], miR-675 [33], and miR-720 [34]. [score:4]
The expression levels of miR-1-1, miR-33a, miR-137, miR-186, miR-520d, miR-539, miR-543, miR-675, miR-720 in the breast cancer samples and the corresponding adjacent normal tissue samples (N = 101) were downloaded from the “The Cancer Genome Atlas” (TCGA) and the Broad GDAC Firehose data portal. [score:3]
0168171.g007 Fig 7The expression levels of miR-1-1, miR-33a, miR-137, miR-186, miR-520d, miR-539, miR-543, miR-675, miR-720 in the breast cancer samples and the corresponding adjacent normal tissue samples (N = 101) were downloaded from the “The Cancer Genome Atlas” (TCGA) and the Broad GDAC Firehose data portal. [score:3]
Most of these miRNAs repressed cancer cell EMT and metastasis in most examined cancer types, and some of them (miR-33a and miR-186) modulated cancer cell sensitivity to cisplatin by down -regulating TWIST1 [27, 30]. [score:2]
On the other hand, miR-186 was shown to induce G1 cell-cycle arrest and enhance cell apoptosis, which consequently rendered the cells more sensitive to cisplatin in ovarian cancers [30]. [score:1]
[1 to 20 of 5 sentences]
22
[+] score: 12
Specifically, 3 miRNAs; miR-26b, miR-3162 and miR-1268 were consistently up-regulated in males, whilst 5 miRNAs including miR-720, miR-186*, miR-3617, miR-320c and miR-3614-5p were found overexpressed in females (Additional file 5: Figure S3). [score:6]
In total, 3 miRNAs were up-regulated in males miR-26b (A), miR-3162 (B) and miR-1268 (C), while 5 miRNAs were overexpressed in females; miR-720 (D), miR-186* (E), miR-3617 (F), miR-320c (G) and miR-3614-5p (H). [score:6]
[1 to 20 of 2 sentences]
23
[+] score: 12
In detail, the expression of miR-186, miR-215 and miR-223 resulted upregulated in ATRA differentiated cells, while the expression of miR-17-5p, miR-25, miR-193, miR-195, and let-7a resulted downregulated (the miRNAs bolded were already reported as deregulated by ATRA in differentiated NB4 cells in refs. [score:12]
[1 to 20 of 1 sentences]
24
[+] score: 11
The luciferase assays showed that miR-27b, miR-101, or miR-128 rather than miR-144 or miR-186 (Figure 3A and 3B) displayed more effectively inhibited luciferase activity with an inhibitory rate of more than 30% in pmiR-VEGF-C and miRNAs co -transfected cells, indicating that miR-27b, miR-101, and miR-128 were candidate miRNAs for VEGF-C. Specifically, miR-27b, miR-101, or miR-128 transfection decreased luciferase expression by 41.65 ± 4.60%, 30.36 ± 15.99%, and 51.20 ± 7.3%, respectively in MKN-45 cells (Figure 3C, p = 0.0020, p = 0.0179, or p = 0.0037). [score:6]
Dual-luciferase reporter gene assay showed that miR-27b, miR-101, or miR-128(decreased 38.68% ± 10.86%, 30.36% ± 10.29%, 47.76% ± 13.61%, p = 0.0115, p = 0.0156, or p = 0.0111) respectively, but not miR-144 or miR-186 displayed strong inhibitory effect on the luciferases expression in MKN-45 cells. [score:4]
Five tumor-suppressing miRNAs including miR-27b, miR-101, miR-128, miR-144, and miR-186, which have potential binding sites in the 3′-UTR of VEGF-C (Figure 3A and Supplementary Figure S1A), were selected for further investigation. [score:1]
[1 to 20 of 3 sentences]
25
[+] score: 11
EIF2S2, an mRNA target of miR-186 was down-regulated in this study. [score:6]
Among the miRNAs with known impact on CL function, only miR-186 was up-regulated. [score:4]
In follicular fluid, miR-186 increases in response to exogenous progesterone after ovulation [63]. [score:1]
[1 to 20 of 3 sentences]
26
[+] score: 10
The upregulated miRNAs included miR-132-3p, miR-604, miR-186-5p, miR-29b-3p, miR-125b-5p, miR-376c-3p, and miR-30b-5p, where the only downregulated miRNA was miR-423-3p (Table 1). [score:7]
Noncoding RNA (2017) 3(3): 22 10.3390/ncrna3030022 106 Suman S Jones-Reed DZZ Schmidt ML Clark GJ Klinge C Barve S Alteration of miR-186 expression modifies inflammatory markers in normal epithelial and prostate cancer cell mo dels. [score:3]
[1 to 20 of 2 sentences]
27
[+] score: 9
Lastly, 7 hubs from the 11 hubs discovered by DIANA-microT are retrieved within the 40 degree sorted nodes on the TargetScan network (in decreasing order by degree: miR-548c-3p, miR-590-3p, miR-579, miR-186, miR-513a-3p, miR-661, miR-495 and lastly miR-940). [score:3]
Although miR-186 is known to have an effect on a proapoptotic purinergic receptor 38, it is not known whether this microRNA has a direct role on apoptosis. [score:2]
These 7 microRNAs (the 3 microRNAs from the assorted club 2 and 4 from the assorted club 1, namely miR-495, miR-548c-3p, miR-590-3p and miR-186) also seem to be placed at key central positions in the network, defining two separate zones (Figure 2a). [score:1]
It comprises miR-495, miR-548c-3p, miR-590-3p, miR-186, miR-579, miR-513a-3p, miR-543 and miR-944. [score:1]
The 5 microRNAs are, in decreasing order of centrality: miR-548c-3p, miR-590-3p, miR-661, miR-186 and miR-940. [score:1]
However, miR-186 and miR-543 are both cited by different studies in cellular aging 31 32, demonstrating the possibility of their coaction. [score:1]
[1 to 20 of 6 sentences]
28
[+] score: 9
Other miRNAs from this paper: hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-98, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-222, hsa-mir-223, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-150, hsa-mir-188, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-363, hsa-mir-302c, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-328, hsa-mir-342, hsa-mir-326, hsa-mir-135b, hsa-mir-338, hsa-mir-335, hsa-mir-345, hsa-mir-424, hsa-mir-20b, hsa-mir-146b, hsa-mir-520a, hsa-mir-518a-1, hsa-mir-518a-2, hsa-mir-500a, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-92b, hsa-mir-574, hsa-mir-614, hsa-mir-617, hsa-mir-630, hsa-mir-654, hsa-mir-374b, hsa-mir-301b, hsa-mir-1204, hsa-mir-513b, hsa-mir-513c, hsa-mir-500b, hsa-mir-374c
Comparison of miRNA expression of microdissected HRS cells from cHL patients to CD77+ GC B cells showed three downregulated miRNAs, namely, miR-520a, miR- 200a, and miR-614 and twelve upregulated miRNAs, namely, miR-20a, miR-21, miR-9, miR-155, miR-16, miR-140, miR-18a, miR-30b, miR-30a- 5p, miR-196a, miR-374, and miR-186 [36]. [score:9]
[1 to 20 of 1 sentences]
29
[+] score: 9
In the human multidrug-resistant adenocarcinoma cell line A549/DDP, curcumin altered miRNA expression and significantly downregulated the expression of miR-186 [24], a negative regulator of the proapoptotic purinergic P2X7 receptor [25], which is also consistent with our result. [score:9]
[1 to 20 of 1 sentences]
30
[+] score: 9
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-185, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
[1 to 20 of 1 sentences]
31
[+] score: 8
The expression levels of selected group of miRNAs identified in the microarray experiment, miR−374−5p, −30b, −222, −320c, −186, −320a,−320e and −29c, were validated using quantitative real-time reverse transcription PCR (qRT-PCR) that confirmed the microarray results and showed upregulation of miR-30b, miR-320 family (320a/320c/ 320e) on day 7 post-AD differentiation induction and further increase in expression levels of the same miRNAs in addition to miR-186 on day 13 (Figure 1e). [score:8]
[1 to 20 of 1 sentences]
32
[+] score: 8
In particular, we identified 10 over-expressed miRNAs (miR-17-5p, miR-221-3p, miR-93-5p, miR-25-3p, miR-181b-5p, miR-106b-5p, miR-186-5p, miR-222-3p, miR-15b-5p, and miR-223-3p; Figure 2A) that are involved in the activation of major liver carcinogenesis-related gene expression networks, especially the TGF-β- and Wnt/β-catenin signaling pathways, the roles of which are well-established in hepatocarcinogenesis [14]. [score:5]
Among these miRNAs, the over -expression of ten miRNAs (miR-15b-5p, miR-17-5p, miR-25-3p, miR-93-5p, miR-106b-5p, miR-181b-5p, miR-186-5p, miR-221-3p, miR-222-3p, and miR-223-3p) was associated with the activation of major hepatocarcinogenesis-related pathways, including the TGF-β, Wnt/β-catenin, ERK1/2, mTOR, and EGF signaling. [score:3]
[1 to 20 of 2 sentences]
33
[+] score: 8
The miRNA hsa-miR-186, the upregulated miRNA with highest AUC has been described to be upregulated in pancreatic cancer [35]. [score:7]
The best classification accuracy has been obtained by using a subset that consists of 16 miRNAs including hsa-miR-186, hsa-let-7d*, hsa-miR-18a*, hsa-miR-145, hsa-miR-99a, hsa-miR-664, hsa-miR-501-5p, hsa-miR-378*, hsa-miR-29c*, hsa-miR-1280, hsa-miR-365, hsa-miR-1249, hsa-miR-328, hsa-miR-422a, hsa-miR-30 d, and hsa-miR-17*. [score:1]
[1 to 20 of 2 sentences]
34
[+] score: 8
We observed altered expressions of 342 miRNAs as a response to curcumin in A549/DDP cells, and miR-186* also emerged as the key target to reverse resistance and promote apoptosis [65]. [score:5]
After 48 h of curcumin treatment at the concentration of 15 μmol/L, we observed that curcumin promoted A549 cell apoptosis through modulation of miR-186* and targeted its down-stream caspase-10 pathway [59]. [score:3]
[1 to 20 of 2 sentences]
35
[+] score: 8
Cisplatin-resistant ovarian cancer cell lines exhibit decreased miR-186 expression and increased Twist1 expression while the introduction of miR-186 can reverse drug resistance through Twist1 down-regulation [117]. [score:8]
[1 to 20 of 1 sentences]
36
[+] score: 7
In vascular endothelial cells, circRNA microarray analysis reveals that hsa_circ_0010729 regulates VECs proliferation and apoptosis via targeting miR-186/HIF-1α axis [10]. [score:4]
In vascular endothelial cell, hsa_circ_0010729 co-express with HIF-1α and negatively correlated with miR-186 in hypoxia induced HUVECs progression [28]. [score:3]
[1 to 20 of 2 sentences]
37
[+] score: 7
org, we choose miR-186, miR-384, miR-410, miR-448, miR-496 and miR-544 to further study which miRNA might regulate matrilin-3 expression. [score:4]
a The mRNA and protein levels of matrilin-3 in normal and osteoarthritis cartilages were determined using quantitative real-time PCR and western blot, n = 10. b The levels of miR-186, miR-384, miR-410, miR-448, miR-496 and miR-544 in osteoarthritis cartilages were determined using quantitative real-time PCR, n = 10. c Pearson’s correlation analysis of the relative expression levels of miR-448 and the relative matrilin-3 mRNA levels in osteoarthritis cartilage. [score:3]
[1 to 20 of 2 sentences]
38
[+] score: 7
Comparison of 5p and 3p expression among 50 top-ranked miRNAs found in primary human chondrocytes demonstrated that three miRNAs, miR-320a, miR-28 and miR-103a-2, showed expression of their 3p arm only and four miRNAs, miR-199b, miR-98, miR-186 and miR-16-1, expressed their 5p arm only. [score:7]
[1 to 20 of 1 sentences]
39
[+] score: 7
Previous studies have shown that CCND1 is the direct target of miR-186 [33] and miR-545 [34], while both CCND1 and CCND2 are directly targeted by miR-15a and miR-16 [35]. [score:7]
[1 to 20 of 1 sentences]
40
[+] score: 7
Specifically, five miRNAs (miR-26b, miR-26a, miR-212, miR-107, and miR-103) were upregulated and twelve miRNAs (miR-125b, miR-141, miR-144, miR-164, miR-145, miR-143, miR-15b, miR-16, miR-186, let-7b, let-7a3, and miR-128) were downregulated. [score:7]
[1 to 20 of 1 sentences]
41
[+] score: 7
To validate our microassay findings above, we then selected four miRNAs including one downregulated (miR-29c) and three upregulated (miR-186, miR-15a and miR-18b) for qRT-PCR analysis. [score:6]
In parallel, levels of miR-186 were 0.02 ± 0.00 vs. [score:1]
[1 to 20 of 2 sentences]
42
[+] score: 7
Among the ten most deregulated miRNAs, hsa-miR-145, hsa-miR-186, and hsa-miR-20b have been found to be deregulated in different types of cancer such as prostate cancer, pancreatic cancer or gastric cancer [13]– [15]. [score:3]
The ten miRNAs that were most significantly deregulated included hsa-miR-145 (1.46·10 [−7]), hsa-miR-186 (2.89·10 [−7]), hsa-miR-664 (5.25·10 [−5]), hsa-miR-20b (1.48·10 [−4]), hsa-miR-422a (1.48·10 [−4]), hsa-miR-142-3p (1.54·10 [−4]), hsa-miR-584 (1.56·10 [−4]), hsa-miR-223 (1.63·10 [−4]), hsa-miR-1275 (1.16·10 [−4]) and hsa-miR-491-5p (2.83·10 [−4]). [score:2]
For the two best miRNAs, hsa-miR-186 and hsa-miR-145, we present bar plots showing the intensity values for all MS and control samples in Figures 2a and 2b. [score:1]
Barplots detailing the intensity values for the miRNAs hsa-miR-145 (a), hsa-mir-186 (b), and hsa-miR-20b (c). [score:1]
[1 to 20 of 4 sentences]
43
[+] score: 6
Consistent with other studies, we also found that miR-200a, miR-200b, miR-18a and miR-224 were among the top 10 downregulated miRNAs, while miR-29, miR-125a, miR-125b, miR-122 and miR-186 were upregulated in LNCaP/DHT compared with LNCaP. [score:6]
[1 to 20 of 1 sentences]
44
[+] score: 6
MiR-186, miR-216b, miR-337-3p, and miR-760 cooperatively induce cellular senescence by targeting α subunit of protein kinase CKII in human colorectal cancer cells. [score:3]
For example, it is known that human miR-186-5p, miR-216b-5p, miR-337-3p, and miR-760 cooperatively induce cellular senescence by targeting the gene CSNK2A1 in human colorectal cancer cells [35]. [score:3]
[1 to 20 of 2 sentences]
45
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7e, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-192, hsa-mir-34a, hsa-mir-204, hsa-mir-205, hsa-mir-214, hsa-mir-215, hsa-mir-222, hsa-mir-223, hsa-mir-1-2, hsa-mir-15b, hsa-mir-125b-1, hsa-mir-141, hsa-mir-191, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-149, hsa-mir-184, hsa-mir-200c, hsa-mir-1-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-339, hsa-mir-146b, hsa-mir-548a-1, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-548a-3, hsa-mir-548c, hsa-mir-624, hsa-mir-650, hsa-mir-651, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-449b, hsa-mir-1185-2, hsa-mir-1283-1, hsa-mir-1185-1, hsa-mir-708, hsa-mir-548e, hsa-mir-548j, hsa-mir-1285-1, hsa-mir-1285-2, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1283-2, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Furthermore, FOXM1, the inducers RAF1, HIF1A, CCNA, CCNB and CCNE were overexpressed, while the repressors miR-149 and miR-186 were down-regulated (S4 Fig). [score:6]
[1 to 20 of 1 sentences]
46
[+] score: 6
Mechanistically, CRNDE could negatively regulate miR-186 and depress the expression of the downstream target genes XIAP (X-linked inhibitor of apoptosis) and PAK7 [p21 protein (Cdc42/Rac)-activated kinase 7], thus contributing to the malignant characteristics of human GSCs (Zheng J. et al., 2015). [score:6]
[1 to 20 of 1 sentences]
47
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-25, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-16-2, hsa-mir-198, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-142, hsa-mir-145, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-146a, hsa-mir-150, hsa-mir-188, hsa-mir-193a, hsa-mir-194-1, hsa-mir-320a, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-362, hsa-mir-369, hsa-mir-375, hsa-mir-378a, hsa-mir-382, hsa-mir-340, hsa-mir-328, hsa-mir-342, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-335, hsa-mir-345, hsa-mir-196b, hsa-mir-424, hsa-mir-425, hsa-mir-20b, hsa-mir-451a, hsa-mir-409, hsa-mir-484, hsa-mir-486-1, hsa-mir-487a, hsa-mir-511, hsa-mir-146b, hsa-mir-496, hsa-mir-181d, hsa-mir-523, hsa-mir-518d, hsa-mir-499a, hsa-mir-501, hsa-mir-532, hsa-mir-487b, hsa-mir-551a, hsa-mir-92b, hsa-mir-572, hsa-mir-580, hsa-mir-550a-1, hsa-mir-550a-2, hsa-mir-590, hsa-mir-599, hsa-mir-612, hsa-mir-624, hsa-mir-625, hsa-mir-627, hsa-mir-629, hsa-mir-33b, hsa-mir-633, hsa-mir-638, hsa-mir-644a, hsa-mir-650, hsa-mir-548d-1, hsa-mir-449b, hsa-mir-550a-3, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-454, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-708, hsa-mir-216b, hsa-mir-1290, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-3151, hsa-mir-320e, hsa-mir-378c, hsa-mir-550b-1, hsa-mir-550b-2, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j, hsa-mir-486-2
High miR-3151 expression was associated with high miR-501-5p and low miR-590, miR-135a, miR-100*, miR-186* and let-7a* expression, however the significance of this association is unknown [129]. [score:5]
[1 to 20 of 1 sentences]
48
[+] score: 5
In recent study from Zhi-Hong Liu’s group, other plasma miRNAs such as miR-125b, miR-186, and miR-193a-3p were found to be upregulated in FSGS patients [17]. [score:4]
Zhang C Plasma microRNA-186 and proteinuria in focal segmental glomerulosclerosisAm. [score:1]
[1 to 20 of 2 sentences]
49
[+] score: 5
For example, miR-186 targets myogenin and thus inhibits terminal muscle differentiation [31]. [score:5]
[1 to 20 of 1 sentences]
50
[+] score: 5
On the other hand, these 19 miRNAs (hsa-miR106a, hsa-miR-125a, hsa-miR-140, hsa-miR-146a, hsa-miR-146b, hsa-miR-155, hsa-miR-16, hsa-miR-17, hsa-miR186, hsa-miR-191, hsa-miR-197, hsa-miR-200b, hsa-miR-200c, hsa-miR-339, hsa-miR-374, hsa-miR-422, hsa-miR-422, hsa-miR-454, hsa-miR-484 and hsa-miR-590) were up-expressed in VP and ART (block1-group2) and down-expressed in EC and HIV- (block2-group2). [score:5]
[1 to 20 of 1 sentences]
51
[+] score: 5
In cisplatin-resistant human lung carcinoma cells A549/DDP, curcumin inhibits the overexpression of miR-186*, leading to elevated apoptosis and declining survival rate with unclear action mechanism [14]. [score:5]
[1 to 20 of 1 sentences]
52
[+] score: 5
Two other brain-expressed miRNAs that could potentially target P2rx7 (miR-186 and miR-150) 21, were not uploaded to the RISC in the contralateral hippocampus (Fig. 2J). [score:5]
[1 to 20 of 1 sentences]
53
[+] score: 5
Ruan T reported that miR-186 targets YAP1 to inhibit Hippo signaling and tumorigenesis in hepatocellular carcinoma [33]. [score:5]
[1 to 20 of 1 sentences]
54
[+] score: 4
For example, miR-150 was found to be reduced in serum of patients with arterial fibrillation and miR-1, miR-134, miR-186, miR-208, miR-233 and miR-499 were all found to be significantly upregulated in serum from acute myocardial infarction (AMI) patients [22- 24]. [score:4]
[1 to 20 of 1 sentences]
55
[+] score: 4
Furthermore the presence of a predicted binding site for pred-MIR191 in the 3′-UTR of SLAIN1 also raises the possibility that this miRNA can regulate the translation of its host gene, a mechanism that has been proposed for miR-186 in dog [62] and for miR-763 in human, mouse and rat [63]. [score:4]
[1 to 20 of 1 sentences]
56
[+] score: 4
Interestingly, BMP2 signaling upregulated miRNAs: miR-194, miR-186, miR-99a, miR-92a and also miR-31, and miR-181a (51). [score:4]
[1 to 20 of 1 sentences]
57
[+] score: 4
Down-regulation of miR-186, miR-203, miR-181b or miR-497 could influence the sensitivity of ovarian, breast, lung or gastric cancer to cisplatin treatment [8, 9]. [score:4]
[1 to 20 of 1 sentences]
58
[+] score: 4
As shown in Table 2, 15 miRNAs (miR-222, miR-320, miR-24, miR-132, let-7b, miR-106a, miR-19b, miR-16, miR-186, miR-339-3p, miR-17, miR-323-3p, miR-197, miR-20a, and miR-382) were down-regulated in Group 2 and were chosen for subsequent verification analysis. [score:4]
[1 to 20 of 1 sentences]
59
[+] score: 4
Lately, miR-760 and miR-186 upregulation has been associated with replicative senescence in human lung fibroblast cells. [score:4]
[1 to 20 of 1 sentences]
60
[+] score: 3
MiR-186, miR-216b, miR-337-3p, and miR-760 cooperatively induce cellular senescence by targeting alpha subunit of protein kinase CKII in human colorectal cancer cells. [score:3]
[1 to 20 of 1 sentences]
61
[+] score: 3
Other miRNAs from this paper: hsa-mir-375
For instance, hPSCs overexpressing miRNA-186 and miRNA-375 display pancreatic cell-specific transcription factors and genes, such as INS, NGN3, GLUT2, PAX4, PAX6, NKX6–1, PDX1 and GCG [97]. [score:3]
[1 to 20 of 1 sentences]
62
[+] score: 3
Besides, we reviewed that miR-186 and miR-26b were involved in cell cycle 62 and cell growth regulation 63, respectively. [score:2]
Via examining the degree distribution of those pivot miRNAs, we found out that miR-29 family, miR-26b and miR-186 were among those top-ranked miRNAs. [score:1]
[1 to 20 of 2 sentences]
63
[+] score: 3
Another genome-wide serum miRNA expression profile identified a combination of four serum miRNAs (miR-222, miR-223, miR-186 and miR-204) as a fingerprint for EEC detection. [score:3]
[1 to 20 of 1 sentences]
64
[+] score: 3
Eight of the miRNAs that showed significant associations with their target mRNAs, were common between the two tissue types: hsa-miR-181a, hsa-miR-186, hsa-miR-30a, hsa-miR-141, hsa-miR-30d, hsa-miR-590-3p, hsa-miR-128 and hsa-miR-340 (Figure 5A ). [score:3]
[1 to 20 of 1 sentences]
65
[+] score: 3
For instance, miR-186 inhibits GSC growth by binding to the 3′-UTRs of XIAP and PAK7[34]. [score:3]
[1 to 20 of 1 sentences]
66
[+] score: 3
Other highly expressed miRNAs in horse blood included miR-25, miR-191a, miR-186, miR-22 and miR-142-5p. [score:3]
[1 to 20 of 1 sentences]
67
[+] score: 3
Three miRNAs (miR-181, miR-186, and miR-590-3p) are predicted to target over 50% of all lupus susceptibility genes [19]. [score:3]
[1 to 20 of 1 sentences]
68
[+] score: 3
miR-186, miR-216b, miR-337-3p, and miR-760 cooperatively induce cellular senescence by targeting α subunit of protein kinase CKII in human colorectal cancer cells. [score:3]
[1 to 20 of 1 sentences]
69
[+] score: 3
From these 25 miRs, trophoblast cells were found to express 8 at a detectable level: miR-7-5p; miR-186-5p; miR-155-5p; miR-22-3p; miR-185-5p; miR-138-5p; miR-329; and miR-362-3p (Table 1 and Table S1). [score:3]
[1 to 20 of 1 sentences]
70
[+] score: 3
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Another subgroup of miRNAs displayed an opposite pattern, i. e. decreased expression during latency: miR-7a-1-3p, miR-107-3p, miR-138-5p, miR-139-3p, miR-186-5p, miR-204-5p, miR-222-3p, miR-324-3p and miR-505-3p were significantly decreased during latency (peak at 4 days after SE), then gradually returned to control levels (Fig. 2, Supplementary Fig. S2). [score:3]
[1 to 20 of 1 sentences]
71
[+] score: 3
In a subsequent study, the expression of 380 miRNAs using TaqMan low density arrays was evaluated in the plasma of patients with primary osteoarthritis and controls and 12 miRNAs (hsa-miR-16, hsa-miR-20b, hsa-miR-29c, hsa-miR-30b, hsa-miR-93, hsa-miR-126, hsa-miR-146a, hsa-miR-184, hsa-miR-186, hsa-miR-195, hsa-miR-345, and hsa-miR-885) were identified being over-expressed in OA patients [28]. [score:3]
[1 to 20 of 1 sentences]
72
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-16-1, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-27a, hsa-mir-31, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-16-2, hsa-mir-192, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-181a-2, hsa-mir-205, hsa-mir-181a-1, hsa-mir-214, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-30b, hsa-mir-125b-1, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-146a, hsa-mir-184, hsa-mir-193a, hsa-mir-194-1, hsa-mir-155, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-219a-2, hsa-mir-99b, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-374a, hsa-mir-148b, hsa-mir-423, hsa-mir-486-1, hsa-mir-499a, hsa-mir-532, hsa-mir-590, bta-mir-26a-2, bta-let-7f-2, bta-mir-103-1, bta-mir-148a, bta-mir-16b, bta-mir-21, bta-mir-221, bta-mir-222, bta-mir-27a, bta-mir-499, bta-mir-125b-1, bta-mir-181a-2, bta-mir-205, bta-mir-27b, bta-mir-30b, bta-mir-31, bta-mir-193a, bta-let-7d, bta-mir-148b, bta-mir-186, bta-mir-191, bta-mir-192, bta-mir-200a, bta-mir-214, bta-mir-22, bta-mir-23a, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-24-2, bta-let-7a-1, bta-mir-532, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-103-2, bta-mir-125b-2, bta-mir-365-1, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-664a, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-1915, bta-mir-146a, bta-mir-155, bta-mir-16a, bta-mir-184, bta-mir-24-1, bta-mir-194-2, bta-mir-219-1, bta-mir-223, bta-mir-26a-1, bta-mir-365-2, bta-mir-374b, bta-mir-486, bta-mir-763, bta-mir-9-1, bta-mir-9-2, bta-mir-181a-1, bta-mir-2284i, bta-mir-2284s, bta-mir-2284l, bta-mir-2284j, bta-mir-2284t, bta-mir-2284d, bta-mir-2284n, bta-mir-2284g, bta-mir-2339, bta-mir-2284p, bta-mir-2284u, bta-mir-2284f, bta-mir-2284a, bta-mir-2284k, bta-mir-2284c, bta-mir-2284v, bta-mir-2284q, bta-mir-2284m, bta-mir-2284b, bta-mir-2284r, bta-mir-2284h, bta-mir-2284o, bta-mir-664a, bta-mir-2284e, bta-mir-1388, bta-mir-194-1, bta-mir-193a-2, bta-mir-2284w, bta-mir-2284x, bta-mir-148c, hsa-mir-374c, hsa-mir-219b, hsa-mir-499b, hsa-mir-664b, bta-mir-2284y-1, bta-mir-2284y-2, bta-mir-2284y-3, bta-mir-2284y-4, bta-mir-2284y-5, bta-mir-2284y-6, bta-mir-2284y-7, bta-mir-2284z-1, bta-mir-2284aa-1, bta-mir-2284z-3, bta-mir-2284aa-2, bta-mir-2284aa-3, bta-mir-2284z-4, bta-mir-2284z-5, bta-mir-2284z-6, bta-mir-2284z-7, bta-mir-2284aa-4, bta-mir-2284z-2, hsa-mir-486-2, hsa-mir-6516, bta-mir-2284ab, bta-mir-664b, bta-mir-6516, bta-mir-219-2, bta-mir-2284ac, bta-mir-219b, bta-mir-374c, bta-mir-148d
Most of the detected top expressed miRNAs are conserved in human, mouse, and bovine, and belong to several miRNA families, vis, miR-31, miR-26a, miR-27a-3p/27b, let-7a-5p/7f/7i, miR-21-5p, miR-22-3p, miR-184, miR-186, miR-191, miR-205 and miR221/222. [score:3]
[1 to 20 of 1 sentences]
73
[+] score: 2
Other miRNAs from this paper: hsa-let-7b
We also found a hub miRNA miR-186-5p function as a date hub to connect four functional modules (module 2, 3, 4 and 5), implying its important roles in organizing the functional modules. [score:1]
A recent study suggested that miR-186 can act as a key player in overcoming chemoresistance in ovarian cancer therapy [22], which strongly supported our findings. [score:1]
[1 to 20 of 2 sentences]
74
[+] score: 2
Other miRNAs from this paper: hsa-mir-152
CRNDE plays an oncogenic role of glioma stem cell through the negative regulation of miR-186 [16]. [score:2]
[1 to 20 of 1 sentences]
75
[+] score: 2
MiR-186, miR-769, miR-95, miR-202 and let-7 g were also relevant to cancer pathways, but did not serve other functions. [score:1]
MiR-186 was found to regulate two genes (CEBPA, CREBBP), which were associated with cancer pathways. [score:1]
[1 to 20 of 2 sentences]
76
[+] score: 2
Other miRNAs from this paper: mmu-mir-186
MicroRNA-186 induces sensitivity of ovarian cancer cells to paclitaxel and cisplatin by targeting ABCB1. [score:2]
[1 to 20 of 1 sentences]
77
[+] score: 1
Not surprisingly, the cellular and molecular role of small noncoding RNAs (miR-21, miR25, miR125, miR146a, and miR186, etc. ) [score:1]
[1 to 20 of 1 sentences]
78
[+] score: 1
173 (miR-186-5p, miR-208a-5p, miR-291a-3p, miR-294-3p, miR-295-3p, miR-302a-3p, miR-302b-3p, miR-302c-3p and miR-302d-3p). [score:1]
[1 to 20 of 1 sentences]
79
[+] score: 1
org/), a set of miRNAs were predicted to have potential interaction with circUBAP2, including miR-150, miR-135, miR-101, miR-181, miR-23, miR-149, miR-139, miR-491, miR-124, miR-301m miR-328, miR-122, miR-186, let-7, miR-132, miR-191, miR-425, miR-125, miR-149, miR-143, and miR-146a. [score:1]
[1 to 20 of 1 sentences]
80
[+] score: 1
The long noncoding RNA PVT1 functions as a competing endogenous RNA by sponging miR-186 in gastric cancer. [score:1]
[1 to 20 of 1 sentences]
81
[+] score: 1
For mir-186 and mir-29a, high abundance of the alternate arm sequence was indicative of low mature sequence levels, suggesting mutually exclusive selection of the arms. [score:1]
[1 to 20 of 1 sentences]
82
[+] score: 1
miR-10b, miR-126, miR-127-3p, miR-186, miR-146a, and miR-21 were elevated in both normal and diabetic limbus vs. [score:1]
[1 to 20 of 1 sentences]
83
[+] score: 1
Zhang J, Du Y, Wu C, et al (2010) Curcumin promotes apoptosis in human lung adenocarcinoma cells through miR-186* signaling pathway. [score:1]
[1 to 20 of 1 sentences]
84
[+] score: 1
Other miRNAs from this paper: hsa-mir-129-1, hsa-mir-129-2
There are transfactors and non-coding RNA such as GATA1, miR-186, miR-129 [33– 35]. [score:1]
[1 to 20 of 1 sentences]
85
[+] score: 1
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
Furthermore, the amyloid protein fragment amyloid beta (Aβ), is also influenced by miRNA-24, miRNA-186, miRNA-455, miRNA-146a, and miRNA-98 (Delay et al., 2011; Li Y. Y. et al., 2011; Hu et al., 2013). [score:1]
[1 to 20 of 1 sentences]
86
[+] score: 1
The normalized RT-PCR data of three additional miRNAs (miR-432, miR-210 and miR-186) are seen to the right, sharing the same color scheme as the histograms. [score:1]
[1 to 20 of 1 sentences]
87
[+] score: 1
Using a profiling-replication-validation mo del, a three-miRNAs panel including miR-132, miR-150, and miR-186 showed a strong discriminating power between the two conditions. [score:1]
[1 to 20 of 1 sentences]
88
[+] score: 1
Interestingly, a number of major miRNAs enriched for seedless interactions (for example, miR-9, miR-181, miR-30 and miR-186) have AU-rich seed sites, indicating that weak seed-pairing stability may favour seedless non-canonical interactions 10. [score:1]
[1 to 20 of 1 sentences]
89
[+] score: 1
Both miR-29a and miR-186 are some of the most frequently detected miRNAs in plasma and serum [46]. [score:1]
[1 to 20 of 1 sentences]
90
[+] score: 1
In only six miRNAs carrying either a single non-templated adenylate residue (miR-122-5p, miR-92a-3p, miR-26a-5p, miR-186-5p, miR-30b-5p, and miR-29a-3p) or a single uridylate residue (miR-122-5p, let-7a-5p, and let-7g-5p have a 3′-end single uridylate residue that is either derived from their precursor forms or added in a non-template -dependent manner; let-7f-5p miR-26a-5p and miR-151a-5p have a non-templated uridylate residue), we observed decreases in their proportions in liver biopsies from patients with HCV. [score:1]
[1 to 20 of 1 sentences]
91
[+] score: 1
Among the 44 miRNAs that they found modulated by UVB, only 4 (miR-31-5p, let-7b-5p, miR-125b-5p and miR-186-5p) also responded to IR in our study [35]. [score:1]
[1 to 20 of 1 sentences]
92
[+] score: 1
There was a group of patients with lower miR-30b-5p, miR-186-5p, miR-382-5p, miR-27a-3p, miR-15a-3p and miR15a-5p. [score:1]
[1 to 20 of 1 sentences]