sort by

118 publications mentioning hsa-mir-185 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-185. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 254
The inhibitory mechanism of AR expression by miR-185 and 342 is likely to be down-regulation of SREBP-1. We previously showed that SREBP-1 regulates AR gene expression by binding an SREBP-1 cis-acting element located in the 5′ flanking AR promoter region [30]. [score:11]
These data suggest that miR-185 and 342 play a tumor-suppressive role by inhibiting SREBP-1 and SREBP-2 expression, and thereby reprogramming lipogenesis and cholesterogenesis. [score:7]
MiR-185 and 342 inhibited fatty acid and cholesterol biosynthesis through down-regulation of key lipogenic and cholesterogenic transcription factors, SREBP-1 and SREBP-2, and their downstream regulated genes including FASN and HMGCR. [score:6]
In the present study, we discovered two new lipid and cholesterol anabolism regulated miRNAs, miR-185 and 342, that blocked the SREBP-lipogenesis-cholesterogenesis, decreased AR expression, inhibited tumorigenicity and induced apoptotic death in prostate cancer cells. [score:6]
Rather, these results suggest a novel mechanism whereby miR-185 and 342 inhibit AR expression through the transcriptional regulation of SREBP in prostate cancer cells. [score:6]
4) While miR-185 and 342 mediate lipogenesis and cholesterogenesis, these two miRNAs also inhibit AR mRNA and protein expression. [score:5]
By blocking endogenous miR-185 and 342 in prostate cancer cells, both miR-185 and 342 inhibitors increased SREBP-1, SREBP-2 and their downstream gene expression (Fig. 1C). [score:5]
MiR-185 and 342 inhibition of SREBP mRNA and protein and expression patterns of miR-185 and 342 in prostate cancer cells. [score:5]
In this study, we revealed that miR-185 and 342 suppressed AR expression in cell culture (Fig. 1A and 1B) as well as in subcutaneous C4-2B tumors (Fig. 4C). [score:5]
Both miR-185 and 342 inhibited the expression of mRNAs (Fig. 1A) as well as precursor (125 kDa) and mature (68 kDa) proteins (Fig. 1B) of SREBP-1 and SREBP-2 in LNCaP and C4-2B prostate cancer cells. [score:5]
In summary, our study demonstrates for the first time that: 1) MiR-185 and 342 inhibit the expression of SREBP-1 and SREBP-2 as well as their downstream regulated genes, and reprogram lipogenesis and cholesterogenesis in prostate cancer cells. [score:5]
Both miR-185 and 342 inhibited the expression of SREBP-1 and SREBP-2 and their downstream genes, FASN and HMGCR, and further decreased the levels of fatty acid and cholesterol in prostate cancer cells. [score:5]
C, MiR-185 and 342 inhibitors (antisense oligonucleotides against miR-185 and 342) increased SREBP-1, SREBP-2, FASN, HMGCR and AR expression in LNCaP and C4-2B cells determined by qRT-PCR. [score:5]
3) Re -expression of miR-185 or 342 suppresses tumorigenicity and cell proliferation, and induces apoptotic cell death in vitro and in vivo. [score:5]
0070987.g001 Figure 1 A, Both miR-185 and 342 inhibited mRNA expression of SREBP-1, SREBP-2, FASN, HMGCR and AR in LNCaP and C4-2B prostate cancer cells determined by qRT-PCR. [score:5]
A, Both miR-185 and 342 inhibited mRNA expression of SREBP-1, SREBP-2, FASN, HMGCR and AR in LNCaP and C4-2B prostate cancer cells determined by qRT-PCR. [score:5]
A, MiR-185 and 342 inhibitors induced cell proliferation in LNCaP cells compared to miR -negative control (NC) transfected cells 3 d following miRNA inhibitor transfection. [score:4]
C, IHC results showed that down-regulation of SREBP-1, SREBP-2, FASN, HMGCR, AR and PSA was observed in the miR-185 and 342 -treated subcutaneous C4-2B tumors in comparison with the NC -treated tumors. [score:4]
The results confirm that SREBP-1 and SREBP-2 mRNAs are direct targets of miR-185 and 342. [score:4]
Taken together, miR-185 and 342 directly or indirectly regulate a cohort of genes with significant biological roles in lipid and cholesterol anabolism and homeostasis, cell proliferation and progression in prostate cancer cells. [score:4]
Consistent with previous in vitro Western blot results (Fig. 1B), IHC data showed that the miR-185 or 342 treated groups had decreased SREBP-1, SREBP-2, FASN, HMGCR, AR and PSA, which is an AR downstream target gene, expression compared with the control tumors (Fig. 4C). [score:4]
Expression of FASN [32] and HMGCR [33], [34], which are SREBP downstream regulated genes, was decreased by miR-185 and 342 (Fig. 1A and 1B). [score:4]
Additionally, miR-185 has been demonstrated to directly bind with the 3′ UTR of AR mRNA to further decrease AR expression [57]. [score:4]
Figure S1 SREBP-1 and SREBP-2 mRNAs are direct targets of miR-185 and 342. [score:4]
MiR-185 and 342 Inhibit Expression of SREBPs and their Downstream Genes in Prostate Cancer Cells. [score:4]
Cell lysates were prepared from miR-185, 342, NC (miR -negative control) -transfected or non -transfected prostate cancer cells using a lysis buffer [50 mM Tris (pH 8), 150 mM NaCl, 0.02% NaN [3], 0.1% SDS, 1% NP-40 and 0.5% sodium deoxycholate] containing 1 mM phenylmethylsulfonyl fluoride and protease inhibitor cocktail (Roche Applied Science, Indianapolis, IN). [score:3]
These results suggest that miR-185 and 342 inhibited SREBP signaling through reduction of SREBP mRNA and protein and decreased the levels of fatty acid and cholesterol in prostate cancer cells. [score:3]
Next, we determined the expression of intrinsic miR-185 and 342 in various cell lines with clinical relevance, including a human normal/non-cancerous prostate epithelial cell line, RWPE-1, and LNCaP (androgen -dependent) and C4-2B (androgen-independent) prostate cancer cells. [score:3]
qRT-PCR results showed that relative expression of miR-185 and 342 was significantly decreased in prostate cancer cells compared with normal/non-cancerous RWPE-1. Lower expression of both miRNAs was observed in aggressive C4-2B compared with LNCaP cells. [score:3]
Conversely, by blocking miR-185 and 342 in prostate cancer cells, miR-185 and 342 inhibitors increased cell proliferation, colony formation, migration and invasion (Fig. S3). [score:3]
When LNCaP and C4-2B cells were transfected with miR-185 and 342, proliferation of both cell types was inhibited in comparison with miR-NC and non -transfected cells (Fig. 2A). [score:3]
These data suggest that both miR-185 and 342 suppress pathways relevant to tumorigenicity and cancer progression. [score:3]
Additionally, partial fresh tumor tissues were collected to determine the expression of miR-185 or 342 by qRT-PCR. [score:3]
Additionally, lower miR-185 and 342 expression was observed in the more aggressive C4-2B line in comparison with LNCaP. [score:3]
A, Schematic representation of the relative positions of putative miR-185 and 342 target sites in SREBP-1 and SREBP-2 mRNA 3′ UTRs. [score:3]
This finding also could be exploited for therapeutic application by co -targeting the lipogenic and cholesterogenic metabolic pathways and AR signaling using miR-185 and 342. [score:3]
Moreover, miR-185 and 342 suppressed tumorigenicity and cell growth and induced apoptosis through activation of a caspase/PARP -mediated apoptotic pathway in prostate cancer cells and mice bearing xenograft human prostate tumors. [score:3]
These findings suggest that the inhibition of subcutaneous C4-2B growth was due to miR-185 or 342 treatment. [score:3]
B, MiR-185 and 342 inhibited precursor (125 kDa) and mature (68 kDa) forms of SREBP-1 and SREBP-2, FASN, HMGCR and AR expression in LNCaP and C4-2B cells assayed by Western blot. [score:3]
B, The relative expression of miR-185 or 342 in C4-2B tumors. [score:3]
Furthermore, lower miR-185 and 342 expression is found in aggressive androgen-independent C4-2B in comparison with androgen-responsive LNCaP cells. [score:3]
It suggests that miR-185 and 342 play a tumor-suppressive role in prostate cancer. [score:3]
To determine intrinsic miR-185 and 342 expression, miRNA was prepared from cells using the mirVana™ miRNA isolation kit (Life Technologies). [score:3]
D, Expression of intrinsic miR-185 and 342 in RWPE-1, LNCaP and C4-2B cells. [score:3]
Taken together, we demonstrate for the first time that miR-185 and 342 play a tumor suppressor role via blockade of a central lipogenesis-cholesterogenesis mechanism. [score:3]
Two miRNAs, miR-185 and 342, were retrieved that potentially co -targeted 3′ UTRs of SREBP-1 and SREBP-2 mRNAs (Fig. S1A). [score:3]
To further test the specificity of miR-185 and 342 for SREBP-lipogenesis-cholesterogenesis, antisense oligonucleotides against miR-185 and 342 were used as miR-185 and 342 inhibitors. [score:3]
Furthermore, we examined the expression of SREBPs, FASN and HMGCR to correlate with intrinsic miR-185 and 342 in these cell lines. [score:3]
Figure S3 MiR-185 and 342 inhibitors induce cell proliferation, colony formation, migration and invasion. [score:2]
Additional studies are warranted to define the regulatory mechanisms involving miR-185 and 342 in prostate cancer cells. [score:2]
A combination of miR-185 and 342 did not show the significantly additive or synergistic effect on gene expression, growth, migration and invasion compared to single miRNA in prostate cancer cells (data not shown). [score:2]
MiR-185 and 342 significantly inhibited in vitro migration (Fig. 2C) and invasion (Fig. 2D) in LNCaP and C4-2B cells. [score:2]
B, MiR-185 and 342 suppressed colony formation in LNCaP and C4-2B cells compared with the control groups after 14 d miRNA transfection. [score:2]
MiR-185 and 342 also reduced AR mRNA and protein expression in prostate cancer cells (Fig. 1A and 1B). [score:2]
A, MiR-185 and 342 inhibited cell proliferation in LNCaP and C4-2B cells compared with non -transfected (−) and miR -negative control (NC) transfected cells 3 d following miRNA transfection. [score:2]
These data indicate that miR-185 and 342 are negative regulators for SREBP signaling in prostate cancer cells. [score:2]
C, Cell migration and D, invasion were significantly induced by miR-185 and 342 inhibitors in LNCaP cells compared to NC. [score:2]
MiR-185 and 342 Suppress Cell Proliferation, Clonogenicity, Migration and Invasion in Prostate Cancer Cells. [score:2]
0070987.g002 Figure 2 A, MiR-185 and 342 inhibited cell proliferation in LNCaP and C4-2B cells compared with non -transfected (−) and miR -negative control (NC) transfected cells 3 d following miRNA transfection. [score:2]
MiR-185 and 342 suppress cell proliferation, clonogenicity, migration and invasion. [score:2]
B, MiR-185 and 342 inhibitors increased colony formation in LNCaP cells compared to NC after 14 d miRNA transfection. [score:2]
To assess the potential for biological consequences elicited by miR-185 and 342, we re-expressed miR-185 and 342 in LNCaP and C4-2B cells and performed a series of functional assays relevant to tumorigenicity and cancer progression. [score:2]
Moreover, expression of intrinsic miR-185 or 342 was significantly low in prostate cancer cells compared to normal/non-cancerous epithelial cells. [score:2]
The in vivo results indicate that direct application of miR-185 and 342 to prostatic tumors can provide a therapeutic benefit in a mo del prostate cancer system. [score:2]
MiR-185 and 342 inhibit cell proliferation and induce apoptosis in subcutaneous xenografts. [score:2]
2) Intrinsic miR-185 and 342 expression is significantly decreased in prostate cancer cells compared to non-cancerous prostate epithelial cells. [score:2]
Both miR-185 and 342 significantly inhibited the growth of C4-2B tumors compared with NC -treated tumors. [score:2]
In vivo Animal ExperimentsTo examine the anti-tumor efficacy of miR-185 and 342 in vivo, six-week-old male athymic nude mice (Harlan Laboratories, Placentia, CA) were inoculated subcutaneously with 2×10 [6] C4-2B cells per mouse. [score:1]
Relative expression of both miR-185 and 342 was significantly decreased in cancer cells compared to non-cancerous RWPE-1 (Fig. 1D) as assayed by qRT-PCR. [score:1]
Tumors injected with miR-185 or 342 contained approximately 116±30-fold (miR-185, P < 0.05) or 278±59-fold (miR-342, P < 0.05) higher than the control tumors (Fig. 4B). [score:1]
C, MiR-185 and 342 decreased pro-caspase 9, 3 and PARP, and activated cleaved caspase 3 and PARP expression in LNCaP cells as assayed by Western blot. [score:1]
B, Caspase 3/7 activities were significantly increased by miR-185 and 342 in LNCaP and C4-2B cells. [score:1]
Further investigation of the expression profiles of miR-185 and 342 in human prostate tumor specimens is warranted. [score:1]
These results suggest that miR-185 and 342 induce prostate cancer cell death through activation of a caspase -dependent apoptotic mechanism. [score:1]
Also, cleaved caspase-3 and PARP, a downstream factor of caspases, were detected in miR-185 and 342 transfected cells (Fig. 3C). [score:1]
To correlate the therapeutic response with the delivery of miRNA, miRNA was isolated from fresh C4-2B tumors and the levels of miR-185 and 342 were assessed by qRT-PCR. [score:1]
To further verify if miR-185 and 342 directly bind with 3′ UTRs of SREBP-1 and SREBP-2, we performed 3′ UTR luciferase reporter assay and found that the relative 3′ UTR luciferase activities of both SREBP-1 and SREBP-2 were significantly decreased in miR-185 and 342 transfected prostate cancer cells (Fig. S1B). [score:1]
Caspase 3/7 activities were also significantly induced by miR-185 and 342 in LNCaP and C4-2B cells (Fig. 3B). [score:1]
Furthermore, to determine the effects of miR-185 and 342 on cell proliferation and apoptosis in vivo, we performed the biomarker Ki67 and cleaved PARP staining in the C4-2 tumors. [score:1]
Intratumoral Delivery of miR-185 and 342 Leads to Regression of Prostate Tumors in a Mouse Xenograft Mo del. [score:1]
Because the in vitro data demonstrated anti-tumorigenic and apoptotic roles of miR-185 and 342 in prostate cancer cells, we subsequently examined the therapeutic potential of miR-185 and 342 using a mouse subcutaneous prostate tumor xenograft mo del. [score:1]
LNCaP or C4-2B cells (6,000 cells/well) were plated on 96-well plates and transfected with miR-185, 342 or NC. [score:1]
Intratumoral delivery of miR-185 and 342 leads to regression of prostate tumors in a mouse xenograft mo del. [score:1]
Furthermore, Western blot results showed that pro-caspase 9 and 3 were decreased by miR-185 and 342 (Fig. 3C). [score:1]
Cells (1.5×10 [5] cells/well) transfected with miR-185, 342 or NC were seeded into the inside of the pre-coated upper chambers. [score:1]
The amounts of long chain fatty acids and cholesterols were determined using the Free Fatty Acid Quantification Kit and Cholesterol/Cholesteryl Ester Detection Kit (Abcam, Cambridge, MA) in cells transfected with miR-185, 342 or NC. [score:1]
To examine the anti-tumor efficacy of miR-185 and 342 in vivo, six-week-old male athymic nude mice (Harlan Laboratories, Placentia, CA) were inoculated subcutaneously with 2×10 [6] C4-2B cells per mouse. [score:1]
[1 to 20 of 87 sentences]
2
[+] score: 188
Analysis of hsa-miR185* Expression in the Replication Case-control Sample Confirmed an Inverse Correlation with TrkB-T1 ExpressionWe next analyzed the expression level of Hsa-miR-185* in the sample of 55 individuals and found a significant increase in Hsa-miR-185* expression in the suicide completers (Figure 2C, t = 2.603; df = 53, p = 0.012) compared to controls. [score:8]
Through functional analyses using silencing or exogenous expression of Hsa-miR-185*, we confirmed that TrkB-T1 expression levels can be regulated by this microRNA in vitro. [score:6]
In the current study, we have shown the functional impact of the up-regulation of Hsa-miR-185* on the reduction of TrkB-T1 expression levels. [score:6]
By focusing on individuals with extreme low TrkB-T1 levels, our study was designed to identify microRNAs that may regulate TrkB-T1 expression, and our results suggest that Hsa-miR-185* may play such a role; however, it is unclear why expression of Hsa-miR-185* is increased. [score:6]
MicroRNAs Hsa-miR-185* and Hsa-miR-491-3p were upregulated in suicide completers with low expression of TrkB. [score:6]
In this study, we presented multiple lines of evidence suggesting a role for microRNA Hsa-miR-185* in the regulation of TrkB-T1, a truncated TrkB transcript whose downregulation has been associated with suicide. [score:5]
Silencing and overexpression studies performed in human cell lines confirmed the inverse relationship between hsa-mir-185* and trkB-T1 expression. [score:5]
The embryonic renal cell line HEK293 strongly expresses TrkB-T1, so this cell line was used to observe the effects of induced Hsa-miR-185* overexpression on the levels of TrkB-T1 (Figure S2). [score:5]
Through a series of complementary experiments beginning with a global microRNA microarray screening, we show that the expression of Hsa-miR-185* is significantly increased in suicide cases with low TrkB-T1 cortical expression. [score:5]
After replicating the association between Hsa-miR-185* and TrkB-T1 brain expression in an independent and significantly larger sample, we conducted a series of functional studies showing that Hsa-miR-185* binds to TrkB-T1 3′UTR sequences and specifically affects its expression. [score:5]
Analysis of hsa-miR185* Expression in the Replication Case-control Sample Confirmed an Inverse Correlation with TrkB-T1 Expression. [score:5]
We found that both Hsa-miR-185* and TrkB-T1 are relatively well expressed in the neuronal line CRL2137, so this cell line was used to analyze the effects of Hsa-miR-185* silencing on the modulation of TrkB-T1 expression. [score:5]
Functional Analysis of Hsa-miR-185* on the Modulation of TrkB-T1 Expression in HumanMultiple human cell lines were first assessed for expression of both Hsa-miR-185* and TrkB. [score:5]
We next analyzed the expression level of Hsa-miR-185* in the sample of 55 individuals and found a significant increase in Hsa-miR-185* expression in the suicide completers (Figure 2C, t = 2.603; df = 53, p = 0.012) compared to controls. [score:4]
These results suggest that an increase of Hsa-miR-185* expression levels regulates, at least in part, the TrkB-T1 decrease observed in the frontal cortex of suicide completers and further implicate the 22q11 region in psychopathology. [score:4]
The increase of Hsa-miR-185* in frontal cortex of suicide completers was validated then confirmed in a larger, randomly selected group of suicide completers, where an inverse correlation between Hsa-miR-185* and TrkB-T1 expression was observed (R = −0.439; p = 0.001). [score:3]
CRL2137 cells from the neuronal line CRL2137 were cultured for a period of three hours and then transfected either with an antagomir that inhibits specifically Hsa-miR-185*, or alternatively, with a negative control not known to bind any mammalian RNA sequences. [score:3]
RT-PCR investigation of Hsa-miR-185* expression in frontal cortex samples of cases and controls included in the initial array study showed a positive correlation (R [2] = 0.6638 p = 0.014) with array results and validated a significant) increase of this microRNA among suicides (Figure 1D, t = 2.861, df = 6, p = 0.028), while the differential expression of Hsa-miR-491-3P was not validated by RT-PCR (Figure 1C, t = 0.9476, df = 6, p = 0.379). [score:3]
Effect of Hsa-miR-185* silencing on TrkB-T1 expression in CRL 2137 cell line. [score:3]
2. Analysis of the functional effect of Hsa-miR-185* exogenous expression on the modulation of TrkB-T1 levels. [score:3]
To ensure the specificity of Hsa-miR-185* on the 3′UTR sequence of the TrkB-T1 transcript, we quantified the expression levels of the TrkB-T2 and TrkB-FL transcripts in the HEK293 cells transfected by the Hsa-miR-185* mimic. [score:3]
Hsa-mIR- 185* binding targets were cloned into a luciferase vector to determine if we could experimentally decrease luciferase activity by co-transfection with an Hsa-mir-185* mimic. [score:3]
1. Functional analysis of Hsa-miR-185* silencing on the modulation of TrkB-T1 expression. [score:3]
# p<0.05 C: Increase of Hsa-miR-185* expression levels in BA10 from suicide completers (N = 38) and controls (N = 17) observed by t test. [score:3]
D: graph bar of the Hsa-miR-185* expression level depending on the genotypes at tSNP rs2078749. [score:3]
The current study suggests that deletions or duplications in Hsa-miR-185* could potentially impact expression levels of TrkB-T1 and lead to a psychiatric phenotype. [score:3]
In order to confirm that an interaction exists between microRNA Hsa-miR-185* and TrkB-T1, HEK293 cells, that strongly express TrkB-T1, were cultured for 24 hours and transfected with either an Hsa-miR-185* mimic, or negative control microRNA. [score:3]
Effect of Hsa-miR-185* exogenous expression on TrkB-T1 levels in HEK293 cell line. [score:3]
TrkB-T1 and Hsa-miR-185* expression levels were not associated with variation in TrkB-T1 3′UTR sequence or in the region containing DNA encoding Hsa-miR-185 microRNA (see Supporting information S1, Supporting Table S5 and Figure S3). [score:3]
The expression of these genes and their binding activity might interfere with the interaction between Hsa-miR-185* and TrkB-T1 [68] and partially contribute to the attenuate the functional effect of The Hsa-miR-185* on TrkB-T1 observed in HEK293 cells. [score:3]
Functional Analysis of Hsa-miR-185* on the Modulation of TrkB-T1 Expression in Human Cell Lines. [score:3]
Together, these results may suggest that the reduction of TrkB-T1 in frontal cortex of suicide completers results from the combined effects of altered histone methylation, decreased promoter methylation, and increased expression of of Hsa-miR-185*. [score:3]
0039301.g003 Figure 3Effect of Hsa-miR-185* silencing on TrkB-T1 expression in CRL 2137 cell line. [score:3]
E: graph bar of the Hsa-miR-185* expression level depending on the genotypes at tSNP rs2008591. [score:3]
Following transfection, RNA was extracted and expression levels of Hsa-miR-185* and TrkB-T1 were quantified by RT-PCR. [score:3]
Figure S2Basal expression levels of Hsa-miR-185* and TrkB-T1 in CRL2137 and HEK293 cells N = 3 for each condition. [score:3]
In order to determine the most accurate endogenous control for microRNA quantification, we measured the expression levels of RNU6B, RNA5S and Hsa-miR-26b as well as Hsa-miR-185* expression level on a subset of patients. [score:3]
Multiple human cell lines were first assessed for expression of both Hsa-miR-185* and TrkB. [score:3]
Hsa-miR-185* is thus a good candidate microRNA to regulate TrkB-T1 expression, and therefore, we decided to further investigate its potential role in the neurobiology of suicide. [score:2]
The luciferase assays suggested that Hsa-miR-185* might induce a small decrease of TrkB-T1 expression by binding 3′UTR sites, given the subtle but significant decreases in luciferase activity. [score:2]
The lowest coefficient of variation was found for Hsa-miR-185* expression levels normalized with RNU6B (40.9% compared to 43.1% for Hsa-miR-26b and 112.6% for RNA5S). [score:2]
We observed a significant increase of TrkB-T1 expression levels in the cells transfected by the Hsa-miR-185* antagomir (t = 5.054; df = 5, p = 0.0033) (Figure 3) compared to cells transfected with the negative control. [score:2]
No significant difference in the expression levels of TrkB-T2 and TrkB-FL was detected in the cells transfected by the Hsa-miR-185* mimetic when compared to cells transfected with a negative control. [score:2]
We cloned a 3.7 kb fragment of TrkB-T1 3′UTR sequence containing all five putative binding sites and co -transfected this construct with Hsa-miR-185* mimic or a negative control oligonucleotide in HEK293 cells. [score:1]
HEK293 cells were transfected with Mimics (Double-stranded oligonucleotide RNAs that mimic mature endogenous miRNAs) 24hours after seeding in 6 well plates - MSY0004611 and #1027280 (Qiagen), respectively for Hsa-miR-185* and negative control, at 10 nM (final concentration) and RNA extraction procedures began 24hours post-transfection. [score:1]
Hsa-miR-185* could also be rapidly degraded after cleavage by the TRBP/dicer complex [22]. [score:1]
Specifically, we performed correlative experiments to demonstrate that Hsa-mir 185* has an effect on TrkB-T1 expression, but we did not investigate why Hsa-miR-185* is decreased in the first place. [score:1]
Hsa-miR-185* and Hsa-miR-491-3P are indicated by a red square. [score:1]
Bioinformatic analyses revealed five putative binding sites for the DiGeorge syndrome linked microRNA Hsa-miR-185*in the 3′UTR of TrkB-T1, but none for Hsa-miR-491-3P. [score:1]
Hsa-miR-185* is the complementary microRNA strand form (frequently referred to as the “passenger strand”) associated with Hsa-miR-185. [score:1]
Figure S3 Analyses of Hsa-miR-185 region by sequencing on the independent replication sample composed of 17 controls and 38 suicide completers. [score:1]
In order to determine which of the five putative Hsa-miR-185* binding sites were contributing to the decrease in luciferase activity, we cloned each site in 130 to 330 bp fragments downstream to the luciferase coding sequence. [score:1]
These constructs were individually co -transfected into HEK293 cells with a Hsa-miR-185* mimic and a normalization vector in adherence to the conditions defined by Larsson et al. [34]. [score:1]
Finally, we observed a decrease of 6.6% in luciferase activity (t = 3.256; df = 10, p = 0.0086) in cells transfected with Hsa-miR-185* mimic and containing putative binding site 4300 (Figure 5). [score:1]
3. Functional analysis of the putative binding sites of Hsa-miR-185* in the 3′UTR sequence of TrkB-T1. [score:1]
0039301.g002 Figure 2Investigation of TrkB-T1 and Hsa-miR-185* expression levels in BA10 tissue from an independent replication sample composed of 17 controls and 38 suicide completers. [score:1]
D: Significant correlation between Hsa-miR-185* and TrkB-T1 expression levels in BA10 from the 55 patients investigated observed by Pearson correlation. [score:1]
Serial dilutions provided amounts ranging between 0.78125 ng and 25 ng for Hsa-miR-185* and between 0.012207 ng and 50 ng for RNU6B. [score:1]
A: Schematic representation of TrkB-T1 3′UTR sequence including the five putative binding sites for Hsa-miR-185*. [score:1]
Antagomirs MIN0004611 and #1027271 (Qiagen), respectively for Hsa-miR-185* and a manufacturer supplied negative control were transfected individually at 25 nM (final concentration), in CRL2137 cells using Hiperfect reagent (Qiagen) as recommended by the manufacturer. [score:1]
Figure S1Interaction between TrkB-T1 3′UTR sequence and Hsa-miR-185* predicited by RNA22 software. [score:1]
0039301.g005 Figure 5Functional effect of the Hsa-miR-185* on the TrkB-T1 3′UTR sequence in HEK 293 cell line. [score:1]
Hsa-miR-185* was first identified in a human neuroblastoma cell line treated with retinoic acid [44] and its locus maps to the velocardiofacial syndrome region on 22q11.2, which has been of significant interest to psychiatry because it is the region deleted in Velocardiofacial/DiGeorge’s syndrome, where ARVCF, COMT and DGCR8 genes are located. [score:1]
A: Schematic representation of SNPs found in a 1.6 kb sequence comprising the 82 sequencing coding for Hsa-mir-185, 1084 bases in the upstream and 516 in the downstream region. [score:1]
3. Functional analysis of the putative binding sites of Hsa-miR-185* in the 3′UTR sequence of TrkB-T1 Five putative binding sites for Hsa-miR-185* are present in the 5165 bp 3′UTR sequence of TrkB-T1 (Figure S1). [score:1]
In order to quantify Hsa-miR-185* microRNA, a cDNA was generated from a synthetic RNA made by IDT. [score:1]
D: Validation of Hsa-miR-185* in the microarray samples by real time PCR. [score:1]
Five putative binding sites for Hsa-miR-185* are present in the 5165 bp 3′UTR sequence of TrkB-T1 (Figure S1). [score:1]
No single individual or groups of individuals were driving the effect of the inverse correlation between Hsa-miR-185* and Trkb. [score:1]
Investigation of TrkB-T1 and Hsa-miR-185* expression levels in BA10 tissue from an independent replication sample composed of 17 controls and 38 suicide completers. [score:1]
Fragments of TrkB-T1 3′UTR sequence containing putative binding sites for Hsa-miR-185* were obtained by PCR (Supporting Table S1). [score:1]
Functional effect of the Hsa-miR-185* on the TrkB-T1 3′UTR sequence in HEK 293 cell line. [score:1]
[1 to 20 of 72 sentences]
3
[+] score: 183
Other miRNAs from this paper: hsa-mir-139, hsa-mir-122, hsa-mir-340, hsa-mir-486-1, hsa-mir-486-2
Furthermore, treatment with the miR-185 inhibitor in Huh-7 and MHCC-97 L cells increased expression of both ITGB5 and β-catenin, leading to the transcription activity of β-catenin upregulation. [score:8]
However, when ITGB5 expression was silenced, the miR-185 inhibitor failed to increase the levels of β-catenin in Huh-7 and MHCC-97 L cells, suggesting an ITGB5 -dependent mechanism of the miR-185 regulation of β-catenin expression (Fig.   6d, e, and f). [score:8]
In summary, our study indicates that ITGB5 was an important regulator in HCC and found that ITGB5, a miR-185 targeted gene, could directly interact with β-catenin and inhibit its degradation, leading to WNT/β-catenin activity. [score:7]
The results revealed that both miR-271 and miR-185 suppressed the expression of luciferase, with miR-185 showing the strongest inhibitory effect (Fig.   5b). [score:7]
In these assays, the miR-185 inhibitor also efficiently suppressed the expression of miR-185 (Additional file  1: Figures S1C and S1D). [score:6]
Through combined analyses from web -based miRNA resources (miRanda and TargetScan), we identified 6 top candidate miRNAs that might regulate ITGB5 expression, including miR-122, miR-486-5p, miR-139, miR-340, miR-271, and miR-185 (Fig.   5a). [score:6]
However, when the expression of ITGB5 or β-catenin was knocked down, the stimulatory effect of the miR-185 inhibitor was compromised (Fig.   6g and h). [score:6]
Furthermore, treatment with the miR-185 inhibitor resulted in elevated ITGB5 expression in both Huh-7 and MHCC-97 L cells (Fig.   5e and f). [score:5]
g–h miR-185 inhibitor was transfected into MHCC-97 L and Huh-7 with or without ITGB5 or β-catenin knockdown. [score:4]
miR-185 regulates ITGB5 expression. [score:4]
The downregulation of miR-185 in HCC cells promotes an increase in ITGB5. [score:4]
An additional increase of ITGB5 is associated with β-catenin upregulation and a miR-185 decrease in HCC tissues. [score:4]
Subsequently, we also found that ITGB5 is a direct targeted gene of miR-185. [score:4]
An increase of ITGB5 was associated with β-catenin upregulation and a decrease in miR-185 in HCC tissues. [score:4]
Nonetheless, the reason for the downregulation of miR-185 in HCC still remains to be discovered in the future. [score:4]
Similarly, in transwell assays, the miR-185 inhibitor promoted cell migration, in which process the expression of ITGB5 and β-catenin was also required (Fig.   6i and j). [score:4]
d–f miR-185 inhibitor was transfected into MHCC-97 L and Huh-7 cells with or without ITGB5 knockdown. [score:4]
e Correlation analyses of miR-185 levels and ITGB5 expression in 30 HCC tissues. [score:3]
With these clinical data, we examined the association of miR-185 expression with the level of ITGB5 and observed significant reverse correlation (Fig.   7e). [score:3]
Fig. 7Decreased miR-185 levels in HCC are associated with ITGB5 protein expression. [score:3]
As miR-185 showed the strongest inhibition on ITGB5 levels, we picked this miRNA for further studies. [score:3]
In subsequent luciferase activity assays, the binding mutations conferred this construct resistance to miR-185 mimic -mediated inhibition of the luciferase activity (Fig.   5j and k). [score:3]
Thus, Our data uncover that the miR-185-ITGB5-β-catenin pathway plays an important role in HCC tumorigenesis, and ITGB5 may be a promising specific target for HCC therapy. [score:3]
j–k The wild type 3′UTR (WT) and mutated 3′UTR (MUT) of ITGB5 were transfected into Huh-7 and MHCC-97 L cells with or without miR-185 overexpression. [score:3]
The high expression of miR-185 in HCC tissues was defined to more than 2 fold higher than in normal tissues. [score:3]
Mimics and inhibitors of miRNA-185 were synthesized by the Genepharma Company (Shanghai, People’s Republic of China). [score:3]
Consistently, in MHCC-97 L cells, the miR-185 mimic also efficiently suppressed ITGB5 levels (Fig.   5d). [score:3]
l The wild type 3′UTR (WT) of ITGB5 was transfected into Huh-7 and MHCC-97 L cells with or without miR-185 inhibition. [score:3]
Our data reveal that the miR-185-ITGB5-β-catenin pathway plays an important role in HCC tumorigenesis, and ITGB5 may be a promising specific target for HCC therapy. [score:3]
The results showed that miR-185 mimic significantly inhibited the luciferase activities in the full length and 0–500 fragment groups, but the activity was not altered in the 500–1166 fragment group (Fig.   5h). [score:3]
In addition, our findings implied that miR-185 participated in the mediation of the cell growth and migration in HCC by directly regulating ITGB5. [score:3]
Among the 6 miRNAs, both miR-271 and miR-185 suppressed the luciferase activity of ITGB5 3′UTR, and miR-185 decreased the protein level of ITGB5 most significantly. [score:3]
On the contary, inhibition of endogenus miR-185 elevated the luciferase activity (Fig.   5l). [score:3]
a Expression levels of miR-185 in HCC tissues and adjacent normal tissues were analysed by Q-PCR. [score:3]
h The different truncations were respectively transfected into MHCC-97 L cells with or without miR-185 overexpression. [score:3]
Previously, miR-185 has been demonstrated to be a key suppressor in HCC [36, 37], which was similar with our result. [score:3]
c The inhibition of b-catenin/TCF/LEF -mediated transcription by miR-185 in MHCC-97 L and Huh-7 cells was monitored. [score:3]
e–f miR-185 inhibitor was transfected into Huh-7 and MHCC-97 L cells. [score:3]
In these assays, the miR-185 mimic dramatically upregulated the levels of miR-185 (Additional file  1: Figure S1B). [score:3]
These results indicate that miR-185 regulates the growth and migration of HCC cells through effects on ITGB5 and β-catenin. [score:2]
ITGB5, negatively modulated by miR-185, promoted tumour growth and migration by regulating β-catenin stability in vitro and in vivo. [score:2]
miR-185 regulates β-catenin through ITGB5. [score:2]
control We compared the expression levels of miR-185 in HCC specimens and adjacent normal tissues. [score:2]
In the following colony formation assays, the miR-185 inhibitor increased the number of colonies. [score:2]
As shown in Fig.   7a, the expression of miR-185 was significantly decreased in HCC tissues compared to in normal adjacent samples. [score:2]
The expression level of ITGB5 mediated by miR-185 was confirmed by bioinformatic analysis, luciferase assay. [score:2]
We next examined whether miR-185 regulates the levels of β-catenin. [score:2]
Decreased miR-185 levels in HCC. [score:1]
c–d miR-185 and miR-271 were introduced into Huh-7 cells. [score:1]
To examine the influence of miR-271 and miR-185 on endogenous ITGB5 levels, we treated Huh-7 cells with the corresponding miRNA mimics. [score:1]
By the comparison of sequence similarity between miR-185 and the sequence 0–500 of the ITGB5 3′UTR region, we speculated the binding site of miR-185 and generated the corresponding binding mutant for miR-185 on the pSICHEK2-luciferase construct (Fig.   5i). [score:1]
Therefore, our data indicated that miR-185-ITGB5-β-catenin pathway may play an important role in HCC tumorigenesis. [score:1]
a–b miR-185 was introduced into MHCC-97 L and Huh-7 cells. [score:1]
When Huh-7 and MHCC-97 L cells were treated with the miR-185 mimic, a concurrent decrease of ITGB5, β-catenin protein levels and the transcript activity of β-catenin was observed (Fig.   6a–c). [score:1]
These observations suggest that the binding site of miR-185 to the 3′UTR region of ITGB5 is located within the sequence 0–500 of the ITGB5 3′UTR region. [score:1]
The effect of miR-185 inhibitor on b-catenin/TCF/LEF -mediated transcription was measured. [score:1]
Integrin-β5 β-catenin miR-185 Hepatocellular carcinoma Hepatocellular carcinoma(HCC) accounts for most (85 to 90%) of the primary liver cancers and ranks as the second leading cause of cancer-related death in men. [score:1]
b The 3′UTR of ITGB5 was constructed into a pSICHECK2 vector and was cotransfected with miR-122, miR-486-5P, miR-139,miR-271 and miR-185 individually. [score:1]
i Sequences of ITGB5 3′UTR and the potential miR-185 binding site at the 3′ UTR of ITGB5 as well as nucleotides mutated in the 3′ UTR of ITGB5, where the red indicates the mutated region. [score:1]
[1 to 20 of 59 sentences]
4
[+] score: 151
Other miRNAs from this paper: hsa-mir-21
Most effective sites map to 3′ untranslated regions (3′ UTRs) and pair perfectly with the miRNA seed (nucleotides 2–7), with an additional pair at nucleotide 8 and/or an A across from nucleotide 1. Using in silico analysis (TargetScanHuman v. 5) to predict the target gene of miR-185, we identified two binding sites into 3′-UTR of the GPx-1 gene (Fig.   3b). [score:7]
We have found that OG increases miR-185 expression, a phenomenon that convincingly leads to a decreased expression of its target GPx-1. MIR185 cytogenetic location was found by genomic sequence analysis; Wang et al. (2013) [27] mapped the gene within the first intron of the C22ORF25 gene (also known as Transport and golgi organization 2 homolog, Tango2) on chromosome 22q11.21 in sense orientation. [score:7]
Knockdown of miR-185, using anti-miR-185 inhibitor, was accompanied by a significant upregulation of GPx-1 in oscillating glucose. [score:7]
miR-185 expression is upregulated by OG. [score:6]
To define the effects of miR-185 on GPx-1 gene regulation, miR-185 expression was silenced using the miR-185 Anti-miR™ miRNA inhibitor. [score:6]
In anti-miR-185 inhibition transfection to knockdown miR-185, we noticed a significant inverted tendency in GPx-1 protein levels (Fig.   4c), suggesting that GPx-1 was modulated specifically by OG and could be a real target for miR-185. [score:6]
Endogenous expression, mimic and inhibition of miR-185. [score:5]
HUVEC cultures were used to confirm glucose’s causal role on the expression of miR-185, its target mRNA and protein and finally the activation of antioxidant response. [score:5]
has-miR-185-5p mirVana [®] miRNA mimic (MC12486), Anti-miR™miRNA-185 inhibitor (AM12486), an antisense miR-185, and scrambled Anti-miR™miRNA inhibitor negative control (AM17010) was purchased from Ambion (Foster City, CA, USA). [score:5]
Recent experimentally validated targets for miR-185, such as Camk2d, Ncx1, and Nfatc3 have been related to cardiac diseases [29, 30]. [score:5]
Because GPx-1 expression, with respect to NG, was unchanged in OG and increased in HG, we explored the effects of miR-185 on GPx-1 target gene. [score:5]
Symbols over the bars refer to differences between the conditions shown under the bars ([§]p < 0.05, [§§§]p < 0.001) It was first addressed whether miR-185 expression was regulated in response to different glucose levels. [score:4]
Our study shows for the first time that the exposure of endothelial cells to OG produces an impaired antioxidant response, in particular, that the upregulation of miR-185 contributes to GPx-1 inappropriate response in OG. [score:4]
RNA hybrid analysis of GPx-1 3′-UTR offered further support for direct binding of miR-185 to the site; the predicted binding of miR-185 on GPx-1 3′-UTR had highly favorable predicted minimum free energy scores of ΔG (Gibbs free energy) = −23.4 kcal/mol, consistent with known miRNA targeting [17]. [score:4]
Glucose oscillations may exert more deleterious effects on the endothelium than high glucose, likely due to an impaired response of GPx-1, coupled by the upregulation of miR-185. [score:4]
OG -induced upregulation of miR-185 was associated with unchanged levels of GPx-1, as detected by q-PCR and Western blot (Fig.   1a–c). [score:4]
Recently, microRNA-185 (miR-185) has been related to altered expression of selenoproteins, including altered GPx-1 [13], but its direct binding did have not yet been reported. [score:4]
Moreover, IL-10Rα was found a direct target of miR-185, demonstrating a further role in inflammation [31]. [score:4]
a q-PCR of miR-185 in HUVECs cultured in OG, HG and NG, following transfection with inhibitor of miR-185. [score:3]
In mouse was detected highest relative miR-185 expression in liver and has been related to lipid metabolism [27]. [score:3]
Although the target prediction was based on poorly conserved site analysis, the mature miR-185 stranded with the seed region in a perfect alignment between nucleotides 2–7 (Fig.   3b). [score:3]
In OG, miR-185 expression significantly increased vs NG (p < 0.001) and HG (p < 0.01), while it was unchanged in NG and HG (Fig.   3a). [score:3]
b Number of viable cells in cell suspensions with anti-miR-185 inhibitor. [score:3]
Transfections of miRNA-185 inhibitors were performed at least three times in triplicate using INTERFERin [®] transfection reagent according to the manufacturer’s protocol (POLYPLUS-transfection, NY, USA). [score:3]
d GPx activity in HUVECs during miR-185 inhibition in scrambled sample during NG, OG and HG. [score:3]
8-OHdG 8-hydroxy-2′-deoxyguanosine CAT catalase EBM-2 endothelial basal medium GPx glutathione peroxidases GPx-1 glutathione peroxidases-1 γ-H2AX phosphorylated form of H2AXH [2]O [2] hydrogen peroxide HG high glucose HUVECs human umbilical vein endothelial cells microRNAs miRNAs miR-185 microRNA-185 MRE microRNA recognition element NG normal glucose OG oscillating glucose ROS reactive oxygen species RLU relative light unit SOD-1 copper zinc SOD SOD-2 manganese SOD 3′ UTRs un-translated regions LLS contributed to: conception and design of the study, acquisition, analysis and interpretation of data wrote manuscript and approved the manuscript submission. [score:3]
Computational analyses predict GPx-1 as miR-185′s target. [score:3]
a Mean expression values of intracellular miR-185 in OG, HG and NG. [score:3]
In the present study we confirmed the Targetscan in silico predictions demonstrating for the first time a specific and significant interaction between GPx-1 3′UTR and miR-185 using luciferase assay. [score:2]
In vitro luciferase assays confirmed computational predictions targeting of miR-185 on 3′-UTR of GPx-1 mRNA. [score:2]
A critical involvement of oscillating glucose -induced miR-185 in the dysregulation of endogenous GPx-1 was found. [score:2]
In this study we sought to determine whether oscillating glucose differentially modulates antioxidant response, and to elucidate the potential regulatory mechanisms exerted by the microRNA-185 (miR-185). [score:2]
HUVEC 5 × 10 [4] cells passage 4 (p4) were transiently co -transfected with 3′-UTR-GPx-1 expression vector firefly luciferase reporter assay (Origene, MD, USA), containing the entire 217 bp GPx-1 3′-UTR together with miRNA-185 mimic sequence, using jetPRIME co-transfection reagent following manufacturer’s instructions (POLYPLUS). [score:2]
Fig.  4Knock-down of miR-185 under high and oscillating glucose. [score:2]
The transfection efficiencies, assessed by measuring miR-185 expression in q-PCR (Fig.   4a), were ≥80 %. [score:1]
Endogenous GPX-1 levels are differentially modulated in OG rather than HG by miR-185. [score:1]
As controls, cells were transfected with empty vector (pMIR) alone, and with pMIR with miRNA-185 mimic sequence. [score:1]
miR-185 interacts with GPx-1 3′-UTR. [score:1]
Bioinformatic tool was used to predict the link between miR-185 on 3′UTR of GPx-1 gene. [score:1]
Our study suggests a key role of miR-185 in the dangerous effects of OG. [score:1]
Fig.  3Oscillating glucose -induced miR-185 modulates cellular antioxidant response to oxidative stress. [score:1]
Deletion of this region it has been associated with Di George syndrome, and consequently loss of miR-185 contributes to the cardiac defects in the syndrome [28]. [score:1]
c Western blot analysis of GPx-1 with or without anti-miR-185 during NG, OG and HG. [score:1]
We also measured GPx activity during inhibition of miR-185 and found an increased activity in OG in respect to HG (p < 0.05, Fig.   4d). [score:1]
Our results demonstrated that the intracellular levels of miR-185 in transfected samples (Fig.   4a) were reduced in a significant manner (OG vs NG, p < 0.01; OG vs HG, p < 0.001; Fig.   4a). [score:1]
We transfected 1 nmol/l of anti-miR-185 in HUVECs at the end of culture in NG, OG and HG (Fig.   4a). [score:1]
Oscillating glucose miR-185 Antioxidant defense GPx-1 Oxidative stress It has recently been suggested that glucose variability may be an independent risk factor for vascular complications of diabetes [1, 2]. [score:1]
MultiScribe Reverse Transcriptase was used for RT-PCR, and TaqMan primers for hsa-miR-185 (assay ID 002271) were used to monitor miR-185 expression. [score:1]
Therefore, in this work, we sought to evaluate the possible modulation carried out by miR-185 during glucose oscillations on GPx-1 expression. [score:1]
Co-transfection of HUVEC with GPx-1 3′UTR and miR-185 resulted in a significant down regulation of the luciferase light emission (RLU, Relative Light Unit) compared to cells co -transfected with pMIR alone (p < 0.05), and with pMIR plus mimic miR-185 (p < 0.05) (Fig.   3c). [score:1]
Table 1 List of primers Gene Sequence Accession number GPx-15′-CCCAGTCGGTGTATGCCTTC-3′5′-AGCATGAAGTTGGGCTCGAA-3′ NM_000581.2 SOD-25′-GGCCTACGTGAACAACCTGA-3′5′-CAGGACGTTATCTTGCTGGG-3′ NM_001024465 SOD-1 Hs00533490_m1 NM_000454.4 CAT Hs00156308_m1 NM_001752.3 ACTB Hs99999903_m1 NM_001101.3 miR-185 expression was examined with the TaqMan MicroRNA Assay Kit (Applied Biosystems, Life Technologies, Grand Island, NY, USA). [score:1]
[1 to 20 of 51 sentences]
5
[+] score: 141
Collectively, these data indicate that the down-regulated miR-185 expression is related to high levels of DNMT1 expression, which may be associated the development of glioma and support the notion that miR-185 directly targets DMNT1 mRNA, thereby regulating the expression of DNMT1 in glioma cells. [score:15]
Therefore, the down-regulated expression of miR-185 and up-regulated expression of DNMT1 contribute to aberrant DNA methylation and in turn to gliomagenesis. [score:11]
In addition, we found loss of heterozygosity (LOH) at the miR-185 locus located in the 22q11.2 in glioma and induction of miR-185 over -expression reduced global DNA methylation and induced the expression of the promoter-hypermethylated genes in glioma cells by directly targeting the DNA methyltransferases 1. These comprehensive data may provide new insights into the epigenetic pathogenesis of human gliomas. [score:8]
Our data indicated that miR-185 directly interacted with the DNMT1 and the lower levels of miR-185 expression in glioma may be one of the reasons for the abnormal expression of DNMT1, which leads to aberrant DNA methylation, contributing to the development of human glioma. [score:7]
More importantly, our findings indicate that miR-185 can directly target DNMT1, thereby leading to a reduction in global DNA methylation (GDM) and regulating the expression of the promoter-hypermethylated genes in glioma cells. [score:7]
Previously studies have reported that microRNA-185 expression is down-regulated in glioma [44, 45]. [score:6]
These data indicated that miR-185 directly interacted with the DNMT1 and the lower levels of miR-185 expression promoted the abnormal expression of DNMT1 in glioma. [score:6]
However, the mechanism underlying down-regulated miRNA-185 expression in glioma is uncovered. [score:6]
Furthermore, transfection with miR-185 significantly reduced the levels of DNMT1 mRNA transcripts and protein expression in glioma cells (Figure 5C and 5D), but did not affect the expression of DNMT3A and DNMT3B (data not shown). [score:5]
However, whether and how miR-185 could regulate DNMT1 expression and affect the genomic DNA methylation, contributing to the development of human glioma, has not been systemically explored. [score:5]
In addition, over -expression of miR-185 re-activated the expression of the promoter-hypermethylated genes in glioma cells. [score:5]
Over -expression of miR-185 reduces global DNA methylation and induces the expression of the promoter-hypermethylated genes. [score:5]
In this study, we found that the expression of miR-185 was significantly down-regulated in glioma, as compared with that in non-tumor brain tissues. [score:5]
We found that transfection with miR-185 and the DNMT1 complementary sequence, but not the mutant with deletion of the miR-185 binding sequence, dramatically reduced luciferase activity in glioma cells, and the levels of DNMT1 expression were inversely correlated with the levels of miR-185 expression in gliomas. [score:5]
Our data indicate that low levels of miR-185 expression are associated the aberrant activation of DNMT1 and global DNA hypermethylation, contributing to the development of human glioma. [score:4]
For example, U251 cells displayed relatively higher methylation in the PCDHA8, ANKDD1A, GAD1, HIST1H3E, PHOX2B, SIX3, and SST genes, and transfection of U251 with miR-185 reduced the methylation levels of these gene promoters and increased the expression levels of these genes. [score:3]
The DNMT1 has been thought to be a putative target of miR-185 [48] (Figure 5A). [score:3]
The difference in the levels of methylation between glioma samples and non-tumor subjects was analyzed by One-way ANOVA, and the difference in the levels of gene expression and miR-185 in different cell lines and tissue samples was analyzed by Student's t-test using SPSS 10.0. [score:3]
Thus, the reduced levels of miR-185 expression may be associated with the loss of 22q11.2 in glioma. [score:3]
DNTM1 is the target of miR-185. [score:3]
Furthermore, SF126 cells had higher methylation in the PCDHA8, ANKDD1A, GAD1, HIST1H3E and PHOX2B, but lower methylation in the PCDHA13, SIX3, and SST genes, and transfection of the cells with miR-185 only changed the methylation and expression levels of the PCDHA8, ANKDD1A, GAD1, HIST1H3E, and PHOX2B genes, but did not affect the low methylated PCDHA13, SIX3, and SST genes. [score:3]
Figure 5 MicroRNA-185 targets DNMT1 mRNA at the 3'-UTR. [score:2]
These data support that the loss of miR-185 is also a frequent event in glioma and suggest that loss of miR-185 may contribute to the development of human glioma. [score:2]
Figure 6 MicroRNA-185 reduces the levels of GDM and induces the expression of the promoter-hypermethylated genes. [score:2]
Moreover, the LOH status was found at the miR-185 locus located in the 22q11.2. [score:1]
Whether the miR-185 locus in the 22q11.2 in glioma could be subjected to the LOH in glioma is still unknown. [score:1]
The miR-185 can induce cell cycle arrest in human non-small cell lung cancer [61]. [score:1]
As shown in Figure 5B, significantly reduced levels of luciferase activities were detected in the cells transfected with the DNMT1 complementary sequences and miR-185, but not in the cells with the mutant sequence and miR-185, indicating that the DNMT1 complementary sequence contained the binding site for miR-185. [score:1]
U251 cells were co -transfected with firefly luciferase constructs containing the DNMT1 wild-type or mutated 3-UTRs and miR-185 or scrambled oligonucleotides, respectively. [score:1]
Figure 4 Microsatellite analysis of the miR-185 locus in 22q11.2 in glioma and paired blood samples. [score:1]
Further analysis of the promoter-hypermethylated genes revealed that transfection with miR-185 mimics significantly reduced the frequency of methylation in these gene promoters (Figure 6B), accompanied by elevating the relative levels of mRNA transcripts of those genes in the cells (Figure 6C). [score:1]
Given that low levels of miR-185 were associated with higher levels of DNMT1, a key factor for the maintenance of global DNA methylation in mammal cells, we further investigated whether the enforced expression of miR-185 could functionally modulate DNA hypermethylation in glioma cells. [score:1]
Deletion of genomic interval encompassing miR-185 (22q11.2) is an extremely frequent event in diverse types of cancers [46, 47]. [score:1]
Glioma cells were transfected with miR-185, si-DNMT1 or controls for 48 h. The levels of DMNT1 mRNA transcripts were determined by Real time PCR. [score:1]
Microsatellite markers and LOH analysis of the miR-185 locus. [score:1]
Apparently, the modulation effects of miR-185 were dependent on the methylation status of individual gene promoters in each cell line. [score:1]
U251, SF126, and SF767 cells were transfected with miR-185 mimics (miR-185M), si-DNMT1, or controls for 48 h and the levels of GDM were determined by HPLC-DAD. [score:1]
The microRNA-185 is predicted to bind to the 3' UTR of DNA methyltransferases 1 (DNMT1). [score:1]
To demonstrate this in glioma cells, the DNMT1 complementary sequence or the mutant with a deletion of 4 nucleotides (UCUC) for the predicted binding of miR-185 were cloned downstream of the firefly luciferase gene. [score:1]
Loss of heterozygosity at the miR-185 locus located in the 22q11.2 in glioma. [score:1]
We also generated a mutant with 4 bp deletion (TCTC) at the potential binding sequence of miR-185 of the 3'UTR of the DNMT1 gene. [score:1]
[1 to 20 of 41 sentences]
6
[+] score: 137
Other miRNAs from this paper: hsa-mir-24-1, hsa-mir-24-2, hsa-mir-155
Overexpression of miR-185 significantly decreased the mRNA expression of c-Met when compared with the controls, whereas inhibition of miR-185 resulted in an increase in c-Met mRNA expression in MCF7 (Fig. 4A) and SKBR3 (Fig. 4B) cells. [score:8]
Furthermore, a previous study demonstrated that miR-185 targeted the expression of RhoA and Cdc42, and inhibited the proliferation potential of human colorectal cells (20). [score:7]
Upregulation of miR-185 expression reduced the intensity of EGFP in the cells transfected with a vector containing the c-Met 3′-UTR when compared with the control groups, whereas in the miR-185 inhibitor group, the intensity of EGFP in the MCF7 and SKBR3 cells increased significantly (Fig. 4E and F). [score:7]
To determine whether miR-185 targeted c-Met in vitro, the MCF7 cells were transfected with miR-185 mimics or an inhibitor, and the mRNA expression of c-Met was detected using qPCR. [score:7]
demonstrated that overexpression of miR-185 resulted in an evident decrease in c-Met protein expression, while a reduction in miR-185 markedly increased the protein expression of c-Met in the MCF7 (Fig. 4C) and SKBR3 cells (Fig. 4D). [score:7]
Moreover, miR-185 was demonstrated to inhibit the proliferation of breast cancer cells by regulating the expression of c-Met, which indicates the therapeutic potential of miR-185 in breast cancer treatment. [score:6]
In the present study, for the first time, miR-185 was demonstrated to inhibit the proliferation of breast cancer cells by regulating the expression of c-Met. [score:6]
qPCR analysis indicated that the expression level of miR-185 was clearly downregulated in the cancer tissues when compared with the corresponding non-tumor samples (Fig. 1A). [score:5]
In the present study, the revealed that overexpression of miR-185 significantly inhibited the proliferation of MCF7 and SKBR3 cells. [score:5]
A significant downregulation in the expression level of miR-185 was observed in the breast cancer cell lines when compared with the normal cell line (Fig. 1B). [score:5]
The data indicated that overexpression of miR-185 significantly inhibited MCF7 cell proliferation (Fig. 2A). [score:5]
In addition, human breast cancer cells transfected with an miR-185 inhibitor exhibited increased proliferation, indicating that miR-185 inhibited the proliferation of breast cancer cells in vitro. [score:5]
In addition, transfection with miR-185 mimics resulted in decreased luciferase activity and c-Met expression in breast cancer cells, indicating that c-Met is the target gene of miR-185. [score:5]
To investigate the mechanism by which miR-185 inhibits cell proliferation in breast cancer tissues, putative miR-185 targets were analyzed using the miRanda, TargetScan and PicTar software. [score:5]
In conclusion, miR-185 was found to be significantly downregulated in breast cancer tissues. [score:4]
These results indicated that miR-185 regulated the mRNA and protein expression levels of c-Met. [score:4]
miR-185 is downregulated in breast cancer tissue. [score:4]
Collectively, these results demonstrated that miR-185 inhibited breast cancer cell proliferation in vitro. [score:3]
The results of the present study demonstrated that overexpression of miR-185 promoted the apoptosis of MCF7 and SKBR3 cells. [score:3]
In addition, the MCF7 cells were transfected with an miR-185 inhibitor and were found to exhibit increased proliferation, as demonstrated by an (Fig. 2B). [score:3]
The results indicated that overexpression of miR-185 led to a significant increase in the apoptosis rates of MCF7 (Fig. 3A) and SKBR3 (Fig. 3B) cells. [score:3]
These results indicated that expression levels of miR-185 are decreased significantly in breast cancer tissues and cell lines. [score:3]
At 48 h post-transfection with the miR-185 mimics/inhibitor or control, the cells were washed with phosphate-buffered saline (PBS), detached with trypsin and harvested. [score:3]
Overexpression of miR-185 promotes breast cancer cell apoptosis. [score:3]
MCF7 cells were seeded into 48-well plates and cotransfected with mimic control, miR-185 mimics or miR-185 inhibitor. [score:3]
c-Met is a target of miR-185 in breast cancer cells. [score:3]
Fluorescent reporter assays were performed to determine whether c-Met was a direct target of miR-185. [score:3]
Analyses of ovarian cancer, pediatric renal tumor and prostate cancer cases have revealed a decreased expression of miR-185, which may be involved in tumor initiation and progression (11, 12). [score:3]
These results indicated that miR-185 binds to the 3′-UTR of c-Met directly. [score:2]
Two breast cancer cells lines, MCF7 and SKBR3, were transfected with miR-185 mimics and the apoptosis rate was analyzed using annexin V/propidium iodide staining. [score:1]
Among numerous miRNAs, miR-185 stands out as an important molecule. [score:1]
The 3′-UTR of c-Met, containing the putative miR-185 binding sites, was identified. [score:1]
To investigate the clinical relevance of miR-185 in human breast cancer, miR-185 expression was analyzed in 24 paired breast cancer and adjacent non-tumor tissues. [score:1]
However, the biological function and underlying molecular mechanisms of miR-185 in breast cancer have not been fully elucidated. [score:1]
Effects of miR-185 on breast cancer cell proliferation. [score:1]
The 3′-UTR of c-Met with the predicted binding site for miR-185 was cloned into a fluorescent reporter vector. [score:1]
[1 to 20 of 36 sentences]
7
[+] score: 127
Other miRNAs from this paper: mmu-mir-182, mmu-mir-185, hsa-mir-182
Furthermore, the significant suppression of both endogenous mRNA and protein expression of SLC30A1, SERPINB2 or AKR1C1 in A549 and H446 cells was verified by transfection of cells with miR-182 or miR-185 mimic (all P < 0.01), and this microRNA -induced suppression of gene expression could be rescued when the specific miRNA inhibitor was co -transfected (Figure 3a– 3c). [score:11]
Figure 6Aberrant expression of SLC30A1 a. SERPINB2 b. and AKR1C1 c. in human lung cancer and paired normal tissues (up panel, squamous cell carcinoma and lower panel, adenocarcinoma) Data were retrieved from the TCGA database Data were retrieved from the TCGA database In the present study, we showed that down-regulation of miR-182 and miR-185 in HBE cells exposed to DMSO extracts of PM [2.5] resulted in increased SLC30A1, SERPINB2 and AKR1C1 gene expression and ectopic expression of these genes can respectively lead to neoplastic transformation in NIH3T3 cells. [score:10]
We then examined the correlation between the expression of microRNAs and mRNAs to predict the potential targets of microRNAs and found 3 genes, SLC30A1, SERPINB2 and AKR1C1, whose expression was inversely correlated with miR-182 and (or) miR-185 expression (Figure 1c). [score:9]
The upregulation of SLC30A1, SERPINB2 and AKR1C1 and downregulation of miR-182 and miR-185 in HBE cells exposed to PM [2.5] extract detected by microarray were further confirmed by using quantitative real-time PCR (qRT-PCR) and Western blot assays (Supplementary Figure S1a and S1b). [score:6]
We also detected depressed expression of miR-182 and perhaps miR-185 in human subjects exposed to high level of PM [2.5] and overexpression of SLC30A1, SERPINB2 and AKR1C1, which we have first demonstrated to be target genes of miR-182 and/or miR-185, in human lung cancer compared with the corresponding normal lung tissues. [score:6]
Figure 1Altered global microRNA a. and mRNA b. expression in human bronchial epithelial cells exposed to DMSO extracts of airborne PM [2.5], and potential interactions between microRNAs and mRNAs suggested by integrate and in silico analysis c. The experimental conditions are described in Materials and Methods SLC30A1, SERPINB2 and AKR1C1 are bona fide target genes of miR-182 or miR-185To test whether SLC30A1, SERPINB2 and AKR1C1 are bona fide targets of miR-182 or miR-185, a series of assays were conducted. [score:6]
Among them, overexpression of SLC30A1, SERPINB2 as well as AKR1C1, mediated by downregulation of miR-182 and (or) miR-185, can induce neoplastic transformation in NIH3T3 cells. [score:6]
The most significant finding in the present study is that we identified at the first time that miR-182 and miR-185 are target regulators of SLC30A1, SERPINB2 or AKR1C1 that function as potential oncogenes because they were able to induce neoplastic transformation in NIH3T3 cells and were overexpressed in human lung cancer. [score:6]
Mutations in the core microRNA binding sites are shown e Figure 3Suppression of endogenous mRNA (up panel) and protein (lower panel) of SLC30A1 a. SERPINB2 b. and AKR1C1 c. in A549 and H446 cells transfected with miR-182 mimic, miR-185 mimic or their inhibitor. [score:6]
Mutations in the core microRNA binding sites are shown e Figure 3Suppression of endogenous mRNA (up panel) and protein (lower panel) of SLC30A1 a. SERPINB2 b. and AKR1C1 c. in A549 and H446 cells transfected with miR-182 mimic, miR-185 mimic or their inhibitor. [score:6]
Mutations in the core microRNA binding sites are shown e. Suppression of endogenous mRNA (up panel) and protein (lower panel) of SLC30A1 a. SERPINB2 b. and AKR1C1 c. in A549 and H446 cells transfected with miR-182 mimic, miR-185 mimic or their inhibitor. [score:6]
MiR-185 seems to be a tumor suppressor and is frequently downregulated in many types of human cancer [24– 26]. [score:5]
These results suggested that SLC30A1, SERPINB2 and AKR1C1 may be regulatory targets for miR-182 and miR-185. [score:4]
Figure 1Altered global microRNA a. and mRNA b. expression in human bronchial epithelial cells exposed to DMSO extracts of airborne PM [2.5], and potential interactions between microRNAs and mRNAs suggested by integrate and in silico analysis c. The experimental conditions are described in Materials and Methods To test whether SLC30A1, SERPINB2 and AKR1C1 are bona fide targets of miR-182 or miR-185, a series of assays were conducted. [score:4]
*, P < 0.05 compared with vector control Figure 5Xenograft tumor formation in nude mice of NIH3T3 cells ectopically and stably expressing SLC30A1, SERPINB2, AKR1C1, or vector control a. Histological analysis showed that all tumor cells had similar morphology and were diagnosed as fibrosarcoma b. Immunohistochemical staining c. demonstrated a high expression of SLC30A1 (up panel) or SERPINB2 (lower panel), respectively, in tumors induced by each of these two genes Reduced expression of miR-182 and miR-185 in human subjects exposed to PM [2.5]Plasma miR-182 and miR-185 were measured in 109 subjects living at the same region (Wuhan, China) but exposed to different levels of PM [2.5] and PM [10] monitored by personal sampler for 24 h. The median levels of individuals' exposure to PM [2.5] and PM [10] were 124.8 μg/m [3] and 179.3 μg/m [3], respectively, with the ranges of 18.7 to 274.2 μg/m [3] for PM [2.5] and 39.8 to 383.3 μg/m [3] for PM [10] (Supplementary Table S1). [score:4]
Depression of plasma miR-182 and miR-185 in subjects exposed to high levels of PM [2.5] and overexpression of SLC30A1, SERPINB2 and AKR1C1 in human lung cancer tissues were detected. [score:3]
Reduced expression of miR-182 and miR-185 in human subjects exposed to PM [2.5]. [score:3]
These results provided further evidence that SLC30A1, SERPINB2 and AKR1C1 are respective bona fide target genes of miR-182 or miR-185 in human cells. [score:3]
Relative activity of reporter gene constructed with wild type of 3′UTR of SLC30A1 a. SERPINB2 b. or AKR1C1 c. gene or their mutant types d. cotransfected with miR-182 or mir-185 or their inhibitors in A549 and H446 cells. [score:3]
We also observed reduced levels of plasma miR-182 and perhaps miR-185 in human subjects exposed to high levels of PM [2.5] compared with those exposed to low levels of PM [2.5] residing at the same region, directly connecting PM [2.5] exposure to microRNA expression in vivo. [score:3]
SLC30A1, SERPINB2 and AKR1C1 are bona fide target genes of miR-182 or miR-185. [score:3]
Figure 2Relative activity of reporter gene constructed with wild type of 3′UTR of SLC30A1 a. SERPINB2 b. or AKR1C1 c. gene or their mutant types d. cotransfected with miR-182 or mir-185 or their inhibitors in A549 and H446 cells. [score:3]
In the present study, we identified SLC30A1, SERPINB2 and AKR1C1 as potential oncogenes targeted by miR-182 and (or) miR-185, respectively. [score:3]
*, P < 0.05 compared with vector control Figure 5Xenograft tumor formation in nude mice of NIH3T3 cells ectopically and stably expressing SLC30A1, SERPINB2, AKR1C1, or vector control a. Histological analysis showed that all tumor cells had similar morphology and were diagnosed as fibrosarcoma b. Immunohistochemical staining c. demonstrated a high expression of SLC30A1 (up panel) or SERPINB2 (lower panel), respectively, in tumors induced by each of these two genes Plasma miR-182 and miR-185 were measured in 109 subjects living at the same region (Wuhan, China) but exposed to different levels of PM [2.5] and PM [10] monitored by personal sampler for 24 h. The median levels of individuals' exposure to PM [2.5] and PM [10] were 124.8 μg/m [3] and 179.3 μg/m [3], respectively, with the ranges of 18.7 to 274.2 μg/m [3] for PM [2.5] and 39.8 to 383.3 μg/m [3] for PM [10] (Supplementary Table S1). [score:2]
Transfection of these plasmids with miR-182 or miR-185 mimic showed no significant change in luciferase activity compared with transfection of these plasmids with microRNA control (Figure 2d), suggesting that the interactions between the two microRNAs and 3′UTR of three target genes are sequence-specific. [score:2]
Plasma miR-182 and miR-185 in subjects exposed to different levels of PM [2.5] and PM [10]. [score:1]
The expression of miR-182 and miR-185 was calculated relative to U6 small nuclear RNA. [score:1]
Transient transfection of these reporter plasmids to human lung cancer cell lines A549 and H446 with miR-182 or miR-185 mimic or microRNA control showed that transfection with miR-182 significantly reduced the luciferase activity caused by 3′UTR of SLC30A1 or SERPINB2 while transfection with miR-185 significantly reduced luciferase activity caused by 3′UTR of AKR1C1 (all P < 0.05). [score:1]
For analysis of plasma miR-182 and miR-185, the input RNA was reverse transcribed using TaqMan miRNA Reverse Transcription Kit (Applied BioSystems, Foster City, CA). [score:1]
[1 to 20 of 29 sentences]
8
[+] score: 116
Prediction tools revealed that miR-15a, miR-185, and miR-211 targeted IL-10Rα whereas none of the miRNAs exclusively downregulated in G361 cells targeted IL-10Rβ. [score:8]
Here we showed that miR-15a, miR-185, and miR-211 mimics inhibited and miRNA inhibitors increased the proliferation of IL-10 -treated melanoma cells through IL-10 signaling, since the silencing of IL-10Rα cancelled the effects of miRNA inhibitors on the proliferation (Fig.   5). [score:7]
Three out of the four miRNAs upregulated in G361 and OCM-1 and unchanged in GR-M were predicted to have seed regions able to bind to the 3′UTR of IL-10Rα (miR-15a was reported in all the miRNA target prediction systems, miR-185 in microRNA and PITA; miR-211 in microRNA and PITA). [score:6]
We found that as many as three out of four miRNAs (namely miR-15a, miR-185, and miR-211) were increased in cells with low expression of IL-10Rα, and that these regulatory molecules targeted the IL-10Rα gene (Fig.   2). [score:6]
These data suggest the potential usefulness of a combined therapeutic strategy targeted to the expression of miR-15a, miR-185, and miR-211 in melanoma cells. [score:5]
Ectopic expression of individual miR-15a, miR-185, and miR-211, and even more their co -expression, caused a marked decrease in the proliferation rate of all the cell lines. [score:5]
c Cells were transfected with individual or combined miR-15a, miR-185, and miR-211 inhibitors for 48-hr and, where indicated, co -transfected with siRNA against IL-10Rα or non -targeting control siRNA. [score:5]
Fig. 3 IL-10Rα is the direct target of miR-15a, miR-185, and miR-211 a Schematic representation of the predicted interaction of miR-15a, miR-185, and miR-211 with IL-10Rα 3′UTR site. [score:4]
miR-15a, miR-185, miR-211, and miR-30d were upregulated in G361 and OCM-1 cells, remaining at similar levels in GR-M cells. [score:4]
Taken together, findings reported in the present study suggest that the IL-10Rα expression in melanoma cells is post-transcriptionally regulated by miR-15a, miR-185, and miR-211. [score:4]
Luciferase reporter and western blot assays showed that IL-10Rα expression is directly regulated by miR-15a, miR-185, and miR-211, either alone or in combination. [score:4]
Knockdown of miR-15a, or miR-185, or miR-211 markedly promoted the proliferation in all the cell lines and the combined inhibitors further increased growth. [score:4]
IL-10Rα is a target of miR15a, miR185, and miR211To validate the direct interaction of miR15a, miR185, and miR211 with IL-10Rα mRNA (Fig.   3a), we constructed a luciferase reporter system containing a binding site (IL-10Rα-3′-UTR-wt) or a mutated site (IL-10Rα-3′-UTR-mut). [score:4]
IL-10Rα is a target of miR15a, miR185, and miR211. [score:3]
In addition, miR-185 exhibits strong anti-proliferative effects on melanoma either in-vitro or in vivo [24] and miR-211 inhibits the aggressive and invasive phenotype of melanoma cells [11]. [score:3]
These results suggest that the 3′-UTR of IL-10Rα mRNA might be the target of miR15a, miR185, and miR211. [score:3]
An inverse expression pattern between IL-10Rα, on one side, and miR-15a, miR-185, and miR-211 on the other one was also shown in melanoma samples. [score:3]
Fig. 4IL-10/IL-10R system and miR-15a, miR-185, miR-211 expression in cutaneous and uveal melanoma samples. [score:3]
The expression profile of IL-10/IL-10R, miR-15a, miR-185, and miR-211 observed in cutaneous and uveal melanoma tissues exhibited the same trend observed in melanoma cell lines (Fig.   4). [score:3]
MiR-15a, miR-185, and miR-211 mimics/inhibitors (Qiagen, Milan, Italy) were transfected either alone or in combination into melanoma cells using HiPerFect according to the manufacturer’s protocols (Qiagen). [score:3]
The IL-10/IL-10R system and miR-15a, miR-185, miR-211 expression in cutaneous and uveal melanoma samples. [score:3]
Interestingly, miR-15a, miR-185, and miR-211 are thought to function as tumor suppressors in melanocytes, as they repress many genes implicated in the melanomagenesis. [score:3]
The vectors were co -transfected into G361, GR-M, and OCM-1 cells with miR15a, miR185, and miR211 mimics or inhibitors. [score:3]
Figure  2 (sections B and C) shows that, as compared to NHEM, only 4 miRNAs (miR-15a, miR-185, miR-211, and miR-30d) were upregulated in G361 and OCM-1 cells, while remaining at similar levels in GR-M cells. [score:3]
Therefore, treatment with100 U/ml of IL-10 for 36-hr was used for cell proliferation assays in the presence of miR-15a, miR-185, and miR-211 mimics or inhibitors. [score:2]
Four mutant plasmids were generated with the mutation sequence without complementary sequence of miR-15a (pGL3- IGF-1 3′-UTR mut 1), miR-185 (pGL3- IGF-1 3′-UTR mut 2), and miR-211 (pGL3- IGF-1 3′-UTR mut 3) or all of them (IL-10Rα 3′-UTR mut-full-length). [score:2]
Next, we further investigated the regulation of IL-10Rα protein expression by miR-15a, miR-185, and miR-211. [score:2]
To validate the direct interaction of miR15a, miR185, and miR211 with IL-10Rα mRNA (Fig.   3a), we constructed a luciferase reporter system containing a binding site (IL-10Rα-3′-UTR-wt) or a mutated site (IL-10Rα-3′-UTR-mut). [score:2]
For the luciferase reporter assay, cells were seeded on 24-well plates and co -transfected using Lipofectamine 2000 (Invitrogen) with 100 ng per well of the resulting luciferase UTR-report vector, 2 ng per well of pRLCMV vector (internal control, Promega), and 20 ng per well of miR-15a, miR-185, and miR-211 mimics or inhibitors following the manufacturer’s instructions (Qiagen, Milan, Italy). [score:2]
Effects of miR-15a, miR-185, and miR-211 on IL-10 -induced melanoma cell proliferation. [score:1]
Fig. 5Effects of miR-15a, miR-185, and miR-211 on IL-10 -induced melanoma cell growth. [score:1]
Figure  4 shows significant higher levels of IL-10Rα (section A) accompanied by a correspondent decrease in miR-15a, miR-185, and miR-211 (section B) in tumor specimens. [score:1]
Significant ** p < 0.01 and *** p < 0.001, as compared to cells transfected with mimic control Next, we proceeded to explore the expression of the members of IL-10/IL-10R system, miR-15a, miR-185, and miR-211 in cutaneous and uveal melanoma samples as compared to normal skin. [score:1]
The wild-type plasmids were created containing the 3′-UTR of IL-10Rα with complementary sequence of miR-15α (IL-10Rα 3′-UTR wild 1), miR-185 (IL-10Rα 3′-UTR wild 2), miR-211 (IL-10Rα 3′-UTR wild 3) or covering all the three miRNA side sites (IL-10Rα 3′-UTR wild-full-length). [score:1]
b Cells were transfected with individual or combined miR-15a, miR-185, and miR-211 mimics for 48-hr and then treated with rIL-10 (100 U/ml) for 36-hr. [score:1]
Total RNA was extracted from 35 normal skin specimens, 52 cutaneous melanomas, and 41 uveal melanomas, reverse-transcribed, and analyzed by qPCR to determine the relative amounts of IL-10, IL-10Rα, IL-10Rβ mRNA (a) and miR-15a, miR-185, miR-211 (b). [score:1]
[1 to 20 of 36 sentences]
9
[+] score: 99
Because the suppression level of CDK6 mRNA expression by miR-185 is very modest, the subsequent decrease of CDK6 protein expression at the time point of observation (24 hours after transfection) may be too little to be observed the conventional immunoblottings. [score:7]
For miR-107, we confirmed mRNA down-regulation of CCNE1 (NM_001238), CDK6, CDCA4 (NM_017955.3), RAB1B (NM_030981.2) and CRKL (NM_005207.3), and for miR-185, we confirmed down-regulation of CCNE1, CDK6, AKT1 (NM_001014431.1), HMGA2 (NM_003483.4) and CORO2B (NM_006091.3) (Fig. 5B). [score:7]
In the hsa-miR-107, hsa-miR-185 and hsa-let-7a transfected cells there were 561, 646 and 812 transcripts down-regulated and 608, 698 and 949 upregulated by 1.5 fold or greater, respectively. [score:7]
We note that both miR-107 and miR-185 transfection caused down-regulation of cyclin E1 (CCNE1) and cyclin dependent kinase 6 (CDK6) mRNA levels although the suppression level of CDK6 by miR-185 is modest (Fig. 5B). [score:6]
We then confirmed by western blotting that CDK6 protein levels are also down-regulated by miR-107, whereas CDK6 expression was relatively unchanged by miR-185 (Fig. 5C). [score:6]
The miR-185, however, could suppress the mRNA expression of cell cycle regulating genes such as CDK6 and AKT1. [score:6]
Finally, the down-regulated genes with hsa-miR-185 showed no enrichment for cell cycle related terms, instead of the terms related to the development and differentiation were prominent. [score:5]
Another important question is that miR-185 showed growth suppressive functions (figures 2, 3) and decrease of expression in lung cancer cells (figure 1) even though the miRNA is localized in a chromosomal region amplified in two lung cancer cell lines ([17] and supplementary table S1). [score:5]
Using miRNA-target prediction analyses and the array data, we listed up a set of likely targets of miR-107 and miR-185 for G1 cell cycle arrest and validate a subset of them using real-time RT-PCR and immunoblotting for CDK6. [score:5]
Overexpression of miR-107 and miR-185 causes growth suppression and induces G1 cell cycle arrest. [score:5]
The number of cell cycle regulators in the downstream suppressed genes is much lower by miR-185 than by miR-107. [score:4]
Gene ontology terms enriched of genes down-regulated by miR-107, miR-185 and let-7a transfection. [score:4]
B) The quantitative RT-PCR analyses of potential targets of miR-107 (CCNE1, CDK6, CDCA4, RAB1B and CRKL) and miR-185 (CCNE1, CDK6, AKT1, HMGA2, CORO2B) are shown. [score:3]
On the other hand, miR-185 did not significantly repress cell cycle regulator as well as let-7, a known cell cycle regulating miRNA [6]. [score:3]
We happened to find that miR-107 and miR-185 can suppress cell proliferation in two lung cancer cell lines and induced a G1 arrest of the cell cycle. [score:3]
Effect of miR-107, miR-185 and let-7a over -expression on cell cycle profile in H1299 cells. [score:3]
of synthetic miR-107 or miR-185 suppressed growth of the human non-small cell lung cancer cell lines. [score:3]
This suggests that growth suppression induced by hsa-miR-107 and hsa-miR-185 transfection was caused by induction of G1 arrest rather than apoptosis. [score:3]
During the study, we found that miR-107 (MIMAT0000104) and miR-185 (MIMAT0000455) suppress proliferation in lung adenocarcinoma cell lines and induce cell cycle arrest at the G1 phase of the cell cycle. [score:3]
The vertical axis indicates the relative ratio of the A450 nm: that of day 0 of each cell as 1. Note miR-107 and miR-185 suppresses proliferation in both cell lines. [score:3]
We identified new cell cycle regulating miRNAs, miR-107 and miR-185, localized in frequently altered chromosomal regions in human lung cancers. [score:2]
The mechanism of cell cycle arrest by miR-185 is not clear. [score:1]
In the other paper, Choong reported that miR-185 have strong positive correlation to the appearance of erythroid surface antigens (CD71, CD36, and CD235a) in human umbilical cord blood cells stimulated with growth factors and induced erythroid differentiation [33]. [score:1]
Transfection of hsa-miR-107 and hsa-miR-185 dramatically reduced cell proliferation in both cell lines (Fig. 2). [score:1]
In the case of the miR-185, epigenetic silencing of the miRNA might occur prior to the gene amplification of the chromosome 22q21.1 region. [score:1]
DNA content analysis by flow cytometry revealed transfection of hsa-miR-107 and hsa-miR-185 induced a significant increase in the percentage of cells at the G1 phase of the cell cycle, to similar levels as a let-7a control while a scrambled negative control did not (Fig. 3). [score:1]
Then we chose three miRNAs : miR-107, miR-185, and miR-31 (MIMAT0000089) [19]– [22]. [score:1]
[1 to 20 of 27 sentences]
10
[+] score: 64
Therefore we speculated that miR-185 could down-regulate anti-β1-AR antibody production by inhibiting CD4 T cell development, which influenced MHC class II antigen presentation pathway in DCM patients. [score:7]
Furthermore, Xu et al. showed that miR-185 could inhibit apoptosis of myocardiocyte by targeting Smad7 33 34. [score:5]
So it could be deduced that miR-185 might be a negative regulator of B cells in DCM, and this inhibitory effect could lead to the improvements of cardiac remo deling and clinical outcomes of DCM patients. [score:4]
Targeting miR-185 might be a valuable therapeutic approach for DCM. [score:3]
During the 1-year follow-up period in patients undergoing the standard treatment for heart failure, the circulating miR-185 expression was stable, but the miR-185 [high] group showed apparent improvements in left ventricular sizes and systolic function, accompanied by the significant decline in the cardiovascular mortality and total admissions for heart failure re-hospitalizations. [score:3]
Circulating miR-185 expressions at baseline. [score:3]
MicroRNA-185 Expression in Peripheral Blood of DCM Patients. [score:2]
Interestingly, only four DCM patients whose miR-185 levels lay within the 95% reference range of healthy controls [721943, 897824] (copy number of miR-185). [score:1]
The Basic Clinical Features of DCM Patients in miR-185 [high] and miR-185 [low] groups. [score:1]
In a majority of DCM patients, the miR-185 levels were seen to be distributing into two clusters, respectively, either obviously higher or lower than those in healthy controls (P < 0.001, Fig. 1A,B). [score:1]
These findings might provide further evidence to strengthen the prognostic value of the miR-185 in DCM. [score:1]
A more significant reduction of LVEDD (P = 0.043 for the 6 [th] month, P = 0.003 for the 12 [th] month, Fig. 4A) and NT-proBNP (P = 0.011 for the 6 [th] month, P = 0.022 for the 12 [th] month, Fig. 4C), and more obvious elevations of LVEF (P = 0.037 for the 6 [th] month, P = 0.035 for the 12 [th] month, Fig. 4B) in miR-185 [high] group at the 6 [th] and 12 [th] months were observed. [score:1]
MiR-185 was detectable in the peripheral blood of both healthy controls and DCM patients, and the levels of miR-185 were significantly higher in DCM patients (P = 0.037, Fig. 1A). [score:1]
We performed correlation analysis of miR-185 levels and the indexes of cardiac function LVEDD, LVEF, and NT-proBNP in patients with DCM at baseline. [score:1]
The levels of miR-185 were determined using standard curves. [score:1]
During the one-year observation period, a total of four (16.7%) miR-185 [low] patients died while none of the miR-185 [high] patients died. [score:1]
Heart failure re-hospitalization in miR-185 [high] and miR-185 [low] DCM patients at 12-month follow-up. [score:1]
All of the four miR-185 [low] patients died from cardiovascular causes (cardiogenic shock at the 7 [th] month, cardiogenic shock at the 9 [th] month, ventricular fibrillation at the 12 [th] month, and cardiac arrest at the 12 [th] month respectively). [score:1]
In addition, the correlations between miR-185 levels and LVEF were not significant in the follow-up period (Fig. 2D–L). [score:1]
Moreover, increasing miR-185 levels attenuate CD4 T cell percentages 22. [score:1]
However, the levels of anti-β1-AR antibody (P = 0.022) and plasma CRP (P < 0.001) in miR-185 [low] group were significantly higher than those in miR-185 [high] group. [score:1]
Mortality in miR-185 [high] and miR-185 [low] DCM patients at 12-month follow-upDuring the one-year observation period, a total of four (16.7%) miR-185 [low] patients died while none of the miR-185 [high] patients died. [score:1]
The changes of TNF-α secreted from B cells were finally observed to be consistent with anti-β1-AR antibody from miR-185 [high] and miR-185 [low] patients. [score:1]
To further explore whether the higher miR-185 levels would lead to the better clinical outcomes in DCM, we classified these forty-six cases of DCM patients into miR-185 [high] group and miR-185 [low] group according to the miR-185 data distribution in Fig. 1. The clinical data of patients in miR-185 [high] and miR-185 [low] groups at baseline are listed in Table 2. There were no differences in the clinical features including age, sex, viral infection rates, NYHA classification, LVEF, LVEDD, NT-proBNP and medications between them at baseline. [score:1]
The relationship between miR-185 and B cell function. [score:1]
Among the 46 patients who completed the one-year follow-up, 6 (27.3%) miR-185 [high] patients and 10 (41.7%) miR-185 [low] patients were re-hospitalized because of heart failure at least once over the year, and some of them were re-hospitalized more than once during this period. [score:1]
However, the baseline miR-185 levels were not correlated with alterations of LVEDD and NT-proBNP at 3 and 6 months. [score:1]
However, no significant change was found in the anti-ANT, MHC and CC antibodies between the miR-185 [low] and the miR-185 [high] groups. [score:1]
Our study firstly showed that the high miR-185 was associated with the favorable prognosis of DCM patients. [score:1]
In the present study, we firstly found that the mean levels of plasma miR-185 in DCM patients were significantly higher than those in healthy controls, but there was no correlation between miR-185 and cardiac function at the baselines. [score:1]
This indicated that higher the circulating miR-185 levels, the better the clinical outcomes of DCM patients. [score:1]
The clinical features of miR-185 [high] and miR-185 [low] DCM patients. [score:1]
Nevertheless, it was unexpected and interesting to note that almost all of these patients could be divided into two different groups according to the cluster distribution of miR-185, which were the miR-185 [high] and the miR-185 [low] groups. [score:1]
Cardiac function in miR-185 [high] and miR-185 [low] DCM patients at 12-month follow-upIn the one-year follow-up, we collected the indexes of cardiac function including LVEDD, LVEF, NT-proBNP and NYHA classification in patients with DCM at 0, 3, 6, and 12 months. [score:1]
The clinical features of miR-185 [high] and miR-185 [low] DCM patientsTo further explore whether the higher miR-185 levels would lead to the better clinical outcomes in DCM, we classified these forty-six cases of DCM patients into miR-185 [high] group and miR-185 [low] group according to the miR-185 data distribution in Fig. 1. The clinical data of patients in miR-185 [high] and miR-185 [low] groups at baseline are listed in Table 2. There were no differences in the clinical features including age, sex, viral infection rates, NYHA classification, LVEF, LVEDD, NT-proBNP and medications between them at baseline. [score:1]
However, the miR-185 levels were not correlated with the levels of these three indexes (Fig. 2A–C). [score:1]
The baseline miR-185 levels were positively correlated with the reduction rate of LVEDD (R = 0.446, P = 0.002) and NT-proBNP (R = 0.390, P = 0.007) in DCM patients at 12 months. [score:1]
How to cite this article: Yu, M. et al. Circulating miR-185 might be a novel biomarker for clinical outcome in patients with dilated cardiomyopathy. [score:1]
Cardiac function in miR-185 [high] and miR-185 [low] DCM patients at 12-month follow-up. [score:1]
Thus, among these total admissions for heart failure re-hospitalizations, there were 8 (36.4%) admissions in miR-185 [high] group, which was significantly lower than those of miR-185 [low] group with 17 (72.9%) admissions (P = 0.011, Table 3). [score:1]
Heart failure re-hospitalization in miR-185 [high] and miR-185 [low] DCM patients at 12-month follow-upAmong the 46 patients who completed the one-year follow-up, 6 (27.3%) miR-185 [high] patients and 10 (41.7%) miR-185 [low] patients were re-hospitalized because of heart failure at least once over the year, and some of them were re-hospitalized more than once during this period. [score:1]
Mortality in miR-185 [high] and miR-185 [low] DCM patients at 12-month follow-up. [score:1]
In addition, the function of anti-β1-AR antibody is known to disturb cardiomyocyte energy metabolism and promote cell necrosis and apoptosis, and the levels of this autoantibody were continuously repressed in the miR-185 [high] group throughout the entire study, which suggested that miR-185 might take part in alleviating the myocardial injuries mediated by the anti-β1-AR antibody. [score:1]
The relationship between miR-185 and cardiac function in DCM patients. [score:1]
[1 to 20 of 44 sentences]
11
[+] score: 56
miR-142-3p, miR-181a, b, c and d and miR-185 target the 3’ UTR of the GARP mRNABecause GARP appears to regulate TGF-β1 secretion by T cells and TGF-β1 is important for the suppressive function of Treg cells, we sought to identify mechanisms that control GARP expression. [score:8]
Therefore, downregulation of miR-142-3p, miR-185 and miR181a, b, c, d in the course of Treg cell differentiation might be required for the acquisition of a complete immunosuppressive phenotype. [score:6]
miR-142-3p, miR-181a, b, c and d and miR-185 are expressed at higher levels in human CD4 [+] Th clones than in Treg clonesIf the 6 miRNAs identified above were to play a role in regulating GARP protein levels in human T cells, we expected their expression to be higher in Th than in Treg clones. [score:6]
Here we identified 6 miRNAs, namely miR-142-3p, miR-185 and miR-181a, b, c and d, that are expressed at lower levels in human Treg than in Th clones, and that control GARP protein amounts through direct targeting of the GARP 3’ UTR. [score:6]
miR-142-3p, miR-181a and miR-185 decrease GARP protein levels when overexpressed in polyclonal populations enriched in TregsTo test whether these miRNAs can control endogenous GARP levels in human T cells, we transfected miRNA mimics in T cell populations with endogenous GARP expression. [score:5]
Together, these results demonstrate that a 400-bp region of the GARP 3’ UTR, that is directly targeted by miR-142-3p, miR-185 and the four miR-181, controls GARP protein levels and the amounts of TGF-β1 that are processed and secreted by human CD4 [+] T cells. [score:4]
miR-142-3p, miR-181a and miR-185 decrease GARP protein levels when overexpressed in polyclonal populations enriched in Tregs. [score:3]
miR-142-3p, miR-181a, b, c and d and miR-185 target the 3’ UTR of the GARP mRNA. [score:3]
miR-142-3p, miR-181a, b, c and d and miR-185 are expressed at higher levels in human CD4 [+] Th clones than in Treg clones. [score:3]
Finally, miR-185 and miR-181c were expressed at lower levels, and 2.9 to 5.7 times more in Th than in Treg clones. [score:3]
Six miRNAs, namely miR-181a, b, c and d, miR-142-3p and miR-185, significantly decreased the reporter’s expression (Figure 6A). [score:3]
GARP protein was decreased after transfection with miR-142-3p, miR-185, miR-181a, or a mixture of the three, by comparison to a control miRNA (Figure 7). [score:1]
miR-142-3p, miR-185 and miR-181a to d decreased GARP protein levels when cotransfected with the GARP plasmid containing the 3’ UTR, but had no effect in its absence. [score:1]
The truncation removes the last 400 bp that contain the binding sites for miR-181a, b, c, d, miR-142-3p, and one of the two miR-185 sites (Figure 6B). [score:1]
0076186.g007 Figure 7Endogenous GARP levels in Tregs are reduced after transfection of miR-181a, miR-142-3p and miR-185 mimics. [score:1]
Endogenous GARP levels in Tregs are reduced after transfection of miR-181a, miR-142-3p and miR-185 mimics. [score:1]
For miR-185, microRNA. [score:1]
[1 to 20 of 17 sentences]
12
[+] score: 53
Therefore, elevated cellular cholesterol activates LXR, which upregulates SREBP1c, which in turn increases expression of miR-185 to suppress SREBP2 and its downstream targets, leading to a reduction in LDLR -mediated cholesterol uptake [35]. [score:10]
Overexpression of miR-185 under normocholesterolemic conditions did not significantly alter HMGCoA-R expression levels [35], though, which suggests that miR-185 may be involved in the fine-tuning of HMGCoA-R expression in hypocholesterolemic conditions. [score:7]
Recently, miR-27b and miR-185 were also shown to regulate expression of HMGCoA-R [28, 35], although suppression of HMGCoA-R by miR-27b in vitro did not reach statistical significance (p = 0.06) [28]. [score:6]
Lastly, miR-96, miR-185, and miR-223 have all been shown to suppress SRB1 expression in vitro and, therefore, regulate macrophage cholesterol uptake [32, 33]. [score:6]
In a second study, HMGCoA-R upregulation by cholesterol depletion was attenuated by miR-185 overexpression [35]. [score:6]
To draw further insight into this pathway, the authors showed that miR-185 expression is negatively regulated by another member of the SREBP family, SREBP1c [35]. [score:4]
Along with miR-223, miR-96 and miR-185 were also identified as regulators of SRB1 expression [32]. [score:4]
MiR-185 and miR-223 are activated by hypercholesterolemic conditions, therefore their ability to inhibit further cholesterol uptake is unsurprising. [score:3]
Indeed, miR-185 decreased SREBP2 mRNA and protein expression in vitro, leading to a downstream decrease in SREBP2-responsive genes, including LDL receptor (LDLR) [35], resulting in a subsequent decrease in cellular LDL uptake. [score:3]
Yang M. Liu W. Pellicane C. Sahyoun C. Joseph B. K. Gallo-Ebert C. Donigan M. Pandya D. Giordano C. Bata A. Identification of miR-185 as a regulator of de novo cholesterol biosynthesis and low density lipoprotein uptake J. Lipid Res. [score:2]
SREBP2 is also regulated by other transcription factors in a process involving miR-185 [35]. [score:2]
[1 to 20 of 11 sentences]
13
[+] score: 53
Other miRNAs from this paper: mmu-mir-185, hsa-mir-4306, hsa-mir-4644
During atherosclerosis, RNCR3 is significantly upregulated, which alleviates miR-185-5p repression effect, thereby upregulating the level of miR-185-5p target gene, KLF2. [score:9]
Overexpression of miR-185-5p significantly reduced the expression of KLF2 and RNCR3 (Supplementary Figure S3D). [score:5]
Ago2 knockdown resulted in a significant increase in RNCR3 expression, whereas miR-185-5p stability was impaired by Ago2 knockdown (Figure 7b). [score:5]
We employed TargetScan database to predict the potential mRNA targets of miR-185-5p. [score:5]
miR-185-5p inhibitor transfection increased the viability and proliferation of HUVECs (Figures 7e and f), whereas RNCR3 knockdown partially abolished this effect. [score:4]
[22] miR-4306, miR-185-5p, and miR-4644 was predicated as potential miRNA targets of RNCR3. [score:3]
The ceRNA regulatory network, RNCR3/miR-185-5p/KLF2, would provide a novel insight into gene regulatory network in atherosclerosis. [score:3]
RNCR3 overexpression may become a sink for miR-185-5p, thereby affecting the derepression of KLF2. [score:3]
As RNCR3, miR-185-5p, and KLF2 constitutes a regulatory network, we then investigated whether KLF2 co-expressed with RNCR3 in mouse and human atherosclerotic lesions. [score:2]
Luciferase assays revealed that KLF2 was a target of miR-185-5p. [score:2]
We then determined whether RNCR3-miR-185-5p is involved in regulating EC function. [score:2]
We show that lncRNA-RNCR3 communicates with and co-regulates KLF2 by competing for binding to miR-185-5p. [score:2]
miR-185-5p is shown as a post-transcriptional regulator. [score:2]
[44] We show that lncRNA-RNCR3 functions as a ceRNA to regulate KLF2 levels by sponging miR-185-5p in endothelial cells. [score:2]
The 3′-UTR of KLF2 was fused into luciferase coding region (RLuc-KLF2-WT) and transfected into HUVECs with miR-185-5p mimic or negative control mimic. [score:1]
Collectively, these results further suggest there is a cross-talk between KLF2 and RNCR3 through interacts with miR-185-5p. [score:1]
Mechanistically, RNCR3 acts as a ceRNA, and forms a feedback loop with KLF2 and miR-185-5p to elicit atheroprotective properties to the endothelium. [score:1]
RNCR3 levels were significantly reduced by miR-185-5p mimic, but not by other miRNA mimics (Figure 7a). [score:1]
[1 to 20 of 18 sentences]
14
[+] score: 51
Fluorescence in situ hybridization (FISH) was conducted in an area containing at least 85% tumor in order to appropriately visualize the expression of miR-185, miR-20a, miR-210, miR-25 and miR-92b in FFPE tissues of GC patients (Fig. 4b), and these experiments provided consistent results concerning the miRNA levels that the five miRNAs were up-regulated in GC patients. [score:6]
Among the five up-regulated miRNAs, miR-185 seemed to play a controversial role in the development and progression of GC, suggesting its conflicting function in GC 24 25. [score:5]
Bioinformatics analysis of miR-185, miR-20a, miR-210, miR-25 and miR-92b The putative target genes of the miRNAs were identified by miRanda, miRDB, miRWalk, RNA22, and Targetscan. [score:5]
MiR-185, miR-20a, miR-210, miR-25 and miR-92b were significantly up-regulated in GC tissues by qRT-PCR (a: 30 pairs of tumor and matched normal tissues) and FISH (b: pictures were selected from 10 pairs of GC tissues and matched normal tissues). [score:4]
In the training and testing phases of our experiment, miR-185, miR-20a, miR-210, miR-25 and miR-92b were found to be significantly up-regulated in GC. [score:4]
When compared the expression levels of the five miRNAs in arterial plasma from patients with different stages (4 with I, 10 with II, 20 with III and 4 with IV), all five miRNAs were found to be elevated but only miR-185 was significantly up-regulated in patients with stage III + IV compared to those with stage I + II (Fig. 5). [score:4]
Interestingly, in arterial plasma, miR-20a, miR-210 and miR-92b were significantly up-regulated while miR-185 was significantly decreased with a fold-change of 1.37, 2.35, 3.34 and 0.44, respectively (Supplementary Table S5 online). [score:4]
As shown in Fig. 4a, the expression of miR-185, miR-20a, miR-210, miR-25 and miR-92b was significantly higher in tumor than in normal tissues, and this correlation was consistent with results obtained from peripheral plasma. [score:3]
When the results of two stages were combined, miR-185, miR-20a, miR-210, miR-25 and miR-92b were significantly up-regulated in peripheral plasma of GC patients compared with NCs (Fig. 2). [score:3]
None of the five miRNAs (miR-185, miR-20a, miR-210, miR-25 and miR-92b) from GC patients demonstrated a significantly different expression level in peripheral plasma exosomes as compared to controls (Supplementary Table S6 online). [score:2]
MiR-185 was significantly up-regulated in late stage compared to early stage patients. [score:2]
Their results showed that the four miRNAs in our study (miR-25, miR-20a, miR-185 and miR-210) were co-purified with the Ago2 ribonucleoprotein complex other than exosomes in plasma while the form of miR-92b was undefined in the circulation. [score:1]
Bioinformatics analysis of miR-185, miR-20a, miR-210, miR-25 and miR-92b. [score:1]
a: miR-185; b: miR-20a; c: miR-210; d: miR-25; e: miR-92b; N: normal controls; T: tumor. [score:1]
a: miR-185; b: miR-20a; c: miR-210; d: miR-25; e: miR-92b. [score:1]
And arterial miR-185 was the only miRNA that was found to be significantly associated with TNM stage. [score:1]
The areas under the curve (AUC) were 0.65 (95% confidence interval (CI): 0.57–0.72), 0.67 (95% CI: 0.61–0.74), 0.75 (95% CI: 0.68–0.82), 0.65 (95% CI: 0.58–0.73) and 0.69 (95% CI: 0.62–0.76) for miR-185, miR-20a, miR-210, miR-25 and miR-92b, respectively (Supplementary Figure S1 online). [score:1]
In the larger cohort, 5 of 11 miRNAs (miR-185, miR-20a, miR-210, miR-25 and miR-92b) were consistent with those in the training stage (Table 2; the other miRNAs were shown in the Supplementary Table S2 and Table S3 online). [score:1]
On the other hand, miR-185 demonstrated a significant reduction in arterial plasma than that in peripheral venous plasma. [score:1]
We assumed that circulating miR-185 released by tumor might stimulate the further secretion of miR-185 according to some mechanism. [score:1]
[1 to 20 of 20 sentences]
15
[+] score: 42
Other miRNAs from this paper: hsa-mir-22, hsa-mir-122, hsa-mir-140
Consistent with the results of the transient transfection assays, RACK1-knockdown cells showed weaker miRNA mediated -inhibition of target gene expression in a reporter system involving miR185 precursor -expressing plasmids and its reporter constructs (Fig. 2D). [score:9]
0024359.g002 Figure 2 A, Overexpression of miR122, miR140, and miR185 precursors suppressed activity of the corresponding reporters. [score:5]
A, Overexpression of miR122, miR140, and miR185 precursors suppressed activity of the corresponding reporters. [score:5]
miRNA185 reporter plasmids were transfected, with or without miR185 precursor -expressing plasmids, into control and RACK1-knockdown cells. [score:4]
Levels of endogenous mature miR122, miR22, miR140-5p,-3p, and miR185, which are expressed at relatively high levels in liver cells [16], were comparable in control and RACK1-knockdown cells (Fig. 3A and Figure S1). [score:4]
miRNA185 reporter plasmids and CatA-Luc plasmids were transfected without miRNA precursor -expressing plasmids into control and RACK1-knockdown cells to assess endogenous miRNA function. [score:4]
Control Huh7 cells and RACK1-knockdown cells were transfected with miR122 reporter plasmids with or without synthetic corresponding miR122 oligonucleotides and non-corresponding miR185 oligonucleotides (to verify specificity). [score:2]
Transient knockdown of RACK1 reduced the function of three miRNAs: miR122, miR140, and miR185 (Fig. 2A). [score:2]
Control and Ago2-knockdown cells were transfected with miR122 or miR185 reporter plasmids with corresponding synthetic mature miRNA oligonucleotides. [score:2]
C, Levels of mature miR122 and miR185 in Ago2-containing complexes were reduced in RACK1-knockdown cells. [score:2]
Control and Ago2-knockdown (Ago2 KD) cells were transfected with miR122 or miR185 reporter plasmids with corresponding synthetic mature miRNA oligonucleotides. [score:2]
For example, the maturation of miRNAs used in our study, i. e., miR122, miR140, and miR185, is KSRP-independent [29]. [score:1]
[1 to 20 of 12 sentences]
16
[+] score: 36
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-22, hsa-mir-29a, hsa-mir-30a, hsa-mir-29b-1, hsa-mir-29b-2, mmu-let-7g, mmu-let-7i, mmu-mir-1a-1, mmu-mir-29b-1, mmu-mir-30a, mmu-mir-127, mmu-mir-132, mmu-mir-133a-1, mmu-mir-136, mmu-mir-144, mmu-mir-146a, mmu-mir-152, mmu-mir-155, mmu-mir-10b, mmu-mir-185, mmu-mir-190a, mmu-mir-193a, mmu-mir-203, mmu-mir-206, hsa-mir-148a, mmu-mir-143, hsa-mir-10b, hsa-mir-34a, hsa-mir-203a, hsa-mir-215, mmu-mir-34c, mmu-mir-34b, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-143, hsa-mir-144, hsa-mir-152, hsa-mir-127, hsa-mir-136, hsa-mir-146a, hsa-mir-190a, hsa-mir-193a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-22, mmu-mir-29a, mmu-mir-29c, mmu-mir-34a, mmu-mir-337, hsa-mir-1-1, mmu-mir-1a-2, hsa-mir-155, mmu-mir-29b-2, hsa-mir-29c, hsa-mir-34b, hsa-mir-34c, hsa-mir-378a, mmu-mir-378a, hsa-mir-337, mmu-mir-133a-2, mmu-mir-133b, hsa-mir-133b, mmu-mir-215, mmu-mir-411, mmu-mir-434, hsa-mir-486-1, hsa-mir-146b, hsa-mir-193b, mmu-mir-486a, mmu-mir-540, hsa-mir-92b, hsa-mir-411, hsa-mir-378d-2, mmu-mir-146b, mmu-mir-193b, mmu-mir-92b, mmu-mir-872, mmu-mir-1b, mmu-mir-3071, mmu-mir-486b, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, mmu-mir-378b, hsa-mir-203b, mmu-mir-3544, hsa-mir-378j, mmu-mir-133c, mmu-let-7j, mmu-mir-378c, mmu-mir-378d, mmu-let-7k, hsa-mir-486-2
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
Down-regulated miRNAs Up-regulated target genes mmu-mir-148a ARL6IP1, ARPP19, ATP2A2, CCNA2, CSF1, EGR2, ERLIN1, ERRFI1, FIGF, GADD45A, GMFB, ITGA5, KLF4, KLF6, LIMD2, MAFB, NFYA, PDIA3, PHIP, PPP1R10, PPP1R12A, PTPN14, RAI14, RSBN1L, SERPINE1, SIK1, SLC2A1, TMEM127, TMSB10, TMSB4X mmu-mir-411 APOLD1, SPRY4 mmu-mir-136 RYBP, ARL10, GLIPR2, UGGT1 Up-regulated miRNAs Down-regulated target genes mmu-mir-34a/c DAB2IP, DMWD, EVI5L, FAM107A, MAZ, SPEG, TFRC, TTC19 mmu-mir-92b COL1A2, DAB2IP, G3BP2, HOXC11, LBX1, NFIX, PKDCC, PRKAB2 mmu-mir-132 ACTR3B, AMD1, GPD2, HBEGF, KBTBD13, KCNJ12, PRRT2, SREBF1, TLN2 mmu-mir-146a IRAK1, TLN2 mmu-mir-152 EML2, GPCPD1, NFIX, RPH3AL, SH3KBP1, TFRC, TRAK1, UCP3 mmu-mir-155 DUSP7, G3BP2 mmu-mir-185 DAB2IP, FAM134C, SYNM, TMEM233 mmu-mir-203 APBB2, CACNG7, FKBP5, GDAP1, HBEGF, KCNC1, SIX5, TMEM182 mmu-mir-206 DMPK, G3BP2, GPD2, KCTD13, MKL1, SLC16A3, SPEG mmu-mir-215 KLHL23 Figure 5The network displays the predicted interactions between age-related miRNAs and mRNAs from the sequencing and was generated using Cytoscape (version 3.0, www. [score:17]
Another novel miRNA, chr11_3738, shared homology with miR-185, which participates in 22q11DS and schizophrenia by dysregulating sarco/endoplasmic reticulum Ca [2+]-ATPase (SERCA2) [29]. [score:2]
[1 to 20 of 3 sentences]
17
[+] score: 35
Some of the EV miRNAs (miR-181d-3p, miR-155-3p, miR-185-5p, miR-3940-3p, miR-4532, miR-7107-5p miR-504-3p, miR-320d, miR-19b-3p and miR-22-3p) up-regulated in female OA synovial fluid were down-regulated in response to estrogen treatment in human and mouse cells 51– 54. [score:7]
We also found that miR-185-5p and miR-7107-5p significantly (p < 0.05) down regulated expression of CREB -binding protein whereas miR-181d-3p did not show significant change in expression of CREB -binding protein (Fig.   5). [score:6]
Quantitative real time PCR showed that miRNA mimics of 181d-3p and miR-185-5p significantly (p < 0.01) down-regulated the expression of estrogen receptor-α, estrogen receptor-β, and aromatase cytochrome P450. [score:6]
Further detailed analysis showed that 6 miRNAs (miR-181d-3p, miR-3940-3p, miR-155-3p, miR-4532, miR-185-5p, miR-7107-5p) target 9 genes of the ovarian steroidogenesis pathway and the same number of miRNAs (miR-4532, miR-181d-3p, miR-185-5p miR-6865-3p, miR-4459, miR-7107-5p) target 14 genes of the estrogen signaling pathway. [score:5]
The miR-185-5p and miR-7107-5p mimics did not show any changes in n-COR and TIF2 gene expressions (Fig.   5). [score:3]
We further confirmed that some of these miRNAs (181d-3p, miR-185-5p, miR-7107-5p) target female estrogen signaling pathway genes. [score:3]
To determine whether OA related miRNAs are involved in estrogen -mediated gene regulation of articular chondrocytes, the cells were treated with miRNA mimics (181d-3p, miR-185-5p, miR-7107-5p) for 24 h and estrogen signaling pathway genes were analyzed. [score:2]
MiRNAs (181d-3p, miR-185-5p, miR-7107-5p) regulates (a) ER-α (estrogen receptor- α), (b) ER-β estrogen receptor- β), (c) CYP19 (aromatase cytochrome P450), (d) CREB -binding protein, (e) nCOR (Nuclear Receptor Co-repressor) and (f) TIF2 (Transcriptional Intermediary Factor 2) in human articular chondrocytes. [score:2]
Scrambled (Negative control) miRNA and miRNA mimics for miR-181d-3p, miR-185-5p and miR-7107-5p were purchased from QIAGEN. [score:1]
[1 to 20 of 9 sentences]
18
[+] score: 33
For instance, miR-185 was reported to be down-regulated in hepatocellular carcinoma and to inhibit tumour growth by targeting the DNMT1/PTEN/Akt pathway [9], commonly activated in MPM 10, 11. [score:8]
On the other hand, the intersection of predicted or experimentally validated targets highlighted the presence of further transcripts targeted by two or more deregulated miRNAs: MPLZ1 (targeted by miR-145, -185, and -197), PRKAR2A (miR-185, -15b and -299), CCNE1 (miR-15b and miR-185), and VEGFA (miR-126 and miR-15b). [score:8]
The expression levels of miRNAs were ranked according to BH values and the top five significant miRNAs were: miR-337-3p, miR-185-5p, miR-485-3p, miR-197-3p, and miR-299-5p, all down-regulated in MPM. [score:6]
We observed a statistically significant down-regulation in MPM samples, after Bonferroni’s correction, for miR-197, miR-185 and miR-299 (see Table  1), whereas we could not validate the results for miR-337 and miR-485. [score:4]
A key anti-tumourigenic role of miR-185 was shown also in lung [13] and gastric cancer [14], modulating target mRNAs (i. e. AKT1 and TRIM29, respectively) involved in the carcinogenic process. [score:3]
microRNALog [2](FC) p-value miR-197-3p −2.540 3.72 × 10 [−7] miR-185-5p −2.742 2.22 × 10 [−4] miR-299-5p −1.239 0.0014 miR-337-3p −0.758 0.0201 miR-485-3p −0.488 0.1886 In addition, from our microarray analysis we could confirm previous findings from several high-throughput studies where mesothelial cell lines or normal mesothelial tissues were used as controls (Table  2). [score:1]
microRNALog [2](FC) p-value miR-197-3p −2.540 3.72 × 10 [−7] miR-185-5p −2.742 2.22 × 10 [−4] miR-299-5p −1.239 0.0014 miR-337-3p −0.758 0.0201 miR-485-3p −0.488 0.1886 In addition, from our microarray analysis we could confirm previous findings from several high-throughput studies where mesothelial cell lines or normal mesothelial tissues were used as controls (Table  2). [score:1]
Thus, overall, we confirmed the role played by miR-126, miR-15b and miR-145 and, in addition, we suggest a role for miR-185, miR-197, and miR-299 in MPM. [score:1]
This approach allowed the identification of six miRNAs (miR-15b, miR-126, miR-145, miR-185, miR-197, and miR-299), three of which (i. e. miR-185, miR-197 and miR-299) have never been linked, to the best of our knowledge, to MPM carcinogenesis. [score:1]
[1 to 20 of 9 sentences]
19
[+] score: 31
While miR-221, miR-125b, miR-34a and miR-100 were up-regulated and miR-130b, miR-210 and miR-185 were down-regulated in obese subjects; miR-130b and miR-210 were both down-regulated during differentiation and in subcutaneous fat depots from obese subjects. [score:10]
Of note, miR-185, miR-139-5p, miR-484, and miR-130b were down-regulated in obese without DM-2 when compared to non-obese subjects while the expression of miR-99a, miR-1229, miR-125b, miR-221 and miR-199a-5p was up-regulated [Figure 4A and Table S2]. [score:8]
Otherwise, miR-185 was up-regulated in mature adipocytes while down-regulated in obese men. [score:7]
miR-15a, miR-101 and miR-185 were also significantly up-regulated during adipocyte differentiation in a previous work [28]. [score:4]
IntegratedSeveral miRNAs, namely miR-221, miR-125b, miR-100, miR-130b, miR-210, miR-30a*, miR-34a, miR-503 and miR-185, were outstanding when integrating results from cells and subcutaneous fat tissue together. [score:1]
Several miRNAs, namely miR-221, miR-125b, miR-100, miR-130b, miR-210, miR-30a*, miR-34a, miR-503 and miR-185, were outstanding when integrating results from cells and subcutaneous fat tissue together. [score:1]
[1 to 20 of 6 sentences]
20
[+] score: 30
Of the differentially expressed miRNAs, miR-185, miR-150, miR-194, and miR-363 were downregulated in individuals with 22q11DS as compared to TD controls and miR-208, miR-190, and miR-1 were upregulated. [score:8]
The observed down-regulation of miR-185 was expected as it is located within the deleted region of chromosome 22 and it was found to be significantly down-regulated across many of the neurological measures. [score:5]
Specifically, six miRNAs (miR-185, miR-15b-3p, miR-363, miR-324-5p, miR-361-5p, and miR-194) were dysregulated in individuals with 22q11DS when examining left hippocampal volume (Figure 5 ), and also with right hippocampal volume (Figure 6 ), while the expression level of two miRNAs (miR-361-5p, and miR-194) significantly decreased with increased whole brain volume (Figure 7 ). [score:4]
In this study down-regulation of miR-185 correlated with brain volume, in agreement with findings in both the prefrontal cortex and the hippocampus of the mouse mo del of 22q11DS [29]. [score:4]
miR-185 is implicated in many neurological disorders leading to hypotonic infants and it has also been suggested as a key player in neuronal development. [score:2]
This and previous research showing the presence of miR-185 at the synapses [61], [62], suggest that miR-185 may have a role in neural function and constitute a key gene regulator in 22q11DS. [score:2]
A number of miRNAs including miR-194, miR-361, miR-150 and miR-185 were found to be dysregulated in 22q11DS. [score:2]
miR-185 contributes to dendritic and spine development deficits in hippocampus of the Df(16)A+/− mouse mo del [55]. [score:2]
In particular, highly significant lower expression levels were observed for miR-194, miR-361 and miR-185 in individuals with 22q11DS across all of our phenotypic neuronal measures. [score:1]
[1 to 20 of 9 sentences]
21
[+] score: 28
A very interesting observation is related to miR-185 expression pattern: published results, in fact, demonstrated that this miRNA was upregulated in mouse GC B cells and downregulated in human GC B cells after stimulation of naïve B cells with lipopolysaccharide antigen [21, 35]. [score:9]
However the four studies presented a controversial expression of mir-185: we detected levels of miR-185 higher in naïve than in GC-restricted B cells (Figure 1), whilst both Malumbres et al. [12] and Belver et al. [21] showed miR-185 upregulation in GC B cells. [score:6]
Our data confirmed that miR-185 is downregulated in human GC B cells. [score:4]
Conversely, 15 miRNAs resulted downregulated in activated B cells: mir-483, mir-95, mir-326, mir-135a, mir-184, mir-185, mir-516-3p, mir-30b, mir-203, mir-216, mir-150, mir-182*, mir-141 and mir-211 (Table 3). [score:4]
Other miRNAs such as mir-155, mir-181b, mir-15a, mir-16, mir-15b, mir-34a, mir-9, mir-30, let-7a, mir-125b, mir-217 and mir-185 modulate the expression of pivotal genes and functions which contribute to the final B-cell maturation [6]. [score:3]
In fact, based on these evidences, we speculate that miR-185 level, in connection with other regulatory mechanisms having different weights in human and mice, participates to the fine tuning of the threshold for the selection of autoreactive B cells. [score:2]
[1 to 20 of 6 sentences]
22
[+] score: 27
In silico target prediction software was used among mRNA (messenger RNA) targets of the three miRNAs that were significantly associated with phenol or phthalate levels (miR-185, miR-142-3p, miR-15a-5p). [score:5]
miR-185 may represent a critical target in mediating these processes as a result of an adverse gestational environment, because its expression is increased in preeclamptic placentas compared with healthy pregnancies, and is increased in placentas from our study with higher phthalate and phenol exposure levels compared with lower exposure levels. [score:3]
We found three miRNAs for which we detected a significant association with either phenol or phthalate levels on expression: miR-142-3p, miR15a-5p, and miR-185. [score:3]
Genes contributing to the enrichment (unadjusted p < 0.0001) of biological processes among predicted targets of miRNAs associated with EDC burden (miR-185, miR-142-3p, miR-15a-5p). [score:3]
This association may be driven by MEP (monoethyl phthalate) exposure, which demonstrated the strongest inverse association with miR-185 expression when mo deled independently (–0.08; 95% CI: –0.15, –0.01; see, Figure S5). [score:3]
A log(mol/L) increase in ΣLMW phthalates was significantly associated with a 0.10 (95% CI: –0.18, –0.01) decrease in miR-185 expression. [score:3]
For three miRNAs—miR-142-3p, miR15a-5p, and miR-185—we detected associations between Σphthalates or Σphenols on expression levels (p < 0.05). [score:3]
Additionally, differential expression of miR-185 has been observed in placenta samples from preeclamptic pregnancies compared with non-preeclamptic pregnancies (Ishibashi et al. 2012; Wang W et al. 2012). [score:2]
After adjusting for multiple testing, 10 genes were found to be significantly correlated with miR-142-3p, 20 were correlated with miR-185, and miR-15a-5p was not associated with any genes (see, Figure S6). [score:1]
Two miRNAs were significantly associated with additive phenols, and miR-185 was associated with ΣLMW (Figure 1; see also, Tables S3 and S4). [score:1]
[1 to 20 of 10 sentences]
23
[+] score: 25
The miRNA hsa-miR-185-5p exhibited increased expression when exposed to 0.5 Gy and 1 Gy dosage of radiation and was predicted to interact with YWHAG (tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide), YWHAB (tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide), and PCNA (proliferating cell nuclear antigen), which appeared to be downregulated under the same condition. [score:6]
In addition, we showed that hsa-miR-185 may control the expression of TCF7 (T-cell-specific transcription factor 7) and HSP90AA1 (heat shock protein 90 kDa alpha, class A member 1) in Figure 3. TCF7 is a known regulator of the Wnt signaling pathway [45] and an important modulator of the self-renewal and differentiation processes in hematopoietic cells [46]. [score:4]
Three microRNAs, hsa-miR-20b-5p, hsa-miR-17-5p, and hsa-miR-185-5p, appear to regulate the highest number of radiation sensitive genes compared to the other differentially expressed microRNAs (Table 2). [score:3]
Consequently, hsa-miR-20b-5p, hsa-miR-17-5p, and hsa-miR-185-5p may be involved in modulating genes underlying cell cycle control and the development of thyroid cancer and prostate cancer. [score:2]
Our results support that these three genes regulate the cell cycle pathway and are particularly sensitive to changes in the external environment, especially radiation exposure, and that hsa-miR-185-5p may be involved in mediating this response. [score:2]
Our analysis demonstrated that miR-107 may cooperate with miR-185-5p to regulate the cell cycle via YWHAB. [score:2]
This result corresponds to a previous study, which showed that the miR-107 and miR-185, localized in frequently altered chromosomal regions in human lung cancers, may contribute to regulate cell cycle in human malignant tumors [52]. [score:2]
In addition, hsa-miR-185 is also known to be involved in the development of prostate cancer [48]. [score:2]
From publicly available miRNA knowledge bases, we retrieved a list of genes that have been validated to interact with these miRNAs, namely, hsa-miR-185-5p, hsa-miR-107, hsa-miR-20b-5p, and hsa-miR-17-5p for the low radiation doses and hsa-miR-142, hsa-miR-223-3p, and hsa-miR-451a for the 5 Gy radiation exposure. [score:1]
Our pathway analysis further supports the roles these three molecules play in carcinogenesis by mapping the interaction among hsa-miR185-5p, TCF7, and HSP90AA1 to prostate cancer through the PI3K signaling pathway. [score:1]
[1 to 20 of 10 sentences]
24
[+] score: 24
miR-185 is still mostly unstudied, but recently it was demonstrated to exert suppressive effects in several malignancies through targeting Six1 oncogene [42], [43]. [score:5]
The mean expression level of most candidate Suppressive miRNAs in the clinical specimens was between the corresponding miRNA values in the PAG and HAG cells, except for miR-185 and miR-31. [score:5]
Three miRNAs were within expression range (miR-34a, miR-185 and miR-204, Figure 2C) and two which were silenced (miR-31 and miR-184, Figure 2B) in the HAG cells. [score:3]
Importantly, a statistically significant inhibition in tumor growth was observed in both miR-34a and miR-185 transducatnts, as compared to control tumors (Figure 7A). [score:2]
Remarkably, a substantial and consistent inhibition in net proliferation was conferred by miR-31, miR-34a, miR-184 and miR-185 as compared to the control cell (Figure 4B). [score:2]
Tube formation activity was substantially inhibited by miR-34a and miR-185, and more mildly by miR-31 and miR-184, but not by miR-204, as compared to control (Figure 5, A–F). [score:2]
While the mean level of miR-185 was very close to the PAG cells, miR-31 levels were clearly higher even than PAG cells (Figure 3). [score:1]
In contrast, very little is known about miR-184, miR-185 and miR-204 in cancer. [score:1]
Concurring with these results, ex-vivo weighing of tumor explants upon termination of the experiments confirmed that the average tumor mass of both miR-34a and miR-185 transducatnts was lower than Mock-transduced tumors (Figure 7B). [score:1]
Remarkably, we describe new miRNAs with little information regarding their role in cancer, such as miR-185. [score:1]
The effect of the Suppressive miRNAs, miR-34a and miR-185 on tumor growth was measured following subcutaneous injection of 3×10 [5] HAG transductants. [score:1]
[1 to 20 of 11 sentences]
25
[+] score: 20
Other miRNAs from this paper: hsa-let-7c, hsa-let-7d, hsa-mir-16-1, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-28, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-99a, hsa-mir-101-1, hsa-mir-16-2, mmu-let-7g, mmu-let-7i, mmu-mir-27b, mmu-mir-30a, mmu-mir-99a, mmu-mir-101a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-128-1, mmu-mir-9-2, mmu-mir-142a, mmu-mir-144, mmu-mir-145a, mmu-mir-151, mmu-mir-152, mmu-mir-185, mmu-mir-186, mmu-mir-24-1, mmu-mir-203, mmu-mir-205, hsa-mir-148a, hsa-mir-34a, hsa-mir-203a, hsa-mir-205, hsa-mir-210, hsa-mir-221, mmu-mir-301a, mmu-let-7d, hsa-let-7g, hsa-let-7i, hsa-mir-27b, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-142, hsa-mir-144, hsa-mir-145, hsa-mir-152, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125b-2, hsa-mir-126, hsa-mir-186, mmu-mir-148a, mmu-mir-200a, mmu-let-7c-1, mmu-let-7c-2, mmu-mir-16-1, mmu-mir-16-2, mmu-mir-21a, mmu-mir-24-2, mmu-mir-29a, mmu-mir-31, mmu-mir-34a, mmu-mir-148b, mmu-mir-339, mmu-mir-101b, mmu-mir-28a, mmu-mir-210, mmu-mir-221, mmu-mir-9-1, mmu-mir-9-3, mmu-mir-125b-1, mmu-mir-128-2, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-301a, hsa-mir-151a, hsa-mir-148b, hsa-mir-339, hsa-mir-335, mmu-mir-335, hsa-mir-449a, mmu-mir-449a, hsa-mir-450a-1, mmu-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-450a-2, hsa-mir-503, mmu-mir-486a, mmu-mir-542, mmu-mir-450a-2, mmu-mir-503, hsa-mir-542, hsa-mir-151b, mmu-mir-301b, mmu-mir-146b, mmu-mir-708, hsa-mir-708, hsa-mir-301b, hsa-mir-1246, hsa-mir-1277, hsa-mir-1307, hsa-mir-2115, mmu-mir-486b, mmu-mir-28c, mmu-mir-101c, mmu-mir-28b, hsa-mir-203b, hsa-mir-5680, hsa-mir-5681a, mmu-mir-145b, mmu-mir-21b, mmu-mir-21c, hsa-mir-486-2, mmu-mir-126b, mmu-mir-142b, mmu-mir-9b-2, mmu-mir-9b-1, mmu-mir-9b-3
Of the miRNAs down-regulated in the metastatic xenografts, miR-185 has been shown to suppress growth and progression of certain human cancers (e. g., breast, ovary) by targeting the Six1 oncogene which regulates c-myc expression [60]. [score:11]
Furthermore, some of the differentially expressed miRNAs have been reported to play a role in the metastasis of other types of cancer, for example, the up-regulated miRNAs, let-7i, miR-9, miR-30a, miR-125b, miR-142-5p, miR-151-3p, miR-450a and the down-regulated miRNAs, miR-24, mir-145, miR-146b-5p, miR-185, miR-186, miR-203 and miR-335. [score:9]
[1 to 20 of 2 sentences]
26
[+] score: 19
For example, the oncogenic miR-185 was significantly up-regulated in ccRCC and anti-correlated with the tumor suppressor gene PTEN, suggesting that its gain of function shuts down PTEN in ccRCC. [score:6]
Another identified target of miR-185 was PTPN13 (also a predicted miR-185 target in miRBase: http://microrna. [score:5]
For instance, loss of miR-149, miR-200c and mir-141 causes gain of function of oncogenes (KCNMA1, LOX), VEGFA and SEMA6A respectively and increased levels of miR-142-3p, miR-185, mir-34a, miR-224, miR-21 cause loss of function of tumor suppressors LRRC2, PTPN13, SFRP1, ERBB4, and (SLC12A1, TCF21) respectively. [score:3]
KCNJ16, member of the potassium channel subfamily of membrane proteins, was also identified as a target of miR-185. [score:3]
As the p-values in Figure 4 indicate, we validate a strong anti-correlation signature between mRNA levels of (KCNMA1, LOX), VEGF, SEMA6A, (LRRC2, PTPN13), SFRP1, ERBB4, SLC12A1 and TCF21, and their identified regulators: miR-149, miR-200c, mir-141, miR-142-3p, miR-185, mir-34a, miR-224 and miR-21 respectively. [score:2]
[1 to 20 of 5 sentences]
27
[+] score: 19
A number of miRNAs are involved in the development of EC dysfunction, such as upregulated miR-185 in response to high glucose milieu [28], miR-99a in LPS-stimulated [38], and miR-149 in TNF-α -induced EC dysfunction through p38MAPK [36]. [score:5]
Plasma miR-155 (A) and miR-185 (B) were significantly upregulated in BMS patients with ISR compared to BMS and DES subjects without any complications, while miR-181b levels (C) were lower in those with ISR versus others without complication. [score:3]
In our study, TNF-α enhanced miR-146a, miR-155 and miR-185 expression in both EC cultures indicating the cellular inflammatory response and dysfunction as seen earlier [41]. [score:3]
However, everolimus caused significantly decreased miR-155 and miR-146a levels, with lower miR-185 expression (data not shown). [score:3]
First, plasma miR-155 (P = 0.006) and miR-185 (P<0.001) were significantly upregulated in BMS patients with ISR compared to BMS and DES subjects without any complication (Fig 7A and 7B). [score:3]
Quantification of circulating miR-155, miR-185 and miR-181b by RT-qPCR in plasma samples of BMS and DES patients. [score:1]
The circulating level of miR-155, miR-185 and miR-181b were quantified by RT-qPCR in the plasma samples of the entire patient population. [score:1]
[1 to 20 of 7 sentences]
28
[+] score: 18
[37] The upregulation of p38α (MAPK14) protein seen in the current human study may be owing to the decreased expression of miR-19a/b, members of the miR-17/92 cluster, or miR-185-5p, as they are predicted to target human MAPK14 (TargetScan release 7.0: http://www/targetscan. [score:12]
[33] Therefore, the underexpression of miR-17/92 cluster members, miR-185-5p and miR-106a/b, and subsequent upregulation of p38α may underlie the observed size reduction of patient-derived neurospheres and the decreased neural differentiation efficiency in patient-derived neurospheres. [score:6]
[1 to 20 of 2 sentences]
29
[+] score: 18
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-129-2, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
Uptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
OsmoticUptake of hyperosmotic 2% saline water resulted in upregulation of expression of miR-7b, miR-9, miR-29b, miR-137, and miR-451 and downregulation of miR-409, miR-107, miR-103, miR-185, and miR-320 in hypothalamus in mice (Lee et al. 2006). [score:9]
[1 to 20 of 2 sentences]
30
[+] score: 17
Emerging evidence demonstrates that miRNAs are critical regulators of lipid synthesis and FAO [81] resulting in defective cell metabolism and carcinogenesis [82] directly targeting key enzymes or transcription factors as oncogenes and tumor suppressors [81] as shown in Table  1. Table 1 miRNAs involved in cancer metabolic plasticity MiRNAs Target Reference miR-122 Cholesterol biosynthesis 88– 90 miR-370 Fatty acid oxidation, CPT1A [91] miR-378/378* Lipid metabolism, CrAT 92, 93 miR-335 Lipid metabolism and adipogenesis [94] miR-205 Lipid metabolism [95] miR-143 Adipocyte differentiation [96] miR-27 Adipolysis [97] miR-33a/b Cholesterol efflux and β-oxidation 98– 100 miR-185 Lipogenesis and cholesterogenesis [101] miR-342 Lipogenesis and cholesterogenesis [101] miR-124 CPT1A [27] miR-129 CACT 27, 102 MiR-122 was the first miRNA identified as tissue-specific, and it is the most abundant in liver involved in lipid metabolic reprogramming [83]. [score:9]
Furthermore, in prostate cancer cells, miR-185 and miR-342 control lipogenesis and cholesterogenesis by reducing the expression of SREBP-1/2 and downregulating their targeted genes, including fatty acid synthase [96]. [score:8]
[1 to 20 of 2 sentences]
31
[+] score: 16
For example, overexpression of miR-185 was shown to inhibit autophagy and apoptosis of dopaminergic cells in Parkinson’s disease, potentially via regulation of the AMPK/mTOR signaling pathway [113]. [score:8]
Wen Z. Zhang J. Tang P. Tu N. Wang K. Wu G. Overexpression of mir185 inhibits autophagy and apoptosis of dopaminergic neurons by regulating the ampk/mtor signaling pathway in parkinson’s diseaseMol. [score:8]
[1 to 20 of 2 sentences]
32
[+] score: 15
For top 10 downregulated microRNAs (hsa-miR-106b-5p, hsa-miR-26b-5p, hsa-miR-494, hsa-miR-425-5p, hsa-miR-363-3p, hsa-miR-15b-5p, hsa-miR-185-5p, hsa-miR-150-5p, hsa-miR-223-3p, hsa-miR-142-5p), we included those have been shown to be deregulated in cancer (having no controversial expression status; some of these microRNAs have been shown to be upregulated in some cancer types, whereas, downregulated in other cancer types), and have either expression data or functional studies in stem cells. [score:15]
[1 to 20 of 1 sentences]
33
[+] score: 15
Interestingly, miR-151-3p and miR-185 have partially overlapping target sequences in the full-length isoform and, in a similar way, miR-128, miR-509 and miR-768-5p target the same segment of the 3'UTR of the truncated isoform (Figure 1B). [score:5]
We could detect a reduction in ERK phosphorylation with miR-151-3p but not with miR-185 (Figure 3B), which is consistent with the reduction observed in the levels of FL-NTRK3 after overexpression of miR-151-3p. [score:3]
The specific luciferase activity of the pGL4.13-FL construct was significantly decreased by 2 miRNAs predicted to target the full-length isoform (miR-151-3p and miR-185, Figure 1A). [score:3]
In agreement with the luciferase assay data, FL-NTRK3 levels were significantly reduced by miR-151-3p (34%); a slight inhibition was also observed with miR-185, but did not reach statistical significance (Figure 3A). [score:2]
The strongest repression was observed with miR-185 (54% reduction), followed by miR-151-3p (20%). [score:1]
Luciferase-validated miRNAs were therefore transfected into either undifferentiated (miR-128, miR-324-5p, miR-330, miR-485-3p, miR-509, miR-625, miR-765 and miR-768-5p) or differentiated SH-SY5Y cells (miR-151-3p and miR-185), and protein levels were assessed by western blotting 72 h after transfection. [score:1]
[1 to 20 of 6 sentences]
34
[+] score: 13
MicroRNA-195 which was significantly decreased with simulated microgravity (p = 0.0083) is predicted to inhibit RAD50 expression (using miRanda, miRDB, miRWalk, and Targetscan databases), and microRNA-185 which was also decreased with simulated microgravity (p = 0.028) is predicted to inhibit RAD23A expression (using miRanda, miRWalk, TargetScan databases). [score:13]
[1 to 20 of 1 sentences]
35
[+] score: 12
The results revealed that six miRNAs (miR-570, miR-122, miR-34b, miR-29c, miR-922, and miR-185) were able to downregulate 79 target genes involved in various processes, such as the immune response, inflammation, and glutathione metabolism [100]. [score:6]
In mice with AFL, miR-199-3p, miR-214, miR-93, miR-146a, miR-191, and let-7b are downregulated and miR-129, miR-490, miR-21, miR-503, miR-183, and miR-185 are upregulated compared with healthy mice [103]. [score:6]
[1 to 20 of 2 sentences]
36
[+] score: 11
Indeed, miR-185 is a key micro -RNA identified as a regulator of de novo cholesterol biosynthesis and low-density lipoprotein uptake; inhibition of miR-185 resulted in decreased SREBP-2 -dependent gene expression, LDL uptake, and HMG-CoA reductase activity [37]. [score:6]
Interestingly, the LowI diet modified the expression of two mir-185 target genes, which are involved in cholesterol biosynthesis (S5 Table), suggesting that this miRNA may also play a role in liver lipid metabolism along with the above-mentioned TFs. [score:5]
[1 to 20 of 2 sentences]
37
[+] score: 11
This targeting mode is similar to miR-185-3p (a potential target sequence in the protein coding region of c-Myc mRNA [24]), while distinct from other c-Myc targeting miRNAs such as miR-145, let-7a, miR-24(target sites in 3’UTR of c-Myc [25– 27]). [score:9]
Several miRNA are known to be regulators of c-Myc in various different cancers including miR-24 in leukemia [26], miR-145 in oral squamous cell carcinoma [25], let-7a in burkitt lymphoma [27], miR-34a in renal cell carcinoma [33] and miR-185-3p in CRC [24]. [score:2]
[1 to 20 of 2 sentences]
38
[+] score: 11
Wang X. C. Zhan X. R. Li X. Y. Yu J. J. Liu X. M. MicroRNA-185 regulates expression of lipid metabolism genes and improves insulin sensitivity in mice with non-alcoholic fatty liver disease World J. Gastroenterol. [score:5]
Lee K. H. Kim S. H. Lee H. R. Kim W. Kim D. Y. Shin J. C. Yoo S. H. Kim K. T. MicroRNA-185 oscillation controls circadian amplitude of mouse Cryptochrome 1 via translational regulation Mol. [score:3]
Yang M. Liu W. Pellicane C. Sahyoun C. Joseph B. K. Gallo-Ebert C. Donigan M. Pandya D. Giordano C. Bata A. Identification of miR-185 as a regulator of de novo cholesterol biosynthesis and low density lipoprotein uptake J. Lipid Res. [score:2]
miR-185, a microRNA involved in cholesterol metabolism [135, 136, 137], and modulated by palmitic acid in HepG2 cells [138] decreases Cry1 levels in murine mo dels [139]. [score:1]
[1 to 20 of 4 sentences]
39
[+] score: 11
Recently, Xiang et al. [32] reported that miR-152 and miR-185 were significantly downregulated in the S KOV3/DDP and A2780/DDP cells, compared with their sensitive parent line S KOV3 and A2780, and up -regulating the expression of miR-152 or miR-185 increased cisplatin sensitivity of S KOV3/DDP and A2780/DDP cells by suppressing DNA methyltransferase 1 (DNMT1) directly. [score:9]
Inconsistently, miR-152 and miR-185(decreased by 0.4 and 0.6 times in A2780/DDP cells compared with A2780 cells in Xiang’s study) was found to be up- or down-regulated in less than two times in A2780/DDP cells compared with A2780 cells, so these miRNAs were not listed as miRNAs of interest. [score:2]
[1 to 20 of 2 sentences]
40
[+] score: 11
miR-185 is downregulated in glioma cells in association with loss of heterozygosity (LOH), and its restoration reduces global DNA methylation and leads to re -expression of hypermethylated genes through targeting DNMT1 (Zhang et al., 2011b). [score:8]
MiR-185 targets the DNA methyltransferases 1 and regulates global DNA methylation in human glioma. [score:3]
[1 to 20 of 2 sentences]
41
[+] score: 10
Although a variety of protein -associated mechanisms have been shown to be involved for its highly expression in cancers [19], several miRNA such as miR-24, miR-22, miR-145, let-7a,miR-34a, miR-185-3p were reported as regulators of c-Myc [24]. [score:4]
However, miR-185-3p and miR-744 in our study have been reported to target protein-coding sequence of c-Myc mRNA. [score:3]
This is clearly distinct from the recently reported c-Myc targeting miR-24 [24], miR-145 [25] and let-7a [26], but is similar to miR-185-3p [27]. [score:3]
[1 to 20 of 3 sentences]
42
[+] score: 10
One of miR-185 target genes is AKT1, which is involved in the PI3K/Akt signaling pathway [40], which is often altered in EAC and involved in the development of the disease. [score:6]
Abnormal expression of mir-185 has been observed in several types of cancer including prostate [38], breast [39] and endometrial cancer [11]. [score:3]
Two additional miRNAs (mir-34a and mir-185) that are involved in many types of cancer [25, 26] were included. [score:1]
[1 to 20 of 3 sentences]
43
[+] score: 9
Amongst these linked miRNAs and circRNAs, we found circRNA-103890 (upregulated) generated by FAM169A (Gene ID: 26049, NM_015566 ) interacts with miR-185-5p (downregulated) (Figure 5C, Supplementary Figure S1). [score:7]
Similarly, we found ciRF-1301-3p (circRNA family binding with miR-1301-3p) with 23 members (Figure 3B), ciRF-328-5p (circRNA family binding with miR-328-5p) with 12 members (Figure 3C), cirRF-185-5p (circRNA family binding with miR-185-5p) with 11 members (Figure 3D). [score:1]
Moreover, FCHO1as (circRNA-001396), antisense to FCHO1, harbors 13 binding sites for miR-328-5p (Figure 3E); whereas IL4Rex (circRNA-000684), exonic spliced from IL4R, harbors 5 binding sites for miR-185-5p (Figure 3F). [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 9
Oncogenic miRNA hsa-miR-574 is upregulated and tumor suppressor miRNAs such as hsa-let-7i, hsa-miR-34a, hsa-miR-185 and hsa-miR-31 are downregulated (Zhao et al., 2015). [score:9]
[1 to 20 of 1 sentences]
45
[+] score: 8
High expression of miR-185 and low expression of miR-133b were correlated with poor survival and metastasis in colorectal cancer [84], which suggest the potential prognostic values of these miRNAs for predicting clinical outcome after surgery, miR-1 and mir-133b have been significantly downregulated in recurrent PCa specimens and can serve as novel biomarkers for prediction of PCa progression [85]. [score:8]
[1 to 20 of 1 sentences]
46
[+] score: 8
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-129-2, hsa-mir-146a, hsa-mir-150, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
Moreover, GC patients with over -expression of miR-107 [28, 29, 30], miR-143 [40], miR-145 [41, 42], miR-181b/c [17, 47, 48, 55, 56], miR-196a/b [59], miR-20b [23, 66], miR-23a/b [77, 78, 79], miR-34 [17, 47, 48, 55, 56] and miR-630 [100] and decreased expression of miR-1 [111], miR-1207-5p [121], miR-125a-3p/-5p [24, 125, 126, 127], miR-185 [140], miR-193b [60], miR-20a [111], miR-206 [150, 151], miR-215 [142], miR-217 [153], miR-27a [111], miR-29c [169], miR-34a [172, 173], miR-423-5p [111], and miR-520d-3p [99] indicate advanced tumor stage or TNM stage. [score:5]
Tan Z. Jiang H. Wu Y. Xie L. Dai W. Tang H. Tang S. miR-185 is an independent prognosis factor and suppresses tumor metastasis in gastric cancer Mol. [score:3]
[1 to 20 of 2 sentences]
47
[+] score: 8
Other miRNAs from this paper: hsa-mir-544a, hsa-mir-544b
The histone acetyl transferase Tip60 was shown to be up-regulated and HDAC1 to be down-regulated in an miR-185-independent manner, thus inducing cell cycle arrest by regulating cell cycle proteins in GC cells [24]. [score:8]
[1 to 20 of 1 sentences]
48
[+] score: 8
When DNMT1, DNMT3A and DNMT3B were decreased by dendrosomal CUR treatment, increased expression of MEG3 occurred which was due to elevated expression of miR-29a and miR-185. [score:5]
miR-29a was determined to inhibit DNMT3A and DNMT3B and miR-185 was shown to affect DNMT1. [score:3]
[1 to 20 of 2 sentences]
49
[+] score: 7
The top five differentially upregulated miRNAs in HCC (Table  5) were: miR-142 (1 million-fold), miR-7704 (257-fold), miR-101 (147-fold), miR-23a (124-fold), and miR-22 (85-fold); whereas, the top five downregulated were: miR-122 (513-fold), Let-7g (358-fold), miR-378c (187-fold), miR-185 (68-fold), and miR-451a (58-fold). [score:7]
[1 to 20 of 1 sentences]
50
[+] score: 7
As a result, we selected 11 miRNAs (miR-27a, miR-27b, miR-145, miR-185, miR-197, miR-203, miR-221, miR-222, miR-338-3p, miR-376a, and miR-376b) that were potentially regulated by CD82 to target FZD2, -3, -5, -7, and -9 for further study (Table 1). [score:4]
No significant differences in miR-27a, miR-27b, miR-145, miR-185, miR-197, miR-221, miR-222, miR-376a, or miR-376b expression levels were observed between h1299/zeo and h1299/CD82 cells (Fig 1). [score:3]
[1 to 20 of 2 sentences]
51
[+] score: 7
RNCR3 can act as ceRNA with miR-185-5p to regulate its target gene kruppel-like factor 2 (KLF2) as observed by using a luciferase reporter assay and the gene knockdown technique to silence the expression of RNCR3. [score:6]
The RNCR3/miR-185-5p/KLF2 complex was also involved in atherosclerosis and DM -induced retinal microvascular abnormalities. [score:1]
[1 to 20 of 2 sentences]
52
[+] score: 6
Among the fifteen miRNAs in the top group, two miRNAs were highly likely to be upregulated, i. e., hsa-miR-24and hsa-miR-885-5p, whereas thirteen miRNAs were highly likely to be downregulated, i. e., hsa-miR-26b, hsa-let-7b, hsa-miR-185, hsa-miR-142-3p, hsa-miR-29b, hsa-miR-483-5p, hsa-miR-144*, hsa-miR-145*, hsa-miR-629*, hsa-miR-222*, hsa-miR-497, hsa-miR-675 and hsa-miR-106b*, in the eutopic endometrium of patients with endometriosis compared with the controls (Table 2). [score:6]
[1 to 20 of 1 sentences]
53
[+] score: 6
Although the mechanisms regulating decreased Elk1 expression in pulmonary fibrosis are unclear, Elk1 is a target of mir-185, which is increased in lung tissue from patients suffering from rapidly progressive IPF (36). [score:6]
[1 to 20 of 1 sentences]
54
[+] score: 6
Figure S3The relations in the five miRNAs (has-miR 34a, miR-432, miR-548d, miR-659 and miR-185) expression levels between two platforms of miRNA quantification, the array -based TLDA vs. [score:3]
To confirm the comparability of TLDA -based genome-wide profiling with individual quantifications, we randomly chose 10 patients and 10 controls from the learning set and further quantified these subjects' expression levels of five miRNAs (has-miR 34a, miR-432, miR-548d, miR-659 and miR-185) using quantitative RT-PCR. [score:3]
[1 to 20 of 2 sentences]
55
[+] score: 6
and 36 significantly down-regulated expression miRs (miR-433, let-7g, miR-125a-5p, miR-760, miR-206, miR-26a, miR-200b, miR-185, etc. ) [score:6]
[1 to 20 of 1 sentences]
56
[+] score: 6
detected the expression profile of miRNAs from blood samples of influenza A H1N1 virus-infected patients and then exhibited that the expression levels of 193 miRNA molecules were altered in all influenza patients, of which 16 highly dysregulated miRNAs (miR-1260, miR-1285, miR-18a, miR-185*, miR-299-5p, miR-26a, miR-30a, miR-335*, miR-34b, miR-519e, miR-576-3p, miR-628-3p, miR-664, miR-665, miR-765 and miR-767-5p) were able to provide a clear distinction between infected and healthy individuals [39]. [score:6]
[1 to 20 of 1 sentences]
57
[+] score: 6
System -based proteomic and metabonomic analysis of the Df(16)A /− mouse identifies potential miR-185 targets and molecular pathway alterations. [score:3]
Interestingly, the implicated pathways were linked to one of the proteomic candidates, O-Linked N-acetylglucosaminyltransferase (OGT1), a predicted miR-185 target and a new mechanism associated with 22q11DS, which may be linked to a cognitive dysfunction and an increased risk of developing schizophrenia (Wesseling et al., 2016). [score:3]
[1 to 20 of 2 sentences]
58
[+] score: 6
Figure 2 Table 3 MiRNAs Confirmation Ranks hsa-mir-507 dbDEMC2.0 1 hsa-mir-30e dbDEMC2.0 2 hsa-mir-9-2 dbDEMC2.0;Mir2desease 3 hsa-mir-520f dbDEMC2.0 4 hsa-mir-132 dbDEMC2.0 5 hsa-mir-424 dbDEMC2.0 6 hsa-mir-431 dbDEMC2.0 7 hsa-mir-34b dbDEMC2.0 8 hsa-mir-149 dbDEMC2.0 9 hsa-mir-185 dbDEMC2.0 10 Inputs: RDnet, denoted as G (V, E, W); specific disease d. Outputs: Top ranked d-related miRNA candidates. [score:3]
Figure 2 Table 3 MiRNAs Confirmation Ranks hsa-mir-507 dbDEMC2.0 1 hsa-mir-30e dbDEMC2.0 2 hsa-mir-9-2 dbDEMC2.0;Mir2desease 3 hsa-mir-520f dbDEMC2.0 4 hsa-mir-132 dbDEMC2.0 5 hsa-mir-424 dbDEMC2.0 6 hsa-mir-431 dbDEMC2.0 7 hsa-mir-34b dbDEMC2.0 8 hsa-mir-149 dbDEMC2.0 9 hsa-mir-185 dbDEMC2.0 10 Inputs: RDnet, denoted as G (V, E, W); specific disease d. Outputs: Top ranked d-related miRNA candidates. [score:3]
[1 to 20 of 2 sentences]
59
[+] score: 6
These same Authors have also shown that selenium intake could alter the expression of some miRNAs, where miR-185 likely plays a role in the regulation of GPX2 and SEPHS2 expression [35]. [score:6]
[1 to 20 of 1 sentences]
60
[+] score: 6
These circRNAs included; circ-MYLK and circ-CTDP1, which have MREs for miR-29a-3p that targets DNMT3B, ITGB1, VEGFA and HAS3; and circ-PC, which has an MRE for miR-185-3p that targets ADD1and BAP1 [100]. [score:5]
Three miRs (miR-33b, miR-93, and miR-185) were predicted to be sponged by circCCDC66. [score:1]
[1 to 20 of 2 sentences]
61
[+] score: 5
Altered hepatic lipid metabolism has also been attributed to other miRNAs, including miR-185 and miR-130b, which were shown to be downregulated by HCV. [score:4]
It is noteworthy that miR-27a/b, miR-185, miR-130b, and miR-146a-5p mentioned above are all mimic screen hits in our study (Supplementary Data  1). [score:1]
[1 to 20 of 2 sentences]
62
[+] score: 5
Other miRNAs from this paper: hsa-mir-26b
Ma X MicroRNA-185 inhibits cell proliferation and induces cell apoptosis by targeting VEGFA directly in von Hippel-Lindau-inactivated clear cell renal cell carcinomaUrol. [score:5]
[1 to 20 of 1 sentences]
63
[+] score: 5
The down regulation of miR-185-5p after bacterial stimulation in AthSMCs was in line with studies on carotid plaques without bacterial stimulation (Raitoharju et al. 2011; Raitoharju et al. 2013) suggesting that bacterial stimulation per se does not change the direction of miRNA expression. [score:5]
[1 to 20 of 1 sentences]
64
[+] score: 5
Other miRNAs from this paper: hsa-mir-217, hsa-mir-152, hsa-mir-126, hsa-mir-148b
Previously, it was shown that miR-185 and GKN1-miR-185-DNMT1 axis can suppress breast carcinoma proliferation and inhibit hepatocellular carcinoma growth [17, 18]. [score:5]
[1 to 20 of 1 sentences]
65
[+] score: 5
As well, the observed difference between the expression pattern of individual let-7 family members and of other highly expressed microRNAs (eg, miR-142, miR-185 and miR-126), versus that previously published by our group [9] may also pertain, in addition to interindividual variations, to the microRNA detection method used, i. e. microarray [9], a hybridization -based approach that may yield different results depending on the normalization procedure, versus the more advanced high-throughput sequencing technology (this study). [score:5]
[1 to 20 of 1 sentences]
66
[+] score: 5
Lu et al. reported that miR-185 suppressed cell growth and invasion via targeting the hypoxia-inducible factor-2α pathway in vitro and in vivo in colorectal cancer [16]. [score:5]
[1 to 20 of 1 sentences]
67
[+] score: 5
Other miRNAs from this paper: mmu-mir-185
T1 is a major TrkB isoform in astrocytes, and its expression was shown to be reduced in the cortex of suicide completers via binding its 3′UTR by a microRNA Hsa-miR-185* (Maussion et al., 2012). [score:3]
Regulation of a truncated form of tropomyosin-related kinase B (TrkB) by Hsa-miR-185* in frontal cortex of suicide completers. [score:2]
[1 to 20 of 2 sentences]
68
[+] score: 5
Primer Sequence (5'-3') ssc-miR-128-forward TCACAGTGAACCGGTCTCTTT ssc-miR-15b-forward TAGCAGCACATCATGGTTTACA ssc-miR-185-forward TGGAGAGAAAGGCAGTTCCTGA ssc-miR-221-3p-forward AGCTACATTGTCTGCTGGGTTT ssc-miR-378-forward ACTGGACTTGGAGTCAGAAGGC ssc-miR-novel-43-forward TTCAAGTAACCCAGGATAGGCT ssc-miR-novel-269-forward TACCCATTGCATATCGGAGTTG miR-reverse GTCGGTGTCGTGGAGTCG U6-forward TCGCTTTGGCAGCACCTAT U6-reverse AATATGGAACGCTTCGCAAA Poly(T) adapter GTCGGTGTCGTGGAGTCGTTTGCAATTGCACTGGATTTTTTTTTTTTTTTTTTV V = A, G, C. Figure 4 Validation of miRNA expression by RT-qPCR. [score:2]
Primer Sequence (5'-3') ssc-miR-128-forward TCACAGTGAACCGGTCTCTTT ssc-miR-15b-forward TAGCAGCACATCATGGTTTACA ssc-miR-185-forward TGGAGAGAAAGGCAGTTCCTGA ssc-miR-221-3p-forward AGCTACATTGTCTGCTGGGTTT ssc-miR-378-forward ACTGGACTTGGAGTCAGAAGGC ssc-miR-novel-43-forward TTCAAGTAACCCAGGATAGGCT ssc-miR-novel-269-forward TACCCATTGCATATCGGAGTTG miR-reverse GTCGGTGTCGTGGAGTCG U6-forward TCGCTTTGGCAGCACCTAT U6-reverse AATATGGAACGCTTCGCAAA Poly(T) adapter GTCGGTGTCGTGGAGTCGTTTGCAATTGCACTGGATTTTTTTTTTTTTTTTTTV V = A, G, C. Figure 4 Validation of miRNA expression by RT-qPCR. [score:2]
Seven candidate miRNAs were randomly selected: two novel miRNAs (ssc-miR-novel-43 and ssc-miR-novel-269) and five known miRNAs (ssc-miR-128, ssc-miR-15b, ssc-miR-185, ssc-miR-221-3p and ssc-mir-378). [score:1]
[1 to 20 of 3 sentences]
69
[+] score: 5
Other miRNAs from this paper: hsa-mir-152, hsa-mir-126, hsa-mir-200c, hsa-mir-377
Additionally, post-transcriptional gene silencing by microRNAs, including miR-152, miR-185, miR-126 and miR-377, which directly interact with the3'-UTR of DMNT1 mRNA, could be important in the regulation of DMNT1 expression [14- 17]. [score:5]
[1 to 20 of 1 sentences]
70
[+] score: 5
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-29a, hsa-mir-31, hsa-mir-99a, hsa-mir-100, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-208a, hsa-mir-30c-2, hsa-mir-147a, hsa-mir-10a, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-204, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-125b-1, hsa-mir-132, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-193a, hsa-mir-195, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-30c-1, hsa-mir-219a-2, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-302d, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-330, hsa-mir-328, hsa-mir-342, hsa-mir-325, hsa-mir-424, hsa-mir-429, hsa-mir-450a-1, hsa-mir-486-1, hsa-mir-146b, hsa-mir-497, hsa-mir-520e, hsa-mir-520f, hsa-mir-520a, hsa-mir-520b, hsa-mir-520c, hsa-mir-520d, hsa-mir-520g, hsa-mir-520h, hsa-mir-450a-2, hsa-mir-503, hsa-mir-608, hsa-mir-625, hsa-mir-629, hsa-mir-663a, hsa-mir-1271, hsa-mir-769, hsa-mir-378d-2, hsa-mir-675, hsa-mir-147b, hsa-mir-374b, hsa-mir-663b, hsa-mir-378b, hsa-mir-378c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-4661, hsa-mir-219b, hsa-mir-203b, hsa-mir-378j, hsa-mir-486-2
Maciel-Dominguez A. Swan D. Ford D. Hesketh J. Selenium alters miRNA profile in an intestinal cell line: Evidence that miR-185 regulates expression of GPX2 and SEPSH2Mol. [score:4]
The miRNAs that are most affected are miR-185, miR-625, miR-203, and miR-429. [score:1]
[1 to 20 of 2 sentences]
71
[+] score: 4
Li G, Wang Y, Liu Y, Su Z, Liu C, Ren S, et al. miR-185-3p regulates nasopharyngeal carcinoma radioresistance by targeting WNT2B in vitro. [score:4]
[1 to 20 of 1 sentences]
72
[+] score: 4
Moreover, miR-145 (Sachdeva et al, 2009), miR-34a (Christoffersen et al, 2010), miR-24 (Lal et al, 2009), miR-141 (Zhang et al, 2010), miR-185-3p (Liao & Lu, 2011) and let-7 (Melton et al, 2010) are found to repress c-Myc expression directly and adversely affect c-Myc's oncogenic function. [score:4]
[1 to 20 of 1 sentences]
73
[+] score: 4
GKN1–miR-185–DNMT1 axis suppresses gastric carcinogenesis through regulation of epigenetic alteration and cell cycle. [score:4]
[1 to 20 of 1 sentences]
74
[+] score: 4
The selected highly expressed miRNAs are hsa-let-7a-5p, hsa-mir-103a-3p, hsa-mir-148a-3p, hsa-mir-16-5p, hsa-mir-185-5p and the patterns appear to be similar across the four samples. [score:3]
Number of isomiRs of hsa-let-7a-5p was found to be highest followed by hsa-mir-185-5p, hsa-mir-16-5p, hsa-mir-148a-3p, hsa-mir-103a-3p (in descending order). [score:1]
[1 to 20 of 2 sentences]
75
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-98, hsa-mir-99a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-10a, hsa-mir-10b, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-181a-1, hsa-mir-221, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-30b, hsa-mir-130a, hsa-mir-152, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-193a, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-181b-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-99b, hsa-mir-130b, hsa-mir-30e, hsa-mir-363, hsa-mir-374a, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-331, hsa-mir-339, hsa-mir-423, hsa-mir-20b, hsa-mir-491, hsa-mir-193b, hsa-mir-181d, hsa-mir-92b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, bta-mir-29a, bta-let-7f-2, bta-mir-148a, bta-mir-18a, bta-mir-20a, bta-mir-221, bta-mir-27a, bta-mir-30d, bta-mir-320a-2, bta-mir-99a, bta-mir-181a-2, bta-mir-27b, bta-mir-30b, bta-mir-106a, bta-mir-10a, bta-mir-15b, bta-mir-181b-2, bta-mir-193a, bta-mir-20b, bta-mir-30e, bta-mir-92a-2, bta-mir-98, bta-let-7d, bta-mir-148b, bta-mir-17, bta-mir-181c, bta-mir-191, bta-mir-200c, bta-mir-22, bta-mir-29b-2, bta-mir-29c, bta-mir-423, bta-let-7g, bta-mir-10b, bta-mir-24-2, bta-mir-30a, bta-let-7a-1, bta-let-7f-1, bta-mir-30c, bta-let-7i, bta-mir-25, bta-mir-363, bta-let-7a-2, bta-let-7a-3, bta-let-7b, bta-let-7c, bta-let-7e, bta-mir-15a, bta-mir-19a, bta-mir-19b, bta-mir-331, bta-mir-374a, bta-mir-99b, hsa-mir-374b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, bta-mir-1-2, bta-mir-1-1, bta-mir-130a, bta-mir-130b, bta-mir-152, bta-mir-181d, bta-mir-182, bta-mir-185, bta-mir-24-1, bta-mir-193b, bta-mir-29d, bta-mir-30f, bta-mir-339a, bta-mir-374b, bta-mir-375, bta-mir-378-1, bta-mir-491, bta-mir-92a-1, bta-mir-92b, bta-mir-9-1, bta-mir-9-2, bta-mir-29e, bta-mir-29b-1, bta-mir-181a-1, bta-mir-181b-1, bta-mir-320b, bta-mir-339b, bta-mir-19b-2, bta-mir-320a-1, bta-mir-193a-2, bta-mir-378-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, bta-mir-148c, hsa-mir-374c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-378j, bta-mir-378b, bta-mir-378c, bta-mir-378d, bta-mir-374c, bta-mir-148d
Let-7a, let-7c, miR-181b, miR-185, miR-378 and miR-423-5p were predicted to target the inducible co-stimulatory molecule (ICOS), which plays a key role in regulating T-cell differentiation, T-cell proliferation, and secretion of lymphokines, providing effective help for antibody secretion by B cells [86]. [score:4]
[1 to 20 of 1 sentences]
76
[+] score: 4
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-96, hsa-mir-99a, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-16-2, hsa-mir-192, hsa-mir-199a-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-139, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-199a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-210, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-15b, hsa-mir-23b, hsa-mir-27b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-135a-1, hsa-mir-135a-2, hsa-mir-140, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-191, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-190a, hsa-mir-194-1, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-194-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-370, hsa-mir-373, hsa-mir-374a, hsa-mir-375, hsa-mir-376a-1, hsa-mir-151a, hsa-mir-148b, hsa-mir-331, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-18b, hsa-mir-20b, hsa-mir-429, hsa-mir-491, hsa-mir-146b, hsa-mir-193b, hsa-mir-181d, hsa-mir-517a, hsa-mir-500a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-637, hsa-mir-151b, hsa-mir-298, hsa-mir-190b, hsa-mir-374b, hsa-mir-500b, hsa-mir-374c, hsa-mir-219b, hsa-mir-203b
Enhanced MMP2 and MMP9Gramantieri et al., 2007; Meng et al., 2007; Li et al., 2008; Garofalo et al., 2009; Ji et al., 2009a; Pogribny et al., 2009; Wang et al., 2010; Song et al., 2013 miR-182 MetastasisWang et al., 2008, 2012b; Wong et al., 2008, 2010 miR-183 Onset and progression, ApoptosisWang et al., 2008; Wong et al., 2008, 2010; Liang et al., 2013 miR-185 MetastasisBudhu et al., 2008; Wong et al., 2008, 2010; Huang et al., 2009; Zhi et al., 2013 miR-192 Inhibition of DNA excision repairXie et al., 2011 miR-194 MetastasisBudhu et al., 2008; Huang et al., 2009; Meng et al., 2010; Xu et al., 2013 miR-195 Proliferation, colony formation. [score:3]
Metastasis-related miR-185 is a potential prognostic biomarker for hepatocellular carcinoma in early stage. [score:1]
[1 to 20 of 2 sentences]
77
[+] score: 4
Finally, c-myc mRNA stability and/or translation are negatively regulated by several microRNAs (miRNAs), such as Let-7 [19], miR-145 [20], miR-34c [21], miR-24 [22, 23], and miR-185 [24]. [score:4]
[1 to 20 of 1 sentences]
78
[+] score: 3
Other miRNAs from this paper: hsa-mir-15a, hsa-mir-146a, hsa-mir-195, hsa-mir-155
For example, miRNA-185-5p was shown to modulate chemosensitivity of human non-small cell lung cancer to cisplatin via targeting ABCC1 [25]. [score:3]
[1 to 20 of 1 sentences]
79
[+] score: 3
CASP3, CASP6 and BID that are involved in induction of apoptosis through death receptors were identified as potential targets of let-7, miR-26, miR-30 and miR-185. [score:3]
[1 to 20 of 1 sentences]
80
[+] score: 3
0046045.g001 Figure 1The scatter-plots show RT-PCR quantification cycle (C [q]) values and log [2]-transformed microarray signal values for microRNAs let-7e, miR-22, miR-30a-5p, miR-185, miR-210, and miR-423-5p (n = 11). [score:1]
The scatter-plots show RT-PCR quantification cycle (C [q]) values and log [2]-transformed microarray signal values for microRNAs let-7e, miR-22, miR-30a-5p, miR-185, miR-210, and miR-423-5p (n = 11). [score:1]
Six of the eight microRNAs, let-7e, miR-22, miR-30a-5p, miR-185, miR-210, and miR-423-5p, were detectable in more than half of the samples, and demonstrated significantly good Pearson correlation (|r| >0.6) between log [2]-transformed microarray signal and RT-PCR C [q] values, indicating validity of the microarray -based microRNA quantification (figure 1). [score:1]
[1 to 20 of 3 sentences]
81
[+] score: 3
MicroRNAs microRNA-15b, microRNA-16, microRNA-22, and microRNA-185 were found to have strong positive correlation with the appearance of erythroid surface antigens (CD71, CD36, and CD235a) and hemoglobin synthesis, while microRNA-28 displayed an inverse relationship with the expression of these markers. [score:3]
[1 to 20 of 1 sentences]
82
[+] score: 3
Xu J Ai Q Cao H Liu Q MiR-185-3p and miR-324-3p predict radiosensitivity of nasopharyngeal carcinoma and modulate cancer cell growth and apoptosis by targeting SMAD7Med Sci Monit. [score:3]
[1 to 20 of 1 sentences]
83
[+] score: 3
Among these globally effective miRNAs, candidates previously reported to regulate apoptosis in certain human and mouse cell types such as miR-133a-5p, miR-96-5p, miR-185-5p, miR-511-3p [26– 29] were identified to induce significant high apoptosis rates (Figure 2A). [score:2]
Interestingly, in case of miR-185-5p the passenger strand was identified to significantly induce apoptosis at high rates in S KOV3 (36.9% ± 1.0%) and HCT 116 cells (36.6% ± 3.7%). [score:1]
[1 to 20 of 2 sentences]
84
[+] score: 3
Other miRNAs from this paper: hsa-mir-16-1, hsa-mir-21, hsa-mir-16-2, hsa-mir-132, hsa-mir-146a
High concentration of phthalates in urine was found to be associated with a decrease in the expression of miR-185 in placenta [178]. [score:3]
[1 to 20 of 1 sentences]
85
[+] score: 3
They further demonstrated that endothelial cell function was regulated through RNCR3/KLF2/miR-185-5p regulatory network. [score:3]
[1 to 20 of 1 sentences]
86
[+] score: 3
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-21, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-98, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-198, hsa-mir-148a, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-205, hsa-mir-210, hsa-mir-181a-1, hsa-mir-222, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-23b, hsa-mir-27b, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-132, hsa-mir-137, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-144, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-134, hsa-mir-136, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-186, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-128-2, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-299, hsa-mir-26a-2, hsa-mir-373, hsa-mir-376a-1, hsa-mir-342, hsa-mir-133b, hsa-mir-424, hsa-mir-429, hsa-mir-433, hsa-mir-451a, hsa-mir-146b, hsa-mir-494, hsa-mir-193b, hsa-mir-455, hsa-mir-376a-2, hsa-mir-33b, hsa-mir-644a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-301b, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-320e, hsa-mir-3613, hsa-mir-4668, hsa-mir-4674, hsa-mir-6722
Several studies demonstrated that miRNA-148a, miRNA-17-5p, miRNA-137, miRNA-181c, miRNA-101, miRNA-184, miRNA-15a, miRNA-185, and miRNA-210 are few of those miRNAs that are expressed in AD (Lukiw, 2007; Cogswell et al., 2008; Hébert et al., 2008; Geekiyanage and Chan, 2011; Wang et al., 2011). [score:3]
[1 to 20 of 1 sentences]
87
[+] score: 3
MicroRNAs miR-15b, miR-16, miR-22, and miR-185 were found to have strong positive correlation with the appearance of erythroid surface antigens (CD71, CD36, and CD235a) and hemoglobin synthesis, while miR-28 displayed an inverse relationship with the expression of these markers [7]. [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
Wang J. He J. Su F. Ding N. Hu W. Yao B. Wang W. Zhou G. Repression of atr pathway by miR-185 enhances radiation -induced apoptosis and proliferation inhibition Cell Death Dis. [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
Other miRNAs from this paper: hsa-mir-148a, hsa-mir-152, hsa-mir-148b
In addition, Xiang et al. reported that DNMT1 is a key target for miR-152 and miR-185 in ovarian cancer cisplatin resistance in vitro and in vivo [20]. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-101-1, hsa-mir-139, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-142, hsa-mir-144, hsa-mir-127, hsa-mir-154, hsa-mir-195, hsa-mir-29c, hsa-mir-101-2, hsa-mir-380, hsa-mir-381, hsa-mir-323a, hsa-mir-520e, hsa-mir-520a, hsa-mir-518c, hsa-mir-520d, hsa-mir-518a-1, hsa-mir-518d, hsa-mir-518a-2, hsa-mir-519a-1, hsa-mir-519a-2, hsa-mir-513a-1, hsa-mir-513a-2, hsa-mir-509-1, hsa-mir-576, hsa-mir-548a-1, hsa-mir-586, hsa-mir-548b, hsa-mir-548a-2, hsa-mir-599, hsa-mir-548a-3, hsa-mir-607, hsa-mir-613, hsa-mir-548c, hsa-mir-625, hsa-mir-634, hsa-mir-642a, hsa-mir-548d-1, hsa-mir-548d-2, hsa-mir-656, hsa-mir-509-2, hsa-mir-509-3, hsa-mir-1208, hsa-mir-548e, hsa-mir-548j, hsa-mir-1290, hsa-mir-548k, hsa-mir-548l, hsa-mir-548f-1, hsa-mir-548f-2, hsa-mir-548f-3, hsa-mir-548f-4, hsa-mir-548f-5, hsa-mir-1247, hsa-mir-548g, hsa-mir-548n, hsa-mir-548m, hsa-mir-548o, hsa-mir-548h-1, hsa-mir-548h-2, hsa-mir-548h-3, hsa-mir-548h-4, hsa-mir-548p, hsa-mir-548i-1, hsa-mir-548i-2, hsa-mir-548i-3, hsa-mir-548i-4, hsa-mir-1324, hsa-mir-1825, hsa-mir-548q, hsa-mir-548s, hsa-mir-548t, hsa-mir-548u, hsa-mir-548v, hsa-mir-323b, hsa-mir-548w, hsa-mir-548x, hsa-mir-548y, hsa-mir-642b, hsa-mir-548z, hsa-mir-548aa-1, hsa-mir-548aa-2, hsa-mir-548o-2, hsa-mir-548h-5, hsa-mir-548ab, hsa-mir-548ac, hsa-mir-548ad, hsa-mir-548ae-1, hsa-mir-548ae-2, hsa-mir-548ag-1, hsa-mir-548ag-2, hsa-mir-548ah, hsa-mir-548ai, hsa-mir-548aj-1, hsa-mir-548aj-2, hsa-mir-548x-2, hsa-mir-548ak, hsa-mir-548al, hsa-mir-548am, hsa-mir-548an, hsa-mir-548ao, hsa-mir-548ap, hsa-mir-548aq, hsa-mir-548ar, hsa-mir-548as, hsa-mir-548at, hsa-mir-548au, hsa-mir-548av, hsa-mir-548aw, hsa-mir-548ax, hsa-mir-548ay, hsa-mir-548az, hsa-mir-548ba, hsa-mir-548bb, hsa-mir-548bc
Note that the expression of ten of the 65 miRNAs we identified in the current study (miR-101, miR-127-3p, miR-139-5p, miR-142-5p, miR-185, miR-195, miR-218, miR-29a, miR-29c, miR-381) has been detected in samples of adult human hippocampus containing different subregions [34]. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
MiRNAs with expression profiles closest to the mean were miR-103, miR-185, miR-532-3p, miR-194, miR-126, miR-155, let-7e, miR-345, miR-425 and miR-15b as illustrated in Table 3. The first 9 miRNAs on this list were excluded from further EC analysis on the basis of their documented roles in breast cancer (Table 3). [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
From these 25 miRs, trophoblast cells were found to express 8 at a detectable level: miR-7-5p; miR-186-5p; miR-155-5p; miR-22-3p; miR-185-5p; miR-138-5p; miR-329; and miR-362-3p (Table 1 and Table S1). [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 2
Some miRNAs, including miR-150, miR-194 and miR-185, have been reported as differentially expressed in individuals with 22q11.2DS compared to controls [38]. [score:2]
[1 to 20 of 1 sentences]
94
[+] score: 2
Three of the seven miRNAs (MIR185, MIR1306, MIR1286) have been found to be expressed in the brain, while two were not (MIR3618, MIR649), [44] and the other two (MIR4761, MIR6816) have yet to be investigated. [score:1]
The two miRNA conserved in the mouse were MIR185 and MIR1306. [score:1]
[1 to 20 of 2 sentences]
95
[+] score: 2
showed that the expression of some miRNAs was changed dramatically after treatment with oridonin, as shown in Table  3 (20 miRNAs, including miR-205, miR-10b, miR-125b, miR-200b, miR-132, miR-320, miR-185, miR-424-5p, and miR-17-5p), which indicated that oridonin may influence BxPC-3 pancreatic cancer cells through regulating miRNAs, though verifying this hypothesis will require further investigation. [score:2]
[1 to 20 of 1 sentences]
96
[+] score: 2
Other miRNAs from this paper: hsa-mir-29a, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-152, hsa-mir-29c
MiR-185 is involved in ovarian cancer through targeting DNMT1 [14]. [score:2]
[1 to 20 of 1 sentences]
97
[+] score: 2
Manual examination found that hsa-mir-185 is in fact negatively associated with meningioma, where the citation explicitly negates its involvement in meningioma. [score:1]
Moreover, miRLiN identified two additional miRNAs (hsa-mir-4417 and hsa-mir-185). [score:1]
[1 to 20 of 2 sentences]
98
[+] score: 2
In particular, the following miRNAs can regulate metastatic ability in osteosarcoma: miR-507 [38], miR-497 [39], miR-519d [23], miR-185 [40], miR-218 [40] and miR-200b [41]. [score:2]
[1 to 20 of 1 sentences]
99
[+] score: 1
0013219hsa-miR-301a-3p0.2070.0048517hsa-miR-45000.4130.0096213hsa-miR-451b0.2100.0055917hsa-miR-36540.4150.004007hsa-miR-1070.2160.0001010hsa-miR-223-3p0.4160.00199Xhsa-miR-196b-3p0.2260.000837hsa-miR-3607-5p0.4210.004125hsa-miR-5581-3p0.2299.8E-051hsa-miR-93-3p0.4220.001297hsa-miR-44170.2300.001241hsa-miR-24-3p0.4270.037889hsa-miR-185-5p0.2390.0136722hsa-miR-365a-3p0.4330.0003016hsa-miR-12750.2400.013796hsa-miR-1260b0.4340. [score:1]
[1 to 20 of 1 sentences]
100
[+] score: 1
The heatmap is separated into 4 clusters with one cluster comprising miRNAs that are known to be enriched in red blood cells, namely hsa-miR-451, hsa-miR-486-5p, and hsa-miR-92a [39] or involved in erythropoiesis, namely hsa-miR-185 [40]. [score:1]
[1 to 20 of 1 sentences]