sort by

136 publications mentioning hsa-mir-129-2 (showing top 100)

Open access articles that are associated with the species Homo sapiens and mention the gene name mir-129-2. Click the [+] symbols to view sentences that include the gene name, or the word cloud on the right for a summary.

1
[+] score: 623
Cells transiently overexpressing the miR-129-5p mimic showed reduced the expression of Wnt5a, while silencing miR-129-5p (by miR-129-5p inhibitor) upregulated the expression of Wnt5a (Fig.   2e). [score:12]
Expression levels of the mesenchymal markers vimentin, slug and N-cadherin were downregulated, while those of E-cadherin were upregulated in miR-129-5p -overexpressing N3 or U251 cells (Fig.   4a). [score:11]
Meanwhile, miR-129-5p overexpression in differentiating N3 and K3 GSC cultures attenuated expression of Sox2 and Oct4 and increased GFAP expression, confirming that in differentiating conditions, miR-129-5p upregulation promoted astrocytic differentiation. [score:10]
l Univariate and multivariate analysis of malignant gliomas in the GSE16011 data set Our findings demonstrate that miR-129-5p acts as a tumour suppressor, mediating the inhibition of proliferation, invasion, migration, neurosphere formation, angiogenesis and TMZ resistance by suppressing its target, Wnt5a. [score:9]
Downregulation of miR-129-5p expression activates the PKC/ERK/NF-κB and JNK pathways by targeting Wnt5a. [score:8]
Altogether these results indicate that miR-129-5p overexpression inhibits tumour growth and angiogenesis in vivo through the downregulation of Wnt5a. [score:8]
Downregulation of miR-129-5p expression activates PKC/ERK/NF-κB and JNK pathways by targeting Wnt5a. [score:8]
A pool of three Wnt5a-specific siRNAs (siWnt5a) or a control (siCtrl) counterpart were transfected into U251 and N3 cells with miR-129-5p inhibition (U251/anti-129-5p and N3/anti-129-5p) (Supplementary Fig.   3B; U251: 0.20 ± 0.01-fold relative expression; N3: 0.12 ± 0.02-fold relative expression). [score:7]
miR-129-5p overexpression significantly increased the protein levels of cleaved caspase 3, cleaved caspase 7 and Bax, while decreasing the expression levels of the apoptosis inhibitor Bcl-2 in U251 and N3 cells upon TMZ treatment (200 μM) for 48 h (Fig.   5h). [score:7]
miR-129-5p overexpression inhibits cell proliferation and angiogenesis in GBM by targeting Wnt5a. [score:7]
The Spearman test of correlation of miR-129-5p expression with Wnt5a transcript expression from both CGGA mRNA sequences and array data sets also revealed a statistically significant inverse correlation between miR-129-5p and Wnt5a expression levels (Fig.   2h, i). [score:7]
Enforced Wnt5a expression restored the ERK and JNK signalling pathways that were inhibited by miR-129-5p overexpression. [score:7]
Enforced Wnt5a expression in miR-129-5p -overexpressing cells abolished the effect of the inhibited proliferation, G1/S phase transition and angiogenesis functions of miR-129-5p (Fig.   3d–i). [score:7]
Thus, overexpression of miR-129-5p suppresses GBM cell invasion and migration by targeting Wnt5a. [score:7]
e Western blot analysis indicated that Wnt5a expression levels were decreased in cells with miR-129-5p mimic overexpression, but increased in cells treated with a miR-129-5p inhibitor. [score:7]
Overexpression of miR-129-5p inhibits neurosphere formation and confers chemosensitivity to TMZ by targeting Wnt5a. [score:7]
Data are expressed as the mean ± s. e. m a Venn diagram displaying miR-129-5p computationally predicted to target Wnt5a by five different prediction algorithms: TargetScan, miRDB, PITA, miRanda and miRWalk. [score:7]
Immunohistochemistry analysis also revealed that tumours derived from miR-129-5p -overexpressing N3 showed increased miR-129-5p, decreased Wnt5a expression (Fig.   7g, left), a lower proliferation index as demonstrated by Ki-67 staining and significantly lower levels of CD31 expression (Fig.   7g, right). [score:7]
Overexpression of miR-129-5p in GBM cells inhibits neurosphere formation and confers chemosensitivity to TMZ by targeting Wnt5a. [score:7]
miR-129-5p overexpression inhibits EMT signalling pathways in GBM cells by targeting Wnt5a. [score:7]
Enforced Wnt5a expression abolished the inhibited colony formation and proliferation caused by miR-129-5p overexpression (Fig.   3b, c). [score:7]
miR-129-5p expression is downregulated in glioma. [score:6]
Meanwhile, miR-129-5p overexpression inhibited cell infiltration in a 3D collagen matrix 24, 25 and miR-129-5p -overexpressing cells demonstrated a less invasive morphology compared to that of the control cells (Fig.   4e). [score:6]
Particularly, miR-129-5p has been demonstrated to be downregulated in multiple types of cancers 2– 9. Recently, miR-129-5p was observed to be downregulated in GBM tissues compared to that in adjacent non-tumourous tissues [10]. [score:6]
Here, we determine whether miR-129-5p directly represses Wnt5a expression, which inactivates non-canonical Wnt signalling and leads to the subsequent inhibition of GBM cell proliferation, angiogenesis, epithelial/mesenchymal transition (EMT), invasion, migration, neurosphere formation, chemoresistance and in vivo tumour growth. [score:6]
Spearman r = −0.6843, P = 0.0002. h and i Spearman correlation test of miR-129-5p expression with Wnt5a expression, as indicated by the CGGA data sets; Spearman r = −0.6093, P = 0.0056 and Spearman r = −0.2393, P = 0.0024, respectively. [score:5]
Luciferase expression assays were performed to functionally verify whether miR-129-5p directly targets Wnt5a in GBM cells (Fig.   2b). [score:5]
Forced expression of Wnt5a partially abolished miR-129-5p -mediated inhibition of GSC stemness (Supplementary Fig.   2A-C). [score:5]
As expected, the colony formation and CCK-8 assays demonstrated that miR-129-5p upregulation significantly inhibited colony formation (Fig.   3b) and the proliferation rate of N3 and U251 cells (Fig.   3c). [score:5]
Data are expressed as the mean ± s. e. mThe results presented in Figs.   3– 5 suggested that miR-129-5p expression contributed to a variety of malignant phenotypic changes. [score:5]
Consistent with previous studies reporting that cyclin D1 and cyclin E1 accelerated the G1/S phase transition in glioma cells [23], cyclin E1 and cyclin D1 expression levels were decreased following enforced miR-129-5p expression (Fig.   3f). [score:5]
We also observed that miR-129-5p inhibited invasion and migration of GBM cells by targeting Wnt5a. [score:5]
miR-129-5p levels were downregulated in these 3 glioma groups compared to those in the normal brain group, and the grade IV gliomas (GBMs) harboured the lowest expression of miR-129-5p (Fig.   1c). [score:5]
Xu H Hu Y Qiu W Potential mechanisms of microRNA-129-5p in inhibiting cell processes including viability, proliferation, migration and invasiveness of glioblastoma cells U87 through targeting FNDC3BBiomed. [score:5]
Altogether these results indicate that inhibition of Wnt5a in GBM cells with low miR-129-5p expression reverses malignant phenotypes in GBM. [score:5]
Data are expressed as the mean ± s. e. m The results presented in Figs.   3– 5 suggested that miR-129-5p expression contributed to a variety of malignant phenotypic changes. [score:5]
miR-129-5p expression of GBMs was significantly downregulated compared to that of matched normal brain tissues (Fig.   1a). [score:5]
Moreover, important pathway proteins, such as p-JNK, p-ERK1/2 and NF-κB activation -associated proteins, were significantly inhibited by miR-129-5p overexpression in GBM xenografts (Fig.   7f). [score:5]
miR-129-5p suppresses invasion and migration in human GBM cells by targeting Wnt5a. [score:5]
Here, we demonstrate that Wnt5a is targeted by miR-129-5p, whose expression is inversely correlated with Wnt5a in glioma. [score:5]
Enforced expression of Wnt5a restored the EMT change and invasion that was inhibited by miR-129-5p (Fig.   4a–c). [score:5]
miR-129-5p overexpression blocks invasion and migration of GBM cells by targeting Wnt5a. [score:5]
miR-129-5p overexpression led to reduced phosphorylation of IKKα and elevated IκBα expression. [score:5]
c Overexpression of miR-129-5p arrested cell proliferation; however, this was rescued upon coexpression of exogenous Wnt5a in N3 and U251 cells (six replicates per group, three independent experiments per group). [score:5]
miR-129-5p overexpression decreases cell proliferation and angiogenesis of GBMs by targeting Wnt5a. [score:5]
f U251 or N3 cells overexpressing miR-NC or miR-129-5p were incubated with the PKC inhibitor, Calp C (100 nM). [score:5]
Data are expressed as the mean ± s. e. m a Relative expression of miR-129-5p was determined in the TCGA data set (normal brain tissues vs. [score:5]
Thus, miR-129-5p overexpression dampens GBM cell proliferation and angiogenesis by targeting Wnt5a. [score:5]
Here, our data suggested that miR-129-5p inhibits neurosphere formation and confers TMZ chemosensitivity on GBM cells by targeting Wnt5a. [score:5]
Overexpression of Wnt5a rescued NF-κB activation and the accumulation of p65 in the nucleus that was inhibited by miR-129-5p (Fig.   6b, c). [score:5]
Enforced expression of Wnt5a reversed miR-129-5p -mediated suppression of cell migration (Fig.   4e, f). [score:5]
Data are expressed as the mean ± s. e. m To identify the mechanism of miR-129-5p in glioma, we applied bioinformatic algorithms to predict potential target genes. [score:5]
miR-129-5p inhibits tumour growth and angiogenesis in vivo by targeting Wnt5a. [score:5]
Fig. 2 a Venn diagram displaying miR-129-5p computationally predicted to target Wnt5a by five different prediction algorithms: TargetScan, miRDB, PITA, miRanda and miRWalk. [score:5]
By performing limiting dilution assays, we demonstrated that overexpression of miR-129-5p inhibited neurosphere formation of N3 and K3 cells (Fig.   5c). [score:4]
miR-129-5p directly binds to a site on the Wnt5a-3′ UTR, which leads to the suppression of the Wnt5a downstream pathway in vitro and in vivo. [score:4]
Wnt5a is a direct target of miR-129-5p. [score:4]
Data are expressed as the mean ± s. e. mEdU assays revealed that miR-129-5p -overexpressing cells exhibited decreased EdU -positive cells, whereas control GBM cells presented a higher number of EdU -positive cells in the presence of TMZ (200 μM) for 48 h (Fig.   5g). [score:4]
Cellular levels of p-ERK1/2 and p-JNK were markedly decreased in U251 and N3 cells stably overexpressing miR-129-5p compared to those in control cells overexpressing miR-NC, while no statistically significant reduction of total ERK1/2 and JNK was observed (Fig.   6c). [score:4]
miR-129-5p directly targets Wnt5a in GBM cells. [score:4]
We then tested the effect of Wnt5a upregulation by using a Wnt5a plasmid (not including the 3′ UTR) -based strategy in N3/miR-129-5p and U251/miR-129-5p cells. [score:4]
We observed that miR-129-5p -mediated downregulation of Wnt5a inactivates the NF-κB pathway in GBM cells and blocks cell-cycle progression. [score:4]
miR-129-5p is downregulated in glioma patient specimens. [score:4]
Data are expressed as the mean ± s. e. m EdU assays revealed that miR-129-5p -overexpressing cells exhibited decreased EdU -positive cells, whereas control GBM cells presented a higher number of EdU -positive cells in the presence of TMZ (200 μM) for 48 h (Fig.   5g). [score:4]
Zhang Y Liu Z Zhou M Liu C MicroRNA-129-5p inhibits vascular smooth muscle cell proliferation by targeting Wnt5aExp. [score:4]
In summary, miR-129-5p downregulation plays an important role in the progression and malignancy of GBM. [score:4]
Cancer stem cells are considered as mediators of chemoresistance 43, 44. miR-129-5p overexpression blocks GBM stem cell markers, inhibits the capability of neurosphere formation and elevates chemosensitivity of GBM cells to TMZ therapy. [score:4]
Taken together these results indicate that downregulation of miR-129-5p activates the Wnt5a-stimulated PKC/ERK/NF-κB and JNK pathways in GBM cells. [score:4]
miR-129-5p -mediated GBM migration was rescued by forced coexpression of Wnt5a. [score:3]
Understanding the dysregulation of miR-129-5p/Wnt5a-stimulated PKC/ERK/NF-κB and JNK pathways in GBM is important to improve our knowledge of the biological basis of GBM development and progression and has therapeutic potential in the treatment of GBM. [score:3]
d Immunoprecipitation (left) of the Ago2/RISC (RNA -induced silencing complex) using the Pan-Ago2 antibody in N3 or U251 cells overexpressing miR-NC or miR-129-5p. [score:3]
MRI analysis also confirmed that overexpression of miR-129-5p in N3 led to a decrease in xenograft volume (Fig.   7c). [score:3]
As shown in Fig.   2g, the expression of Wnt5a and miR-129-5p in 24 glioma specimens were observed to be inversely correlated. [score:3]
g Enforced deletion of Wnt5a dampened colony formation in U251 or N3 GBM cells with miR-129-5p inhibition (six replicates per group, three independent experiments per group). [score:3]
Overexpression of miR-129-5p significantly decreased cell survival of U251 and N3 cells in the presence of TMZ (200 μM) (Fig.   5f). [score:3]
Data are expressed as the mean ± s. e. m Next, we investigated the effect of miR-129-5p overexpression on EMT in GBM cells. [score:3]
Thus, we hypothesised that low miR-129-5p expression activates multiple Wnt5a -associated signalling pathways that are involved in GBM progression. [score:3]
Fig. 1 a Relative expression of miR-129-5p was determined in the TCGA data set (normal brain tissues vs. [score:3]
g FISH analysis of miR-129-5p and immunohistochemical analysis of paired sections of Wnt5a, Ki-67 and CD31 expression in intracranial tumours originating from pCDH- or pCDH miR-129-5p -transfected N3 cells (three replicates per group, three independent experiments per group). [score:3]
We overexpressed miR-129-5p mimics in N3 and K3 cells (N3/miR-129-5p and K3/miR-129-5p) (Fig.   3a). [score:3]
RNA-ChIP analysis was also employed to selectively detect Wnt5a mRNA abundance in the Ago2/RNA -induced silencing complex (RISC) complex after miR-129-5p overexpression, confirmed by RT-qPCR (Supplementary Fig.   1A and Fig.   2d, left and middle). [score:3]
Conversely, mesenchymal GBMs tended to express the lowest miR-129-5p levels in both the TCGA and CGGA data sets (Fig.   7j, k), although this result did not reach statistical significance. [score:3]
To determine the role of miR-129-5p in chemotherapy, we exposed N3 and K3 GSCs overexpressing miR-129-5p or miR-NC to different concentrations of TMZ and demonstrated that the IC50 for GSCs was ~300 μM (data not shown). [score:3]
The scores of 2 items together were divided into 3 groups for quantitative analysis of miR-129-5p expression: 2–3 = negative(loss), 4–5 = positive and 6–7 = strong positive. [score:3]
l Univariate and multivariate analysis of malignant gliomas in the GSE16011 data set We determined the expression levels of miR-129-5p and Wnt5a in 4 molecular GBM subtypes [35]. [score:3]
f Western blot analysis indicated the regulation of the cell-cycle-regulatory proteins cyclin E1 and cyclin D1 in miR-NC, miR-129-5p or miR-129-5p mimic plus Wnt5a -transfected N3 or U251 cells. [score:3]
miR-129-5p -overexpressing GSCs showed markedly lower viability than control GSCs upon exposure to TMZ (300 μM) (Fig.   5d). [score:3]
Overexpression of Wnt5a rescued the accumulation of p65 in the nucleus attenuated by miR-129-5p (three replicates per group, three independent experiments per group). [score:3]
We also quantified the expression of miR-129-5p in 24 glioma samples, divided into three groups with different grades and 6 normal brain tissue samples (Fig.   1b). [score:3]
e Representative images of FISH analysis of miR-129-5p expression in normal brain and WHO grade II, grade III and grade IV glioma (GBM) tissues. [score:3]
miR-129-5p mimic, miR-129-5p inhibitor and their related negative controls (RiboBio Co. [score:3]
RT-qPCR (right) of Wnt5a incorporated into RISC in N3 or U251 cells overexpressing miR-129-5p. [score:3]
Parallel experiments were performed in miR-129-5p -overexpressing N3 cells and similar results were observed (Supplementary Fig.   3A). [score:3]
b Predicted miR-129-5p target sequence in Wnt5a-3′ UTRs. [score:3]
e Western blot analysis of p-JNK, total JNK, p-ERK1/2, total ERK1/2 and NF-κB activation -associated proteins in siCtrl or siWnt5a U251 or N3 cells with miR-129-5p inhibition (three replicates per group, three independent experiments per group). [score:3]
miR-129-5p overexpression reduced the luciferase activity of the NF-κB reporter, indicating that miR-129-5p contributed to NF-κB inactivation (Fig.   6a). [score:3]
Data are expressed as the mean ± s. e. m We established an orthotopic GBM mo del to analyse the in vivo function of miR-129-5p. [score:3]
Flow cytometry demonstrated that miR-129-5p overexpression induced cell-cycle arrest and elevated the percentage of cells in the G1 phase at 72 h post-transfection while decreasing the percentage of cells in the S phase in both N3 and U251 cells (Fig.   3e). [score:3]
miR-129-5p inhibits Wnt5a and VEGF secretion, both of which act as pro-angiogenic modulators in GBM tumourigenesis [41]. [score:3]
RNA was purified by ethanol precipitation with glycogen, resolved, and treated with DNase I. miR-129-5p expression in human glioma samples and nude mouse xenografts was determined using FISH, as described previously [22]. [score:3]
Forced expression of Wnt5a reversed the miR-129-5p -mediated chemosensitivity (Fig.   5d–f). [score:3]
GBM tissues); P < 0.0001. b Relative miR-129-5p expression was analysed in 6 normal brain tissues and 24 glioma tissues (8 grade II, 8 grade III and 8 grade IV) (six replicates per sample, three independent experiments per sample). [score:3]
A lentiviral pCDH empty vector (pCDH) and miR-129-5p expressing vector (pCDH miR-129-5p) were purchased from GeneChem Co. [score:3]
N3 and U251 cells overexpressing miR-129-5p or miR-NC were fixed with 1% formaldehyde, followed by chromatin fragmentation. [score:3]
j– k miR-129-5p expression in molecular GBM subtypes in the CGGA and TCGA data sets. [score:3]
As predicted by TargetScan, miRDB, PITA, miRanda and miRWalk, there was complementarity between miR-129-5p and Wnt5a-3′ UTR (Fig.   2a). [score:3]
l Univariate and multivariate analysis of malignant gliomas in the GSE16011 data setWe determined the expression levels of miR-129-5p and Wnt5a in 4 molecular GBM subtypes [35]. [score:3]
Enrichment in the levels of Wnt5a that was incorporated into RISC was observed in miR-129-5p -overexpressing cells (Fig.   2d, right). [score:3]
To further investigate the role of miR-129-5p in the NF-κB activation process, we assessed the phosphorylation levels of IKKα and IκBα expression in miR-129-5p -overexpressing GBM cells (Fig.   6c). [score:3]
N3/miR-129-5p and K3/miR-129-5p neurospheres showed markedly decreased stem cell marker expression (Sox2, Oct4) and increased astrocytic marker (GFAP) relative to control neurospheres (Fig.   5a, b). [score:3]
To investigate the mechanism whereby miR-129-5p inhibited GBM cell invasion, we determined the expression of the invasion -associated molecules, matrix-metalloproteinase (MMP) 9 and MMP2. [score:3]
Human brain microvessel endothelial cells (HBMVECs) cultured in conditioned medium obtained from miR-129-5p -overexpressing GBM cells displayed fewer vessels and branches and a shorter tube length (Fig.   3g). [score:3]
Relative expression of miR-129-5p in normal brain tissues and 3 different grades of glioma samples was determined. [score:3]
e was detected in GBM cells stably expressing miR-NC or miR-129-5p, without or with TMZ treatment at different doses (six replicates per group, three independent experiments per group). [score:3]
f Expression of miR-129-5p was analysed in NHAs and eight GBM cells (six replicates per group, three independent experiments per group). [score:3]
i Enforced deletion of Wnt5a dampened the anti-apoptotic effect of miR-129-5p inhibition in U251 or N3 GBM cells upon TMZ treatment (200 μM) for 48 h (six replicates per group, three independent experiments per group). [score:3]
f Expression levels of p-JNK, total JNK, p-ERK1/2, total ERK1/2 and NF-κB activation -associated proteins in xenografts from mice bearing pCDH- or pCDH miR-129-5p -transfected N3 cells (three replicates per group, three independent experiments per group). [score:3]
h Enforced deletion of Wnt5a dampened the invasion in U251 or N3 GBM cells with miR-129-5p inhibition (six replicates per group, three independent experiments per group). [score:3]
miR-129-5p inhibits tumour growth in vivo and elevated Wnt5a is associated with decreased survival. [score:3]
Data are expressed as the mean ± s. e. m To study the influence of miR-129-5p on cellular proliferation, we transfected the primary GBM N3 cell and U251 cell with miR-NC (N3/miR-NC and U251/miR-NC) or a miR-129-5p mimic (N3/miR-129-5p and U251/miR-129-5p). [score:3]
P < 0.0001. d Expression levels of miR-129-5p in the Chinese Glioma Genome Atlas (CGGA) cohort of human malignant glioma patients (GBM vs. [score:3]
MMP9 and MMP2 protein levels were markedly decreased upon miR-129-5p overexpression (Fig.   4c). [score:3]
g Spearman correlation analysis was employed to confirm the correlations between the Wnt5a and miR-129-5p expression levels in 24 human glioma specimens. [score:3]
In an exploration of the mechanism of miR-125-5p action, we demonstrate that dysregulation of miR-129-5p/Wnt5a signalling activates the PKC/ERK/NF-κB and JNK pathways, leading to a more malignant phenotype and resistance to TMZ. [score:2]
Surprisingly, the expression of p65—a key member of the NF-κB family—did not change in U251/miR-129-5p cells compared to that in control cells (Fig.   6c). [score:2]
d Immunofluorescence assay was conducted on GBM cells overexpressing miR-NC or the miR-129-5p mimic. [score:2]
h Western blot analysis was used to detect regulation of the apoptosis-related proteins cleaved caspase 3, cleaved caspase 7, Bcl-2 and Bax by miR-129-5p in U251 or N3 cells upon TMZ treatment (200 μM) for 48 h (three replicates per group, three independent experiments per group). [score:2]
Representative images of neurosphere formation capacity in the presence of miR-129-5p overexpression were captured following the neurosphere formation assay (Right panel) (six replicates per group, three independent experiments per group). [score:2]
Quantitative determination by ELISA in miR-129-5p -overexpressing GBM cell supernatants demonstrated impaired Wnt5a and VEGF secretion compared to that in control cells (Fig.   3h, i). [score:2]
RT-qPCR analysis (middle) of miR-151a incorporated into RISC in N3 or U251 cells overexpressing miR-129-5p compared to the levels in the control. [score:2]
b Effect of miR-129-5p overexpression on miR-NC, miR-129-5p or miR-129-5p plus Wnt5a -transfected GBM cell invasion was examined by a Matrigel invasion assay (six replicates per group, three independent experiments per group). [score:2]
Furthermore, the role of miR-129-5p in regulating proliferation and invasion of GBMs was demonstrated in U87 cell lines, in vitro [10]. [score:2]
However, p65 expression levels were elevated in cytoplasmic extracts and reduced in nuclear extracts of U251/miR-129-5p cells compared to those in U251/miR-NC cells (Fig.   6b). [score:2]
We compared the expression levels of apoptosis-related proteins between miR-NC- and miR-129-5p -transfected cells. [score:2]
miR-129-5p -overexpressing U251 and N3 monolayer cells also showed decreased cell viability upon 48 h TMZ treatment compared to that in control cells (Fig.   5e). [score:2]
To quantify the expression levels of miR-129-5p, the stem-loop-specific primer method was used [47]. [score:2]
Transwell assays demonstrated that restoration of miR-129-5p dramatically inhibited the normally strong invasive capacity of N3 and U251 cells (Fig.   4b). [score:2]
GBM cells expressed lower miR-129-5p levels compared to normal human astrocytes (NHAs) (Fig.   1f). [score:2]
We established an orthotopic GBM mo del to analyse the in vivo function of miR-129-5p. [score:1]
f Proliferation of miR-NC, miR-129-5p or miR-129-5p plus Wnt5a -transfected U251 and N3 cells upon TMZ treatment (200 μM) was tested every 24 h (six replicates per group, three independent experiments per group). [score:1]
a N3/miR-129-5p, K3/miR-129-5p and U251/miR-129-5p cells were transfected with the Wnt5a-plasmid vector, followed by western blot analysis of Wnt5a transcripts (three replicates per group, three independent experiments per group). [score:1]
c Representative images of T2-weighted MRI of intracranial tumour growth (arrows) at day 30 in mice bearing pCDH- or pCDH miR-129-5p -transfected N3 cells. [score:1]
a Representative bioluminescence images of mice bearing intracranial pCDH- or pCDH miR-129-5p -transfected N3 cells on the days indicated (n = 10 each group). [score:1]
Wnt5a protein levels were increased in Wnt5a-co -transfected N3/miR-129-5p and U251/miR-129-5p cells (N3/miR-129-5p + Wnt5a and U251/miR-129-5p + Wnt5a) over N3/miR-129-5p and U251/miR-129-5p cells (Fig.   3a). [score:1]
Moreover, EdU assays demonstrated that miR-129-5p -overexpressing N3 and U251 cells exhibited a significant decrease in the number of EdU -positive cells compared to those in the control cells (Fig.   3d). [score:1]
g Representative images and quantification of EdU analysis of miR-NC, miR-129-5p or miR-129-5p plus Wnt5a -transfected U251 and N3 cells treated with TMZ (200 μM) for 48 h (six replicates per group, three independent experiments per group). [score:1]
Histograms of miR-129-5p FISH scores in normal brain (n = 20), grade II and III (n = 45) and GBM specimens (n = 65) (miR-129-5p loss was defined by a FISH score of 2–3) (Chi-square test, P < 0.001) (three replicates per sample, three independent experiments per sample). [score:1]
The cells were seeded in 24-well plates overnight and then transfected with miR-NC, miR-129-5p or miR-129-5p plus pcDNA3.1-Wnt5a. [score:1]
Representative images and quantification of spheroid migration of neurospheres enriched from miR-NC, miR-129-5p or miR-129-5p plus Wnt5a -transfected GBM cells (six replicates per group, three independent experiments per group). [score:1]
The median survival of mice bearing intracranial pCDH -transfected tumour xenografts was 30 days, whereas mice bearing the pCDH miR-129-5p -transfected xenografts had a median survival of 46 days (Fig.   7d; log-rank test, P < 0.0001). [score:1]
Fig. 3. a N3/miR-129-5p, K3/miR-129-5p and U251/miR-129-5p cells were transfected with the Wnt5a-plasmid vector, followed by western blot analysis of Wnt5a transcripts (three replicates per group, three independent experiments per group). [score:1]
c Protein levels of MMP9 and MMP2 in miR-NC, miR-129-5p or miR-129-5p mimic plus Wnt5a -transfected N3 or U251 cells (three replicates per group, three independent experiments per group). [score:1]
miR-129-5p is a critical repressor of Wnt5a. [score:1]
d EdU analysis of miR-NC, miR-129-5p or miR-129-5p plus Wnt5a -transfected N3 and U251 cells (six replicates per group, three independent experiments per group). [score:1]
a EMT -associated proteins in miR-NC, miR-129-5p or miR-129-5p mimic plus Wnt5a -transfected N3 or U251 cells were determined by western blotting. [score:1]
Representative images of GBM cells transfected with either miR-NC or miR-129-5p (six replicates per group, three independent experiments per group). [score:1]
miR-129-5p attenuated the accumulation of p65 in the nucleus in a Wnt5a -dependent manner (Fig.   6d). [score:1]
d Proliferation of miR-NC, miR-129-5p or miR-129-5p plus Wnt5a -transfected N3 and K3 GSCs upon TMZ treatment (300 μM) was tested every 24 h (six replicates per group, three independent experiments per group). [score:1]
U251 and N3 cells were seeded in triplicate in 24-well plates and cultured for 24 h. The cells were co -transfected with the wild-type or mutated plasmid and indicated amounts of miR-129-5p or miR-NC mimics. [score:1]
Fig. 7. a Representative bioluminescence images of mice bearing intracranial pCDH- or pCDH miR-129-5p -transfected N3 cells on the days indicated (n = 10 each group). [score:1]
b Western blot analysis of p65, GAPDH in cytoplasmic extracts (Cyto) and p65, Histone3 in nuclear extracts (NE) in miR-NC, miR-129-5p or miR-129-5p plus Wnt5a -transfected U251 and N3 cells (three replicates per group, three independent experiments per group). [score:1]
Wild-type miR-129-5p binding sites of the Wnt5a-3′ UTR led to decreased luciferase activity relative to mutated binding sites in N3 and U251 cells co -transfected with a miR-129-5p mimic (Fig.   2c). [score:1]
d Kaplan–Meier survival curve of mice injected with pCDH- or pCDH miR-129-5p -transfected N3 cells (Log-rank test, P < 0.0001). [score:1]
Bioluminescence imaging demonstrated a statistically significant difference in tumour volume between two groups implanted with N3 cells transfected by the lentiviral control pCDH or pCDH miR-129-5p, confirmed by RT-qRCR (Supplementary Fig.   4A and Fig.   7a, b). [score:1]
c Western blot analysis of p-JNK, total JNK, p-ERK1/2, total ERK1/2, p-IKKα, IKKα, IҡBα and p65 in U251/miR-NC, U251/miR-129-5p, N3/miR-NC and N3/miR-129-5p cells co -transfected with the vector or Wnt5a (three replicates per group, three independent experiments per group). [score:1]
Fig. 4. a EMT -associated proteins in miR-NC, miR-129-5p or miR-129-5p mimic plus Wnt5a -transfected N3 or U251 cells were determined by western blotting. [score:1]
Simultaneously, wound-healing assays demonstrated that miR-129-5p -overexpressing cells had decreased migration compared to that of cells transfected with miR-NC (Fig.   4d). [score:1]
The sequences complementary to the binding site of miR-129-5p in the 3′-UTR (Wnt5a: GCAAAAA) were replaced by TACCCCC for mutagenesis of the binding site. [score:1]
Haematoxylin and eosin (H&E) staining confirmed this finding that mice bearing N3 cells transfected with pCDH miR-129-5p showed a drastic decrease in tumour volume (Fig.   7e). [score:1]
b Colony formation ability of the miR-NC- or miR-129-5p -transfected N3 or U251 cells without transfection or transfected with the pcDNA3.1-Wnt5a plasmid (Wnt5a) (six replicates per group, three independent experiments per group). [score:1]
Moreover, fluorescence in situ hybridisation (FISH) analysis confirmed a higher rate of miR-129-5p loss in GBM tissues (45%) than that in grade II and III tissues (20%) and normal brain tissues (8%) (Fig.   1e). [score:1]
miR-129-5p blocked the accumulation of p65 in the nuclei of U251 GBM cells. [score:1]
Explicit molecular mechanisms of miR-129-5p in GBM need to be fully explored in multiple GBM cell lineages, including primary GBM cells and GBM stem cells (GSCs). [score:1]
A previous study also demonstrated that miR-129-5p binds to the 3′ UTR of Wnt5a in human vascular smooth muscle cells [21]. [score:1]
bWestern blot analysis of Sox2, Oct4 and GFAP in N3 and K3 neurospheres transfected with miR-NC, miR-129-5p or miR-129-5p plus Wnt5a (three replicates per group, three independent experiments per group). [score:1]
However, there is a need to characterise the landscape of miR-129-5p expression in all malignant gliomas. [score:1]
We first analysed miR-129-5p levels in data from 491 GBM patients using the TCGA database. [score:1]
[1 to 20 of 177 sentences]
2
[+] score: 430
Other miRNAs from this paper: hsa-mir-129-1
To confirm whether the loss of miR-129-2 is an important factor of HCC malignancy by upregulating HMGB1 expression, we performed that qRT-PCR and and found that ectopic expression of miR-129-2 dramatically decreased the mRNA (Figure 4B) and protein (Figure 4C) expression of HMGB1. [score:10]
Moreover, the rescue experiment showed that upregulation of HMGB1 expression in miR-129-2 -overexpressing cells led to increased phosphorylation of AKT and the expression of MMP2 and MMP9 (P < 0.05, Figure 6B). [score:10]
Furthermore, miR-129-2 suppresses proliferation and migration of esophageal carcinoma cells through downregulation of SOX4 expression [20] and epigenetic repression of miR-129-2 leads to overexpression of SOX4 in gastric cancer [16]. [score:10]
Mechanistically, we suggest that miR-129-2 is downregulated by DNA methylation and functions as a tumor suppressor by targeting HMGB1 in HCC cells, which in turn results in the dephosphorylation of AKT on Ser473 and decreased expression of MMP2/9. [score:10]
Taken together, our data suggested that miR-129-2 function as a tumor suppressor in HCC cells by directly targeting HMGB1 and is down-regulated by DNA methylation, which may provide a novel therapeutic strategy for treatment of HCC. [score:9]
As shown in Figure 6G–6I, the migration and invasion capability were remarkably attenuated upon AKT inhibitor treatment in miR-129-2 -overexpressing and HMGB1 overexpression plasmid cotransfection group, and the attenuation effects were also observed in the expression of MMP2 and MMP9 (P < 0.05, Figure 6J). [score:9]
In addition, miR-129-2 function as a tumor suppressor in glioma cells by targeting HMGB1 and is downregulated by DNA methylation [21]. [score:8]
As shown in Figure 8B, extremely high methylation was observed in Huh7, Hep3B and SK-Hep-1, while PLC/PRF/5 and SNU-475 were unmethylated, which was inversely correlated with the expression of miR-129-2. To confirm that the DNA methylation participated in the regulation of miR-129-2 expression, we treated Hep3B and Huh7 cells in vitro with DNA methytransferase inhibitor 5-Aza-dC. [score:8]
To further validate that miR-129-2 suppressed HCC invasion and metastasis by regulating HMGB1, we performed rescue experiment by transfecting HMGB1 overexpression plasmid or empty vector (EV) in miR-129-2 -overexpressing cells (P < 0.05, Figure 5A). [score:8]
To elucidate the molecular mechanism by which miR-129-2 exerts its inhibitory effect on HCC cells, we predicted potential targets by different miRNA target algorithms and found conserved putative miR-129-2 sites at the 3′-UTR of HMGB1 (Figure 4A). [score:7]
p-AKT overexpression abrogated the suppressive effects of miR-129-2 overexpressed on HCC cells. [score:7]
Figure 3Ectopic expression of miR-129-2 ameliorates HCC migration and invasion, both in vitro and in vivo(A) The expression of miR-129-2 was significantly increased in Hep3B and Huh7 cells infected with miR-129-2 expression or control lentiviruses. [score:7]
Moreover, we found the expression of HMGB1 mRNA (Figure 4E) and protein (Figure 4F, 4G) in the miR-129-2 high -expressing tumors were significantly lower than those in the miR-129-2 low -expressing tumors. [score:7]
Furthermore, we observed that the upstream regulators of p-AKT (Thr308) [31], including P85, PTEN, and PDK1 had no obvious changes in miR-129-2 -overexpressing cells (Figure 7B), which validated that miR-129-2 selectively inhibited AKT phosphorylation at Ser473, not Thr 308. [score:6]
In conclusion, we find that miR-129-2 is downregulated in HCC and its decreased expression is associated with poor prognostic features. [score:6]
Downregulated expression of miR-129-2 predicts poor prognosis in HCC patients. [score:6]
Upregulation of p-AKT rescued the decreased migration and invasion induced by miR-129-2, whereas Akt phosphorylation inhibition significantly decreased HMGB1-enhanced migration and invasion. [score:6]
Upregulation of miR-129-2 significantly reduced the expression of HMGB1 and decreased the luciferase reporter activity of HMGB1 wt 3′-UTR but not mt 3′-UTR. [score:6]
These data suggested that miR-129-2 is downregulated by DNA methylation and functions as a tumor suppressor in HCC cells. [score:6]
In this study, we identify miR-129-2 as downregulated in both HCC tissues and cells and a critical suppressor of HCC cells migration and invasion both in vitro and in vivo. [score:6]
As shown in Figure 3D, forced expression of miR-129-2significantly inhibited cell invasion. [score:5]
These data revealed that miR-129-2 exerts its biological suppressive function through dephosphorylation of AKT on Ser473 and elevated expression of MMP2 and MMP9. [score:5]
Ectopic expression of miR-129-2 ameliorates HCC migration and invasion, both in vitro and in vivoTo explore the biologic significance of miR-129-2, we stably overexpressed miR-129-2 in HCC cell lines Hep3B and Huh7 with lentiviruses carrying miR-129-2 and its control. [score:5]
We found that HMGB1 overexpression rescued the decreased migration and invasion abilities induced by miR-129-2 overexpressing cells (P < 0.05, Figure 5B–5D, respectively). [score:5]
Representative immunohistochemical staining showed a weak staining of HMGB1 in miR-129-2 high -expressing HCC tissue and strong staining of HMGB1 in the miR-129-2 low -expressing tumor. [score:5]
To further study whether the AKT signaling pathway was necessary for miR-129-2 -mediated suppression of HCC migration and invasion, we transfected miR-129-2 -overexpressing cells with pmyt-AKT (dominant-active AKT) or pcDNA3.1. [score:5]
Taken together, these data provide competent evidences to support that miR-129-2 exerts its suppressive effect on HCC, at least partly, through inhibiting HMGB1. [score:5]
In our study, we indicated that miR-129-2 decreased the expression of MMP2/9 by inhibiting AKT phosphorylation. [score:5]
Furthermore, we revealed that miR-129-2 exerted its biological function, at least in part, by inhibiting HMGB1 expression and additional downstream Akt/MMP2/9 pathways. [score:5]
Expectedly, overexpression of miR-129-2 significantly decreased the AKT activity and the expression of phosphorylated AKT, MMP2 and MMP9 in HCC cells (P < 0.05, Figure 6A). [score:5]
miR-129-2-HMGB1 axis modulates the expression of MMP2 and MMP9 by inhibiting AKT phosphorylation. [score:5]
Taken together, these data revealed that miR-129-2 exerts its physiologic function through inhibiting HMGB1, which in turn results in the dephosphorylation of AKT on Ser473 and decreased expression of MMP2/9. [score:5]
Functional analysis also revealed that demethylation -induced expression of miR-129-2 inhibited cell migration and invasion of Hep3B and Huh7 cells (Figure 8D–8F). [score:5]
We found miR-129-2 expression was upregulated with 5-Aza-dC compared with the control cells (Figure 8C). [score:5]
Moreover, demethylation of miR-129-2 treatment increased miR-129-2 expression in HCC cells and resulted in significant inhibitory effects on cell migration and invasion. [score:5]
Relative expression levels of miR-129-2 (normalized by U6 RNA expression) in these cells were determined by Taqman qRT-PCR analysis. [score:5]
Figure 5(A) miR-129-2 -overexpressingHep3B and Huh7 cells that were transfected with empty vector (EV) or HMGB1 expression plasmid were subjected to western blot analysis for HMGB1. [score:5]
HCC patients with higher expression of miR-129-2 had better (A) overall survival (OS) and (B) disease-free survival (DFS). [score:5]
HMGB1 was a direct target of miR-129-2 in HCC. [score:4]
Our results revealed that miR-129-2 plays an important protective role in HCC migration and invasion by manipulating HMGB1/p-AKT (Ser473)/MMP2/9 signaling pathway, however, the regulatory mechanism of miR-129-2 expression in HCC cells was still unknown. [score:4]
Our data demonstrated that hypermethylation of upstream of miR-129-2 led to the downregulation of miR-129-2 in both HCC tissues and cell lines. [score:4]
miR-129-2 expression is epigenetically regulated by DNA methylation in HCC. [score:4]
and Transwell migration assay revealed that exogenous expression of miR-129-2 dramatically inhibited cell migration in comparison with that of control cells (P < 0.05, Figure 3B, 3C). [score:4]
HMGB1 is a direct target of miR-129-2 in HCC cells. [score:4]
Moreover, miR-129-2 was methylation -mediated downregulated in HCC [23, 24]. [score:4]
In our current study, miR-129-2 was found frequently downregulated in aggressive tumors than in nonaggressive tumors. [score:4]
Previous study demonstrated that miR-129-2 downregulation is mediated by epigenetic mechanism, especially DNA methylation. [score:4]
miR-129-2 expression is epigenetically regulated by DNA methylation in HCC cells. [score:4]
miR-129-2 is frequently downregulated in HCC tissues and is negatively associated with metastatic potential. [score:4]
Importantly, our results showed that downregulated miR-129-2 conferred a significant higher recurrence rate for HCC patients. [score:4]
In this study, we confirmed that HMGB1 was a direct downstream target of miR-129-2 and it was implicated in the functional effect of miR-129-2 on HCC. [score:4]
To determine whether miR-129-2 is aberrantly expressed in HCC, we performed qRT-PCR analysis in a 106 pairs of HCC tissues and matched para-tumor tissues. [score:3]
We demonstrate that miR-129-2 is an independent prognostic factor for predicting both the overall and the disease-free 5-year survival of HCC patients. [score:3]
Moreover, ectopic expression of miR-129-2 attenuated cell migration and invasion both in vitro and vivo. [score:3]
Taken together, we consider that miR-129-2 may potentially act as a clinical biomarker and therapeutic target in HCC. [score:3]
Thus, our results indicate that the reduced expression of miR-129-2 is correlated with poor prognostic features of HCC. [score:3]
These results suggest that the reduced expression of miR-129-2 is correlated with poor prognostic features in HCC. [score:3]
Figure 1(A, B) Relative miR-129-2 expression levels in 106 paired HCC tissues and matched adjacent normal tissues were determined by qRT-PCR. [score:3]
Clinical correlation of miR-129-2 expression in HCC. [score:3]
In addition, to confirm the miR-129-2 -mediated inhibition effects of p-AKT (Ser473), we examined the correlation between miR-129-2 and p-AKT (Ser473), MMP2 and MMP9 in serial sections of 106 HCC cases by immunohistochemical study. [score:3]
In present study, we confirmed p-AKT (Ser473) was obviously inactivated in miR-129-2 -overexpressing cells, nevertheless, p-AKT (Thr308) presented no significant difference. [score:3]
To explore the biologic significance of miR-129-2, we stably overexpressed miR-129-2 in HCC cell lines Hep3B and Huh7 with lentiviruses carrying miR-129-2 and its control. [score:3]
Figure 6(A) showing decreased levels of p-AKT, MMP2/9 in miR-129-2–overexpressed Hep3B and Huh7 cells. [score:3]
Furthermore, Kaplan-Meier analysis showed that the higher miR-129-2 expression exhibited better overall survival (OS, median OS time were 53 vs. [score:3]
As shown in Table 1, the low expression of miR-129-2 was prominently associated with multiple tumor nodes (P = 0.008), venous infiltration (P = 0.001), high Edmondson–Steiner grading (P = 0.014) and advanced tumor-node-metastasis (TNM) tumor stage (P = 0.001). [score:3]
We indicate that miR-129-2 inhibits tumor migration and invasion in vitro and vivo. [score:3]
To verify the consequences of ectopic expression of miR-129-2, we subsequently injected Huh7-miR-129-2 and Huh7-miR-control cells into the lateral veins of the nude mice. [score:3]
Therefore, we tested the change of p-AKT (Ser473) and p-AKT (Thr308) in miR-129-2 -overexpressing cells. [score:3]
The chosen target region for quantificational methylation analysis of miR-129-2 gene is a 190 bp long sequence in CpG island. [score:3]
Moreover, miR-129-2 expression level was an independent risk factor for predicting both 5-year OS and DFS of HCC patients (P = 0.004 and 0.001, respectively, Table 2). [score:3]
miR-129-2 selectively inhibits AKT phosphorylation at Ser473. [score:3]
Taken together, these data indicated that the expression level of miR-129-2may be used as an independent factor for predicting the prognosis of HCC. [score:3]
We found the level of p-AKT (Ser473) significantly decreased, whereas p-AKT (Thr308) revealed no obvious difference in miR-129-2 -overexpressing cells (Figure 7A). [score:3]
In addition, the overexpression of miR-129-2 prominently reduced the luciferase activity of HMGB1 wild-type reporter but not the mutant type (Figure 4D). [score:3]
Moreover, demethylation treatment of miR-129-2 inhibited the migration and invasion of HCC. [score:3]
An inverse correlation between the expression of miR-129-2 and HMGB1 mRNA and protein was observed in HCC tissues. [score:3]
Clinical analysis revealed that miR-129-2 was expressed at significantly lower levels in HCC patients with multiple tumor nodes, venous infiltration, high Edmondson-Steiner grading and advanced TNM tumor stage. [score:3]
Collectively, these results strongly suggested that HMGB1 is a downstream target of miR-129-2 in HCC. [score:3]
Importantly, we confirmed that restoration of HMGB1 expression abrogated the functional effect of miR-129-2 on HCC migration and invasion. [score:3]
Ectopic expression of miR-129-2 ameliorates HCC migration and invasion, both in vitro and in vivo. [score:3]
These results implicated that epigenetic modification may modulate the miR-129-2 expression in HCC. [score:3]
Consistently, our data indicated that miR-129-2 expression revealed a significantly inverse correlation with p-AKT (Ser473), MMP2 and MMP9, respectively. [score:3]
In addition, our data demonstrated that the reduced expression of miR-129-2 predicted a significant worse 5-year survival for HCC patients. [score:3]
Furthermore, IHC scores were used for semiquantitative analysis, we found a strong inverse correlation between miR-129-2 expression and p-AKT (Ser473), MMP2 and MMP9, respectively (Figure 7C). [score:3]
Similarly, the relative lower expression of miR-129-2 was also observed in a panel of HCC cell lines as compared with a nontransformed hepatic cell line (LO2) (P < 0.05, Figure 1F). [score:2]
However, the clinical significance and regulatory mechanism between miR-129-2 and HMGB1 are poorly understood. [score:2]
These results suggested that miR-129-2 is critical for prognosis determination in HCC patients and plays an important role in the regulation of tumor migration and invasion in HCC. [score:2]
As the invasive capacity is a key step during tumor metastasis, we therefore performed Transwell Matrigel invasion assay with miR-129-2 -overexpressing Hep3B and Huh7 cells. [score:2]
Recently, epigenetic repression of miR-129-2 was identified as a crucial regulator during the progression of human cancers [18]. [score:2]
Significantly, there was a remarkable decrease in miR-129-2 expression in approximately 93.4% (99/106) of tumor tissues compared with para-tumor tissues (P < 0.01, Figure 1A, 1B). [score:2]
We observed that up-regulation of miR-129-2 showed fewer and smaller metastatic growth in the lungs and livers of the nude mice with microscopic evaluation (9 vs. [score:2]
In addition, we found that well-differentiated HCCs showed higher miR-129-2 expression, as compared with those in poorly differentiated HCCs samples (P < 0.05, Figure 1E). [score:2]
Right Panel: the correlation of miR-129-2 level with those of p-AKT (Ser473) and MMP2/9 in 106 HCC patients. [score:1]
24 nodules per lung in Huh7-miR-129-2 and miR-control cells, respectively; P < 0.01, Figure 3F, Supplementary Figure S1). [score:1]
HMGB1 is a downstream mediator of the biological function of miR-129-2 in HCC. [score:1]
Lentiviruses containing vector pGCSIL-GFP and pGCSIL-GFP-miR-129-2 were constructed by Genechem (Shanghai, China) and used to infect Hep3B and Huh7 cells at a multiplicity of infection of 10 or 50, respectively, according to the manufacturer's instructions. [score:1]
Figure 8 cells(A) The methylation intensity of miR-129-2 promoter in HCC tissues (n = 106) and adjacent non-tumor tissues was detected by quantative methylation specific PCR; (B) Methylation profiles of 5 HCC cell lines created following methylated DNA quantification analysis. [score:1]
Multivariate Cox repression analysis indicated that miR-129-2 was an independent prognostic factor for predicting survival of HCC patients. [score:1]
These data confirm that HMGB1 is an essential and functional downstream mediator of miR-129-2 in HCC. [score:1]
TaqMan microRNA assays (Applied Biosystems, Foster City, California, USA) were used to quantify the expression levels of miR-129-2. Forward and reverse primers were used as follows: HMGB1, AGA AGT GCT CAG AGA GGT GGA and CCT TTG GGA GGG ATA TAG GTT; miR-129-2, GCG ACT GAC GTC TTT TTG CGG TCT GG and CAG AAC AGT GTC GTG ACA GTG ACG AT; U6, CGC TTC GGC AGC ACA TAT ACT A and CGC TTC ACG AAT TTG CGT GTC A. DNA was extracted by digestion of frozen samples and cell pellets with 1% protease K, followed by standard phenol/chloroform extraction and ethanol precipitation. [score:1]
Collectively, these results indicated that miR-129-2 is capable of manipulating aggressive and metastatic phenotype of HCC both in vitro and in vivo. [score:1]
We first detect the promoter methylation level of miR-129-2 in 106 pairs HCC tissues and matched adjacent non-tumor tissues. [score:1]
Notably, an obvious inverse correlation between miR-129-2 and HMGB1 mRNA was revealed by Spearman's correlation analysis in HCC tissues (Figure 4H). [score:1]
Moreover, miR-129-2 is an independent prognostic factor for OS and DFS of HCC patients. [score:1]
Cell migration as measured by wound healing assay (B) and Transwell migration assay (C) was inhibited by up-regulation of miR-129-2 in Hep3B and Huh7 cells as compared with control cells. [score:1]
4–6 week-old female BALB/c nude mice (Centre of Laboratory Animals, The Medical College of Xi'an Jiaotong University, Xi'an, China) were randomized into two groups (n = 5), and either Huh7-miR-129-2 or Huh7-miR-control cells (1 × 10 [6]) were injected into the tail veins for the establishments of pulmonary metastatic mo del. [score:1]
Together, these data suggest that intracellular AKT -dependent proteolytic enzyme MMPs signaling pathway may play the key role in the modulation of miR-129-2-involved HCC migration and invasion. [score:1]
Figure 4(A) The putative binding sequence of miR-129-2 in the 3′-UTR of HMGB1. [score:1]
The prognostic value of miR-129-2 for HCC patients. [score:1]
Together, these data indicated that miR-129-2 may play a protective role in the metastasis or invasion of HCC. [score:1]
HMGB1is the functional mediator downstream of miR-129-2 in HCC cells. [score:1]
Altering HMGB1 expression partly abolished the functional effect of miR-129-2 on cell migration (B) wound healing assay (C) Transwell migration assay and cell invasion (D). [score:1]
With threshold set at 10%, we found that the frequency of miR-129-2 gene hypermethylation in tumor tissues was significantly higher than that in matched adjacent non-tumor tissues (50.94% (54/106) in tumor vs. [score:1]
[1 to 20 of 113 sentences]
3
[+] score: 308
According to our findings, we propose a mo del wherein after BRCA1 function is downregulated or inactivated by gene mutations or epigenetic silencing (e. g. DNA methylation), oncogenic NEAT1 is upregulated to epigenetically downregulate tumor-suppressive miR-129-5p expression and subsequently activate WNT4 expression. [score:17]
Furthermore, we have revealed that NEAT1 upregulation by BRCA1 deficiency results in activating the expression of the stem-cell factor WNT4 by suppressing miR-129-5p expression. [score:10]
Consistent with the reporter data, miR- 129- 5p overexpression significantly suppressed WNT4 expression in both cell lines (Figure 6C), demonstrating that WNT4 is the genuine target of miR-129-5p. [score:9]
To reveal if the NEAT1/miR-129-5p signaling axis mediates BRCA1-deficiency -induced upregulation of WNT4 expression and WNT signaling, Western blot analysis of WNT4 and β-catenin in BRCA1-knockdown cells with or without co-overexpression of miR- 129- 5p was performed. [score:9]
These findings demonstrate that downregulation of miR-129-5p expression by upregulated NEAT1 contributes to enhanced cell proliferation, stemness, invasiveness and anchorage-independent growth of BRCA1 -deficient breast tumor cells. [score:9]
Consistent with the PCR array data, NEAT1 knockdown led to the induction of miR-129-5p expression in both MCF10A and MCF10DCIS cells, whereas BRCA1 knockdown suppressed its expression (Figure 4B). [score:9]
These data together indicate that miR-129-5p inhibits WNT signaling via downregulation of WNT4 expression. [score:8]
Although ectopic expression of miR-129-5p alone had no significant impact on cell growth, co -expression of miR-129-5p in BRCA1-knockdown MCF10DCIS cells suppressed approximately 55% of increased cell growth (Figure 5A). [score:8]
Figure 6 WNT4 is a miR-129-5p target gene that is regulated by the BRCA1/NEAT1/miR-129-5p axis(A) A map for the predicted miR-129-5p targeting site in the 3′-untranslated region of the WNT4 mRNA. [score:8]
To further confirm the result of the miR-129-5p mimic, we transfected the miR-129-5p inhibitor RNA into MCF10A cells with normal expression levels of miR-129-5p and examined the effect of miR-129-5p inhibition on WNT4 and β-catenin protein levels. [score:7]
To reveal how relevant the BRCA1/NEAT1/miR-129-5p signaling axis is to breast cancer, we performed in silico analysis of publicly available cancer-related expression databases and published expression data to examine the expression correlation between these three molecules. [score:7]
qRT-PCR analysis of miR-129-5p expression was performed on MCF10A and MCF10DCIS cells transfected with the control siRNA, the siRNA targeting BRCA1 or NEAT1, or the siRNA combination targeting both genes for 48 hours. [score:7]
Based on the prior finding that NEAT1 is the downstream of BRCA1, this result suggests that inhibition of miR-129-5p expression by BRCA1 knockdown is NEAT1 -dependent. [score:6]
To understand whether inhibition of miR-129-5p has an opposite effect to promote self-renewal of breast stem cells, we transfected the miR-129-5p inhibitor RNA (antagomir) into MCF10A cells that express normal levels of miR-129-5p and performed sphere formation assays to examine the effect. [score:6]
Indeed, as shown in Figure 6C, β-catenin protein levels positively correlated with WNT4 protein levels and miR-129-5p overexpression concurrently downregulated both WNT4 and β-catenin protein levels. [score:6]
After removal of the four cell lines (HCC70, MDA-MB-231, SUM-185PE, and SUM-52PE) with a poor correlation, the remaining 31 cell lines displayed a negative correlation between NEAT1 and miR-129-5p expression (correlation coefficiency = –0.2175 ± 0.1063) in a statistically significant manner (p = 0.0499) (Figure 8B, the right plot), consistent with our finding that NEAT1 negatively regulates miR-129-5p expression. [score:6]
Indeed, in both MCF10A and MCF10DCIS cells co-overexpression of miR-129-5p abolished induction of WNT4 expression and activation of WNT signaling induced by BRCA1 knockdown (Figure 6I). [score:6]
Figure 8 In silico expression correlation analysis of BRCA1, NEAT1 and miR-129-5p in a cohort of human breast cancer cell lines(A) Regression analysis of the expression correlation between BRCA1 and NEAT1 in breast cancer cell lines. [score:5]
This was expected as miR-129-5p expression is epigenetically regulated by NEAT1 and any other epigenetic alterations may interfere with this regulatory axis. [score:5]
This rescue study indicates that downregulation of miR-129-5p in BRCA1-knockdown cells contributes to the increased cell growth phenotype. [score:5]
Additionally, BRCA1 overexpression consistently induced miR-129-5p expression in both MCF10A and MCF10DCIS cell lines (Figure 4C). [score:5]
qRT-PCR analysis of miR-129-5p expression was performed on MCF10A and MCF10DCIS cells transfected with the empty vector or BRCA1 expression plasmid DNA. [score:5]
To verify that WNT4 is a target of miR-129-5p, we performed luciferase reporter analysis of the WNT4 3′-untranslated region (3′-UTR). [score:5]
We found that NEAT1 inhibited miR-129 expression by increasing the DNA hypermethylation of the CpG island in the miR-129 gene. [score:5]
To unravel how the NEAT1/miR-129-5p axis contributes to enhanced malignancies caused by BRCA1 deficiency, we searched the putative gene targets of miR-129-5p using PicTar, TargetScan, and Miranda algorithms [64– 66]. [score:5]
This result reveals that NEAT1 epigenetically inhibits miR-129 expression. [score:5]
WNT4 is a miR-129-5p target gene that is regulated by the BRCA1/NEAT1/miR-129-5p axis. [score:4]
When co -transfected with siBRCA1, the miR-129-5p mimic significantly inhibited the increased self-renewal and proliferation of BCSCs induced by BRCA1-knockdown (Figure 5D). [score:4]
These 35 cell lines showing the trend of BRCA1/NEAT1 regulation were further subjected to expression correlation analysis of both NEAT1 and miR-129-5p. [score:4]
These results, taken together, indicate that as a downstream effector of the NEAT1/miR-129-5p axis, upregulated WNT4 is functionally required for enhanced malignant phenotypes and stemness of breast tumor cells induced by BRCA1 abrogation. [score:4]
Given that the miR-129 gene is epigenetically silenced in breast and gastric cancers via DNA methylation [62, 63], we hypothesized that NEAT1 may regulate the DNA methylation status of the miR-129 gene to modulate its expression. [score:4]
Upregulation of WNT4 by the NEAT1-miR129 axis is functionally implicated in promoting malignant phenotypes and stemness of BRCA1 -deficient breast tumor cells. [score:4]
As shown in Figure 8B (the left plot), the expression correlation between these two non-coding RNAs was poor (p = 0.6259) possibly due to loss of NEAT1/miR-129-5p regulation in some cell lines (indicated by red dots). [score:4]
Moreover, the transfection of the miR-129- 5p mimic alone suppressed invasiveness and anchorage-independent growth of MCF10DCIS cells and its co- transfection with siBRCA1 impaired the enhancing effects of BRCA1 knockdown on these two malignant phenotypes (Figure 5F, 5G). [score:4]
Co-transfection of miR- 129-5p with the wild-type WNT4 3′-UTR reporter led to approximately 60% suppression of the reporter activity (p < 0.01, n = 3), whereas miR-129- 5p had no effect on the activity of the mutated WNT4 3′-UTR reporter with mutations at the miR-129-5p recognition site (Figure 6B). [score:4]
To further confirm the role of NEAT1 in the regulation of the miR-129-5p/WNT4 axis, NEAT1 overexpression experiments were performed. [score:4]
Epigenetic regulation of miR-129-5p expression by the BRCA1/NEAT1 axis. [score:4]
48 hours posttransfection, Western blot analysis of WNT4, β-catenin and β-actin was performed on MCF10A cells transfected with either the scramble or miR-129-5p inhibitor RNA. [score:3]
In silico expression correlation analysis of BRCA1, NEAT1 and miR-129-5p in a cohort of human breast cancer cell lines. [score:3]
Ectopic expression of miR-129-5p alone attenuated self-renewal (indicated by the reduced sphere number) and the proliferation rate (indicated by the smaller sphere size) of BCSCs in MCF10DCIS (Figure 5D). [score:3]
The miR-129-5p mimic and inhibitor were obtained from Sigma (St. [score:3]
We further analyzed the expression correlation between BRCA1 and miR-129-5p in these 31 BC lines. [score:3]
BRCA1 mRNA expression levels tended to positively correlate with miR-129-5p levels (correlation coefficiency = 0.3048 ± 0.2129) although it was not statistically significant (p = 0.1629) (Figure 8C, the left plot). [score:3]
We obtained miR-129-5p data from a publication by Riaz et al., who profiled the miRNA expression of 51 breast cancer cell lines [71]. [score:3]
The discovery of the BRCA1/NEAT1/miR-129-5p/WNT4 axis and the pivotal roles of WNT4 in WNT signaling activation as well as in the enhancement of BCSC generation suggest that WNT signaling is a potential therapeutic target for breast cancer with alterations in this signaling axis. [score:3]
The left regression analysis plot was made according to BRCA1 and miR-129-5p expression datasets from 31 BC lines that were narrowed down from analysis shown in the right panel of (B). [score:3]
siRNA, miR-129-5p mimic and inhibitor transfections were performed with 20 nM of each reagent using OligofectamineTM RNAiMAX (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. [score:3]
As shown in Figure 5B and 5C, ectopic expression of miR-129-5p alone significantly reduced both CD44+CD49f+CD24– (7.31 ± 1.49% vs. [score:3]
7.62 ± 0.28% of the control, p < 0.05; n = 3), indicating that miR-129-5p is an intrinsic suppressor of BCSCs. [score:3]
were performed on MCF10A cells transfected with either the control scramble or miR-129-5p inhibitor RNA. [score:3]
WNT4 is a target of miR-129-5p and downstream of the BRCA1/NEAT1 axis. [score:3]
siRNA, miR-129-5p mimic and inhibitor transfections. [score:3]
As predicted, NEAT1 knockdown resulted in decreased DNA methylation of the miR-129 CpG island (66.3 ± 2.6% vs. [score:2]
Through our mechanistic studies we have identified the NEAT1/miR-129-5p/WNT4 axis and revealed that dysregulation of this signaling axis contributes to BRCA1-deficiency -induced malignant phenotypes in breast cancer cells, such as increases in cell proliferation, invasiveness, anchorage-independent growth and stemness. [score:2]
Moreover, our in silico correlation analysis indicates that a significant portion of breast cancer cell lines (> 70%) manifested the regulation trend of the BRCA1/NEAT1/miR-129-5p axis. [score:2]
Figure 5(A) The miR-129-5p mimic attenuates enhanced proliferation of BRCA1-knockdown MCF10DCIS cells. [score:2]
A DNA fragment with mutations in the seeding site of WNT4 3′-UTR was used to construct the mutant reporter and its RNA sequence is shown under the map with its wild-type and miR-129- 5p sequences. [score:2]
These in silico analyses, taken together, indicate that 29 (76.3%) out of 38 BC lines exhibited the trend of BRCA1/NEAT1/miR-129-5p axis regulation. [score:2]
To reveal if the miR-129 gene is under the regulation of the BRCA1/NEAT1 axis, qRT-PCR assays were performed on MCF10A and MCF10DCIS cells with single or double knockdown of BRCA1 and NEAT1. [score:2]
Co-transfection of miR-129-5p with BRCA1 siRNA partially abrogated the expanded CD44+CD49f+CD24– (from 21.85 ± 2.71% down to 16.26 ± 1.29%, p < 0.05; n = 3) and CD44+CD49f+CD24–EpCAM+ BCSC subsets (from 18.07 ± 2.83% down to 12.77 ± 1.27%, p < 0.05; n = 3) induced by BRCA1 knockdown (Figure 5B, 5C). [score:2]
Given variable genetic and epigenetic alterations among these breast cancer cell lines, we predicted that some cell lines had lost the BRCA1/NEAT1/miR-129- 5p regulation axis. [score:2]
The NEAT1/miR-129-5p axis mediates the effect of BRCA1 deficiency to enhance malignancies and stemness of breast tumor cells. [score:1]
Western blot analysis of WNT4, β-catenin and β-actin was performed on scramble dsRNA-tansfected and miR-129-5p -transfected MCF10A and MCF10DCIS cells. [score:1]
The NEAT1/miR-129-5p signaling axis contributes to enhanced malignant phenotypes and stemness of BRCA1 -deficient breast tumor cells. [score:1]
Without these sequential analyses, there is no correlation between BRCA1 and miR-129-5p (correlation coefficiency = –0.02839 ± 0.1607; p = 0.8608; r [2] = 0.000866) from analysis of all 38 cell lines. [score:1]
Western blot analysis of WNT4, β-catenin and β-actin was performed on MCF10A and MCF10DCIS cells transfected with the control siRNA, the BRCA1 siRNA or BRCA1 siRNA plus miR-129-5p mimic for 48 hours. [score:1]
These data together demonstrate that the miR-129 gene is the downstream of the BRCA1/NEAT1 axis. [score:1]
Bisulfite sequencing analysis of the DNA region (containing 32 CpG dinucleotides) within the CpG island of the miR-129 gene was performed on genomic DNA samples isolated from control and NEAT1 siRNA -transfected MCF10DCIS cells. [score:1]
To reveal the functional role of miR-129-5p in the BRCA1-deficiency -induced malignant phenotypes of breast tumor cells, we performed a miR-129-5p rescue study by co-transfecting the miR-129-5p mimic with BRCA1 siRNA into MCF10DCIS cells. [score:1]
As expected, inactivation of miR-129-5p resulted in elevated protein levels of WNT4 and β-catenin in MCF10A cells (Figure 6D). [score:1]
To test this hypothesis, we performed bisulfite sequencing analysis of the CpG island of the miR-129 gene in NEAT1-knockdown MCF10DCIS cells compared with control siRNA -transfected cells. [score:1]
The mo del for the role of the BRCA1/NEAT1/miR-129-5p/WNT4 signaling axis in BRCA1-deficiency -driven breast tumorigenesis. [score:1]
As our aforementioned findings (Figure 6) indicate that WNT4 is downstream of the BRCA1/NEAT1/miR-129-5p axis and activates oncogenic WNT signaling in breast tumor cells, we postulated that WNT4 is involved in enhancing malignant phenotypes and stemness of BRCA1 -deficient breast tumor cells. [score:1]
HEK-293T cells were transfected with the wild-type or mutated WNT4 3′-UTR reporter plasmid DNA along with either the control scramble dsRNA or the miR-129-5p mimic. [score:1]
MCF10DCIS cells were transfected with the control siRNA, BRCA1 siRNA, miR-129-5p mimic or BRCA1 siRNA plus miR- 129- 5p mimic. [score:1]
These findings, taken together, indicate that WNT4 is downstream of the BRCA1/NEAT1/miR-129-5p signaling axis. [score:1]
After exclusion of two cell lines (BT-483 and HCC1143, indicated by red dots in the left plot of Figure 8C) identified to have a poor correlation, the remaining 29 BC lines showed a positive correlation between BRCA1 and miR-129-5p (correlation coefficiency = 0.4364 ± 0.2120) in a statistically significant manner (p = 0.0493) (Figure 8C, the right plot). [score:1]
The relevance of the BRCA1/NEAT1/miR-129-5p axis in breast cancer. [score:1]
By using the same miR-129-5p rescue method, we next performed flow cytometry analysis to examine the effect of miR-129-5p on the BCSC population. [score:1]
[1 to 20 of 79 sentences]
4
[+] score: 302
Other miRNAs from this paper: mmu-mir-129-1, hsa-mir-129-1, mmu-mir-129-2, mmu-mir-129b
MiR-129 induced autophagic flux by targetedly suppressing Notch-1. MiR-129 induced autophagy by targetedly suppressing Notch-1. E2F7 partially promoted Notch-1 inhibition -induced autophagy by upregulating Beclin-1. E2F7 was suppressed by Notch-1 and induced autophagy. [score:15]
Moreover, overexpression of E2F7 was shown to be capable of inducing autophagy by upregulating Beclin-1. Interestingly, enforced expression of miR-129 or inhibition of Notch-1 increased the expression of E2F7 in glioma cells. [score:12]
By targetedly suppressing Notch-1, which in turn suppressed the activation of mTOR and promoted the expression of Beclin-1, miR-129 induced autophagy. [score:9]
By upregulating Beclin-1 expression, miR-129 and E2F7 induced autophagy and inhibited cell proliferation. [score:8]
In this study, the major novel findings were that miR-129 is a new inducer of autophagy both through mTOR signaling and upregulation of Beclin-1 by targetedly suppressing Notch-1 in glioma cell lines. [score:8]
Taken together, these results demonstrated that inhibition of endogenous Notch-1 might promote miR-129 -induced autophagy through suppress the activity of mTOR and enhance the expression of Beclin-1. Having tested the influence of Notch-1 on autophagy as indicated by Ingenuity Pathway Analysis (IPA) in Gastric cancer network 1: http://www. [score:7]
Western blot analysis showed that the Lv-miR-129 group had a high level of miR-129 with downregulated Notch-1 expression along with increased E2F7 and Beclin-1 expression, p62 degradation and LC3-I to LC3-II conversion compared with the other two groups (Figure 6C and 6D). [score:7]
Immunohistochemical analysis showed that Notch-1 expression was downregulated, whereas Beclin-1 and LC3 expression were increased in the Lv-miR-129 group compared with the other two groups (Figure 6E). [score:7]
Taken together, these results demonstrated that inhibition of endogenous Notch-1 might promote miR-129 -induced autophagy through suppress the activity of mTOR and enhance the expression of Beclin-1. (A) Predicted binding sequences between miR-129 and seed site in Notch-1 3′UTR. [score:7]
In addition to Notch-1 and E2F7, we also found miR-129 could inhibit the expression of Notch-2, E2F1 and E2F3 while promoted the expression of E2F8 (Supplementary Figure S5A and S5B). [score:7]
On the contrary, miR-129 inhibition upregulates the protein level of Notch-1 in glioma cells (Supplementary Figure S3A and S3B). [score:6]
Indeed, we demonstrated that overexpression of miR-129 or knockdown of Notch-1 not only inhibited mTOR activity but also increased Beclin-1 protein levels in glioma cells. [score:6]
Treatment with 3-Methyladenine (3-MA), an autophagy inhibitor due to inhibit PI3K, in U87-129 cells could restore miR-129 -induced autophagic flux (Figure 1F). [score:5]
Target genes of hsa-miR-129-5p were predicted using multiple target prediction algorithms: http://diana. [score:5]
Figure 7(A) Expression of miR-129 and Notch-1 mRNA in 16 malignant glioma and 8 normal brains tissues was analyzed by qPCR, indicating that miR-129 expression was significantly lower and (B) Notch-1 was significantly higher in malignant glioma than that of normal brain tissues (** P < 0.01, *** P < 0.001). [score:5]
Many studies demonstrated that miR-129 acted as a tumor suppressor with the ability to inhibit proliferation and promote apoptosis in a variety of tumor cell lines [15– 17]. [score:5]
These results showed that miR-129 was expressed in glioma samples and cell lines at a relatively low level, whereas the Notch-1 relative expression was high (Figure 7A, 7C–7D). [score:5]
Consistent with MTT, the results showed that overexpression of miR-129 or E2F7 could inhibit the proliferation of U87 cells (Figure 5C and 5D, Supplementary Figure S7A and S7B). [score:5]
It has been demonstrated that miR-129 acted as a tumor suppressor to inhibit proliferation and promote apoptosis in a variety of tumor cell line [15– 17]. [score:5]
Finally, suppression of miR-129- or E2F7 -induced autophagy by knockdown of Beclin-1 or knockdown of Atg5 restored cell viability. [score:5]
In this study, we demonstrated that hsa-miR-129-5p, hereafter referred to as miR-129 unless particularly stated, could induce autophagy by targetedly suppressing Notch-1 in glioma cells. [score:5]
Consistent with the result of miR-129 overexpression and Notch-1 inhibition, E2F7 also increased Beclin-1 protein levels and induced autophagy in U87 and U251 glioma cells. [score:5]
The miR-129 sponge (129 sponge) vector effectively inhibited the expression of miR-129 (Supplementary Figure S1D) and Rap -induced the amount of LC3-I converted to LC3-II compared with scramble sponge (SCR sponge) vector (Figure 1B). [score:4]
However, a qPCR analysis of U87 cells revealed that overexpression of E2F7 had no obvious impact on the expression of miR-129 compared with negative controls (Supplementary Figure S4C). [score:4]
Knockdown of endogenous miR-129 expression prevented p62 degradation by Rap (Figure 1B). [score:4]
The protein levels of p62 in Lv-miR-129 infected cells were also upregulated by CQ (Supplementary Figure S2B). [score:4]
Knockdown of miR-129 inhibited Rap -induced LC3-I to LC3-II conversion and p62 degradation. [score:4]
The predicted target site was mutated by site-directed mutagenesis, and 50 nM miR-129 mimics or NC mimics (RiboBio, Guangzhou, China) was transfected into cells with 5 ng Renilla plasmid (Promega, Madison, Wisconsin, USA) and 100 ng of the WT or MUT plasmid. [score:4]
MiR-129 induced autophagy through mTOR signaling by targetedly suppressing Notch-1 in glioma cell lines. [score:4]
On the contrary, U87 or U251 cells were transfected with miR-129 sponge vector, which inhibits endogenous miR-129, or scramble sponge vector for 48 hours. [score:3]
The ability of miR-129 to inhibit proliferation and promote apoptosis has been demonstrated in a variety of tumor cell lines [15– 17]. [score:3]
Overexpression of miR-129 induces autophagy in human glioma cells. [score:3]
These findings suggest that miR-129 is a promising therapeutic target as well as a diagnostic marker in glioma. [score:3]
Consistent with the results shown above, miR-129 could promote the mRNA and protein expression of E2F7 both in U87 and U251 cell lines (Figure 4A and 4B). [score:3]
Using DIANA microT v3.0 and miRanda bioinformatics tools, we found that hsa-miR-129-5p but not hsa-miR-129-3p potentially targets Notch-1, which contains two “seed” regions in the 3′UTR (Figure 2A). [score:3]
Suppressed miR-129 -induced autophagic flux increased the viability of glioma cells which may further illustrate the mechanism of miR-129 in contributing to cell proliferation. [score:3]
Many studies have shown that miR-129 acted as a tumor suppressor in a variety of human cancers [15– 17]. [score:3]
The MTT results indicated that suppression of miR-129 -induced autophagic flux by 3-MA, siBeclin-1 or siAtg5 attenuated the antiproliferative function of miR-129 in U87-129 cells after 48 or 72 hours (Figure 5A). [score:3]
Thus, these results demonstrate that enforced expression of miR-129 increases autophagic flux. [score:3]
Overexpression of miR-129 induced autophagy in glioma cells. [score:3]
Therefore, these data demonstrated that overexpression of miR-129 increased the autophagic activity of glioma cells. [score:3]
Suppression of miR-129 -induced autophagic flux rescued cell viability of U87 cells. [score:3]
Thus, Beclin-1 may be involved in miR-129 or Notch-1 inhibition -induced autophagy (Figure 5E). [score:3]
Importantly, inhibition of autophagic flux induced by miR-129 or E2F7 rescued the proliferation of glioma cells. [score:3]
After infected with Lv-NC or Lv-miR-129 lentivirus for 96 hours, the infection efficiency was nearly 96% as indicated by fluorescence microscope scan and flow cytometry (Supplementary Figure S1A and S1B), and the expression of miR-129 were present at a high level in U87-129 and U251-129 cells (Supplementary Figure S1C). [score:3]
To investigate the role of miR-129, as well as Notch-1, E2F7, Beclin-1, p62 and LC-3 expression in autophagy in vivo, tumor tissues were subjected to miR-129 and protein expression analyses. [score:3]
Figure 4(A) qPCR analysis of relative expression of E2F7 mRNA in U87 and U251 cells after infected with Lv-NC or Lv-miR-129 for 72 hours (mean ± SEM of independent experiments, n = 3, ** P < 0.01). [score:3]
In addition, forced expression of ICN-1 restored E2F7 and Beclin-1 protein levels induced by miR-129 (Figure 4D). [score:3]
E2F7 partially mediated miR-129- and Notch-1 inhibition -induced autophagy. [score:3]
To produce viruses, the pri-miR-129 expression plasmid and the backbone plasmids pMD2. [score:3]
The result showed that miR-129 -induced autophagy and related protein expression was rescued to control levels after cotransfection of ICN-1 (Figure 2F). [score:3]
Suppressed miR-129- or E2F7 -induced autophagy by siBeclin-1 could rescue the cell proliferation (Figure 5C and 5D, Supplementary Figure S7A and S7B). [score:3]
Correlations between the expression levels of miR-129 and Notch-1 were analyzed using Pearson's correlation coefficient. [score:3]
Inhibition of miR-129 -induced autophagic flux rescued the viability of glioma cells. [score:3]
Suppression of miR-129 -induced autophagic flux, which may contributes to its anti-tumor effect, increased the viability and proliferation of glioma cells. [score:3]
MiR-129 treatment suppressed glioma cell growth and induced autophagy in xenograft mo del. [score:2]
Knockdown of Beclin-1 rescued E2F7- and miR-129 -induced autophagic flux (Figure 4E and 4F). [score:2]
These data indicate an inducing role for miR-129 in autophagy and the regulation of Notch-1, E2F7 and Beclin-1 by miR-129 in vivo and vitro. [score:2]
In summary, our findings document miR-129 and E2F7 as two autophagy inducers. [score:1]
CQ treatment caused significant increase of LC3-II in both Lv-NC and Lv-miR-129 infected cells (Supplementary Figure S2B). [score:1]
It is unclear, however, whether miR-129 induced autophagy partially by suppressing of Notch-2 or there have a feedback loop between Notch-2 and E2F7 need to be investigated. [score:1]
Next, we examined the levels of p62, a poly-ubiquitin binding protein that binds to LC3 and is degraded by autophagy to determine whether miR-129 -induced autophagosome accumulation is due to autophagy induction or a block in downstream steps. [score:1]
However, the influence of miR-129- or E2F7 -induced autophagy on cell proliferation was unclear. [score:1]
MiR-129 is transcribed from two genes, miR-129-1 and miR-129-2 [14]. [score:1]
Notch-1/E2F7/Beclin-1 axis was involved in miR-129-triggered autophagic flux. [score:1]
There were two potential “seed” sites in the 3′UTR of Notch-1 for hsa-miR-129-5p (Figure 2A), but there were no possible “seed” sites for hsa-miR-129-1-3p. [score:1]
U87 cells were infected with Lv-NC or Lv-miR-129 for 72 hours and then transfected with pDsRed-LC3 for another 24 hours, or treated with 100 nM Rap and transfected with pDsRed-LC3 for 24 hours. [score:1]
However, whether miR-129 affected autophagy was unclear. [score:1]
These results suggested that miR-129 or E2F7 had an antiproliferative function may partially by inducing Beclin-1 -mediated autophagy (Figure 5E). [score:1]
The p62 was degraded after infected with Lv-miR-129 for 48, 72 and 96 hours in U87 cells (Supplementary Figure S2A). [score:1]
To further confirm this in vivo, we performed a xenograft experiment with U87 cells to manifest the inductive effect of miR-129 on autophagy in nude mice. [score:1]
Nevertheless, to our knowledge, the influence of miR-129 on autophagy has not been reported. [score:1]
To investigate the influence of miR-129 on autophagy, we infected with pHAGE-miR-129 lentivirus (Lv-miR-129) in U87 cells (named U87-129) and U251 cells (named U251-129) cells, which stably expressed miR-129. [score:1]
Moreover, miR-129 promoted LC3 conversion in a time dependent manner. [score:1]
Figure 2(A) Predicted binding sequences between miR-129 and seed site in Notch-1 3′UTR. [score:1]
Thus, miR-129 is a promising diagnostic marker in glioma. [score:1]
The mTOR signaling pathway and Beclin-1 were involved in autophagy induced by miR-129. [score:1]
Cells were infected with Lv-NC or Lv-miR-129 for 96 hours or treated with 100 nM rapamycin (Rap) for 24 hours and then analyzed by Western blot. [score:1]
Many studies have demonstrated the antiproliferative effect of miR-129 in a variety of human cancers [15– 17]. [score:1]
Cells were transfected with miR-129 mimics or non-specific mimics as a negative control (NC) (RiboBio, Guangzhou, China) using Lipofectamine [™] 2000 reagent (Invitrogen, San Diego, CA, USA) according to the manufacturer's protocol. [score:1]
These findings may provide new insights to the application of miR-129 for glioma therapy. [score:1]
Moreover, miR-129 triggered autophagy partially by a novel Notch-1/E2F7/Beclin-1 axis. [score:1]
The in vitro experiments demonstrated that miR-129 could enhance autophagic flux in glioma cells. [score:1]
The 600-bp fragment of the predicted miR-129 -binding sequence or a mismatch sequence in the 3′UTR of Notch-1 mRNA, amplified from 293T genomic DNA, was cloned into Spe I and Hand III restriction site of pMIR-REPORT plasmid (Invitrogen, San Diego, CA, USA). [score:1]
The conversion of LC3-I to LC3-II increased after infected with Lv-miR-129 for 48, 72 and 96 hours in U87 cells (Supplementary Figure S2A). [score:1]
A fragment of pri-miR-129 was amplified from 293T genomic DNA and cloned into lentiviral vector pHAGE-CMV-MCS-IZsGreen. [score:1]
As miR-129-1 was frequently deleted in solid tumors [27], it was cloned into a pHAGE-CMV-IZsGreen vector (pHAGE) pHAGE-miR-129 and named as pHAGE-miR-129 in our experiments. [score:1]
It has also been reported that miR-129 was decreased in clinical glioma samples by miRNA microarray and had an antiproliferative effect in glioma cell lines using a human pre-miR miRNA precursor library [26]. [score:1]
There is a negative correlation between miR-129 and Notch-1 (Figure 7B). [score:1]
In conclusion, the present study demonstrated that miR-129 and E2F7 as new inducer of autophagy. [score:1]
These results indicated that E2F7 partially promoted miR-129-triggered autophagic flux. [score:1]
U87 cells were infected with Lv-NC or Lv-miR-129 for 72 hours and harvested for qPCR. [score:1]
Figure 5(A) U87 cells were infected with Lv-NC or Lv-miR-129 for 24 hours and then treated with 5 mM 3-MA or transfected with 50 nM siBeclin-1 or siAtg5 for another 24 hours, 48 hours and 72 hours. [score:1]
These findings provide new insights into the antitumor effects of miR-129 and may contribute to the application of miR-129 for glioma therapy. [score:1]
Moreover, miR-129 promoted p62 degradation in a time dependent manner. [score:1]
These results showed that the autophagic flux induced by miR-129 was a continual process. [score:1]
Therefore, these results suggested that miR-129 likely induced autophagic flux partially in a Notch-1/E2F7/Beclin-1 -dependent manner in U87 cells. [score:1]
Then, the groups were injected with phosphate buffered saline (PBS), Lv-NC and Lv-miR-129, respectively. [score:1]
These results indicated that miR-129- or E2F7 -induced autophagy was injurious to glioma cells. [score:1]
[1 to 20 of 99 sentences]
5
[+] score: 248
Third, overexpression of miR-129-5p inhibited TEAD transcriptional activity and expression of CTGF and Cyclin A, while downregulation of miR-129-5p promoted such activities. [score:10]
Figure 3MiR-129-5p inhibits ovarian cancer cell proliferation and survival in vitro (A) MTT assay reveals that miR-129-5p upregulation inhibits, while miR-129-5p inhibition promotes, proliferation of S KOV3 and A2780 cells. [score:9]
In this study, we demonstrate that miR-129-5p directly inhibits YAP and TAZ expression, which leads to the inactivation of TEAD and subsequent inhibition of ovarian cancer cell proliferation, survival and tumorigenicity. [score:8]
In this study, we demonstrated that miR-129-5p robustly downregulates endogenous YAP and TAZ expression and inhibits ovarian cancer cell proliferation and survival. [score:8]
Our cellular fractionation and western blot assays revealed that when overexpressing miR-129-5p reduced nuclear accumulation of YAP and TAZ, while when silencing miR-129-5p upregulated nuclear YAP and TAZ expression (Figure 2A). [score:7]
To investigate the role microRNAs may play in regulating YAP and TAZ expression, we applied publicly available algorithms from TargetScan to reveal that YAP and TAZ might be potential targets of miR-129-5p (Figure 1A). [score:6]
However, significant changes to YAP and TAZ expression were not observed when cells were transfected with miR-101, miR-124 and miR-18a, which are also predicted to target YAP and TAZ, and miR-129-5p has no effect on the LATS1 phosphorylation level (Supplementary Figure 1C), suggesting that YAP and TAZ are selectively regulated by miR-129-5p (data not shown). [score:6]
Our results suggest that miR-129-5p downregulation increases YAP and TAZ expression, consequently resulting in an aggressive ovarian cancer with poor prognosis. [score:6]
Herein, we identify that the microRNA, miR-129-5p, directly represses YAP and TAZ expression, which inactivates TEAD and leads to the subsequent inhibition of ovarian cancer cell proliferation, survival and tumorigenicity. [score:6]
Figure 7 (A and B) Expression analysis (A) and correlation (B) of miR-129-5p expression and YAP, TAZ protein expression, and CTGF, Cyclin A mRNA levels in nine freshly collected human ovarian cancer tissue samples (T) The ratio of first sample (YAP/α-tubulin, TAZ/α-tubulin) was considered as 1.0. α-Tubulin were used as loading controls. [score:6]
Figure 4 (A) miR-129-5p -induced suppression of TEAD transcriptional activity is reversed by expression of either YAP or TAZ in indicated cells. [score:5]
The expression of miRNA was defined based on the Ct, and relative expression levels were calculated as 2 [−[(Ct of miR-129-5p)–(Ct of U6)]] after normalisation with reference to expression of U6 small nuclear RNA. [score:5]
Importantly, micro-ribonucleoprotein (miRNP) immunoprecipitation (IP) assay showed that miR-129-5p overexpression enriched the transcripts of YAP and TAZ (and not GAPDH or 5s rRNA, that assembled into the miRNP complexes, indicating that miR-129-5p directly targets the mRNA 3′ UTR regions of these transcripts (Figure 1D). [score:5]
As expected, MTT and colony formation assays showed that miR-129-5p upregulation significantly decreased the proliferation rate of the S KOV3 and A2780 cells, while miR-129-5p inhibition increased proliferation rates (Figure 3A and 3B). [score:5]
Importantly, we identify miR-129-5p expression as an independent prognostic factor in patients with ovarian cancer (hazard ratio = 2.365, 95% CI = 1.831–2.952, p < 0.001; Supplementary Table 3), and show low miR-129-5p expression is associated with shorter overall survival in patients with primary ovarian cancer (p < 0.001; Figure 6D). [score:5]
The expression of miR-129-5p is marked upregulated in the miR-125-5p/tumors but decreased in the antagomiR-125-5p/tumors compared control tumors, respectively (Supplementary Figure 4A). [score:5]
Real-time PCR analysis revealed that miR-129-5p was differentially downregulated in 12 tested ovarian cancer cell lines when compared with two normal ovarian epithelial cell (NOEC) lines; and in eight primary ovarian cancer tissues when compared with the paired tumor-adjacent tissues (Figure 6A and 6B), implying that miR-129-5p is downregulated in human ovarian cancer. [score:5]
miR-129-5p suppresses tumorigenicity of ovarian cancer cells in vivoWe then examined the tumor suppressive role of miR-129-5p in ovarian cancer progression using an in vivo tumor mo del. [score:5]
Downregulation of miR-129-5p correlates with ovarian cancer progression. [score:4]
Our western blot analysis revealed that expression levels of YAP and TAZ were significantly decreased in miR-129-5p -transfected cells, but increased in miR-129-5p-silenced cells (Figure 1B and Supplementary Figure 1A–1B), suggesting that miR-129-5p negatively regulates these two proteins. [score:4]
Meanwhile, multi-CpG-rich loci of TRPM3 promoter were retrieved by the UCSC genome browser, suggesting that miR-129-5p downregulation might be associated with genomic methylation. [score:4]
Furthermore, western blotting analysis showed that overexpressing miR-129-5p reduced, while silencing miR-129-5p increased YAP and TAZ in xenograft tumors, further supporting the notion that miR-129-5p regulated the tumor growth via YAP and TAZ (Supplementary Figure 4B). [score:4]
Taken together, these results suggest that miR-129-5p downregulation is involved in human ovarian cancer progression. [score:4]
Importantly, we show that the downregulation of miR-129-5p highly correlates with ovarian cancer progression with poor prognosis. [score:4]
In summary, our study has revealed that miR-129-5p downregulation plays an important role in ovarian cancer progression and that miR-129-5p is a critical repressor of YAP and TAZ. [score:4]
Importantly, intratumoral injection with miR-129-5p mimic dramatically inhibited tumor growth, while injecting a mimic control had no effect on tumor development (Figure 5A, and 5D). [score:4]
Consistent to our observations, we find miR-129-5p is substantially downregulated in ovarian cancer cells. [score:4]
We then examined the tumor suppressive role of miR-129-5p in ovarian cancer progression using an in vivo tumor mo del. [score:3]
Finally, we examined whether miR-129-5p -mediated suppression of YAP and TAZ in ovarian cancers are clinically relevant. [score:3]
Figure 6 (A and B) Real-time PCR analysis of miR-129-5p expression in (A) two NOEC (normal ovarian epithelial cell) lines and 12 cultured ovarian cancer cell lines, and (B) eight pairs of ovarian cancer samples (T) and adjacent normal ovary tissues (ANT). [score:3]
Taken together, our results demonstrate that YAP and TAZ are bona fide targets of miR-129-5p. [score:3]
miR-129-5p -overexpressing and control cells were transfected with HA-Ago1, followed by HA-Ago1 immunoprecipitation using HA-antibody. [score:3]
Finally, expression of YAP and TAZ antagonized the effect of miR-129-5p on cell proliferation and survival. [score:3]
Moreover, when YAP/TAZ or their 3′UTR elements was ectopically overexpressed in miR-129-5p-transduced S KOV3 and A2780 cells, miR-129-5p -induced cell growth arrest and death were, in part, antagonized (Figure 4B and 4C and Supplementary Figure 3B). [score:3]
Therefore, our results suggest miR-129-5p inhibits ovarian cancer cell proliferation and survival in vitro. [score:3]
Interestingly, by analysis of the promoter region of miR-129-5p using the CONSITE program, we found that miR-129-5p was potentially targeted by p53, whose malfunction is frequently detected in human cancers. [score:3]
First, western blot analysis showed that miR-129-5p decreased expression levels of YAP and TAZ. [score:3]
Moreover, overexpression of miR-129-5p significantly reduced TEAD dependent luciferase activity, levels of CTGF and Cyclin A, and binding capability of TEAD with CTGF and Cyclin A promoter in ovarian cancer cells. [score:3]
In turn, several lines of evidence demonstrate that YAP and TAZ are bona fide targets of miR-129-5p. [score:3]
Figure 1 (A) Predicted miR-129-5p target sequence in 3′ UTRs of YAP and TAZ. [score:3]
Importantly, the delivery of miR-129-5p mimic dramatically inhibited the tumorigenicity of ovarian cancer cells, suggesting the anti-cancer potential of the miR-129-5p mimic. [score:3]
Here, our results suggest that miR-129-5p suppresses the tumorigenicity of ovarian cancer cells in vivo. [score:3]
Understanding the precise role of miR-129-5p in the pathogenesis of ovarian cancer and activation of the YAP/TAZ signaling pathway promises to increase our knowledge of the biological basis of cancer development, and may also allow the development of new therapeutic strategies against ovarian cancer. [score:3]
MiR-129-5p directly suppresses YAP and TAZ. [score:3]
We then examined miR-129-5p expression in archived ovarian cancer specimens. [score:3]
The correlation between miR-129-5p and the target genes was determined using another 9 freshly collected ovarian cancer tissues. [score:3]
In the ovarian cancer samples, statistical analysis revealed that decreased miR-129-5p expression strongly correlated with FIGO stage (p = 0.004), histological differentiation (p < 0.001) and pelvic metastasis (p = 0.006) (Supplementary Table 1 and 2). [score:3]
Depletion of YAP or TAZ dramatically suppressed TEAD transcriptional activity in miR-129-5p silenced ovarian cells (Figure 4D and Supplementary Figure 3D). [score:3]
miR-129-5p suppresses tumorigenicity of ovarian cancer cells in vivo. [score:3]
As shown in Figure 7A–7B and Supplementary Figure 5, miR-129-5p levels in nine freshly collected ovarian cancer samples were inversely correlated with the expression levels of YAP (r = –0.706, p = 0.003) and TAZ (r = –0.683, p = 0.005), and mRNA levels of Hippo downstream genes CTGF (r = –0.832, p < 0.001) and Cyclin A (r = –0.801, p < 0.001). [score:3]
Through bioinformatics analysis, we reveal oncogenes YAP and TAZ are indicated as theoretical miR-129-5p targets. [score:3]
However, neither overexpressing miR-129-5p nor silencing miR-129-5p exhibited effects on the reporter activities linked with mutant 3′ UTRs of YAP and TAZ. [score:3]
MiR-129-5p inhibits ovarian cancer cell proliferation and survival in vitroHippo pathway inactivation and the subsequent nuclear translocations of YAP and TAZ have been shown to promote cell proliferation and resistance to death [31, 32]. [score:2]
We synthesised cDNA from 10 ng total RNA using a TaqMan miRNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA), and quantified the expression levels of miR-129-5p using a miRNA-specific TaqMan MiRNA Assay Kit (Applied Biosystems). [score:2]
MiR-129-5p inhibits ovarian cancer cell proliferation and survival in vitro. [score:2]
In addition, our TUNEL assays demonstrated that ectopic expression of miR-129-5p rendered ovarian cancer cells more sensitive to treatment by the chemotherapeutic agent cisplatin (Figure 3C). [score:2]
Meanwhile, our staining assays revealed that miR-129-5p -overexpressing tumors exhibited decreased Ki67 -positive cells and increased TUNEL -positive cells, whereas miR-129-5p-silenced tumors presented a higher Ki67 proliferation index and decreased TUNEL -positive apoptotic cells (Figure 5E and 5F). [score:2]
Thus, it would be of great interest to further investigate whether downregulation of miR-129-5p in ovarian cancer is attributed to genomic methylation and/or p53 -mediated transcriptional regualtion. [score:2]
Furthermore, luciferase assays revealed miR-129-5p overexpression led to a decrease in reporter activity linked with the 3′ UTRs of YAP and TAZ transcripts, while in miR-129-5p silenced cells, an increase in reporter activity was observed (Figure 1C). [score:2]
Clinical relevance of miR-129-5p, YAP, TAZ, CTGF and Cyclin A in ovarian cancer. [score:1]
Clinical relevance of miR-129-5p, YAP and TAZ in ovarian cancer. [score:1]
The mice in groups were inoculated subcutaneously with S KOV3 cells (5 × 10 [6]) in the left dorsal flank, and two weeks later, injected intratumorally with 100 μL miR-129-5p mimic, mimic control, antagomiR-129-5p control or antagomiR control (diluted in PBS at 2 mg/mL) three times per week for three weeks. [score:1]
Second, the luciferase activity assay with 3′ UTR and the miRNP IP assay revealed miR-129-5p repressed YAP and TAZ expression via interaction with YAP- and TAZ-3′ UTR elements. [score:1]
These results suggest that YAP and TAZ are functionally relevant effectors of miR-129-5p in ovarian cancer cell proliferation and survival. [score:1]
We purchased miR-129-5p mimic, miR-129-5p antagonist (antagomiR-129-5p), and controls from RiboBio (Guangzhou, China). [score:1]
YAP and TAZ are functionally involved in miR-129-5p -mediated ovarian cancer cell proliferation and survival. [score:1]
Transfection of the plasmids, siRNAs, miR-129-5p mimic, and antagomiR-129-5p were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. [score:1]
The human miR-129-5p gene was PCR-amplified from genomic DNA and cloned into a pMSCV-puro retroviral vector. [score:1]
We further explored the functional significance of YAP and TAZ in cell proliferation and survival of ovarian cancer cell lines, in addition to TEAD activity induced by miR-129-5p. [score:1]
We next evaluated whether the expression of miR-129-5p is clinically correlated with ovarian cancer progression. [score:1]
[1 to 20 of 70 sentences]
6
[+] score: 245
Other miRNAs from this paper: hsa-mir-129-1, hsa-mir-1247
Transfection of miR-129-5p mimic significantly decreased Beclin-1 expression and inhibited NP cell autophagy, whereas miR-129-5p inhibitor had the opposite effect indicating that miR-129-5p suppresses NP cell autophagy by regulating Beclin-1 expression. [score:12]
MiR-129-5P mimic and inhibitor were used to induce and inhibit miR-129-5P expression, respectively, and Beclin-1 siRNA was used to knock down protein expression. [score:10]
To verify whether the inhibitory effect of miR-129-5P on NP cell autophagy was exerted via direct targeting of Beclin-1, we inhibited the expression of the two factors by transfection of short interfering (si)RNA constructs (Figure 4A–4C). [score:10]
DNA methylation of CpG islands in target gene promoters can alter gene expression; for instance, methylation of miR-129-2 has been linked to the regulation of high mobility group box 1 expression in human hepatocellular carcinoma [61]. [score:8]
MiR-129-5P regulates NP cell autophagy via regulation of Beclin-1. MiR-129-5P regulates degenerative human NP cell autophagy by directly targeting Beclin-1. Autophagy prevents apoptosis by inhibiting cathepsin B release into cytoplasm in human degenerative NP cells. [score:8]
We found that miR-129-5P expression was downregulated whereas Beclin-1 transcript level was upregulated in degenerative as compared to normal disc tissue (Figure 1C). [score:8]
We speculate that miRNA-119-5p contributes to NP cell apoptosis by targeting Beclin-1. In this study, we confirmed that miR-129-5P regulates Beclin-1 expression and inhibits autophagy in human NP cells. [score:8]
We also found that miR-129-5p expression was upregulated by 5-AZA treatment, whereas the levels of the autophagy-related proteins LC3 and Beclin-1 and autophagic activity were decreased. [score:6]
This is the first demonstration that miR-129-5P regulates NP cell autophagy by inhibiting Beclin-1 expression. [score:6]
In the current study, we found that miR-129-5P regulated human NP cell autophagy by targeting Beclin-1 and that miR-129-5P expression is modulated by methylation. [score:6]
Similarly, dysregulated miR-129-5p may prevent autophagy in human IVDD by inhibiting Beclin-1, suggesting that miR-129-5p is an etiological factor in this disease. [score:6]
This induced miR-129-5P expression (Figure 6B), while Beclin-1 mRNA levels were also downregulated (Figure 6C). [score:6]
Meanwhile, Beclin-1 expression increased in the miR-129-5P inhibitor -transfected groups, whereas Beclin-1 siRNA mediated Beclin-1 knockdown reversed this effect (Figure 4A–4C). [score:6]
These results indicate that methylation can inhibit miR-129-5P expression and induce NP cell autophagy in degenerating discs. [score:5]
Methylation inhibits miR-129-5P expression and induces NP cell autophagy. [score:5]
MiR-129-5P mimic, scrambled miR-129-5P mimic (control), miR-129-5P inhibitor, scrambled miR-129-5P inhibitor, Beclin-1 siRNA, and scrambled Beclin-1 siRNA were purchased from RiboBio (Guangzhou, China). [score:5]
To investigate the mechanistic basis for the decrease in apoptosis of NP cells when autophagy increased, we evaluated the expression of apoptosis-related proteins in these cells and found that caspase3/8/9 protein expression was increased in the Beclin-1 knockdown group, and decreased in the miR-129-5P inhibitor -transfected group (Figure 5A, 5C). [score:4]
MiR-129-5P suppresses Beclin-1 expression in NP cells. [score:4]
MiRNA-129-5P is known to regulate Beclin-1 expression [39], and is thus a potential regulator of autophagy [39, 53]. [score:4]
In addition, we found the cathepsin B level in the cytoplasm was increased and decreased in the Beclin-1 knockdown and miR-129-5P inhibitor -transfected groups, respectively (Figure 5A, 5B). [score:4]
A recent study showed that miR-129-5P modulates the expression of Beclin-1 [39] and regulates autophagy in atherosclerosis. [score:4]
LC3-II and Beclin-1 protein expression was markedly decreased in the miR-129-5P mimic -transfected group as compared to the control and inhibitor -treated groups (Figure 2C, 2D). [score:4]
group b. The miR-129-5P gene promoter contains CpG islands; we therefore speculated that miR-129-5P expression is regulated by methylation. [score:4]
Although miR-129-5P is known to regulate autophagy in atherosclerosis, its expression and role in human NP cell autophagy are unknown. [score:4]
This suggests that miR-129-5P promoter methylation leads to downregulation of miR-129-5P and an increase in autophagic activity in NP cells. [score:4]
These results provide a basis for IVDD treatment based on overexpression of miR-129-5P. [score:3]
Similarly, the increase in LC3-II to LC3-I ratio induced by miR-129-5P inhibition was reversed by co-transfection of Beclin-1 siRNA (Figure 4D), which was confirmed by flow cytometry (Figure 4G). [score:3]
Beclin-1 mRNA levels were downregulated in cells transfected with miR-129-5P mimic as compared to the control (Figure 2B). [score:3]
Figure 3 (A) Putative miR-129-5P target site in the 3′-UTR of Beclin-1 transcript predicted by bioinformatics analysis. [score:3]
org) databases were used to predict potential miR-129-5P targets. [score:3]
Thus, the ratio of LC3-II to LC3-I was decreased in cells transfected with miR-129-5P mimic relative to the control or inhibitor -transfected groups (Figure 2E). [score:3]
It is unclear whether miR-129-2 demethylation underlies miR-129-5P overexpression. [score:3]
NP cells were harvested and washed three times with PBS and fixed with 4% formaldehyde for 15 min at room temperature after transfection with miR-129-5p mimic or inhibitor. [score:3]
The opposite was observed upon transfection of miR-129-5P inhibitor (Figure 2B). [score:3]
Cells transfected with miR-129-5P mimic or inhibitor were incubated with goat serum for 30 min, followed by overnight incubation at 4°C with primary antibody against LC3 (1:150; Abcam) and a 1-h incubation with secondary antibody (1:100; GE Healthcare). [score:3]
To clarify the role of miR-129-5P in NP cell autophagy, we inhibited or overexpressed miR-129-5P in NP cells and Beclin-1 mRNA and protein levels were evaluated by qRT-PCR, western blotting (Figure 2B–2D), and immunofluorescence analyses (Figure 3C, 3D). [score:3]
NP cells were transfected with miR-129-5P mimic or inhibitor with high transfection efficiency being observed (Figure 2A). [score:3]
Figure 2Cells were transfected with miR-129-5P mimic, miR-129-5P inhibitor, or scrambled mi-129-5P (miR-Scr) for 48 h. (A) MiR-129-5P expression was evaluated by qRT-PCR. [score:3]
DNA methylation blocked miR-129-5P expression and induced NP cell autophagy in degenerative human NP cells. [score:3]
For example, methylation -induced miR-1247 silencing promotes cancer cell invasion and migration in non-small cell lung cancer [42], while miR-129-5P methylation was associated with expression of human valosin-containing protein in osteosarcoma [43]. [score:3]
Cells were transfected with miR-129-5P mimic, miR-129-5P inhibitor, or scrambled mi-129-5P (miR-Scr) for 48 h. (A) MiR-129-5P expression was evaluated by qRT-PCR. [score:3]
These results indicate that miR-129-5P suppresses human NP cell autophagy. [score:3]
We also demonstrated that miR-129-5P inhibited NP cell autophagy. [score:3]
We speculated that methylation of miR-129-5P promoter CpG islands leads to a decrease in miR-129-5P expression in degenerative NP cells; this was confirmed by MSP analysis of IVDD tissue. [score:3]
MiR-129-5P regulates Beclin-1 expression in degenerative human NP cells. [score:3]
MiR-129-5P and Beclin-1 show opposite expression patterns in degenerative NP cells. [score:2]
Beclin-1 3′-UTR reporter plasmids containing the predicted miR-129-5P binding sequence (pRL-Beclin-1 3′-UTR) or a mutation in the miR-129-5p binding site (pRL-Beclin-1 3′-UTR mut) were amplified by PCR and inserted into the pGL3 control vector (RiboBio). [score:2]
The results demonstrated that Beclin-1 is negatively regulated by miR-129-5P in the process of autophagy. [score:2]
MiR-129-5P and Beclin-1 expression in normal and degenerative NP tissue. [score:2]
MiR-129-5P suppresses autophagy in degenerative NP cells. [score:2]
An electron microscopy analysis revealed more autophagosomes and autophalysosomes in cells transfected with miR-129-5P inhibitor as compared to the mimic (Figure 2I). [score:2]
The regulatory mechanism of miR-129-5P in degenerative discs remains unclear. [score:2]
In this study, we determined that miR-129-5P expression was higher in normal as compared to degenerative NP tissues. [score:2]
Multiple factors are thought to regulate autophagy, including miRNAs such as miR-129-5P [39, 51– 53]. [score:2]
We carried out the luciferase reporter assay to confirm direct binding of miR-129-5P to this site. [score:1]
These results suggest that miR-129-5P and Beclin-1 are involved in the progression of disc degeneration. [score:1]
We therefore speculated that miR-129-5P is involved in NP cell autophagy. [score:1]
To investigate the relationship between miR-129-5P methylation and autophagy, NP cells were treated with the methylation inhibitor 5-AZA. [score:1]
To test this hypothesis, the present study investigated the relationship between miR-129-5P methylation status and expression and autophagy in NP cells. [score:1]
Three predicted CpG islands are present in the miR-129-2 promoter region (http://www. [score:1]
Beclin-1 was found to have a putative miR-129-5P binding site. [score:1]
However, the role of miR-129-5P in the progression of IVDD is unclear. [score:1]
A bioinformatics analysis revealed a miR-129-5P seed sequence in the 3′-UTR of Beclin-1, an autophagy-related gene (Figure 3A). [score:1]
A 7500 real-time PCR instrument (Applied Biosystems, Foster City, CA, USA) was used to quantify miR-129-5P and Beclin-1 and LC3 mRNA levels. [score:1]
In this study, we found that changes in miR-129-5P and Beclin-1 levels and autophagic activity were associated with disc degeneration. [score:1]
Figure 4Human NP cells were transfected with miR-129-5P and Beclin-1 siRNA. [score:1]
These results indicate that Beclin-1 is essential for miR-129-5P -induced autophagy in NP cells. [score:1]
Human NP cells were transfected with miR-129-5P and Beclin-1 siRNA. [score:1]
NP cells were co -transfected with 200 ng of plasmid along with 90 nM miR-129-5P mimic or scrambled miRNA using Lipofectamine 2000. [score:1]
Based on these findings, we speculated that miR-129-5P modulates IVDD progression via DNA methylation. [score:1]
[1 to 20 of 70 sentences]
7
[+] score: 205
Suppression of the expression of VCP or increasing the level of miR-129-5p could induce cell apoptosis and migration in vitro and inhibit the tumor genesis of HCC in vivo. [score:7]
To further confirm the effect of miR-129-5p was dependent on the regulation of VCP expression, the VCP was expressed in HCC cells transfected with miR-129-5p. [score:6]
miR-129-5p induced the apoptosis and reduced the migration of HCC cells dependent on the down-regulation of VCP expression. [score:6]
To further verify the regulatory role of miR-129-5p on VCP expression, the inhibitor of miR-129-5p was transfected into the liver cancer cell line SK-HEP1 together with pGL3-VCP-3′UTR. [score:6]
miR-129-5p suppressed the expression of VCP protein and regulated NF-κB pathway. [score:6]
In this study, we identified that miR-129-5p could down-regulate the expression of VCP by interaction with two sites located at its 3′UTR. [score:6]
In conclusion, our results identified that miR-129-5p can directly inhibit the expression of VCP. [score:6]
miR-129-5p could directly regulate the expression of VCP. [score:5]
All of these results revealed miR-129-5p may be associated with the progression of HCC by inhibiting the expression of VCP. [score:5]
It was found that silencing of VCP gene with si-VCP suppressed cell growth (Figure 4A) and increased the apoptosis of both HepG2 and SK-HEP1 cells, which was consistent with the consequence of restoration of miR-129-5p expression (Figure 4B, 4C). [score:5]
miR-129-5p could regulate the cell growth, apopotosis and migration of HCC cells dependent on the regulation of VCP expression. [score:5]
It was found that only miR-129-5p can down-regulate the luciferase activities of the reporter (Figure 2A). [score:4]
Wu et al reported that miR-129-5p could regulate the expression of Cdk6 and induce G1 phase arrest in mouse lung epithelial cell line (E10 Cells) [34]. [score:4]
It suggested that phenotypic alternation of cells induced by miR-129-5p was achieved by direct influencing the expression of VCP. [score:4]
The luciferase expression was no longer regulated by miR-129-5p after the 162–168 and/or 505–511 of 3′UTR were deleted (Figure 2C, 2D). [score:4]
This suggested that both target sites in the 3′UTR of VCP mRNA were essential for the regulation of miR-129-5p. [score:4]
To verify whether VCP protein expression was indeed regulated by miR-129-5p, miR-129-5p, si-VCP or NC were transfected into HepG2 and SK-HEP1 cells. [score:4]
G: The level of miR-129-5p was negatively correlated with the expression of VCP in HCC. [score:3]
E: The inhibiter of miR-129-5p could increase the luciferase activities of pGL3-VCP-3′UTR in SK-HEP1 cells, while has no effect on three mutant reporter vectors. [score:3]
When cells had been treated with the NF-κB inhibitor (BAY 11-7082), miR-129-5p or si-VCP could not influence the activities of NF-κB. [score:3]
D: miR-129-5p could significantly suppress the luciferase activities of pGL3-VCP-3′UTR in MHCC-LM3 cells, while has no effect on three mutant reporter vectors. [score:3]
A: miR-129-5p could significantly suppress the luciferase activities of pGL3-VCP-3′UTR in HepG2 cells. [score:3]
Then these samples were divided into two groups (level 1(n = 17) and level 2 (n = 22)) according the level of VCP as the classification standard described previously [2] (Table S2) in which the expression of VCP in level 1 was lower than that in level 2. At the same time, the expression level of miR-129-5p in two VCP level groups was measured by qRT-PCR. [score:3]
Five potential candidate miRNAs (miR-103; miR-107; miR-129-5p; miR-136; miR-339-5p) were predicted to have target sites in 3′UTR of VCP mRNA. [score:3]
C: Detection the level of VCP protein by Western blot (Upper panel) and mRNA by RT-PCR (Lower panel) after miR-129-5p inhibitor and NC were transfected into HepG2 or SK-HEP1 cells individually for 72 h. GAPDH served as the internal control. [score:3]
It was found that the luciferase activities in SK-HEP1 cells were increased after the cells were transfected with miR-129-5p inhibitor (Figure 2E). [score:3]
0035800.g002 Figure 2. A: miR-129-5p could significantly suppress the luciferase activities of pGL3-VCP-3′UTR in HepG2 cells. [score:3]
To confirm the binding between miR-129-5p and 3′UTR of VCP, three mutants of 3′UTR of VCP mRNA were constructed by deleting the two targets sites individually or both to generate three reporter vectors(pGL3-VCP-3′UTRm1/m2/m3)(Figure 2B). [score:3]
In the HCC tissues, it was found that the expression of miR-129-5p was negatively correlated with the level of VCP. [score:3]
IκBα is the inhibitor of NF-κB, so the affection on the cell growth, apoptosis and migration induced by VCP and miR-129-5p might be via NF-κB pathway. [score:3]
It was found that miR-129-5p could also suppress the progression of HCC in vivo. [score:3]
Right panel showed the apoptosis of cell after miR-129-5p with/without VCP expression vector were transfected into HepG2 cells for 72 h. The experiment was repeated three times independently. [score:3]
It was found that the level of miR-219-5p was higher in level 1 than that in level 2, which indicated the miR-129-5p level was negatively related to the expression of VCP (Figure 2G). [score:3]
NC: negative control RNA duplex; miR-129-5p: miR-129-5p mimic; miR-129-5p/pcDNA3.1: cells were co -transfected with miR-129-5p mimic and blank pcDNA3.1; miR-129-5p/VCP: cells were co -transfected with miR-129-5p mimic and VCP expression vector. [score:3]
Cells transfected with miR-129-5p revealed a delayed tumor formation time (11/15 versus 2/15 on day 10) and a significant reduction in the tumor size, which was consist with the result of si-VCP group, suggesting a potential tumor suppressive effect of miR-129-5p (Figure 1B, 1C). [score:3]
There were two predicted miR-129-5p target sites in the 3′UTR of VCP mRNA, 162–168 and 505–511. [score:3]
In addition, no significant difference in the luciferase activities of pGL3-VCP-3′UTRm1/m2/m3 was observed after the cells were transfected with the inhibitor of miR-129-5p (Figure 2C,2D,2E). [score:3]
The in vivo study showed that enhancing the level of miR-129-5p could suppress the growth of tumor, which was similar to si-VCP group. [score:3]
There were two putative miR-129-5p target sites located in the VCP 3′UTR (162–168 and 505–511). [score:3]
Dot plots showed an inverse relationship between U6 snRNA and miR-129-5p expression in HCC. [score:3]
miR-129-5p is produced by the precursor of miR-129-1 and miR-129-2 and both of them negatively regulate SOX4 [25]. [score:2]
These results suggested that miR-129-5p directly interacts with the 3′UTR of VCP mRNA. [score:2]
C: The luciferase activity of the mutant VCP 3′UTR report genes were not regulated by miR-129-5p in HepG2 cells. [score:2]
These results indicated miR-129-5p might modulate the NF-κB signal pathway through the regulation of VCP. [score:2]
In the further investigation, it was found that the expression of VCP protein was enhanced compared to NC group after the miR-129-5p inhibitor was transfected to cells (Figure 3C). [score:2]
The western blot showed that the expression of VCP protein was significant reduced after the cell was treated with miR-129-5p or si-VCP compared with NC (Figure 3A). [score:2]
In our study, it was found that miR-129-5p was frequently decreased in HCC, which was in accordance with the previous reports [17]. [score:1]
Further investigation revealed that miR-129-5p could inhibit the degradation of IκBα. [score:1]
These results suggested that miR-129-5p and VCP was involved in the NF-κB signal pathway through degradation of IκBα. [score:1]
Five predicted miRNAs (miR-103, miR-107, miR-129-5p, miR-136, miR-339-5p) were transfected in HepG2 cells, respectively, with VCP 3′UTR report. [score:1]
As shown in Figure 3D, the luciferase activities of pNFκB-luc were strongly repressed following miR-129-5p or si-VCP transfection. [score:1]
HepG2 and SK-HEP1 cells were transfected with miR-129-5p or si-VCP. [score:1]
B,C: Effect of si-VCP and miR-129-5p on tumor growth in nude mice mo del. [score:1]
si-VCP, miR-129-5p- and NC -transfected HepG2 cells (1×10 [6]) were suspended in 100 µl PBS and then injected subcutaneously into either side of the posterior flank of the male BALB/c athymic nude mouse at 5–6 weeks of age. [score:1]
The migration level of miR-129-5p group was reduced to 23.54% of negative control level. [score:1]
The level of miR-129-5p was higher in SK-HEP1 than that in HepG2 and MHCC-LM3 (data not shown). [score:1]
The three mutant reporters were transfected into two HCC cell lines (HepG2 and MHCC-LM3) together with miR-129-5p. [score:1]
It was found that the level of Bcl-2 and XIAP was decreased in HepG2 or SK-HEP1 cells transfected with miR-129-5p or si-VCP (Figure 4D). [score:1]
Human miR-129-5p, MIMAT0000242; homo sapiens VCP, NM_007126.3. [score:1]
0035800.g003 Figure 3 A: Detection the level of VCP protein, accumulated ubiquitinated proteins and IκBα by Western blot after miR-129-5p, siRNA of VCP and NC were transfected into HepG2 or SK-HEP1 cells individually for 72 h. GAPDH served as the internal control. [score:1]
B: Bioinformatic analysis of miR-129-5p predicted binding sites in the VCP 3′UTR. [score:1]
si-VCP, miR-129-5p and NC -transfected HepG2 cells were suspended and then injected subcutaneously into either side of the posterior flank of the male BALB/c athymic nude mouse. [score:1]
F: Analysis of the level of miR-129-5p in HCC tissues by qRT-PCR. [score:1]
The significant decreased level of miR-129-5p was observed in HCC tissues (Figure 2F). [score:1]
The microarray results in the previous reports had presented that the level of miR-129 was deregulated in human HCC tissues compared with the normal controls [16]. [score:1]
The result showed that the level of miR-129-5p is frequently reduced in human HCC tissues. [score:1]
As described previously, miR-129-5p origins from miR-129-1 and miR-129-2. Huang Y et al identified that the miR-129-2 CpG island was frequently hypermethylated in endometrial tumors and the level of miR-129-5p decreases [33]. [score:1]
To verify the correlation between VCP and miR-129-5p, the level of VCP in the paraffin-embedded tissue samples of HCC was detected by immunohistochemistry with specific antibodies against VCP. [score:1]
It was found that the number of cells migrating across the membranes was decreased dramatically after the cells were treated with miR-129-5p or si-VCP. [score:1]
The result showed miR-129-5p and si-VCP could repress cell growth. [score:1]
miR-129-5p could decrease the level of VCP and increase the level of accumulated unbiqutinated proteins and IκBα. [score:1]
In our experiment, we found the level of IκBα in the HepG2 and SK-HEP1 cells after transfection with miR129-5p or si-VCP was increased (Figure 3A). [score:1]
A: Detection the level of VCP protein, accumulated ubiquitinated proteins and IκBα by Western blot after miR-129-5p, siRNA of VCP and NC were transfected into HepG2 or SK-HEP1 cells individually for 72 h. GAPDH served as the internal control. [score:1]
So we checked if miR-129-5p or VCP could influence the cell growth, apoptosis and migration of HCC cells. [score:1]
Left panel showed miR-129-5p and si-VCP could increase the apoptosis of HepG2 cells at 48 h and 72 h after the transfection. [score:1]
miR-129-5p and si-VCP could increase the apoptosis of SK-HEP1 cells at 72 h after the transfection. [score:1]
The reduction was also observed in the mRNA level of VCP in the cells transfected with si-VCP or miR-129-5p (Figure 3B). [score:1]
To assess whether the activities of NF-κB was affected by VCP or miR-129-5p, we transiently transfected a reporter plasmid with a luciferase gene linked to the binding region of NF-κB (pNFκB-luc) in HepG2 cells. [score:1]
Given the broad association between VCP and various cell activities, further study on whether miR-129-5p is involved in these processes will conducted in the future. [score:1]
B: Detection of the level of VCP mRNA in HepG2 or SK-HEP1 cells after transient transfection with si-VCP or miR-129-5p for 72 h. GAPDH served as the internal control. [score:1]
As the level of VCP and miR-129-5p in HCC samples is significantly different from that in adjacent normal tissues, the two molecules may be an indicator for prediction of the genesis of HCC. [score:1]
Figure 4A showed that the ubiquitinated proteins were accumulated after the cells were treated with miR-129-5p or si-VCP. [score:1]
The reporter vector of NF-κB was transfected into HepG2 together with miR-129-5p. [score:1]
[1 to 20 of 83 sentences]
8
[+] score: 190
Other miRNAs from this paper: mmu-mir-129-2
Our study is the first to demonstrate that: i) NG2 expression is associated with DIPG; ii) NG2 expression is symmetric in mitotic cells resulting in uncommitted progenitors with CSC properties; iii) NG2 in DIPGs is regulated by miR129-2; and iv) NG2 expression can be targeted in vivo and in vitro using miR129-2. Orthotopic injection of NG2 expressing cells results in rapidly developing pontine tumors that co-express PDGFRα, PDGFRβ and Ki67. [score:14]
Furthermore, we show that in vivo targeting of NG2 by miR129-2 results in downregulation of NG2, providing a strong candidate for targeted therapy for regulating NG2 expression. [score:11]
NG2 is Regulated by microRNA 129-2. NG2 upregulation in DIPG is partially due to hypermethylation and downregulation of its regulatory microRNA, miR129-2. miR129-2 Regulates NG2 in Human DIPGs. [score:10]
Importantly, 71.4 % (5 of 7) of patients with downregulated miR129-2 expression also demonstrated NG2 upregulation at the gene (Figure 3d) or protein level in whole transcriptome and proteomic analysis. [score:9]
Moreover, transient transfection of PDGFB mouse tumor cells with NG2 -targeting shRNA or miR129-2 expressing plasmid resulted in downregulation [(76% and 63%, respectively) as compared to control shRNA treated or empty vector treated cells] of NG2 protein as assessed by Western blot assay, validating the role of miR129-2 in regulation of NG2 expression (Figure 3b). [score:9]
To validate NG2 as a target for miR129-2, we transfected PDGFB mouse neurospheres with a vector containing the 3′-UTR sequence of NG2 cloned downstream of the firefly luciferase gene (Luc-3′UTR) along with a plasmid vector containing miR129-2. We found that co -expression of Luc-3′UTR and miR129-2 results in significant downregulation of luciferase expression as compared to cells transfected with luc-3′UTR vector alone (Figure 3a). [score:9]
As expected, downregulation of miR129-2 due to hypermethylation resulted in upregulation of NG2 mRNA as detected by NG2 mRNA using illumina platform. [score:7]
Co -expression of Luc-3′UTR of NG2 and miR129-2 resulted in significant downregulation of luciferase expression as compared to cells transfected with luc-3′UTR and empty vector. [score:7]
miR129-2 targets and downregulates NG2 in vivo. [score:6]
Figure 6miR129-2 targets and downregulates NG2 in vivoBrain sections from NG2-dsRed mice were analyzed 2 weeks after the intracranial injections with control lentiviral vector on left side and lentiviral vector harboring miR129-2 on right side. [score:6]
40 × magnification images (Scale bar: 10 μM) of boxed area in merged images are shown to demonstrate the downregulation of NG2 (red) in miR129-2 (green) transduced cells (arrows) while control transduced cells are expressing normal levels of NG2. [score:6]
However, in the contralateral hemisphere injected with GFP only control lentivirus, no reduction in NG2 expression was observed indicating the suitability of miR129-2 as a potential therapeutic molecule for regulating NG2 expression in vivo (Figure 6). [score:6]
analysis by confocal microscopy revealed upregulation of miR129-2 (indicated by GFP) resulted in NG2 (red) downregulation in vitro when compared to control transduced cells. [score:6]
Upregulation of either miR129-2 or NG2-shRNA resulted in NG2 downregulation in vitro when compared to empty vector or control shRNA treated cells. [score:6]
analysis by confocal microscopy revealed upregulation of miR129-2 (indicated by GFP), which resulted in NG2 (red) downregulation in vitro when compared to control transduced cells (Figure 3c). [score:6]
Examination of the right hemisphere injected with miR129-2 lentivirus indicated non to low expression of NG2 in cells transduced by miR129-2 as judged by GFP and dsRed expression. [score:5]
Nine days old (P9) NG2-dsRed mice were injected orthotopically with miR129-2 and GFP expressing lentivirus on the right hemisphere, and with GFP only expressing lentivirus (Control) on contralateral hemisphere. [score:5]
5-Aza is a DNA methyl-transferase inhibitor that has been used successfully for targeting miR129-2 in gastric cancer [18] and for epigenetic modification of SOX2 gene in adult malignant glioma cells [19]. [score:5]
We show that in DIPGs, significant hypermethylation of miR129-2 promoter results in miR-129-2 downregulation. [score:4]
In five of these patients, RT-PCR generated miR129-2 expression levels corresponded with levels detected via whole transcriptome analysis of the same DIPG cohort (average FC = −2, n=7 pairs) [8]. [score:3]
PDGFB mouse neurospheres were transfected in triplicates with luciferase and miR129-2 vectors, as shown, and luciferase expression was determined. [score:3]
Hypermethylation (at > 4 CpG sites) corresponded to decreased miR129-2 expression in 57% (4 of 7) of these patients (Figure 3d). [score:3]
To validate miR129-2 mediated NG2 targeting in human DIPG, we used primary DIPG lines (SF8628). [score:3]
NG2 Expression is controlled In Vitro by Demethylating DrugsEpigenetic silencing of miR129-2 is associated with cancer and has been shown to be reversible by demethylating drugs, including 5-Azacytidine (5-Aza) [18]. [score:3]
We detected downregulation of miR129-2 in 85.7% (6 of 7) of DIPG tumors compared to normal tissue (average FC = −30.79, n=7 pairs). [score:3]
Specifically, treatment with NG2-shRNA, miR129-2 and 5-Aza resulted in 51% (p < 0.001), 51% (p < 0.001) and 82.5% (p < 0.001) cell invasion inhibition, respectively. [score:3]
miR129-2 is shown to be downregulated in DIPG as assessed by RT-PCR and illumina chip assays. [score:3]
Treatment with NG2-shRNA and miR129-2 resulted in a very similar reduction in cell invasion (51%), which may rule out an off-target effect of the two constructs. [score:3]
QRT-PCR for miR129-2 expression. [score:3]
TaqMan small RNA assays kit (Applied Biosystems) was used to quantify the expression of miR129-2 in human DIPG samples. [score:2]
Our data suggests the role of miR129-2 in regulating NG2. [score:2]
IPA analysis identified miR129-2 as a potential NG2 regulator. [score:2]
NG2 knockdown with shRNA and miR129-2. Construction of miR129-2 lentiviral vector. [score:2]
Brain sections from NG2-dsRed mice were analyzed 2 weeks after the intracranial injections with control lentiviral vector on left side and lentiviral vector harboring miR129-2 on right side. [score:1]
Hypermethylation of miR129-2 at four or more CpG sites corresponding to miR129-2 promoter were detected in 57% of DIPGs. [score:1]
PDGFB mouse neurospheres and adherent mouse tumor cells were transfected with NG2 specific shRNA (Origene) or control shRNA or miR129-2 plasmids or empty vector using XtremeGene HP transfection reagent, according to the manufacturer's protocol (Roche). [score:1]
To determine whether miR129-2 is hypermethylated in DIPGs, we inspected methylation patterns at 8 CpG loci corresponding to the miR129-2 promoter in DIPG specimens. [score:1]
Epigenetic silencing of miR129-2 is associated with cancer and has been shown to be reversible by demethylating drugs, including 5-Azacytidine (5-Aza) [18]. [score:1]
Control transfections were performed by transfecting cells with miR129-2 plasmid alone or luciferase reporter construct alone. [score:1]
Human DIPG cells were transduced with pCDH-control or pCDH-miR129-2 lentivirus. [score:1]
QPCR of miR129-2 was performed according to manufacturer's instructions. [score:1]
Detection of the green signal (GFP) indicates in vivo transduction of either control or miR129-2. Area enclosed by dotted line in 10 × image (Scale bar: 100 μM) represents the site of injection. [score:1]
Figure 3(a) Luciferase vector with 3′-UTR sequence of NG2 cloned downstream of the firefly luciferase gene (Luc-3′UTR) and plasmid vector with miR129-2 sequence were used. [score:1]
Using a 26-gauge needle fitted to a gas tight Hamilton syringe, 2 μl (2×10 [8] TU/ml) of pCDH-miR129-2 lentiviral vector was injected on the right side and pCDH control vector was injected on the left side of the same mouse. [score:1]
Using XtremeGene HP transfection reagent (60 μl), cells were co -transfected with 10 μg of control-pCDH or pCDH-miR129-2 vectors and packaging plasmids. [score:1]
Briefly, miR129-2 precursor sequence from pmiR129-2 plasmid was isolated and cloned into pCDH-EF1-MCS-BGH-PGK-GFP-T2A-Puro vector using EcoR1 and Not1 restriction sites. [score:1]
Media was then replaced with 2 ml of fresh media containing 5 μg/ml of polybrene and added 0.4 million TU in 20 μl of control pCDH or pCDH miR129-2 vectors to cells. [score:1]
PDGFB mouse neurospheres were seeded into 6-well tissue culture plates (200,000/well) in complete media and maintained at 37 [o]C for 24 h. The cells were then co -transfected in triplicates with empty vector or miR129-2(5′ CUUUUUGCGGUCUGGGCUUGC 3′) plasmid (Origene) and luciferase reporter construct (Origene) harboring 3′ UTR of NG2 downstream of luciferase gene, using XtremeGene HP transfection reagent (Roche). [score:1]
[1 to 20 of 48 sentences]
9
[+] score: 160
Other miRNAs from this paper: hsa-mir-129-1, hsa-mir-423, hsa-mir-18b, hsa-mir-452, hsa-mir-622
This study demonstrated that microvesicles can be interrogated as a source of miRNAs released into the circulation with HF, that there is an inverse relationship between levels of miR129-5p in circulating microvesicles and the degree of HF in pediatric patients with univentricular heart disease, that miR129-5p is similarly downregulated in cultured human cardiomyocytes and cardiomyocytes derived from hESCs exposed to oxidative stress, and that BMPR2 expression is likely regulated by miR129-5p in the setting of cardiomyocyte stress. [score:9]
We also showed that overexpression of miR129-5p results in downregulation of BMPR2 transcript expression in HL1 cells cultured under these conditions (Fig 6C). [score:8]
0183624.g006 Fig 6A) In silico analysis of potential miR129-5p targets using Target Scan Human identified bone morphogenetic protein receptor 2 (BMPR2) as a potential target. [score:7]
Using a dual-luciferase reporter assay in HL1 cells, we demonstrated that transcriptional activity under control of the BMPR2 3’UTR was upregulated under hypoxic or oxidative stress conditions, however, this response was inhibited with overexpression of miR129-5p (Fig 6B). [score:7]
A) In silico analysis of potential miR129-5p targets using Target Scan Human identified bone morphogenetic protein receptor 2 (BMPR2) as a potential target. [score:7]
An increase in BMPR2 expression was seen under both conditions of oxidative stress, and this increase was suppressed by overexpression of miR129-5p. [score:7]
Upregulation of hypoxia -mediated VEGFA and downregulation of miR129-5p was seen. [score:7]
While we see a decrease in miR129-5p levels with worsening HF symptoms, this should result in disinhibition of BMPR2 expression contrary to what occurs with inactivating mutations leading to idiopathic pulmonary hypertension. [score:6]
miR129-5p expression was downregulated with increasing Ross score independent of ventricular morphology or stage of palliation. [score:6]
In each patient, miR129-5p expression was downregulated with increasing Ross score. [score:6]
Under both conditions, miR129-5p expression was downregulated. [score:6]
To extend these findings, we also exposed cardiomyocytes derived from hESCs to 1% O [2], and similarly observed an increase in expression of VEGFA, consistent with an hypoxic response, as well as a decrease in miR129-5p expression (Fig 5). [score:5]
To further define the relationship between miR129-5p expression and clinical heart failure, individual patient sera were analyzed for miR129-5p expression and stratified by type of single ventricle and stage of surgical palliation (Fig 2). [score:5]
In this case, miR129-5p appears to serve as a potential biomarker for HF in univentricular heart disease, and further study of miR129-5p targets may elucidate the mechanism by which patients with univentricular physiology develop HF and its pulmonary vascular sequelae. [score:5]
TargetScan (version 6.2) was used to search the 3’UTRs of expressed genes for the presence of 7/8-mer sites that matched the seed region of miR129-5p. [score:5]
pmiR-129-5p-Luc expresses Photinus pyralis luciferase under control of a CMV promoter, regulated by the presence of a miR-129 binding site within the 3’ UTR of the luciferase coding sequence. [score:4]
Co-transfection with miR129-5p (mimic) downregulates luciferase activity. [score:4]
In contrast, the current study demonstrates that miR129-5p levels vary with degree of clinical HF in univentricular heart disease independent of ventricular morphology and stage of palliation. [score:3]
Serial miR129-5p expression in univentricular heart failure patients. [score:3]
miR129-5p showed a decrease in expression with increasing Ross score. [score:3]
miR129-5p expression in HL1 cells with oxidative stress. [score:3]
A) hESC-derived cardiomyocytes were cultured in 1% O [2] and relative expression of vascular endothelial growth factor A (VEGFA) and miR129-5p were assessed by qPCR. [score:3]
C) HL1 cells were grown in 1% O [2] or 100 μM H [2]O [2] and relative expression of BMPR2 in the presence and absence of transfected miR129-5p (mimic) was assessed by qPCR. [score:3]
Bone morphogenetic protein receptor 2 is a target of miR129-5p in HL1 cells. [score:3]
miR129-5p expression by ventricular morphology and stage of palliation. [score:3]
Aliquots of sera were pooled from patients with Ross scores <3, 3–5, and >5 for expression analysis of miR129-5p, miR18b, miR423-5p, miR622, and miR452. [score:3]
Similarly, miR129-5p expression decreased in HL1 cells under both conditions (Fig 4C). [score:3]
C) miR129-5p expression in HL1 cells grown in 1% O [2] or H [2]O [2] was analyzed by qPCR. [score:3]
0183624.g005 Fig 5A) hESC-derived cardiomyocytes were cultured in 1% O [2] and relative expression of vascular endothelial growth factor A (VEGFA) and miR129-5p were assessed by qPCR. [score:3]
A decrease in relative expression of miR129-5p to ≤0.58 predicts the presence of clinical HF with 85% sensitivity and 100% specificity. [score:3]
miR129-5p expression in hESC-derived cardiomyocytes with hypoxia. [score:3]
ROC analysis of miR129-5p versus Ross scores. [score:1]
Serial plasma samples from three patients were evaluated for miR129-5p expression and plotted relative to Ross score at the time of sample collection. [score:1]
A dose -dependent inverse relationship was observed between Ross score and miR129-5p within this cohort (Fig 1). [score:1]
At the time of miR-129 mirVana miRNA mimic (Ambion, MC10195) transfection (30nM final concentration), HL1 cells were co -transfected with 0.5μg pmiR-129-5p-Luc reporter plasmid (Signosis, binding site sequence: 5’GCAAGCCCAGACCGCAAAAAG3’) together with 50ng of pRL-TK using DharmaFECT Duo (Thermo Scientific, T-2010-02). [score:1]
0183624.g003 Fig 3 Serial plasma samples from three patients were evaluated for miR129-5p expression and plotted relative to Ross score at the time of sample collection. [score:1]
This demonstrated that miR129-5p levels declined with increasing Ross score independent of ventricular morphology or stage of palliation. [score:1]
0183624.g002 Fig 2 Sera from individual patients were evaluated for miR129-5p expression and plotted relative to Ross score. [score:1]
ROC curve analysis of miR129-5p data for the entire cohort exceeded our pre-specified threshold of ≥75% area contained by the curve (c-statistic 98%, P<0.0001; S2 Fig). [score:1]
Following linear pre-amplification of miRNA sequences using the Applied Biosystems Preamplification system, relative expression was determined using singleplex TaqMan Assays (ABI) with primer sets for miR-129 (ABI; 000590), miR-18b (ABI; 002310), miR-423-5p (ABI; 002340), miR-622 (ABI; 001553), and miR-452 (ABI; 002330). [score:1]
Conservation among mammals of the miR129-5p binding site in the 3’UTR of BMPR2 is shown below. [score:1]
To evaluate whether changes in miR129-5p expression in response to HF may originate from the myocardium, HL1 cells representing human adult cardiomyocytes [15] were grown under hypoxic conditions (1% O [2]) or subjected to oxidative stress (100 μM H [2]O [2]) (Fig 4). [score:1]
This allowed us to evaluate several candidate miRNAs previously associated with HF in adult patients, and specifically identify miR129-5p as an informative biomarker for HF in children with univentricular heart disease. [score:1]
To assess the specificity of the miRNA -binding site of the pmiR-129-5p-Luc reporter plasmid, a custom luciferase reporter vector with a scrambled binding site (Signosis, scrambled binding site sequence: 5 ’CAGACGAACCGGACAACGAAC3’) was transfected into HL1 cells along with the miR-129 miRNA mimic and pRL-TK. [score:1]
Sera from individual patients were evaluated for miR129-5p expression and plotted relative to Ross score. [score:1]
[1 to 20 of 45 sentences]
10
[+] score: 140
Other miRNAs from this paper: hsa-mir-129-1
DNA methylation mediated downregulation of miR-129 has been reported in endometrial 7, gastric 8, 9, colorectal 10, liver cancer 11, and lymphocytic leukaemia 12, and miR-129 expression level is much lower in tumour cell lines or primary tumour tissues from neural, gastric, and colorectal cancers than their corresponding controls 13– 15. miR-129 is one of the candidate miRNAs possessing the potential of tumour suppressor activity, implied by studies that the ectopic expression of miR-129-5p reduced proliferation activities and promoted cell death of endometrial tumour cells and bladder cancer cells 7, 16. [score:10]
VCP gene is a target of miR-129 and the hypomethylation treatment down-regulated VCP expression in lung cancer cells. [score:8]
These data showed that miR-129 overexpression suppressed cell proliferation with G2/M phase cell cycle arrest in A549 cells through up -regulating Wee1 and p21 along with down -regulating CDK1, CCNB1 and CDC25c. [score:7]
The major regulators of G2 to M transition are CDK1 and the regulatory subunit cyclin B1 3, both of which showed reduced expression in miR-129 overexpressed cells. [score:7]
To sum up, these observations indicated that the up-regulation of miR-129 in lung cancer cells resulted in the inhibition of cell migration and invasion. [score:6]
Figure 6 Inhibition of A549 cell migration and invasion by miR-129 overexpression. [score:5]
In this study, we observed a reduction of VCP in either miR-129 overexpressing or hypomethylated lung cancer cells, and verified that VCP gene is a target of miR-129. [score:5]
Moreover, we confirmed that VCP gene is a target of miR-129, and expressed negatively correlated with miR-129. [score:5]
Suppression of cell proliferation with G2/M phase cell cycle arrest in miR-129 overexpressing A549 cells. [score:5]
miR-129-2 overexpression inhibited cell migration and invasion in A549 cells. [score:5]
Figure 2 VCP mRNA is a direct target of miR-129. [score:4]
As we know, the most of protein-coding genes may be regulated by epigenetics, one of which is DNA methylation frequently observed in the CpG islands sites on promoter region of a gene 5. It is said that 10% of miRNAs are undergoing epigenetic regulation through DNA methylation in the miRNA 5′ regulatory region 5, 6. The CpG islands are encompassed in the promoter and 5′ UTR region of miR-129-2 gene, located in chromosome 11p11.2. [score:4]
By real-time PCR, the overexpression of miR-129 increased the expression of miR-129-5p and miR-129-3p by 2.10-fold and 1.63-fold, respectively, and reduced VCP mRNA by more than 50% (Fig. 5A) compared to the controls. [score:4]
In the present study, we found that miR-129 was regulated by DNA methylation and conferred the tumour suppressive potential. [score:4]
To assess the alteration of miR-129 expression caused by hypomethylation, we performed real-time RT-PCR, and found that both of its mature products (miR-129-5p and miR-129-3p) were significantly increased in A549 cells (Fig. 1C); while in SPCA-1, miR-129-5p rose predominantly and miR-129-3p did not change (Fig. 1D). [score:3]
Here, we speculate that DNA methylation alters the expression of miR-129 in lung cancer and miR-129 plays pivotal roles in lung cancer progression. [score:3]
After deletion of one or both of the two putative miR-129 -binding sites, the luciferase activities rose remarkably (Fig. 2C), suggesting that miR-129 directly regulates VCP gene through these two binding sites. [score:3]
In hepatocellular and gastric carcinoma, the elevated expression of VCP is combined with increased incidence of recurrence, whereas the level of VCP in hepatocellular carcinoma tissues was negatively associated with the level of miR-129-5p 41– 44. [score:3]
Our data showed that lung cancer cells were profoundly arrested at G2/M phase of cell cycle after miR-129 overexpression. [score:3]
Cells were seeded into 6-well plate and cultured overnight before transfection with miR-129 mimics or inhibitor, and before DAC treatment. [score:3]
In summary, miR-129 suppressed lung cancer cell proliferation by arresting cell cycle at G2/M phase through inactivation of CDK1 by Wee1, and reduced cell migration and invasion in lung cancer through controlling the protein levels of NF-κB and MMP-2. The authors declare that they have no conflict of interest. [score:3]
Interestingly, in line with the observations after DAC treatment, the ectopic expression of miR-129 in A549 cells not only prevented the cell migration, but also hampered the cell invasion. [score:3]
Figure 5 Effects of miR-129 overexpression on A549 cell proliferation and cell cycle. [score:3]
Furthermore, we found that A549 cells were arrested at G2/M phase of cell cycle by miR-129 overexpression (Fig. 5C and D). [score:3]
At the same time, we checked VCP gene, a presumed target gene of miR-129, by real-time RT-PCR, and discovered a marked decrease at VCP mRNA level in both cells (Fig. 1C and D). [score:3]
To confirm the regulation role of miR-129 on VCP, we utilized luciferase assay for detection of the interactions between miR-129 and the putative miR-129 -binding sites on 3′-UTR of VCP gene (Fig. 2A), predicted by software TargetScanHuman. [score:3]
The NF-κB pathway was attenuated by miR-129 overexpression as indicated by fainter band than controls (Fig. 6D). [score:3]
After transfection by miR-129 mimics or inhibitor, both of A549 (Fig. 2B, upper panel) and SPCA-1 (Fig. 2B, lower panel) cells showed weaker band or stronger band of VCP protein, respectively, by Western blotting. [score:3]
The results of luciferase assay showed significant inhibition of luciferase activity after miR-129 transfection (Fig. 2C). [score:2]
A549 cells transfected with miR-129 mimics or the control for miR-129 mimics were collected after 48 hrs, and examined for the expression levels of selected genes using specific primers. [score:2]
Figure 6A exhibited representative photographs of wound healing assays, and the percentage of wound healing distance was 43.20% less in miR-129 overexpressed A549 cells than the control (Fig. 6A, lower panel). [score:2]
We observed an increase in E-Cadherin, and a decrease in β-catenin, Snail, Vimentin and NF-κB in miR-129 ectopic expressed cells as compared with control, which were coincident with the cells treated with DAC. [score:2]
In lung adenocarcinoma, it was reported that the expression level of miR-129 was much lower as compared with normal lung tissues 17. [score:2]
In the subsequent experiments, A549 and SPCA-1 were chosen as the totally methylated mo del for miR-129-2, while 95-D as un-methylated mo del. [score:1]
Profiles of miR-129-2 gene methylation in lung cancer cell lines. [score:1]
As indicated in Figure 1A, A549 cells showed faint band representing methylated miR-129-2 and strong band for un-methylated miR-129-2 after hypomethylation. [score:1]
HEK293 cells grown on 96-well plates were co -transfected with both psiCHECK-2 (M) construct and miR-129 mimics or control. [score:1]
In this study, we examined the epigenetic status of miR-129-2 in five human lung cancer cell lines and found that miR-129-2 was absolutely methylated in A549, SPCA-1, SK-MES-1 and PC-9 cells, and totally un-methylated in 95-D cell, suggesting a methylation of miR-129-2 in the majority of lung carcinoma. [score:1]
Consistently, the number of migrated cells per field was 2.83-fold less in miR-129 overexpressed cells compared with the control utilizing Transwell assay (Fig. 6B). [score:1]
These data indicated that miR-129 was restored by DAC in both A549 and SPCA-1 cells. [score:1]
To investigate the roles of miR-129 in lung cancer, we determined the functions of miR-129 by ectopic expression in A549 cells. [score:1]
A549 cells were transfected with miR-129 mimics (D) or the control for miR-129 mimics (C), and 48 hrs later, the cells were stained by PI and assessed for cell cycle distribution by flow cytometry. [score:1]
[1 to 20 of 42 sentences]
11
[+] score: 117
Other miRNAs from this paper: hsa-mir-129-1, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-181a-1
Effects of hsa_circ_0005986 downregulation on miR-129-5p and Notch1 expressionTo verify that hsa_circ_0005986 and NOTCH1 are targets of miR-129-5p, we further sought to determine whether the downregulation of hsa_circ_0005986 would influence miR-129-5p and NOTCH1mRNA levels. [score:11]
To verify that hsa_circ_0005986 and NOTCH1 are targets of miR-129-5p, we further sought to determine whether the downregulation of hsa_circ_0005986 would influence miR-129-5p and NOTCH1mRNA levels. [score:6]
Effects of hsa_circ_0005986 downregulation on miR-129-5p and Notch1 expression. [score:6]
Via Arraystar's home-made miRNA target prediction software based on TargetScan and miRanda [16], we found that hsa_circ_0005986 has hsa-miR-129-5p seed matches. [score:5]
Based on these, by using luciferase reporter assay and qRT-PCR, we found that hsa_circ_0005986 could interact with miR-129-5p directly, that interference of the hsa_circ_0005986 level could influence miR-129-5p and Notch1 mRNA expression levels, and that hsa_circ_0005986 and Notch1 mRNA expression changed simultaneously. [score:5]
Hsa_circ_0005986 and NOTCH1 mRNA are targeted by miR-129-5p NOTCH1 is one of the validated targets of miR-129-5p (Figure 2C) [17]. [score:5]
Figure 4Expression of hsa_circ_0005986 and Notch1 mRNA in HepG2 and Huh7 cell lines transfected with miR-129-5p mimics (A) or inhibitors (B). [score:5]
We found that hsa_circ_0005986 could directly interact with miR-129-5p through luciferase reporter assay, and regulate NOTCH1 mRNA expression by acting as a sponge for miR-129-5p. [score:4]
If hsa_circ_0005986 functions as a ceRNA, its downregulation might free miR-129-5p. [score:4]
Figure 5Expression of hsa_circ_0005986 (A), miR-129-5p (B) and NOTCH1 mRNA (C) in HepG2 and Huh7 cell lines after hsa_circ_0005986 knockdown. [score:4]
One of the mechanisms underlying hsa_circ_0005986 influencing HCC carcinogenesis is that it regulated Notch1 expression through interacting with miR-129-5p. [score:4]
These all showed hsa_circ_0005986 could regulate NOTCH1 expression by acting as a sponge for miR-129-5p. [score:4]
We focused on hsa_circ_0005986 and NOTCH1 in this study, because both of them are targets of miR-129-5p. [score:3]
Firefly luciferase (FL) plasmid and miR-129-5p expression plasmid were cotransfected with pRL-TK Renilla luciferase (RL) vector (Promega, Madison, WI) for normalization. [score:3]
Figure 2(A) The interaction of hsa_circ_0005986-hsa-miR-129-5p was predicted based on TargetScan and miRanda. [score:3]
For the transfection of the miR-129-5p mimics, inhibitors and small interfering RNAs (siRNAs), HepG2 and Huh-7 cells (2 × 105) were seeded in 6-well plates. [score:3]
MiR-129-5p expression plasmid (pmirGLO) was purchased from GenePharma Co. [score:3]
The following day, they were transfected with 120nM miR-129-5p mimics, inhibitors or siRNA using Lipofectamine 2000 Reagent (Life Technologies). [score:3]
The miR-129-5p MRE of hsa_circ_0005986 wild-type and mutant sequence showed in Figure 3 following Arraystar's home-made miRNA target prediction (Figure 2A). [score:3]
NOTCH1 is one of the validated targets of miR-129-5p (Figure 2C) [17]. [score:3]
Next, we utilized qRT-PCR analysis to reveal that miR-129-5p inhibitors increased both hsa_circ_0005986 and Notch1 abundance in two HCC cell lines (Figure 4B). [score:3]
To test whether hsa_circ_0005986 and Notch1 expression levels were affected by miR-129-5p, we increased the miR-129-5p level by transfection of its mimics into HepG2 and Huh7 cells. [score:3]
Hsa_circ_0005986 and NOTCH1 mRNA are targeted by miR-129-5p. [score:3]
To decrease the miR-129-5p level, we transfected miR-129-5p inhibitors into HepG2 and Huh7 cells. [score:3]
The sequence of miR-129-5p inhibitor was GCAAGCCCAGACCGCAAAAAG. [score:3]
php?mirtid=MIRT005412), we found Notch1 is one of validated target genes of hsa-miR-129-5p by luciferase reporter assay and microarray [17]. [score:2]
It indicates the direct interaction between hsa_circ_0005986 and miR-129-5p. [score:2]
The sequence of miR-129-5p mimic was 5′-CUUUUUGCGGUCUGGGCUUGC-3′ (sense) and 5′-AAGCCCAGACCGCAAAAAGUU-3′(antisense). [score:1]
Detailed seed matches between hsa-miR-129-5p and Notch1mRNA. [score:1]
Prediction of hsa_circ_0005986-hsa-miR-129-5p-NOTCH1 interaction. [score:1]
Hence, it could conceivably be hypothesized that hsa_circ_0005986 and Notch1mRNA may act as a pair of ceRNAs that are linked by miR-129-5p. [score:1]
The results showed that this not only effectively reduced the hsa_circ_0005986 level but also increased the miR-129-5p level in the HepG2 and Huh7 cells (Figure 5A, 5B). [score:1]
Prediction for hsa_circ_0005986-miR-129-5p related pathways and GO analysis. [score:1]
Here, our study further verified the direct interaction between hsa_circ_0005986 and miR-129-5p via dual luciferase reporter assays (Figure 3). [score:1]
Several reports have shown that miR-129-5p is linked to cancer, especially HCC [45, 46]. [score:1]
qRT-PCR analysis indicated that the transfection of miR-129-5p mimics decreased not only hsa_circ_0005986 levels but also Notch1mRNA levels in both HepG2 and Huh7 cells (Figure 4A). [score:1]
Through DIANA mirPath v. 3, we identified has-miR-129-5p was closely related with a lot of cancer-related pathways, such as viral carcinogenesis, prostate cancer, hippo signaling pathway, p53 signaling pathway, pathways in cancer, PI3K-Akt signaling pathway, etc. [score:1]
The hsa_circ_0005986-miR-129-5p related pathway and gene ontology (GO) analysis were carried out based on DIANA-miRPath V. 3 [48]. [score:1]
[1 to 20 of 38 sentences]
12
[+] score: 83
Fold-changes of target gene transcripts, as quantified via TaqMan® real time PCR in THP-1 cells, transfected with pre-miR-129-5p and stimulated with MDP, transfected with anti-miR-146a and stimulated with TNF-a and transfected with anti-miR-378 and stimulated with TNF-α are displayed (green = downregulation, yellow = no regulation, red = upregulation, grey = not detected). [score:10]
0031151.g004 Figure 4 Fold-changes of target gene transcripts, as quantified via TaqMan® real time PCR in THP-1 cells, transfected with pre-miR-129-5p and stimulated with MDP, transfected with anti-miR-146a and stimulated with TNF-a and transfected with anti-miR-378 and stimulated with TNF-α are displayed (green = downregulation, yellow = no regulation, red = upregulation, grey = not detected). [score:10]
The miRanda mo del predicted 3736, 2763 and 2229 targets, miRBase predicted 999, 1038 and 1038, PicTar predicted 290, 157 and 0, PITA predicted 14, 59 and 62 targets and TargetScanS predicted 0, 37 and 0 targets for miR-129-5p, miR-146a and miR-378 respectively. [score:9]
The complexity and the potential involvement of interaction partners which were not monitored in this study is demonstrated by the example of nucleotide -binding oligomerization domain containing 2 (CARD15/NOD2): It is downregulated upon transfection of THP-1 cells with pre-miR-129-5p in the presence of MDP, but upregulated upon transfection with anti-miR-146a or anti-miR-378 in the presence of TNF-α. [score:7]
Out of 13 predicted targets for miR-129-5p, 8 showed a downregulation after transfecting THP-1 cells with pre-miR-129-5p (ERBB2IP, ERC1, FKBP5, MAP3K1, MAP3K2, MAP3K7IP3, NFKB1, PPP2CB). [score:6]
miR-129-5p was the only miRNA that was regulated exclusively in response to MDP (6.02-fold upregulated, p = 0.022) and showed no similarities to response patterns resulting of other stimuli. [score:5]
The downregulation however, can not be attributed to miR-129-5p exclusively, since this miRNA responded only to MDP, not to TNF-α. [score:4]
A cluster analysis of inductions (Figure 4) revealed strong similarities between the two miRNAs that were regulated in response to TNF-α (anti-miR-146a and anti-miR-378; Figure 1), while pre-miR-129-5p exhibited a approximately opposite patter of induced target genes. [score:4]
Table S2 In silico predictions of target genes for hsa miR-129-5p, 146a and 378. [score:3]
The profile showed that miR-129-5p was present in low levels (0.02% of miR-150) while miR-146a and miR-378 were expressed at higher levels (both located within the top 15 [th] percentile; Figure S2). [score:3]
To assess the impact of the presented miRNA patterns, three exemplary miRNAs were selected for further analysis of their impact on potential target transcripts, associated to inflammatory processes: hsa-miR-129-5p, hsa-miR-146a and hsa-miR-378. [score:3]
A summary of target genes predicted by these 5 algorithms for three exemplary miRNAs (miR-129-5p, miR 146a and miR 378) is presented in Table S2. [score:3]
From the range of predicted target genes for miR-129-5p, miR-146a and miR-378, a subset of closely interconnected genes, functionally relevant to several inflammatory pathways (e. g. upstream of NFκB activation and/or MAP kinase activation) and interaction partners of these genes were selected for subsequent verification. [score:3]
To display their relative endogenous expression, miR129-5p, miR-146a and miR-378 are highlighted. [score:3]
The y-axis represents the fold-change, relative to the corresponding control-miRNA (control pre-miR for miR129-5p and control anti-miR for miR146a and 378). [score:1]
doi:10.1182/blood-2009-06-225987 41 Dyrskjøt L Ostenfeld MS Bramsen JB Silahtaroglu AN Lamy P 2009 Genomic profiling of microRNAs in bladder cancer: miR-129 is associated with poor outcome and promotes cell death in vitro. [score:1]
Therefore, miR-129-5p was selected to be experimentally increased by transfection of THP-1 cells with pre-miR-129-5p in contrast to miR-146a and miR-378 which were selected to be experimentally decreased by transfection with anti-miR-146a and anti-miR-378, respectively. [score:1]
Previous reports associate miR-129 mainly with cancer and differentiation processes [41], [42], while its association to inflammation was not described previously. [score:1]
THP-1 cells were stimulated with the corresponding stimulus to reflect the initial result in primary cells (MDP for cells transfected with pre-hsa-miR129-5p; TNF-α for cells transfected with anti-has-miR146a and anti-has-miR378). [score:1]
Synthetic pre-miR-129-5p, pre-miR-ctrl, anti-miR-146a, anti-miR-378 and anti-miR-ctrl were purchased from Ambion (AppliedBiosystems). [score:1]
Finally, these findings present miR-129-5p as a novel candidate for NOD-like receptor (NLR) -mediated responses. [score:1]
Table S1, illustrated by fold changes in response to transfection with pre-hsa-miR129, anti-hsa-miR146a and anti-hsa-miR378. [score:1]
When transfected into monocytes, we observed that the effect of pre-miR-129-5p on transcript levels after MDP-stimulation represents almost the opposite to the effect observed when transfecting cells with anti-miR-146a and anti-miR-378 after TNF-α stimulation (Figure 4). [score:1]
As a representative of the MDP-response cluster, miR-129-5p was selected. [score:1]
[1 to 20 of 24 sentences]
13
[+] score: 65
The expression of let-7a, miR-9, and miR-129-5p in the human fetal cerebellum is consistent with their roles in regulating FOXP2 expression during early cerebellum development. [score:7]
The expression of let-7a, miR-9, and miR-129-5p in the human fetal cerebellum is consistent with their roles in regulating FOXP2 expression during early cerebellum development in humans. [score:7]
We selected 12 miRNAs: miR-9, miR-19b, miR-27b, miR-92a, miR-140-5p, miR-190, miR-200a, let-7a, miR-129-5p, miR-582-5p, miR-892a, and miR-1237 (Figure  1) and tested whether they downregulate FOXP2 expression in cell culture systems. [score:6]
Focusing on let-7a, miR-9, and miR-129-5p, three brain-enriched miRNAs, we show that these miRNAs regulate human FOXP2 expression in a dosage -dependent manner and target specific sequences in the FOXP2 3′ UTR. [score:6]
Using quantitative real time PCR (qRT-PCR), we also found that FOXP2 mRNA level was downregulated by let-7a, miR-9, and miR-129-5p in similar transfection experiments (Figure  2D). [score:4]
Of these miRNAs, let-7a, miR-9, and miR-129-5p were among the most effective regulators, reducing FOXP2 protein by 70-90%; they are also known to be abundantly expressed in vertebrate brains [17, 18]. [score:4]
The dose -dependent downregulation was significant for each miRNA (p < 0.0018 for let-7a and miR-9; p < 0.0006 for miR-129-5p, Jonckheere-Terpstra test). [score:4]
Figure 3 The downregulatory effects of let-7a, miR-9, and miR-129-5p are mediated via specific sequences in the human FOXP2 3′ UTR. [score:4]
Let-7a, miR-9, and miR-129-5p are expressed in the cerebellum of the human fetal brain. [score:3]
let-7a, miR-9, and miR-129-5p target specific sequences in the human FOXP2 3′ UTR. [score:3]
We found that all these three miRNAs, let-7a, miR-9, and miR-129-5p, were expressed in the cerebellum of the human fetal brain (Figure  4). [score:3]
Figure 4 Expression of let-7a, miR-9, and miR-129-5p in the cerebellum of the human fetal brain. [score:3]
We examined the expression of let-7a, miR-9, and miR-129-5p in human fetal brain tissue by in situ hybridization using Locked Nucleic Acid (LNA) modified miRNA detection probes. [score:3]
Recently, dysregulation of miR-129-5p is found in the cerebellum of autistic brains, albeit only a limited number of brains were examined [24]. [score:2]
We focused on let-7a, miR-9, and miR-129-5p and further tested whether their regulatory effects were sequence-specific. [score:2]
We found that miR-9, miR-19b, miR-140-5p, miR-200a, let-7a, miR-129-5p, miR-582-5p, and miR-892a reduced FOXP2 protein levels significantly (Figure  2A). [score:1]
LNA modified miRNA detection probes were purchased from Exiqon: let-7a probe (18000–01); miR-9 probe (88078–05); a customer designed mutant miR-9 probe (miR-9m: 5′-TCATA GAGCTA CATAACCA TA CA-3′, underlined are mutated nucleotides); miR-129-5p probe (38482–15); negative control probe (99004–01). [score:1]
At 2 nM, comparing to the control, let-7a and miR-9 each decreased FOXP2 protein levels by about 50%, while miR-129-5p decreased FOXP2 protein by less than 10% (p < 0.01 for all). [score:1]
At 20 nM, let-7a and miR-9 decreased FOXP2 protein levels by 90%, and miR-129-5p decreased FOXP2 protein by 70% (p < 0.001 for all, Figure  2B and C). [score:1]
[1 to 20 of 19 sentences]
14
[+] score: 59
miR-129 might influence CTSE expression indirectly by binding the 3-untranslated region (3 ′-UTR) of specificity protein 1 (SP1) [60]. [score:6]
A significant downregulation of SP1 -expression was observed after transfection of HeLa cells with exogenous miR-129-5p [60]. [score:6]
Expression of miRNAs mmu-miR-101c and mmu-miR-129-5p was downregulated. [score:6]
Autophagy-related miRNAs mmu-miR-101c, mmu-miR-129-5p, and mmu-miR-210-5p were differentially expressed in L. m. -infected BMDM in the late infection phase and directly influenced the parasite clearanceTo identify additional regulatory mechanisms, involved in the autophagic clearance of L. m. amastigotes, the small RNA transcriptome at 24 h p. i. was analyzed with Affymetrix® chips (Fig.   10a). [score:5]
Fig. 10Global analysis of differentially expressed miRNAs in L. m. -infected BMDM, bioinformatical prediction of miRNA interactions with LISA, and infection rates of L. m. -infected BMDM after transfection with mmu-miR-101c or mmu-miR-129-5p mimics as well as mmu-miR-155-5p or mmu-miR-210-5p inhibitors. [score:5]
The miRNAs mmu-miR-101c and mmu-miR-129-5p were significantly downregulated in our experiments during the late infection phase. [score:4]
Transfection of L. m. -infected BMDM with miRNA mimics for mmu-miR-101c and mmu-miR-129-5p, or with an mmu-miR-210-5p inhibitor in the late infection phase, resulted in significantly decreased infection rates, which suggests that these miRNAs might influence autophagic processes directly (Fig.   10c). [score:4]
Transfection with mimics of mmu-miR-101c and mmu-miR-129-5p, as well as with an inhibitor of mmu-miR-210-5p, demonstrated direct effects of the respective miRNAs on parasite clearance in L. m. -infected BMDM. [score:4]
For downregulated miRNAs, L. m. -infected BMDM were transfected with miRNA mimics (mmu-miR-101c: MSY0019349, Qiagen; mmu-miR-129-5p: MSY0000209, Qiagen). [score:4]
Autophagy-related miRNAs mmu-miR-101c, mmu-miR-129-5p, and mmu-miR-210-5p were differentially expressed in L. m. -infected BMDM in the late infection phase and directly influenced the parasite clearance. [score:4]
Transfection of L. m. -infected BMDM with an mmu-miR-210-5p inhibitor as well as with mmu-miR-101c and mmu-miR-129 mimics significantly decreased the infection rates of these cells. [score:3]
In contrast to the expected decrease of infection rates from transfection of L. m. -infected BMDM with an mmu-miR-210-5p inhibitor and an mmu-miR-129-5p mimic, the infection rates also decreased after treatment with an mmu-miR-101c mimic. [score:3]
c A significant decrease in the infection rates was detected in L. m. -infected BMDM after transfection with mmu-miR-101c, mmu-miR-129-5p, and mmu-miR-210-5p compared to L. m. -infected BMDM transfected with a negative control of miRNA mimics or inhibitors. [score:2]
Direct influences on parasitic clearance were shown for (1) the proteins BNIP3 and CTSE, and (2) the miRNAs mmu-miR-101c, mmu-miR-129-5p, and mmu-miR-210-5p. [score:2]
Furthermore, mmu-miR-101c, mmu-miR-129-5p, and mmu-miR-210-5p were involved in parasite clearance from BMDM. [score:1]
[1 to 20 of 15 sentences]
15
[+] score: 58
Other miRNAs from this paper: hsa-mir-21, hsa-mir-31, hsa-mir-129-1, hsa-mir-146a, hsa-mir-331
Zhang et al. have reported that the transcription factor SP1 is a direct downstream target of miR-129-5p in Hela cells, and SP1 expression is down-regulated significantly by over-expressed miR-129-5p [19]. [score:11]
The up-regulation of miR129-5p is required for KSHV/viral latent proteins reducing HPV16 E6 and E7 expression. [score:6]
The up-regulation of miR129-5p is required for KSHV/viral proteins reducing E6 and E7 expression. [score:6]
One remaining question is the mechanisms through which miRNA129-5p inhibiting E6 and E7 expression. [score:5]
We next used specific miRNA129-5p inhibitor to block its activities (Supplementary Figure 2), which effectively restored E6/E7 expression from KSHV-infected or LANA-/vFLIP -transfected SiHa cells (Figure 5C–5E). [score:5]
We also have found the underlying mechanism is through the down-regulation of at least one cellular microRNA, miRNA129-5p, although some other mechanisms are possibly involved as well. [score:4]
Zhang et al. have reported that interferon-β treatment can induce miRNA129-5p, while its levels gradually decrease with the development of cervical intraepithelial lesions and correlate with E6 and E7 expression [19]. [score:4]
So future work will try to determine whether the similar mechanisms are present in SiHa cells, or whether E6 and E7 are direct targets by miR-129-5p. [score:4]
Another interesting question is how KSHV infection can manipulate miR-129-5p expression in SiHa cells. [score:3]
The mirVana™ miRNA inhibitors for blocking miR129-5p or miR331-3p activities and the control were purchased from Invitrogen, and used according to the manufacturer's instructions. [score:3]
We found that either KSHV infection or ectopic expression of LANA or vFLIP significantly increased miRNA129-5p but not miRNA331-3p from SiHa cells (Figure 5A–5B). [score:3]
These data demonstrate that miRNA129-5p but not miRNA331-3p is required for KSHV and/or viral latent proteins reducing E6/E7 expression from SiHa cells. [score:3]
One of potential mechanisms is through cellular microRNAs such as miRNA129-5p and miRNA331-3p [19, 20]. [score:1]
[1 to 20 of 13 sentences]
16
[+] score: 57
Other miRNAs from this paper: mmu-mir-129-2, hsa-mir-335, mmu-mir-335
Instead, our study suggests one possible epigenetic modification mechanism for SOX4 expression in pancreatic cancer via repressed expression level of miR-129-2 and miR-335, which would otherwise target SOX4 transcript at its 3′ UTR for degradation [17], [50]. [score:7]
We clearly demonstrate that the level of miR-129-2 expression or of miR-335 is inversely correlated with SOX4 expression in most patients with pancreatic cancer in a statistically significant way. [score:5]
Expression of SOX4 in pancreatic cancers correlates with poor survival, and is strongly associated with co-repressed expression of microRNA-129-2 and microRNA-335. [score:5]
Given the multiple genetic alterations that are present in pancreatic cancer and the minimal physiological effect conferred by the re -expression of miR-129-2 in pancreatic cancer cell lines in vitro, more than one mechanism may contribute to over -expression of SOX4 in pancreatic cancers. [score:5]
Accordingly, we examined the expression levels of miR-129-2, miR-335, and SOX4 in twenty-three paired human pancreatic tumors and normal tissues. [score:3]
It would be interesting to investigate whether collaborative interaction between suppressed miR-129-2 and suppressed miR-335 in pancreatic epithelial cells could achieve robust induction of SOX4 in initiating or maintaining PDAC tumorigenesis. [score:3]
Co-repressed miR-129-2 and miR-335 are associated with expression of SOX4, which correlates with shorter survival in patients with pancreatic cancer. [score:3]
However, in vitro introduction of miR-129-2 into PANC cells is insufficient to achieve significant physiological effects, indicating redundancies may exist between miRNA seed sequences and target mRNA. [score:3]
It would also be interesting to explore the mechanism for repressed miR-129-2 in pancreatic cancer, in light of the finding that hypermethylation of its miRNA promoter CpG island accounts for miR-129-2 suppression in endometrial cancer [17]. [score:3]
Intriguingly, re-introduction of miR-129-2 into PDAC cell lines had mild suppressive effect on the level of SOX4 mRNA (Fig. 5C), suggesting functional redundancy with other microRNAs such as miR-335. [score:3]
Pearson correlation analysis further demonstrated that the relative expression level of SOX4 in pancreatic carcinomas (normalized with the value derived from non-tumor tissues) was inversely correlated with that of miR-129-2 and miR-335, respectively, in a statistically significant way (Pearson correlation coefficient R = −0.4991, P = 0.0154 for LogmiR-129-2 vs logSOX4; R = −0.724, P = 0.0005 for logmiR-335 vs logSOX4) (Fig. 5B, left and central plot). [score:3]
Elevation of SOX4 expression associated with repressed miR-129-2 or miR-335 is reported in gastric-, endometrial-, and breast cancers [17]– [19]. [score:3]
The SOX4 transcript is a target of both miR-129-2 and miR-335. [score:3]
Moreover, the repressed expression of miR-335 in pancreatic carcinoma samples was positively correlated with the decreased level of miR-129-2 (Fig. 5B, right plot), indicating a concomitant repression of miR-129-2 and miR-335 in pancreatic cancers. [score:3]
Right plot: the expression level of miR-335 in pancreatic carcinoma samples is positively correlated with the level of miR-129-2 in a linear regression way. [score:3]
The elevation of SOX4 has been reported to be a consequence of miR-129-2 repression in endometrial, gastric, and bladder cancer [17], [18], [51], [52], or as a consequence of miR-335 repression in metastatic breast cancer [50], suggesting the miR-129-2/SOX4 or miR-335/SOX4 regulatory axis as a general strategy for tumor formation or progression. [score:2]
[1 to 20 of 16 sentences]
17
[+] score: 47
Tumor suppressor QKI (the common target of miR-493-3p, miR-129 and miR-765) is expressed at significantly low levels in most of the gastric cancer tissues [46]. [score:7]
miR-129 can regulate multiple tumor cell lines and primary tumors including medulloblastoma, undifferentiated gastric cancers, lung adenocarcinoma, endometrial cancer and colorectal carcinoma through down -regulating CDK6 expression [44]. [score:5]
It is believed that miR-129 binds at the 3' UTRs end of QKI mRNA to down regulate its translation. [score:4]
In this module, miR-765 targets 6 mRNAs and miR-129 regulates 4 mRNAs. [score:4]
miRNAs Targeted mRNAs modules miR-557ADRA1D, ACVR1C, DNAJA3, FAM120A HCV+ miR-214ASB16, GALNTL4, CBX5, BNC2, PDLIM2, RAB43, SPCS2, NKTR, ASXL1, ACLY,C6orf192, ING4, GLG1, SHOC2 HCV+ miR-34aCPLX2, FNDC5 HCV+ miR-493-3p WDR33 HCV+ miR-184EPB41L5, ALDH4A1 HCV+ miR-129 CBLB, OCRL, COMT, DENND2C HCV- miR-765ABCC5, BRD3, ANKRD12, AUTS2, PCID2, NMD3, NUP43 HCV-/+ miR-210FGD4, HDAC4, CACNA2D2, OAZ2, ADAMTS5, AK3, CDKN1B, EPM2AIP1, PPP1R12B, PRPF4B, STAM2, EZ6L, SAMD4A, PISD, KCTD9, FAM118A, CHD2, KIT, TCF4 HCV- miR-452 ARMC1, ZNF462, EFNA3, SMG5, FAM73B HCV- miR-17-3pBNC2, DICER1, GFRA1, KIAA1804, ENPP1, ZNF558, ERO1L, SNX27, ZNF718 HCV-The numbers of mRNAs in these significant modules are shown in the last column of Table 2. Figure 4 and 5 show two examples of these significant modules, and all the miRNAs in bold and the mRNAs with underline and italics can be confirmed by the literature. [score:3]
We also report another mRNA QKI which has a strong inverse expression relationship with miR-129 and miR-493-3p which may bind at the 3' UTR of QKI with a perfect sequence match. [score:3]
miRNAs Targeted mRNAs modules miR-557ADRA1D, ACVR1C, DNAJA3, FAM120A HCV+ miR-214ASB16, GALNTL4, CBX5, BNC2, PDLIM2, RAB43, SPCS2, NKTR, ASXL1, ACLY,C6orf192, ING4, GLG1, SHOC2 HCV+ miR-34aCPLX2, FNDC5 HCV+ miR-493-3p WDR33 HCV+ miR-184EPB41L5, ALDH4A1 HCV+ miR-129 CBLB, OCRL, COMT, DENND2C HCV- miR-765ABCC5, BRD3, ANKRD12, AUTS2, PCID2, NMD3, NUP43 HCV-/+ miR-210FGD4, HDAC4, CACNA2D2, OAZ2, ADAMTS5, AK3, CDKN1B, EPM2AIP1, PPP1R12B, PRPF4B, STAM2, EZ6L, SAMD4A, PISD, KCTD9, FAM118A, CHD2, KIT, TCF4 HCV- miR-452 ARMC1, ZNF462, EFNA3, SMG5, FAM73B HCV- miR-17-3pBNC2, DICER1, GFRA1, KIAA1804, ENPP1, ZNF558, ERO1L, SNX27, ZNF718 HCV- The numbers of mRNAs in these significant modules are shown in the last column of Table 2. Figure 4 and 5 show two examples of these significant modules, and all the miRNAs in bold and the mRNAs with underline and italics can be confirmed by the literature. [score:3]
We also closely examined a strong negative regulatory relationship, shown in Figure 6. This regulatory relationship is between QKI mRNA and multiple miRNAs miR-493-3p, miR-129 and miR-765 (see Figure 9). [score:3]
Another interaction is confirmed between hsa-miR-129-5p (previous ID: hsa-miR-129) and QKI in the starBase database, with the highest Pearson's Correlation Coefficient in Table 5. In this work, we have proposed rule -based methods for the discovery of miRNA-mRNA regulatory modules in HCV infection. [score:2]
• In the module of miR-129 and miR-765 (Figure 5), miR-129 has been strongly believed to be involved in the significant dysregulation in hepatocellular carcinogenesis [26, 35], and miR-765 is one of promising candidate miRNA biomarkers to detect hepatocellular carcinoma among hepatitis C virus patients [36]. [score:2]
Figure 5 The regulatory module inferred from the first HCV- rule consisting of miR-129 and miR-765. [score:2]
Six miRNAs (miR-214, miR-34a, miR-129, miR-765 and miR-210) and 9 mRNAs (ACVR1C, RAB43, FNDC5, WDR33, ALDH4A1, ANKRD12, KCTD9, ARMC1 and DICER1) all in red are confirmed by literature work. [score:1]
CAMK2D has a random correlation with miR-129 and miR-214, but it is negatively correlated with miR-17-3p. [score:1]
Furthermore, the interaction between hsa-miR-129-5p (previous ID: hsa-miR-129) and QKI is supported with CLIP-Seq data from starBase. [score:1]
The seed matching sequence of miR-129 is located within the 3' UTRs end of QKI. [score:1]
Another interaction is confirmed between hsa-miR-129-5p (previous ID: hsa-miR-129) and QKI in the starBase database, with the highest Pearson's Correlation Coefficient in Table 5. On the original miRNA data set of the 36 samples and 470 miRNAs, the gain ratio method selects 21 top-ranked miRNAs as the most significant miRNAs for the distinction between the HCV+ and HCV- samples. [score:1]
GFRA2 QKI MAP2 FRMPD4 BNC2 CAMK2D miR-493-3p - -0.68 - 0.12 - - miR-184 - - - -0.05 - - miR-129 - -0.71 - - - 0.01 miR-214 - - -0.15 - -0.01 0.03 miR-557 0.18 - -0.01 - - - miR-765 0.21 -0.44 -0.02 -0.04 -0.10 - miR-17-3p 0.26 - - - -0.13 -0.13 miR-34a - - -0.05 - - - (Figure 8). [score:1]
But, the 5' UTRs of QKI mRNA does not contain the miR-129 complementary seed site. [score:1]
For example, miR-129, miR-214 and miR-34a are found to associate with human hepatocellular carcinoma [26, 31, 35, 42]. [score:1]
An negative relationship between the QKI mRNA and miR-493-3p, miR-129, and miR-765. [score:1]
[1 to 20 of 20 sentences]
18
[+] score: 47
Yang et al. have reported that the expression of miR-129-2 in glioma cells is regulated by DNA methylation and that miR-129-2 inhibits glioma cell growth and promotes apoptosis by directly targeting HMGB1 [81]. [score:9]
miR-129-2 downregulates the expression of SOX4 [74], an oncogene of the SRY-related HMGB family, and epigenetic deregulation of miR-129-2 results in overexpression of SOX4 in endometrial cancer [78] and gastric carcinoma [79]. [score:9]
Further investigations have indicated that miR-129-2 suppresses AKT phosphorylation and downregulates matrix metalloproteinase 2/9 (MMP2/9) expression. [score:6]
Demethylation of miR-129-2 has an inhibitory impact on cell growth, partly though inhibition [40]. [score:5]
The miR-129-2 level is correlated with venous infiltration, a high Edmondson-Steiner grade, and an advanced tumor-node-metastasis (TNM) stage and serves as an independent prognostic factor to indicate overall survival and disease-free survival. [score:3]
Chen et al. have reported that methylation -mediated repression of miR-129-2 might promote SOX4 expression and HCC progression [83]. [score:3]
miR-129-2 suppresses proliferation, migration, and invasion of renal carcinoma [73], esophageal carcinoma [74], breast cancer [75, 76], and lung cancer [77]. [score:3]
Additionally, miR-129-2 is regulated by DNA methylation. [score:2]
3.4. miR-129-2. 3.5. miR-325. [score:1]
miR-129-2 belongs to the miR-129 family, which presumably functions negatively in different cancers. [score:1]
For example, Liu et al. have noted that the relationship between the miR-129-2 level and advanced malignant features is reversely correlated, which might provide hints toward patient prognosis [40]. [score:1]
The relationship between miR-129-2 and HMGB1 is also under exploration. [score:1]
Another group from China have reported that miR-129-2 is remarkably declined in HCC cells [40]. [score:1]
Lu et al. have found frequent DNA methylation of miR-129-2 in HCC and have suggested the potential clinical utility of miR-129-2 as a diagnostic biomarker for HCC [82]. [score:1]
Furthermore, the miR-129-2 gene is reportedly hypermethylated in endometrial cancer [78], gastric carcinoma [79], osteosarcoma [80], and glioma [81]. [score:1]
[1 to 20 of 15 sentences]
19
[+] score: 37
Over -expression of miR-129-5p up-regulated FBW7 expression, however; the underlying mechanism is unclear [197]. [score:8]
Liu et al. found that miR-129-5p suppressed tumor growth and reduced cell migration through inhibition of VCP (Valosin containing protein) in hepatocellular carcinoma [195]. [score:5]
Recently, miR-129-5p was identified to regulate FBW7 expression. [score:4]
In addition, multiple microRNAs (miRNAs) such as miR-27a, miR-25, miR-129-5p, and miR-223 have also been demonstrated to regulate the expression of FBW7. [score:4]
Zhi et al. reported that miR-129-5p was up-regulated in serum in AML patients, indicating that miR-129-5p could be a potential biomarker for detecting AML [196]. [score:4]
For example, it has been demonstrated that miR-129-5p is required for histone deacetylase inhibitor -induced cell death in thyroid cancer cells [194]. [score:3]
Accordingly, further study is necessary to define how miR-129-5p controls FBW7 expression and whether this process is involved in tumorigenesis. [score:3]
3.7.4 by miR-129-5pMounting evidence suggested that miR-129-5p may also be involved in tumor development and progression [192, 193]. [score:2]
Regulation of FBW7 by miR-129-5p. [score:2]
Mounting evidence suggested that miR-129-5p may also be involved in tumor development and progression [192, 193]. [score:2]
[1 to 20 of 10 sentences]
20
[+] score: 34
A total of seven miRNAs deregulated in R. rickettsii-infected endothelial cells were thus further confirmed in this study, of which four (miR-129-5p, miR-200a-3p, miR-200b-3p, and miR-595) were up-regulated and another three (miR-301b-3p, miR-548a-3p, and miR-377-3p) were down-regulated. [score:8]
However, the extent of up-regulation (the fold-change over basal expression in uninfected cells) for miR-129-5p and miR-595 at both 3 h and 24 h post-infection was considerably higher in our microarray data (Figure 1A). [score:6]
Figure 4 shows the relative expression of NOTCH1 (A), SMAD2 (B), SMAD3 (C), and RIN2 (D) mRNA as potential downstream targets of positively-regulated miRNAs miR-129-5p, miR-200a-3p, and miR-200b-3p. [score:6]
Again, q-RT-PCR based quantitation on day 3 post-infection (Figure 3) revealed about 7.0 ± 1.9-fold higher expression of miR-129-5p (A) and 4.7 ± 0.9-fold up-regulation of miR-200a-3p (B) in the lungs of infected mice when compared to the uninfected controls and a decrease of about 53 ± 5% in the levels of miR-301b-3p (C) and 51 ± 10% in miR-377-3p (D), respectively. [score:5]
As an important corollary to these in vitro findings, we further analyzed the expression status of miR-129-5p, miR-200-3p, miR-301b-3p, and miR-377-3p in the lungs of mice infected with R. conorii, another spotted fever group pathogen phylogenetically and antigenically similar to R. rickettsii. [score:3]
Generally corresponding to the microarray results (Figure 1A), q-RT-PCR based analysis of miR-129-5p (B), miR-200a-3p (C), miR-200b-3p (D), and miR-595 (E) also revealed a pattern of significantly increased expression in infected host cells. [score:3]
In addition, this analysis lends further support to the findings of this study illustrating the potential for regulation of NOTCH1 by miR-200a-3p and possibly by others namely miR-200b-3p and miR-129-5p (Figure 6). [score:2]
Considering that the NOTCH pathway can be easily manipulated with inhibitors of γ-secretase and metalloprotease, further investigations to elucidate the roles of miR200a-3p, miR-200b-3p, miR-129-5p and possibly other miRNAs that could be mechanistically linked with NOTCH and other signal transduction pathways should allow for their exploitation as a new therapeutic strategy. [score:1]
[1 to 20 of 8 sentences]
21
[+] score: 32
Most importantly, miR-129 downregulation is associated to SOX4 overexpression in endometrial and gastric cancers (24, 25). [score:6]
miR-129-5p overexpression resulted in decreased cell proliferation, which may suggest a tumor suppressor role in MB. [score:5]
Our miRNA profile (84) Chromosomal localization Fold change Reference DOWNREGULATED hsa-miR-206 6p12.2 −7.53(29) hsa-miR-219-2-3p 9q33.3 −6.64(52) hsa-miR-383 8p22 −6.56(12, 55, 56) hsa-miR-138 16q13.3/3p21.32 −5.16(12, 14) hsa-miR-323-3p 14q32.2 −4.96(12, 52) hsa-miR-122 18q21.31 −4.82 hsa-miR-105 Xq28 −4.66 hsa-miR-129-5p 11p11.2/7q32.1 −4.56(23) hsa-miR-935 19q13.43 −4.53(52) hsa-miR-329 14q32.2 −4.48 hsa-miR-129-3p 11p11.2/7q32.1 −4.43 hsa-miR-650 22q11.21 −4.19 hsa-miR-184 15q24.3 −4.14 hsa-miR-370 14q32.2 −3.99(12) hsa-miR-433 14q32.2 −3.96(29) hsa-miR-138-2* 16q13. [score:4]
Functional studies using mimic miR-129-5p (11p11.2/7q32.1), miR-206 (6p12.2), and miR-323-3p (14q32.2) and the DAOY cell line, suggested a suppressive role for miR-129-5p in MB proliferation. [score:3]
miR-129 is reported to be significantly downregulated in pediatric brain tumors compared to normal tissues (23). [score:3]
Preliminary functional studies were performed in DAOY cells by ectopic expression of miR-129-5p, 206, and 323-3p mimics. [score:3]
As expected, miR-206 (p = 0.0001; Mann–Whitney test), miR-129-5p (p = 0.002), miR-323-3p (p = 0.014), and miR-495 (p = 0,054), had lower expression in MB in comparison to normal cerebellum (Figure 3), thus confirming our microarray findings. [score:3]
No significant differences were found on cell viability or apoptosis after miR-206, miR-129-5p, and miR-323-3p transfections in comparison to control (Figure 4; Figure A3 in, respectively). [score:1]
Briefly, mimic-miR-206, mimic-miR-129-5p, and mimic-miR-323-3p or mimic -negative control #1 transfected cells were harvested 20 h after transfection and seeded in triplicate in 96-well plate (1,500 cells/well) in serum-free RPMI-1640 (Cultilab). [score:1]
Transfection of miRVana miRNA mimics (Invitrogen Ambion, Austin, TX, USA) of miR-206, miR-129-5p, miR-323-3p, or miRVana miRNA mimic negative control #1 (referred to as scrambled) was carried out 24 h after seeding, in a final concentration of 3 nM, using Lipofectamine RNAiMAX reagent (Invitrogen) according to the manufacturer’s recommendation. [score:1]
In addition, miR-206 and miR-129-5p were chosen for analysis because of their high fold change (see Table 3), lack of previous functional studies and possible oncogenic role. [score:1]
73(12) hsa-miR-377* 14q32.2 −2.72 hsa-miR-7 15q25.3/19p13.3/9q21.32 −2.72(12, 14) hsa-miR-124 20p23.1/8q12.3/8p23.1 −2.71(12, 14, 29, 48, 49) hsa-miR-323-5p 14q32.31 −2.69(12) hsa-miR-873 9p21.1 −2.65 hsa-miR-129* 11p11.2/7q32.1 −2.63 hsa-miR-338-5p 17q25.3 −2.61(14) hsa-miR-409-5p 14q32.2 −2.61 hsa-miR-874 5q31.2 −2.46 hsa-miR-495 14q32.2 −2.46(52) hsa-miR-885-5p 3p25.3 −2.45 hsa-miR-376c 14q32.2 −2.43(52) hsa-miR-299-5p 14q32.2 −2.41 hsa-miR-539 14q32. [score:1]
[1 to 20 of 12 sentences]
22
[+] score: 25
Thus, miR-129 and miR-499 expression was downregulated upon induction of Aire among mature mTECs, yet both miRNAs were also downregulated in mature mTECs in Aire null mice as compared with WT. [score:8]
Mir-129, miR-499 and miR-302b were expressed at similar levels in immature mTECs of mutant and control littermates, but were significantly downregulated in mature mTECs of Aire null mutants (Fig. 2B). [score:6]
In the context of a putative role of miRNA in pGE, it is noteworthy that several mRNAs, upregulated upon mTEC maturation, showed tissue-specific expression patterns, i. e. being restricted to brain (miR-124 and miR-129), heart (miR-499), testis (miR-202), skin (miR-203) or embryo (miR-467 and miR-302). [score:6]
miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were stably expressed at two- to tenfold higher level in the mTEC [high] subset independent of the maturation marker used for sorting the cells (Fig. 1C). [score:3]
Interestingly, miR-124, miR-129, miR-202, miR-203, miR-302b and miR-467a were differentially regulated in immature and mature Aire [neg] versus mature Aire [pos] mTEC subsets. [score:2]
[1 to 20 of 5 sentences]
23
[+] score: 24
Emerging evidence demonstrates that miRNAs are critical regulators of lipid synthesis and FAO [81] resulting in defective cell metabolism and carcinogenesis [82] directly targeting key enzymes or transcription factors as oncogenes and tumor suppressors [81] as shown in Table  1. Table 1 miRNAs involved in cancer metabolic plasticity MiRNAs Target Reference miR-122 Cholesterol biosynthesis 88– 90 miR-370 Fatty acid oxidation, CPT1A [91] miR-378/378* Lipid metabolism, CrAT 92, 93 miR-335 Lipid metabolism and adipogenesis [94] miR-205 Lipid metabolism [95] miR-143 Adipocyte differentiation [96] miR-27 Adipolysis [97] miR-33a/b Cholesterol efflux and β-oxidation 98– 100 miR-185 Lipogenesis and cholesterogenesis [101] miR-342 Lipogenesis and cholesterogenesis [101] miR-124 CPT1A [27] miR-129 CACT 27, 102 MiR-122 was the first miRNA identified as tissue-specific, and it is the most abundant in liver involved in lipid metabolic reprogramming [83]. [score:9]
Moreover, Valentino et al. have demonstrated that the downregulation of hsa-miR-124-3p, hsa-miR-129-5p, and hsa-miR-378 induces an increase in both expression and activity of CPT1A, CACT, and CrAT in malignant prostate cells [22]. [score:6]
In addition, the carnitine system components are directly regulated by miR-370, miR-124 (CPT1A), miR-129 (CACT), miR-33a/b (CPT1A and CrAT), and miR-378 (CrAT) MicroRNAs are transcribed by RNA polymerases II and III in pri-miRNAs, generating precursors that undergo a series of cleavage events to form mature microRNA. [score:3]
In addition, the carnitine system components are directly regulated by miR-370, miR-124 (CPT1A), miR-129 (CACT), miR-33a/b (CPT1A and CrAT), and miR-378 (CrAT) Cancer metabolic plasticity allows tumor cells to survive in the face of adverse environmental conditions. [score:3]
In addition, the analysis of human prostate cancer and prostate control specimens confirmed the aberrant expression of miR-124-3p, miR-129-5p, and miR-378 in primary tumors. [score:3]
[1 to 20 of 5 sentences]
24
[+] score: 20
Similarly, expression of most predicted genes of miR-129/219/330 (higher expression in brain) had decreased expression in brain, but their expression in non-brain tissues was highly variable. [score:9]
In this study, we examined the expression of miRNAs in a comprehensive list of normal human tissues using 345 unique miRNA assays, and identified miRNAs that were expressed in specific tissues with minimal or no expression in other tissues we examined, such as miR-129/219/330 in brain, miR-124a/124b in brain and PBMC, and two groups of miRNAs primarily expressed in placenta and testes. [score:8]
Our heat map in Figure 5 also showed low but detectable miR-129 in PBMC, testes, and pancreas, and interestingly in this segment of sequence we identified binding sites for STAT5, SOX5, and INSM1 that are specifically expressed in these three tissues, respectively (see Additional file 6). [score:3]
[1 to 20 of 3 sentences]
25
[+] score: 20
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-101-1, hsa-mir-106a, hsa-mir-107, hsa-mir-16-2, hsa-mir-192, hsa-mir-196a-1, hsa-mir-199a-1, hsa-mir-129-1, hsa-mir-148a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-196a-2, hsa-mir-199a-2, hsa-mir-203a, hsa-mir-210, hsa-mir-212, hsa-mir-214, hsa-mir-215, hsa-mir-217, hsa-mir-218-1, hsa-mir-218-2, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-27b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-130a, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-153-1, hsa-mir-153-2, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-146a, hsa-mir-150, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-106b, hsa-mir-29c, hsa-mir-200a, hsa-mir-101-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-130b, hsa-mir-376c, hsa-mir-375, hsa-mir-378a, hsa-mir-148b, hsa-mir-338, hsa-mir-335, hsa-mir-423, hsa-mir-20b, hsa-mir-429, hsa-mir-449a, hsa-mir-433, hsa-mir-451a, hsa-mir-193b, hsa-mir-520d, hsa-mir-503, hsa-mir-92b, hsa-mir-610, hsa-mir-630, hsa-mir-650, hsa-mir-449b, hsa-mir-421, hsa-mir-449c, hsa-mir-378d-2, hsa-mir-744, hsa-mir-1207, hsa-mir-1266, hsa-mir-378b, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-4512, hsa-mir-378i, hsa-mir-203b, hsa-mir-451b, hsa-mir-378j
In addition, the tumor suppressor miR-125a, which targets ERBB2 (erb-b2 receptor tyrosine kinase 2), and miR-129, which targets CDK6 (cyclin -dependent kinase 6), are also involved in anti-proliferative and pro-apoptotic functions [24, 126, 127, 131]. [score:7]
Fesler A. Zhai H. Ju J. miR-129 as a novel therapeutic target and biomarker in gastrointestinal cancer OncoTargets Ther. [score:5]
Shen et al. [35] reported that miR-129-2 targets SOX4 to induce apoptosis by regulating the relative abundance of pro-apoptotic and anti-apoptotic members of the Bcl-2 family in GC. [score:4]
Shen R. Pan S. Qi S. Lin X. Cheng S. Epigenetic repression of microRNA-129-2 leads to overexpression of SOX4 in gastric cancer Biochem. [score:3]
Yu X. Luo L. Wu Y. Liu Y. Zhao X. Zhang X. Cui L. Ye G. Le Y. Guo J. Gastric juice miR-129 as a potential biomarker for screening gastric cancer Med. [score:1]
[1 to 20 of 5 sentences]
26
[+] score: 20
The authors confirmed miR-129-5p downregulation by RT-qPCR and northern blot analysis and found that miR-129-5p modulated E-cadherin and vimentin expression by targeting SIP1 and SOX4 3′UTRs and modulating E-cadherin and vimentin promoter activity via the TGF- β1/SIP1 pathway [33]. [score:8]
Analysis of miRNA expression profiles in total PDE cells from patients having undergone PD therapy for less than 6 months versus long-term PD patients identified downregulation of miR-129-5p, a potent downstream inhibitor of TGF- β1 in renal fibrosis [33]. [score:8]
These data suggest that miR-129-5p protects MCs undergoing MMT transformation induced by TGF- β1 during PD through direct targeting of SIP1 and SOX4 [33]. [score:4]
[1 to 20 of 3 sentences]
27
[+] score: 20
CDK6 is a direct target of miR129 in CC, so downregulation of miR-129 results in upregulation of CDK6 and cell cycle deregulation in this carcinoma. [score:11]
Data demonstrate that downregulation of miR129 and upregulation of CDK6 by either E6 or E7 oncoprotein cooperate with cyclin D1 to further promote cell cycle progression in CC (Figure 2(c)). [score:7]
miR-129 is considered a candidate miRNA with potential tumor suppressor activity. [score:2]
[1 to 20 of 3 sentences]
28
[+] score: 19
Down-regulation of miR-129-5p inhibits growth and induces apoptosis in laryngeal squamous cell carcinoma by targeting APC. [score:8]
Growth inhibitory effects of three miR-129 family members on gastric cancer. [score:3]
12 h miR-132-3p miR-132-5p miR-129-5p miR-212-3p miR-212-5p MTMR1 −0.788 BTN3A2 −0.663 FAM46A −0.545 SP110 −0.778 KLF4 −0.748 SP110 −0.799 FKBP1B −0.934 ADD3 −0.588 MTMR1 −0.863 DHTKD1 −0.865 TTC39C −0.773 CASP6 −0.606 DNPEP −0.828 CCDC170 −0.516 SPN −0.772 TRIM22 −0.690 IFITM2 −0.795The resulting set of target genes includes genes playing a role in immune response. [score:3]
12 h miR-132-3p miR-132-5p miR-129-5p miR-212-3p miR-212-5p MTMR1 −0.788 BTN3A2 −0.663 FAM46A −0.545 SP110 −0.778 KLF4 −0.748 SP110 −0.799 FKBP1B −0.934 ADD3 −0.588 MTMR1 −0.863 DHTKD1 −0.865 TTC39C −0.773 CASP6 −0.606 DNPEP −0.828 CCDC170 −0.516 SPN −0.772 TRIM22 −0.690 IFITM2 −0.795 The resulting set of target genes includes genes playing a role in immune response. [score:3]
In this way, we found three DEMs (miR-132-3p, miR-132-5p, miR-212-5p) for the 6 h and five DEMs (miR-129-5p, miR-132-3p, miR-132-5p, miR-212-3p, miR-212-5p) for the 12 h samples (Figure 1). [score:1]
Besides that, the microRNA miR-129-5p has been associated to different cancer types (Li et al., 2013; Yu et al., 2013). [score:1]
[1 to 20 of 6 sentences]
29
[+] score: 19
miRNA Expressionp-value Expression fold change (log2) Survivalp-value hsa-miR-136 7.52E-14 −1.69 NS hsa-miR-145 5.88E-04 −1.04 0.005 hsa-miR-155 1.18E-21 1.94 NS hsa-miR-181b 5.44E-02 −0.22 NS hsa-miR-342 4.35E-10 −1.25 NS hsa-miR-129 1.29E-16 −3.39 NS hsa-miR-376a 4.35E-07 −0.63 NS hsa-miR-376b 7.37E-02 0.07 NS Survival p-value was calculated from miRNA expression data with Kaplan-Meier analysis. [score:5]
The predicted and experimentally proven targets of each miRNA that reduced proliferation provided by the IPA program are shown in Table 2. In total, 6,458 target genes were predicted by the IPA program for the eight miRNAs that reduced proliferation found in our study available in IPA, ranging from 448 genes for miR-342-5p to 2,149 genes for the miR-129 cluster. [score:5]
For eight of the miRNAs (hsa-miR-129,-136, -145, -155, -181b, -342, -376a/b), expression array data were available from the Cancer Genome Atlas (TCGA) project data [14]- [16]. [score:3]
Nine miRNA precursor molecules (hsa-miR-129, -136, -145, -155, -181b, -342-5p, -342-3p, -376a/b) were selected for additional validation experiments based on the functional and expression data. [score:3]
According to the CellTiter-Glo assay, overexpression of seven miRNA precursors (hsa-miR-155, -145, -181b, -136, -129, and -376a/b) caused significant reduction in cell proliferation in the A172 and LN405 cell lines, whereas four miRNA precursors (hsa-miR-129, -376a, -376b, and -342-5p) significantly reduced cell proliferation in the U87MG cell line. [score:2]
One of the nine miRNA precursors, miR-129, had a hit only in the U87MG cell line, which was not screened with the Dharmacon precursor library. [score:1]
[1 to 20 of 6 sentences]
30
[+] score: 18
However, only a few miRNAs were differentially expressed between ASC populations (miR-143 downregulated and miR-204 upregulated in MAPC with respect to MSC; miR-129 and miR-199b downregulated and miR-204 upregulated in MAPC respect to MSC and miR-424 downregulated in MSC respect to ADSC) and those differences were smaller than those observed between ESC and ASC. [score:18]
[1 to 20 of 1 sentences]
31
[+] score: 18
Thermo-sensitive miRNAs Fold change in miRNA Fold change in target mRNA Predicted gene targets Cell Type rno-miR-22-3P + 3.4 −13.5 Acly Spermatid rno-miR-22-5P + 1.8 −13.5 Acly Spermatid rno-miR-129-5P −1.9 + 8.5 selV Spermatocyte rno-miR-3560 + 2.1 −1.6 MCT2 Spermatocyte rno-miR-3560 + 2.1 −12.3 Txnrd1 Spermatocyte rno-miR-466c-5P + 1.5 −1.8 Prkar2B Spermatid Crytorchidism is a state wherein the loss of germ cells takes place by apoptosis leading to infertility, and transient testicular heating has been shown to provide reversible contraception in men [25] and temporary sterility in rats [26]. [score:5]
Thermo-sensitive miRNAs Fold change in miRNA Fold change in target mRNA Predicted gene targets Cell Type rno-miR-22-3P + 3.4 −13.5 Acly Spermatid rno-miR-22-5P + 1.8 −13.5 Acly Spermatid rno-miR-129-5P −1.9 + 8.5 selV Spermatocyte rno-miR-3560 + 2.1 −1.6 MCT2 Spermatocyte rno-miR-3560 + 2.1 −12.3 Txnrd1 Spermatocyte rno-miR-466c-5P + 1.5 −1.8 Prkar2B Spermatid The H & E stained testes sections of control and cryptorchid rat suggest that at 24 h there was negligible visible change in any stage of spermatogenesis and most of the stages were present (Fig.   1b), as in control (Fig. 1a). [score:5]
The study has identified Acly, selV, SLC16A7(MCT-2), Txnrd1 and Prkar2B as potential heat sensitive targets in germ cells, which may be tightly regulated by heat sensitive miRNAs rno-miR-22-3P, rno-miR-22-5P, rno-miR-129-5P, rno-miR-3560, rno-miR-3560 and rno-miR-466c-5P. [score:4]
Among various pathways affected significantly by heat stress, the study has identified Acly, selV, SLC16A7(MCT-2), Txnrd1 and Prkar2B as potential heat sensitive targets in germ cells, which may be under tight regulation of heat sensitive miRNAs, rno-miR-22-3P, rno-miR-22-5P, rno-miR-129-5P, rno-miR-3560, rno-miR-3560 and rno-miR-466c-5P, as predicted by miRDB tool. [score:4]
[1 to 20 of 4 sentences]
32
[+] score: 17
Interestingly, both miR-132 and miR-129-5p target EP300, which encodes the histone acetyltransferase protein E1A -associated cellular p300 transcriptional co-activator, and each miRNA explains some of the variation in EP300 expression (adjusted R-squared 0.039 and 0.033 respectively). [score:5]
While miR-132 may thus be influencing AD, in part, through histone acetylation and chromatin remo deling, miR-129-5p appears to be regulating genes related to the regulation of transcription. [score:3]
Specifically, miR-132 (P = 2 × 10 [−8]) and miR-129-5p (P = 3.9 × 10 [−6]) were found to be diminished in expression in subjects with AD, consistent with prior studies [12, 13]. [score:3]
Finally, by performing analyses integrating both miRNA and RNA sequence data from the same individuals (525 samples), we characterize the impact of AD associated miRNA on human brain expression: we show that the effects of miR-132 and miR-129-5b converge on certain genes such as EP300 and find a role for miR200 and its target genes in AD using an integrated miRNA/mRNA analysis. [score:3]
In addition, we found that, among the tested miRNAs, miR-129-3p (P = 1.8 × 10 [−6]) was associated with NP, and miR-99b (P = 6 × 10 [−5]) was associated with NFT, exceeding our significance threshold (p < 0.00016). [score:1]
The pathologic AD -associated miRNA, miR-132 and miR-129-5p, were associated with both NP and NFT (Table 1). [score:1]
Of the 11 miRNA previously reported to be associated with AD in the prefrontal cortex, only miR-132 and miR-129-5p replicated. [score:1]
[1 to 20 of 7 sentences]
33
[+] score: 15
Other miRNAs from this paper: hsa-mir-16-2, hsa-mir-129-1, hsa-mir-10a, hsa-mir-10b
The upregulation of the tumorigenic, progrowth miR10a and miR10b, and downregulation of the antiproliferative miR129-5p seen in the Mim23 -expressing cells would be predicted to alter cell growth and invasion properties. [score:9]
Therefore, the in vivo sensitivity of mature miR-10b and miR-129 levels to DGCR8 protein level or phosphorylation status could be due to differential interactions with some protein cofactor that regulates processing or to indirect effects of DGCR8 phosphorylation. [score:3]
MiR129-5p, on the other hand, has been reported to have an antiproliferative effect by targeting Cdk6 (Wu et al., 2010). [score:2]
Of those seven, the most abundant was miR-129-5p. [score:1]
[1 to 20 of 4 sentences]
34
[+] score: 15
Expression of miR-124 and miR-137, respectively, increased up to 8- and 24-fold, expression of miR-129 and miR-139, respectively, decreased up to 2- and 4-fold, and expression of miR-7 and miR-218 did not change appreciably. [score:7]
Of the 35 miRNAs, we identified six HGA-miRNAs, which were down-regulated in both AA and GBM tumors at a more stringent degree of significance (P < 0.01): miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218. [score:4]
We identified six miRNAs of particular interest, miR-7, miR-124, miR-129, miR-137, miR-139 and miR-218, which were down-regulated in both AAs and GBMs (Figure 1A, Additional file 8 and Table 1) at a more stringent level of significance (P ≤ 0.01). [score:4]
[1 to 20 of 3 sentences]
35
[+] score: 15
Recently, over -expression of miR-129-5p was identified to upregulate Fbxw7 expression. [score:8]
What is more, several proteins such as, RITA, EBP2, Numb4, SGK1,,, Pin1, FAM83D, C/EBPδ, Hes-5, presenilin, miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a are found to regulate the expression of Fbxw7. [score:4]
Besides those, recently, accumulating evidence has shown that several molecules such as, miRNAs including miR-223, miR-25, miR-27a, miR-182, miR-503, and miR-129-5p, RITA, and FAM83D, as well as Pin1, CCAAT/enhancer -binding protein-δ, presenilin,,, EBP2, Numb4 and serum-and glucocorticoid-inducible protein kinase1 could regulate Fbxw7 (Figure 3). [score:2]
MicroRNAs (miRNAs) Including miR-223, miR-25, miR-27a, miR-182, miR-503, miR-129-5p, and miR-92a. [score:1]
[1 to 20 of 4 sentences]
36
[+] score: 14
Hypermethylation silencing miR-129 expression is associated with a poor clinical outcome in gastric cancer while restoration of miR-129 is linked to the cell growth inhibition and stimulation of apoptosis through suppression of CDK6 expression (Refs 79, 80). [score:9]
120) analysed miR-129 expression in 141 gastric juices samples collected by gastroscopy from gastric cancer, gastric ulcer, atrophic gastritis and minimal gastritis patients and subjects with normal mucosa. [score:3]
Their data showed that the miR-129 level in gastric juice was significantly lower in patients with gastric cancer compared with patients with benign gastric diseases. [score:2]
[1 to 20 of 3 sentences]
37
[+] score: 14
Consistent upregulation across 48 h pi was observed with miR-3648, miR-3687, miR-129-5p, miR-572, and two-way ANOVA confirmed that infection is the main factor in miRNAs deregulation as their expression increased along with increasing viral load (P < 0.001) (Fig. 3A–D). [score:7]
As shown in Fig. 3J, the expression of miR-3648, miR-3687, miR-129-5p, miR-572, increased with increased MOI used for initial infection in human microglial cells. [score:3]
Using stringent algorithm, we have identified ten miRNAs (miR-129-5p, miR-3148, miR-4470, miR-4672, miR-3646, miR-3180, miR-4690, miR-3622, miR-5096, and miR-885) that can target different genes in innate immune pathway. [score:3]
The results of qPCR analysis of (A) miR-3648, (B) miR-3687 (C) miR-572, (D) miR-129-5p, (E) miR-197-3p, (F) miR-145-5p, (G) miR-374b-5p, (H) miR-26b-5p, (I) miR-149-5p, at three different time points are presented. [score:1]
[1 to 20 of 4 sentences]
38
[+] score: 14
For example, miR-129 was the most commonly up-regulated and its up-regulation was associated with poor outcome [19]; the expression of miR-96 and miR-183 in urine was significantly correlated with tumor stage and grade, and their expressions were significantly decreased after radical surgery [20]; miR-133b and miR-518c were also strongly up-regulated in bladder cancer tissues [19]. [score:14]
[1 to 20 of 1 sentences]
39
[+] score: 13
Other miRNAs from this paper: hsa-mir-129-1, hsa-mir-222, hsa-mir-130a
Most recently, miR-129-5p was revealed to function as a tumor suppressor miRNA that directly inhibited YAP/TAZ expression. [score:8]
In ovarian cancer cells, ectopic expression of miR-129-5p significantly inhibited TEAD -dependent luciferase activity. [score:5]
[1 to 20 of 2 sentences]
40
[+] score: 12
Other miRNAs from this paper: hsa-mir-129-1, hsa-mir-200b, hsa-mir-200c, hsa-mir-155, hsa-mir-200a
In a previous study, we demonstrated that MCRS1 overexpression resulted partially from the downregulation of the level of miR-129* in NSCLCs [3]. [score:6]
These data indicated that factors other than changes in the MCRS1 DNA copy number also regulated MCRS1 expression in NSCLC cells, e. g., the level of miR-129* expression [3]. [score:6]
[1 to 20 of 2 sentences]
41
[+] score: 12
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-17, hsa-mir-18a, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-26a-1, hsa-mir-99a, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-106a, hsa-mir-107, mmu-let-7g, mmu-let-7i, mmu-mir-99a, mmu-mir-101a, mmu-mir-125a, mmu-mir-125b-2, mmu-mir-126a, mmu-mir-127, mmu-mir-145a, mmu-mir-146a, mmu-mir-129-1, mmu-mir-206, hsa-mir-129-1, hsa-mir-148a, mmu-mir-122, mmu-mir-143, hsa-mir-139, hsa-mir-221, hsa-mir-222, hsa-mir-223, mmu-let-7d, mmu-mir-106a, hsa-let-7g, hsa-let-7i, hsa-mir-122, hsa-mir-125b-1, hsa-mir-143, hsa-mir-145, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-146a, hsa-mir-206, mmu-mir-148a, mmu-let-7a-1, mmu-let-7a-2, mmu-let-7b, mmu-let-7c-1, mmu-let-7c-2, mmu-let-7e, mmu-let-7f-1, mmu-let-7f-2, mmu-mir-18a, mmu-mir-20a, mmu-mir-21a, mmu-mir-22, mmu-mir-26a-1, mmu-mir-129-2, mmu-mir-103-1, mmu-mir-103-2, rno-let-7d, rno-mir-335, rno-mir-129-2, rno-mir-20a, mmu-mir-107, mmu-mir-17, mmu-mir-139, mmu-mir-223, mmu-mir-26a-2, mmu-mir-221, mmu-mir-222, mmu-mir-125b-1, hsa-mir-26a-2, hsa-mir-335, mmu-mir-335, rno-let-7a-1, rno-let-7a-2, rno-let-7b, rno-let-7c-1, rno-let-7c-2, rno-let-7e, rno-let-7f-1, rno-let-7f-2, rno-let-7i, rno-mir-17-1, rno-mir-18a, rno-mir-21, rno-mir-22, rno-mir-26a, rno-mir-99a, rno-mir-101a, rno-mir-103-2, rno-mir-103-1, rno-mir-107, rno-mir-122, rno-mir-125a, rno-mir-125b-1, rno-mir-125b-2, rno-mir-126a, rno-mir-127, rno-mir-129-1, rno-mir-139, rno-mir-143, rno-mir-145, rno-mir-146a, rno-mir-206, rno-mir-221, rno-mir-222, rno-mir-223, hsa-mir-196b, mmu-mir-196b, rno-mir-196b-1, hsa-mir-20b, hsa-mir-451a, mmu-mir-451a, rno-mir-451, hsa-mir-486-1, hsa-mir-499a, mmu-mir-486a, mmu-mir-20b, rno-mir-20b, rno-mir-499, mmu-mir-499, mmu-mir-708, hsa-mir-708, rno-mir-17-2, rno-mir-708, hsa-mir-103b-1, hsa-mir-103b-2, mmu-mir-486b, rno-mir-126b, hsa-mir-451b, hsa-mir-499b, mmu-mir-145b, mmu-mir-21b, mmu-let-7j, mmu-mir-130c, mmu-mir-21c, mmu-mir-451b, mmu-let-7k, hsa-mir-486-2, mmu-mir-129b, mmu-mir-126b, rno-let-7g, rno-mir-148a, rno-mir-196b-2, rno-mir-486
After 6 and 12 wks of E [2] exposure, 15 miRNAs were down-regulated, e. g., miR-22, miR-99a, miR-106a, miR-127, miR-499, and 19 miRNAs were-up-regulated, e. g., miR-17-5p, miR-20a, miR-21, miR-129-3p, miR-106a, miR-22, and miR-127. [score:7]
By 18 wks of E [2] treatment, the mammary glands were characterized by lobular involution and hyperplasia, and only 1 miRNA was down-regulated (miR-139) and 5 miRNAs were up-regulated (miR-20b, miR-21, miR-103, mir-107, miR-129-3p, and miR-148a). [score:5]
[1 to 20 of 2 sentences]
42
[+] score: 12
Also, miR-129-5p, which targets SOX4, was significantly downregulated in human chondrosarcoma tissues, while SOX4 protein was activated [41]. [score:6]
In line with this, in chondrosarcoma cell lines miR-129-5p repressed WNT/β-catenin signaling by targeting SOX4 which repressed proliferation and invasion [41]. [score:3]
Zhang P. Li J. Song Y. Wang X. Mir-129–5p inhibits proliferation and invasion of chondrosarcoma cells by regulating sox4/wnt/β-catenin signaling pathwayCell. [score:3]
[1 to 20 of 3 sentences]
43
[+] score: 11
Small RNA miR-129 potentially targets the genes MDM4 and ATM in this pathway; miR-125b, miR-143, miR-30a/c, and miR-223 were predicted to target p53 directly (Fendler et al., 2011). [score:6]
Among the studies examined in the present review, the most commonly up-regulated miRNA in BC was miR-129 (Dyrskjot et al., 2009). [score:4]
Genomic profiling of microRNAs in bladder cancer: miR-129 is associated with poor outcome and promotes cell death in vitro. [score:1]
[1 to 20 of 3 sentences]
44
[+] score: 11
In some cases the true miRNA found more target sites than did, on average, the corresponding controls (miR-324-3p, Figure 1D), whereas in other cases each control, on average, found more targets than did the miRNA (miR-129, Figure 1E). [score:5]
0005745.g001 Figure 1Numbers of predicted target sites per miRNA and its control sequences for (A) miR-1 and its controls with WC nt 2–8; if miR-1 hybridized with perfect WC complementarity this would yield −30.8 kcal/mol (see Methods); (B) let-7a and imposing only the requirement of WC base pairs within nucleotide positions 2–8; let-7a perfect WC complementarity would yield −33.2 kcal/mol; (C) miR-17-5p and its controls with WC nt 2–8; perfect WC complementarity would yield −44.5 kcal/mol; (D) miR-324-3p and its controls with WC nt 2–8; perfect WC complementarity would yield −52.8 kcal/mol; and (E) miR-129 and its controls with WC nt 2–8; perfect WC complementarity would yield −41.4 kcal/mol. [score:3]
Numbers of predicted target sites per miRNA and its control sequences for (A) miR-1 and its controls with WC nt 2–8; if miR-1 hybridized with perfect WC complementarity this would yield −30.8 kcal/mol (see Methods); (B) let-7a and imposing only the requirement of WC base pairs within nucleotide positions 2–8; let-7a perfect WC complementarity would yield −33.2 kcal/mol; (C) miR-17-5p and its controls with WC nt 2–8; perfect WC complementarity would yield −44.5 kcal/mol; (D) miR-324-3p and its controls with WC nt 2–8; perfect WC complementarity would yield −52.8 kcal/mol; and (E) miR-129 and its controls with WC nt 2–8; perfect WC complementarity would yield −41.4 kcal/mol. [score:3]
[1 to 20 of 3 sentences]
45
[+] score: 11
For example, miR-129-5p induces interferon-β which down-regulates E6 and E7 expression [19], miR-26a and miR-342-3p inhibit cell proliferation and invasion through each protein tyrosine phosphatase type IVA 1 and the mitogen-activated protein kinase (MAPK) pathway or forkhead box M1 [20, 21], and miR-101 regulates the cell cycle by inhibiting the G1-to-S transition [22]. [score:11]
[1 to 20 of 1 sentences]
46
[+] score: 10
On the other hand, HDAC inhibition also determined coherent up- or down-modulation of several miRNAs directly involved in positive (e. g. mir-129-3p, mir-193b, mir-370) or negative (e. g. mir-196b, mir-335, mir-370) control of cell cycle [44], [45], [46], [47], [48], [49], thus suggesting the existence of an epigenetically regulated negative loop protecting CD34 [+] cells from unrepressed cellular growth, and reinforcing the anti proliferative effect exerted by small cyclin/CDK inhibitors such as p14 [ARF], p16 [INK4] and p21 [Cip1/Waf1] gene products (Figure 2E). [score:7]
Nat Immunol 44 Huang YW Liu JC Deatherage DE Luo J Mutch DG 2009 Epigenetic repression of microRNA-129-2 leads to overexpression of SOX4 oncogene in endometrial cancer. [score:3]
[1 to 20 of 2 sentences]
47
[+] score: 10
Probe sequences used for each target miRNA are given in Table 4. Table 4 Probes used for Taqman analysis of specific miRNA sequences miRBase name Company name Sequence detected tgu-let-7a let-7a 5'-UGAGGUAGUAGGUUGUAUAGUU-3' tgu-let-7f let-7f 5'-UGAGGUAGUAGAUUGUAUAGUU-3' tgu-miR-124 miR-124 5'-UAAGGCACGCGGUGAAUGCC-3' tgu-miR-9 miR-9 5'-UCUUUGGUUAUCUAGCUGUAUGA-3' tgu-miR-129-5p miR-129-5p 5'-CUUUUUGCGGUCUGGGCUUGC-3' tgu-miR-129-3p miR-129-3p 5'-AAGCCCUUACCCCAAAAAGCAU-3' tgu-miR-29a miR-29c 5'-UAGCACCAUUUGAAAUCGGU-3' tgu-miR-92 miR-92a 5'-UAUUGCACUUGUCCCGGCCUGU-3' tgu-miR-25 miR-25 5'-CAUUGCACUUGUCUCGGUCUGA-3' RNU6B RNU6B 5'-CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU-3' tgu-miR-2954-5p novel51F-5p 5'-GCUGAGAGGGCUUGGGGAGAGGA-3' tgu-miR-2954-3p novel51F-3p 5'-CAUCCCCAUUCCACUCCUAGCA-3' (Northern validated) tgu-miR-2954R-5p novel51R-5p 5'-UGCUAGGAGUGGAAUGGGGAUG-3' tgu-miR-2954R-3p novel51R-3p 5'-UCCUCUCCCCAAGCCCUCUCAGC-3' Northern blotting to confirm novel miRNA tgu-miR-2954-3p was performed by modifying the protocol of [97]. [score:3]
Probe sequences used for each target miRNA are given in Table 4. Table 4 Probes used for Taqman analysis of specific miRNA sequences miRBase name Company name Sequence detected tgu-let-7a let-7a 5'-UGAGGUAGUAGGUUGUAUAGUU-3' tgu-let-7f let-7f 5'-UGAGGUAGUAGAUUGUAUAGUU-3' tgu-miR-124 miR-124 5'-UAAGGCACGCGGUGAAUGCC-3' tgu-miR-9 miR-9 5'-UCUUUGGUUAUCUAGCUGUAUGA-3' tgu-miR-129-5p miR-129-5p 5'-CUUUUUGCGGUCUGGGCUUGC-3' tgu-miR-129-3p miR-129-3p 5'-AAGCCCUUACCCCAAAAAGCAU-3' tgu-miR-29a miR-29c 5'-UAGCACCAUUUGAAAUCGGU-3' tgu-miR-92 miR-92a 5'-UAUUGCACUUGUCCCGGCCUGU-3' tgu-miR-25 miR-25 5'-CAUUGCACUUGUCUCGGUCUGA-3' RNU6B RNU6B 5'-CGCAAGGAUGACACGCAAAUUCGUGAAGCGUUCCAUAUUUUU-3' tgu-miR-2954-5p novel51F-5p 5'-GCUGAGAGGGCUUGGGGAGAGGA-3' tgu-miR-2954-3p novel51F-3p 5'-CAUCCCCAUUCCACUCCUAGCA-3' (Northern validated) tgu-miR-2954R-5p novel51R-5p 5'-UGCUAGGAGUGGAAUGGGGAUG-3' tgu-miR-2954R-3p novel51R-3p 5'-UCCUCUCCCCAAGCCCUCUCAGC-3' Northern blotting to confirm novel miRNA tgu-miR-2954-3p was performed by modifying the protocol of [97]. [score:3]
Five conserved miRNAs showed significant and consistent changes in copy number after song exposure across three biological replications of the song-silence comparison, with two increasing (tgu-miR-25, tgu-miR-192) and three decreasing (tgu-miR-92, tgu-miR-124, tgu-miR-129-5p). [score:1]
To test for song-specificity of the miRNA response, we conducted a further TaqMan experiment assessing the levels of six miRNAs (tgu-miR-124, tgu-miR-92, tgu-miR-129-5p, and three miRNAs derived from the tgu-miR-2954 locus, next section), in birds who had heard either a normal song or a carefully matched non-song acoustic stimulus, "song enveloped noise" (SEN). [score:1]
Three miRNAs consistently decreased after song (tgu-miR-92, tgu-miR-124, tgu-miR-129-5p) and two increased (tgu-miR-25, tgu-miR-192). [score:1]
In these same animals, normal song, but not SEN, triggered a significant decrease in the levels of tgu-miR-124, tgu-mir-129-5p, tgu-miR-92 and tgu-miR-2954-3p (Additional File 2, Figure S3 panels A-C, H). [score:1]
[1 to 20 of 6 sentences]
48
[+] score: 10
Based on the collected miRNA-circRNA interactions and the deregulated RNA molecules, we collected several abnormally expressed miRNAs, including 11 downregulated miRNAs (miR-124-3p, miR-129-5p, miR-135a-5p, miR-153-3p, miR-204-5p, miR-208a-3p, miR-211-5p, miR-218-5p, miR-488-3p, miR-490-3p, and miR-504-5p) and 1 upregulated miRNA (miR-373-3p). [score:10]
[1 to 20 of 1 sentences]
49
[+] score: 9
In GC, oncogenic miRNAs such as miR-21 [12], miR-362 [13] and miR-296-5p [14] are abnormally upregulated, and tumor suppressing miRNAs such as miR-506 [15], miR-129-5p [16] and miR-361-5p [17] are significantly downregulated. [score:9]
[1 to 20 of 1 sentences]
50
[+] score: 9
On the contrary, overexpression of miR-129 could develop tumor suppressive functions and prevent prostate cancer growth [63]. [score:5]
On the other hand, miRNA-129 is a novel independent prognosic factor because of being downregulated significantly in prostate cancer. [score:4]
[1 to 20 of 2 sentences]
51
[+] score: 9
Prediction results for specific miRNAs in TARGETSCAN include the following: miR-129-3p and miR-494 target HMGCS1; miR-150 targets MMP14; miR-150, and 92b target MMP16. [score:9]
[1 to 20 of 1 sentences]
52
[+] score: 9
For example, in mammals, miR-7, miR-129-5p, miR-490-3p and miR-204 and miR-211 have been proven to act as tumor suppressors [21], inhibiting the progression and proliferation of hepatocellular carcinoma [22], pulmonary and intestinal carcinoma [23] and breast cancer [24]. [score:5]
Ma N. Chen F. Shen S. Chen W. Chen L. Su Q. Zhang L. Bi J. Zeng W. Li W. MicroRNA-129–5p inhibits hepatocellular carcinoma cell metastasis and invasion via targeting ETS1Biochem. [score:4]
[1 to 20 of 2 sentences]
53
[+] score: 9
A. Real-time PCR showed that the expression of human miR-133b, miR-204-5p, miR-30e-5p, miR-4270, miR-129-2-3p, miR-202-3p, miR-195-5p, miR-664b-3p, miR-497-5p, miR-34b-5p, miR-513a-5p, and miR-101-3p was statistically higher in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
Figure 3 A. Real-time PCR showed that the expression of human miR-133b, miR-204-5p, miR-30e-5p, miR-4270, miR-129-2-3p, miR-202-3p, miR-195-5p, miR-664b-3p, miR-497-5p, miR-34b-5p, miR-513a-5p, and miR-101-3p was statistically higher in Sertoli cells of SCOS patients than Sertoli cells of OA patients. [score:3]
Real-time PCR revealed that hsa-miR-133b, hsa-miR-204-5p, hsa-miR-30e-5p, hsa-miR-4270, hsa-miR-129-2-3p, hsa-miR-202-3p, hsa-miR-195-5p, hsa-miR-664b-3p, hsa-miR-497-5p, hsa-miR-34b-5p, hsa-miR-513a-5p, and hsa-miR-101-3p were statistically upregulated in human Sertoli cells of SCOS patients compared to OA patients (Figure 3A). [score:3]
[1 to 20 of 3 sentences]
54
[+] score: 9
Other miRNAs from this paper: hsa-mir-197, hsa-mir-145, hsa-mir-328, hsa-mir-505, hsa-mir-1207
The authors also showed that down-regulated targets of two miRs, miR-1207-5p and miR-129-2-3p, were enriched in PI3K and MAPK pathways and that eight of 12 enriched pathways were downregulated in individuals with metabolic syndrome. [score:9]
[1 to 20 of 1 sentences]
55
[+] score: 8
Similarly, other miRNAs (let-7a, miR-9, and miR-129-5p) are also found to inhibit FOXP2 expression in a dosage -dependent manner and target specific sequences in the 3’-UTR of FOXP2 during early cerebellum development [141]. [score:8]
[1 to 20 of 1 sentences]
56
[+] score: 8
miR-129, expressed in mouse cerebellum, has a near perfect complementary match with Musashi-1, which is an RNA -binding gene essential for neural development, regulated in the cerebellum, and up-regulated in medulloblastoma (Yokota et al. 2004). [score:8]
[1 to 20 of 1 sentences]
57
[+] score: 8
The ability of NEAT1 in sponging miRNAs was first described by Fang et al. [108], who reported NEAT1 overexpression in HCC tissues, as well as its negative correlation with miR-129-5p expression. [score:5]
Fang L. Sun J. Pan Z. Song Y. Zhong L. Zhang Y. Liu Y. Zheng X. Huang P. Long non-coding rna neat1 promotes hepatocellular carcinoma cell proliferation through the regulation of mir-129-5p-vcp-ikappabAm. [score:2]
They also proposed a mechanism of action involving the miR-129-5p, valosin-containing protein (VCP) and IkB axis. [score:1]
[1 to 20 of 3 sentences]
58
[+] score: 8
In ovarian cancer cells, TAZ is validated as a direct target of miR-129-5p which plays a tumor-suppressive role in ovarian cancer. [score:6]
The inverse correlation between TAZ and miR-129-5p in ovarian cancer samples indicates that this regulation exists in vivo as well (Tan et al., 2015). [score:2]
[1 to 20 of 2 sentences]
59
[+] score: 7
Meanwhile, other miRNAs such as mir-128b, mir-129 and mir-148 were reported to be down-regulated in undifferentiated GC tissue [53], which summarized in Table 1. Presently, there have been some preliminary findings on the relationship between miRNA expression and GC development. [score:7]
[1 to 20 of 1 sentences]
60
[+] score: 7
Other miRNAs from this paper: hsa-mir-129-1, hsa-mir-491, hsa-mir-561, hsa-mir-4717, hsa-mir-4795
Five poorly conserved miRNAs namely; miR-129, miR-491, miR-4795, miR-561, and miR-4717 have been predicted to target the 3′UTR region surrounding the ABCB1 4036A> G SNP using the TargetScanHuman 6.1 miRNA target prediction software. [score:7]
[1 to 20 of 1 sentences]
61
[+] score: 7
The highly expressed hsa_circ_0005986 was found to competitively bind miR-129-5p, resulting in decreased expression of Notch1 mRNA; this led to the inhibition of EMT with an accompanying anti-cancer effect [70]. [score:7]
[1 to 20 of 1 sentences]
62
[+] score: 7
Previous studies have shown that miR-129-2 is dysregulated and heavily methylated in many types of cancers, such as gastric cancer, endometrial cancer, esophageal squamous cell carcinoma, and colorectal cancer [10, 51– 53]. [score:2]
Hence, miR-129-2 may be an early diagnostic marker for HCC, with the ability to distinguish HCC patients from cirrhosis patients and healthy individuals. [score:1]
3.2.6. miR-129-2. 3.2.7. miR-17-5p. [score:1]
Recently, a study by Lu et al., which was the first to identify frequent miR-129-2 methylation in HCC, indicated the potential use of miR-129-2 methylation as a diagnostic marker for HCC [19]. [score:1]
Their results showed that 85% of stage I HCC patients could be identified based on their miR-129-2 methylation levels, with a cut-off value of 2.36 [19]. [score:1]
Furthermore, miR-129-2 methylation was not detected in plasma from patients with cirrhosis associated with hepatitis B or hepatitis C, which reflected the high specificity of this marker. [score:1]
[1 to 20 of 6 sentences]
63
[+] score: 7
MiR129 potentially targets MDM4 and ATM in this pathway; miR125b, miR43, miR30a/c, and miR223 were predicted to target p53 directly (Fendler et al., 2011). [score:6]
Genomic profiling of microRNAs in bladder cancer: miR-129 is associated with poor outcome and promotes cell death in vitro. [score:1]
[1 to 20 of 2 sentences]
64
[+] score: 7
Other miRNAs from this paper: hsa-mir-17, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-23a, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-27a, hsa-mir-30a, hsa-mir-32, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-93, hsa-mir-107, hsa-mir-129-1, hsa-mir-30c-2, hsa-mir-139, hsa-mir-181c, hsa-mir-204, hsa-mir-212, hsa-mir-181a-1, hsa-mir-222, hsa-mir-15b, hsa-mir-23b, hsa-mir-132, hsa-mir-138-2, hsa-mir-140, hsa-mir-142, hsa-mir-138-1, hsa-mir-146a, hsa-mir-154, hsa-mir-186, rno-mir-324, rno-mir-140, rno-mir-129-2, rno-mir-20a, rno-mir-7a-1, rno-mir-101b, hsa-mir-29c, hsa-mir-296, hsa-mir-30e, hsa-mir-374a, hsa-mir-380, hsa-mir-381, hsa-mir-324, rno-mir-9a-1, rno-mir-9a-3, rno-mir-9a-2, rno-mir-15b, rno-mir-17-1, rno-mir-18a, rno-mir-19b-1, rno-mir-19b-2, rno-mir-19a, rno-mir-21, rno-mir-23a, rno-mir-23b, rno-mir-24-1, rno-mir-24-2, rno-mir-27a, rno-mir-29c-1, rno-mir-30e, rno-mir-30a, rno-mir-30c-2, rno-mir-32, rno-mir-92a-1, rno-mir-92a-2, rno-mir-93, rno-mir-107, rno-mir-129-1, rno-mir-132, rno-mir-138-2, rno-mir-138-1, rno-mir-139, rno-mir-142, rno-mir-146a, rno-mir-154, rno-mir-181c, rno-mir-186, rno-mir-204, rno-mir-212, rno-mir-181a-1, rno-mir-222, rno-mir-296, rno-mir-300, hsa-mir-20b, hsa-mir-431, rno-mir-431, hsa-mir-433, rno-mir-433, hsa-mir-410, hsa-mir-494, hsa-mir-181d, hsa-mir-500a, hsa-mir-505, rno-mir-494, rno-mir-381, rno-mir-409a, rno-mir-374, rno-mir-20b, hsa-mir-551b, hsa-mir-598, hsa-mir-652, hsa-mir-655, rno-mir-505, hsa-mir-300, hsa-mir-874, hsa-mir-374b, rno-mir-466b-1, rno-mir-466b-2, rno-mir-466c, rno-mir-874, rno-mir-17-2, rno-mir-181d, rno-mir-380, rno-mir-410, rno-mir-500, rno-mir-598-1, rno-mir-674, rno-mir-652, rno-mir-551b, hsa-mir-3065, rno-mir-344b-2, rno-mir-3564, rno-mir-3065, rno-mir-1188, rno-mir-3584-1, rno-mir-344b-1, hsa-mir-500b, hsa-mir-374c, rno-mir-29c-2, rno-mir-3584-2, rno-mir-598-2, rno-mir-344b-3, rno-mir-466b-3, rno-mir-466b-4
Some miRNAs (miR-129-1-3p; miR-129-2-3p, miR-129-5p, miR181c-5p, miR181d-5p, miR-409a-5p, miR-655 and miR-874-3p) were up-regulated (Fig. 2, Supplementary Fig. S3A), whereas others (miR-296-5p, miR-500-3p and miR-652-3p) were down-regulated only in the chronic phase, while not being significantly altered during latency (Fig. 2, Supplementary Fig. S3B). [score:7]
[1 to 20 of 1 sentences]
65
[+] score: 6
The most common up-regulated miRNAs across the analyzed set of expression profiles were miR-21-5p (15 profiles), followed by miR-132-3p, miR-23a-3p, miR-212-3p, miR-146a-5p, miR-27a-3p, miR-129-5p, miR-203a-3p, miR-17-5p, miR-19a-3p (Supplementary Table  S4). [score:6]
[1 to 20 of 1 sentences]
66
[+] score: 6
For instance, mir-215 and mir-301 are downregulated in colon cancer, and mir-129 is overexpressed in prostate cancer. [score:6]
[1 to 20 of 1 sentences]
67
[+] score: 6
In mice with AFL, miR-199-3p, miR-214, miR-93, miR-146a, miR-191, and let-7b are downregulated and miR-129, miR-490, miR-21, miR-503, miR-183, and miR-185 are upregulated compared with healthy mice [103]. [score:6]
[1 to 20 of 1 sentences]
68
[+] score: 6
Other miRNAs from this paper: hsa-let-7a-1, hsa-let-7a-2, hsa-let-7a-3, hsa-let-7b, hsa-let-7c, hsa-let-7d, hsa-let-7e, hsa-let-7f-1, hsa-let-7f-2, hsa-mir-15a, hsa-mir-16-1, hsa-mir-18a, hsa-mir-19a, hsa-mir-19b-1, hsa-mir-19b-2, hsa-mir-20a, hsa-mir-21, hsa-mir-22, hsa-mir-24-1, hsa-mir-24-2, hsa-mir-25, hsa-mir-26a-1, hsa-mir-26b, hsa-mir-27a, hsa-mir-29a, hsa-mir-30a, hsa-mir-31, hsa-mir-33a, hsa-mir-92a-1, hsa-mir-92a-2, hsa-mir-96, hsa-mir-101-1, hsa-mir-29b-1, hsa-mir-29b-2, hsa-mir-103a-2, hsa-mir-103a-1, hsa-mir-107, hsa-mir-16-2, hsa-mir-196a-1, hsa-mir-198, hsa-mir-129-1, hsa-mir-148a, hsa-mir-30c-2, hsa-mir-30d, hsa-mir-7-1, hsa-mir-7-2, hsa-mir-7-3, hsa-mir-10a, hsa-mir-10b, hsa-mir-34a, hsa-mir-181a-2, hsa-mir-181b-1, hsa-mir-181c, hsa-mir-182, hsa-mir-183, hsa-mir-196a-2, hsa-mir-199b, hsa-mir-203a, hsa-mir-204, hsa-mir-210, hsa-mir-211, hsa-mir-212, hsa-mir-181a-1, hsa-mir-214, hsa-mir-215, hsa-mir-216a, hsa-mir-217, hsa-mir-219a-1, hsa-mir-221, hsa-mir-222, hsa-mir-223, hsa-mir-224, hsa-mir-200b, hsa-let-7g, hsa-let-7i, hsa-mir-1-2, hsa-mir-15b, hsa-mir-23b, hsa-mir-30b, hsa-mir-122, hsa-mir-124-1, hsa-mir-124-2, hsa-mir-124-3, hsa-mir-125b-1, hsa-mir-128-1, hsa-mir-130a, hsa-mir-132, hsa-mir-133a-1, hsa-mir-133a-2, hsa-mir-137, hsa-mir-138-2, hsa-mir-140, hsa-mir-141, hsa-mir-142, hsa-mir-143, hsa-mir-145, hsa-mir-9-1, hsa-mir-9-2, hsa-mir-9-3, hsa-mir-125a, hsa-mir-125b-2, hsa-mir-126, hsa-mir-127, hsa-mir-138-1, hsa-mir-146a, hsa-mir-150, hsa-mir-184, hsa-mir-185, hsa-mir-195, hsa-mir-206, hsa-mir-320a, hsa-mir-200c, hsa-mir-1-1, hsa-mir-155, hsa-mir-181b-2, hsa-mir-128-2, hsa-mir-29c, hsa-mir-30c-1, hsa-mir-200a, hsa-mir-101-2, hsa-mir-219a-2, hsa-mir-34b, hsa-mir-34c, hsa-mir-301a, hsa-mir-99b, hsa-mir-296, hsa-mir-130b, hsa-mir-30e, hsa-mir-26a-2, hsa-mir-365a, hsa-mir-365b, hsa-mir-375, hsa-mir-376a-1, hsa-mir-378a, hsa-mir-382, hsa-mir-383, hsa-mir-151a, hsa-mir-148b, hsa-mir-338, hsa-mir-133b, hsa-mir-325, hsa-mir-196b, hsa-mir-424, hsa-mir-20b, hsa-mir-429, hsa-mir-451a, hsa-mir-409, hsa-mir-412, hsa-mir-376b, hsa-mir-483, hsa-mir-146b, hsa-mir-202, hsa-mir-181d, hsa-mir-499a, hsa-mir-376a-2, hsa-mir-92b, hsa-mir-33b, hsa-mir-151b, hsa-mir-320b-1, hsa-mir-320c-1, hsa-mir-320b-2, hsa-mir-378d-2, hsa-mir-301b, hsa-mir-216b, hsa-mir-103b-1, hsa-mir-103b-2, hsa-mir-320d-1, hsa-mir-320c-2, hsa-mir-320d-2, hsa-mir-378b, hsa-mir-320e, hsa-mir-378c, hsa-mir-378d-1, hsa-mir-378e, hsa-mir-378f, hsa-mir-378g, hsa-mir-378h, hsa-mir-378i, hsa-mir-219b, hsa-mir-203b, hsa-mir-451b, hsa-mir-499b, hsa-mir-378j
In Nile tilapia, the expression of miR-129-3p and miR-727-3p was significantly higher in mature females than males, whereas the expression of miR-132a and miR-212 was significantly higher in mature males than females (Xiao et al. 2014). [score:5]
Soares et al. (2009) let-7a,b,c,f,i, miR-7b, miR-9-5p, miR-9-3p, miR-34b, miR-103, miR-107, miR-124a, miR-125a,b, miR-128, miR-129-3p, miR-132, miR-138, miR-181a,b, miR-216, miR-217, miR-219, and miR-375 Zebrafish Microarray, ISH ? [score:1]
[1 to 20 of 2 sentences]
69
[+] score: 6
Finally, the 3′UTR of the FMR1 mRNA is targeted by miR-101, miR-129-5p, and miR-221 (Zongaro et al., 2013). [score:3]
The 3′ UTR of FMR1 mRNA is a target of miR-101, miR-129-5p and miR-221: implications for the molecular pathology of FXTAS at the synapse. [score:3]
[1 to 20 of 2 sentences]
70
[+] score: 6
It has been suggested that methylation of the CpG islands that are associated with miR genes (i. e. miR-203, miR-152, miR-124-1, miR-34b/c, miR-129-2, miR-9-1, miR-130b, miR-124-2, and miR-181c) might inversely correlate with their expression levels [12- 17]. [score:3]
It is reported that expression levels of some miR genes (including intragenic miR-152 and miR-34a/b/c and extragenic miR-203, miR-124-1/124-2, miR-129-2, and miR-181c) inversely correlate with methylation of their corresponding CpG islands [11, 13, 14, 16, 27, 38, 44]. [score:3]
[1 to 20 of 2 sentences]
71
[+] score: 6
The top five upregulated miRNAs (miR-1195, miR-223-3p, miR-129-2-3p, miR-709, and miR-224-5p) were selected for subsequent analysis, which was performed via quantitative real-time PCR analysis of the plasma from individual mice in each group. [score:4]
Five miRNAs (miR-1195, miR-223-3p, miR-129-2-3p, miR-709, and miR-224-5p), whose levels were found to be significantly elevated in the pooled plasma of ß-glucan -injected SKG mice by panel real-time PCR, were analyzed. [score:1]
We were unable to detect miR-1195, miR-129-2-3p, and miR-224-5p in the plasma of mice in either group (Fig 3). [score:1]
[1 to 20 of 3 sentences]
72
[+] score: 6
In contrast, the expression of miR-128b, miR-129 and miR-148 is downregulated in gastric cancer tissues[22]. [score:6]
[1 to 20 of 1 sentences]
73
[+] score: 5
Other miRNAs from this paper: hsa-mir-129-1
For example, microRNA-129-5p inhibited ovarian cancer cell proliferation and survival through suppression of TAZ [40]. [score:5]
[1 to 20 of 1 sentences]
74
[+] score: 5
The highest ranked complexes are listed in Table 1 and Table 2. Table 1 Top ranking single miRNAs targeting protein complexes Complex Description miRNA P-value corum_3028 TGF-beta receptor II-TGF-beta receptor I-TGF-beta3 complex hsa-miR-665 2.00326E-05 corum_1810 ITGA4-PXN-GIT1 complex hsa-miR-199a-5p 3.26913E-05 corum_4 ACTR-p300-PCAF complex hsa-miR-338-5p 3.65869E-05 corum_642 CtBP complex hsa-miR-129-5p 4.60618E-05 corum_642 CtBP complex hsa-miR-548f 5.10388E-05 corum_3754 CREBBP-SMAD3-SMAD4 pentameric complex hsa-miR-1284 7.21639E-05 corum_3753 CREBBP-SMAD2-SMAD4 pentameric complex hsa-miR-1264 8.26908E-05 corum_2377 ITGA2b-ITGB3-CD47-SRC complex hsa-miR-149 8.78087E-05 corum_2760 SMAD3-SMAD4-FOXO3 complex hsa-miR-1284 9.18449E-05 Table 2 Top ranking miRNA clusters targeting protein complexes Complex Description Cluster P-value corum_3028 TGF-beta receptor II-TGF-beta receptor I-TGF-beta3 complex hsa-miR-493-665 0.00079949 corum_3753 CREBBP-SMAD2-SMAD4 pentameric complex hsa-miR-1912-1264 0.00095073 corum_3059 ITGA11-ITGB1-COL1A1 complex hsa-miR-29a-29b 0.00101944 corum_3059 ITGA11-ITGB1-COL1A1 complex hsa-miR-29c-29b 0.00101944 corum_1080 P-TEFb. [score:5]
[1 to 20 of 1 sentences]
75
[+] score: 5
Liu M. -X. Zhou K. -C. Cao Y. MCRS1 overexpression, which is specifically inhibited by miR-129*, promotes the epithelial-mesenchymal transition and metastasis in non-small cell lung cancer Mol. [score:5]
[1 to 20 of 1 sentences]
76
[+] score: 5
11 miRs from the 34 extra targets on Septin7, which were found only by HuMiTar although these miRs are included in PicTar's database, i. e. miR-148, miR-106b, miR-134, miR-106, miR-144, miR-151, miR-384, miR-101, miR-142, miR-129, and miR-126. [score:3]
The Septin7 expression levels were measured (left to right) for (1) control sample, (2) miR-127, (3) miR-182, (4) miR-412, (5) miR-19a, (6) miR-453, (7) miR-448, (8) miR-450, (9) miR-183, (10) miR-141, (11) miR-202, (12) miR-148, (13) miR-106b, (14) miR-134, (15) miR-106, (16) miR-144, (17) miR-151, (18) miR-384, (19) miR-101, (20) miR-142, (21) miR-129 and (22) miR-126. [score:1]
Analysis of 39 miRs that were predicted exclusively by HuMiTar shows that 11 of them (miR-101, miR-126, miR-129, miR-134, miR-144, miR-151, miR-202, miR-384, miR-412, miR-450, miR-453) are included in the Western blot on Figure 3. Among them, nine are true positives, miR-453 is a borderline case, and miR-412 is a false positive. [score:1]
[1 to 20 of 3 sentences]
77
[+] score: 5
miRNA miR function Regulation Tissue/cell type Source miR-16 p53, cell cycle, JAK/STAT signaling Down Placenta Maccani et al. 2010 miR-21 Fatty acid synthesis, apoptosis miR-146a Inflammation, NFκβ mediator miR-223 Immunology Up Maternal and cord blood Herberth et al. 2013 miR-129 Cell cycle regulation, apoptosis Down Spermatozoa Marczylo et al. 2012 miR-634 Inflammation miR-340 Cell migration and invasion Up Spermatozoa Marczylo et al. 2012 miR-365Targets NKX2.1 miR-143 Cardiogenesis Down Gastric tissue Stánitz et al. 2013 miR-21 Fatty acid biosynthesis, apoptosis Up Gastric tissue Stánitz et al. 2013 Let-7c Cell proliferation, angiogenesis Down Induced sputum Van Pottelberge et al. 2011 miR-146a Inflammation, NFκβ mediator miR-150 Hematopoeiesis miR-203 DNA damage response miR-340 Cell migration and invasion miR-443 Unknown miR-223 Immunology Down Plasma MV Badrnya et al. 2014 miR-29b Apoptosis Up Plasma MV Badrnya et al. 2014 RNU6-2 Reference miR MV, microvesicles. [score:5]
[1 to 20 of 1 sentences]
78
[+] score: 4
In the second case, it was shown that FNDC3B could be down-regulated by miR-129-5p. [score:4]
[1 to 20 of 1 sentences]
79
[+] score: 4
In fact, the hypermethylated regions included a number of well-defined epigenetically silenced miRNA genes, including miR-9-2, miR-124-2, and miR-129-2, while the hypomethylation was accompanied by upregulation of several miRNAs, including miR-21, miR-34a, and miR-155. [score:4]
[1 to 20 of 1 sentences]
80
[+] score: 4
MiR-129-5p could inhibit the degradation of IkappaB-alpha, increase apoptosis, and reduce the migration of HCC cells by suppressing the valosin-containing protein (VCP) [37]. [score:4]
[1 to 20 of 1 sentences]
81
[+] score: 4
Other miRNAs from this paper: mmu-mir-129-2, dre-mir-129-2, xtr-mir-129-2
For example, the 10 kb TFR dr25.92 and its human ortholog hs11.145 lack any protein coding genes but the latter centers over the microRNA locus mir-129-2. (Fig. 2). [score:1]
Figure 2 Orthologous human and zebrafish TFRs that contain the miRNA mir-129-2. (A) 20 kb of the human genome (chr11:43,548,001–43,568,000) including the non-genic 13 kb TFR hs11.145 (red bar). [score:1]
Although there are currently no genes annotated in this region, the conservation profile suggests that an ortholog of mir-129-2 resides within the TFR. [score:1]
Small purple bar indicates the position of the human miRNA mir-129-2. (B) A close up view of 130 bp around mir-129-2, thick purple bar indicates the mature miRNA, thin purple line indicates pre-miRNA hairpin. [score:1]
[1 to 20 of 4 sentences]
82
[+] score: 4
MiR-129 has anticancer miRNA activity, activating apoptosis by suppressing a key anti-apoptotic protein, B-cell lymphoma-2 (Bcl-2). [score:3]
[75] 4. miR-129 Fluorouracil (5-FU) This ‘combination therapy’ was used to treat colorectal tumor mouse mo del. [score:1]
[1 to 20 of 2 sentences]
83
[+] score: 4
The expression of both miR-129-5p and miR-30e-3p were found to correlate with obesity (R = 0.67 and 0.64 respectively) (Fig.   8b, c). [score:3]
b, c Correlation observed between normalised miR-129-5p and 30e-3p expression and body mass index (BMI) respectively The potential of miRNAs to serve as novel biomarkers is under intense investigation. [score:1]
[1 to 20 of 2 sentences]
84
[+] score: 4
Additionally, Liu et al. demonstrated that MALAT1 promoted OS cell growth by inducing HMGB1 activity through inhibition of its negative regulators miR-142-3p and miR-129-5p. [score:4]
[1 to 20 of 1 sentences]
85
[+] score: 4
As determined, hsa_circ_0005986 regulated the HCC cell cycle and proliferation, by acting as a miR-129-5p sponge and through promoting Notch1 gene expression [139]. [score:4]
[1 to 20 of 1 sentences]
86
[+] score: 4
miR-124a, miR-129 and miR-137 are downregulated through promoter hypermethylation on colorectal cancer (CRC) and breast cancer cell lines. [score:4]
[1 to 20 of 1 sentences]
87
[+] score: 3
Six candidate miRNAs that are predicted to target caspase-3 (let-7, miR-138, miR-30b, miR-129, miR-203, and miR-219-5p) and have an aggregate Pct greater than 0.2 were selected (Fig.   1c). [score:3]
[1 to 20 of 1 sentences]
88
[+] score: 3
Subsequently also miR-129-2, miR-124, miR-203, miR-125b, miR-34b and miR-200b were recognized as novel tumor suppressor miRNAs epigenetically silenced in HCC [17– 21]. [score:3]
[1 to 20 of 1 sentences]
89
[+] score: 3
The main regulation of miR-129 is that of angiogenesis, the Wnt signaling pathway, transcription regulation and cell junction. [score:3]
[1 to 20 of 1 sentences]
90
[+] score: 3
The 3′ UTR of FMR1 mRNA is a target of miR-101, miR-129-5p and miR-221: implications for the molecular pathology of FXTAS at the synapse. [score:3]
[1 to 20 of 1 sentences]
91
[+] score: 3
In non-Hodgkin's lymphoma and multiple myeloma, miR-129-2 serves as a tumor suppressor and its promoter is frequently methylated [41]. [score:3]
[1 to 20 of 1 sentences]
92
[+] score: 3
Other miRNAs from this paper: hsa-mir-129-1
The overexpression of miRNA-129-3p, a microRNA conserved in vertebrates, also induces ciliogenesis in RPE1, ARPE19, and IMCD3 cells under the growth condition, whereas it fails to cause severe cell cycle arrest in RPE1 cells [36]. [score:3]
[1 to 20 of 1 sentences]
93
[+] score: 3
For examples, miR-129, miR-142-5p, and miR-25 were found to be differentially expressed in all pediatric brain tumor types [17]. [score:3]
[1 to 20 of 1 sentences]
94
[+] score: 3
In the setting of EC, MIR152 [15], MIR194 [16], MIR34b [17], MIR204 [18], MIR145 [19] and MIR129-2 [20] have been reported to be tumor suppressor genes, and MIR125b [21] has been reported to be an oncogene (oncomir). [score:3]
[1 to 20 of 1 sentences]
95
[+] score: 3
We found only two synovial sarcoma-specific miRNAs, miR-126 and miR-129, that have both lower expression levels and decreased activity in both studies. [score:3]
[1 to 20 of 1 sentences]
96
[+] score: 3
24 *** hsa-mir-770-5p 19 *** 75.47 *** hsa-mir-93* 9.5 *** 92.1 - Inhibited differentiation & low cell count *** hsa-let-7b* 4.75 *** 28.64 *** hsa-mir-1224-3p 2.38 *** 51.46 *** hsa-mir-1228 2.38 ** 9.43 *** hsa-mir-1249 1.66 *** 53.17 *** hsa-mir-125a-5p 19 *** 69.8 *** hsa-mir-1260 7.12 *** 61.75 *** hsa-mir-1280 11.88 *** 68.95 *** hsa-mir-129-3p 9.5 *** 65.64 - hsa-mir-1296 9.5 *** 36.36 *** hsa-mir-133a/hsa-mir-133b 42.75 * 0.85 *** hsa-mir-150 4.75 *** 60.37 *** hsa-mir-197 4.75 *** 27.79 *** hsa-mir-204 2.85 *** 27.44 *** hsa-mir-328 0.1 ** 30.87 *** hsa-mir-342-3p 33.25 *** 58. [score:3]
[1 to 20 of 1 sentences]
97
[+] score: 3
Among these miRNAs, tumor-suppressive miRNAs, including miR-9, miR-129, miR-137, and miR-34a, are frequently silenced by aberrant DNA hypermethylation in CRC [7, 8]. [score:3]
[1 to 20 of 1 sentences]
98
[+] score: 3
For instance, Bandres et al. first identified 23 miRNAs that are down-regulated in primary colorectal cancers compared with matched normal colorectal epithelium and subsequently discovered that miR-129-2, miR-9-1, and miR-137 are silenced by DNA methylation in cancer [8]. [score:3]
[1 to 20 of 1 sentences]
99
[+] score: 3
Several tumor-suppressive miRNAs are known to be silenced by aberrant DNA methylation of their promoter regions in human cancers, including miR-34, miR-129, miR-137, miR-193a, miR-203, and miR-148a [27– 30]. [score:3]
[1 to 20 of 1 sentences]
100
[+] score: 3
MiR-129-2 was silenced in GC and restoration of its expression could trigger apoptosis probably through regulating the relative abundance of proapoptotic and antiapoptotic members of Bcl-2 family [82]. [score:3]
[1 to 20 of 1 sentences]